Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

תצפית בזמן אמת של התגובה Exchange גדיל DNA מתווכת על-ידי Rad51

Published: February 13, 2019 doi: 10.3791/59073

Summary

קרינה פלואורסצנטית תהודה אנרגיה המבוסס על העברת בזמן אמת התבוננות במערכות ה-dna לנטישה של exchange התגובה מתווכת על-ידי Rad51 פותחו. באמצעות פרוטוקולים המובאת כאן, אנחנו מסוגלים לזהות את היווצרות התגובה intermediates, המרה שלהם לתוך מוצרים, במהלך ניתוח גם את קינטיקה אנזימטי של התגובה.

Abstract

התגובה exchange גדיל DNA מתווכת על-ידי Rad51 היא שלב קריטי של רקומבינציה הומולוגית. התגובה הזו, Rad51 טפסים של פילמנט נוקלאופרוטאין על חד גדילי ה-DNA (ssDNA), לוכדת כפול גדילי הדנ א (dsDNA) הלא ספציפית לחקור אותו לרצף הומולוגיים. לאחר היתקלות הומולוגיה, מזרז Rad51 exchange גדיל DNA לתווך זיווג של ssDNA עם סטרנד משלימים של dsDNA. התגובה הזו הוא מאוד מווסתות על-ידי אינספור פריטי חלבונים ויוו. למרות קונבנציונאלי מבחני הביוכימי יש כבר מועסקים בהצלחה לבחון את התפקיד של כזה חלבון אביזר במבחנה, ניתוח קינטי של היווצרות ביניים והתקדמות שלה לתוך תוצר סופי הוכיחה מאתגר בשל אופי התגובה לא יציב וחולף intermediates. להתבונן השלבים התגובה ישירות בפתרון, העברת האנרגיה של תהודה קרינה פלואורסצנטית (סריג)-מבוסס תצפית בזמן אמת מערכות של תגובה זו הוקמו. ניתוח קינטי של מתצפיות מראה כי התגובה exchange גדיל DNA מתווכת על-ידי Rad51 מצייתת מודל התגובה שלושה שלבים מעורבים היווצרות של שלוש-גדיל דנ א ביניים, ההבשלה הזו ביניים ולאחר שחרורו של ssDNA מ בוגרות הביניים. המתחם Swi5-Sfr1, חלבון פריטי שמור ב פרוקריוטים, משפר בחריפות את השלבים השני והשלישי של התגובה הזו. מבחני מבוסס סריג המובאת כאן מאפשרים לנו לחשוף את המנגנונים המולקולריים לעבור רקומבינציה אילו חלבונים פריטי לעורר הפעילות exchange גדיל ה-DNA של Rad51. המטרה העיקרית של פרוטוקול זה היא להגביר את הרפרטואר של טכניקות לרשות החוקרים בתחום של רקומבינציה הומולוגית, במיוחד אלה שעבדו עם חלבונים מן מינים אחרים שמר הביקוע, כך ניתן לקבוע אבולוציונית שימור הממצאים שהוצגו במסמך זה.

Introduction

רקומבינציה הומולוגית (HR) מאפשר למיין מידע גנטי בין שתי מולקולות DNA שונות. בית הוא חיוני עבור שתי תופעות ביולוגיות היסוד: הדור של מגוון גנטי במהלך gametogenesis1 ותיקון של DNA כפול-strand שובר (DSBs)2 במהלך מיטוזה. DSBs הם הצורה החמורה ביותר של נזק לדנ א ומהווים שבירה של כרומוזום. תיקון שגוי של DSBs יכול לגרום מיבנה כרומוזומלית, אי יציבות גנומית, אשר הופכים שני של סרטן3.

התגובה החלפת גדיל דנ א הוא השלב המרכזי משאבי אנוש. החלבון Rad51, שהוא חבר של משפחת מאוד שנשמרת רקה-סוג של recombinases, הוא החלבון מפתח מזרז את התגובה הזו פרוקריוטים4,5. התגובה הזו, Rad51 נקשר חד גדילי הדנ א (ssDNA) שנוצרו על-ידי עיבוד חד-תאית של הסוף DSB, טפסים נוקלאופרוטאין לוליינית מורכבים כינה את הסיב presynaptic. הלהט הזה תופס שלם כפול גדילי הדנ א (dsDNA) nonspecifically כדי לחפש רצף הומולוגיים. כאשר הסיב מוצא רצף הומולוגיים, תגובת ביניים המכיל שלוש גדילי DNA נוצר, חוט הלהט Rad51 שמתווכת סטרנד exchange בתוך זה מבנה6,7,8. כדי להשיג את התגובה הזו ביעילות, Rad51 דורש מספר סוגים של חלבונים עזר כגון BRCA1 ו- BRCA2, מוצרים של השד סרטן הרגישות גנים9,10.

ההבנה כיצד גורמים אביזר לווסת Rad51 היא שלב נפרד ב לחשוף את הסיבות של אי יציבות גנומית במהלך tumorigenesis. למרות מחקרים רבים בכל הנוגע עם ההשפעות של גורמים אלו על היווצרות הלהט presynaptic, יציבות11,12,13,14,15,16, תרומתם של גורמים אלה כדי היווצרות הביניים שלוש-strand ועיבוד שלה לתוך המוצר הסופי לא ברור עדיין. התבוננות השלבים התגובה דרך ניסויים הביוכימי המקובלת היא קשה מאוד משום הביניים שלוש-strand היא לא יציבה, מועדים להתמוטט על ידי מניפולציות ניסיוני משותף כגון deproteinization של דגימות או אלקטרופורזה.

כדי להתגבר על בעיה זו, שינינו שתי מערכות תצפית בזמן אמת שפותחו בעבר התגובה exchange גדיל DNA באמצעות העברת האנרגיה של תהודה קרינה פלואורסצנטית (סריג): זיווג גדיל ה-DNA, ה-DNA לנטישה של עקירה מבחני17, 18 (איור 1). ב סטרנד DNA זיווג assay, Rad51 טפסים של הלהט presynaptic עם fluorescein amidite (FAM) - הנקרא ssDNA, ואז הומולוגי carboxy-x-rhodamine (רוקס) - הנקרא dsDNA נוסף ליזום התגובה exchange strand. כאשר הסיב תופס את התווית על-ידי רוקס dsDNA צורות הביניים שלוש-strand, שני fluorophores נכנסו לתוך קרבה, פליטת קרינה פלואורסצנטית FAM הוא מתרצה מאת רוקס (איור 1 א'). ב וזמינותו הזחה גדיל ה-DNA, הלהט presynaptic נוצרו על ssDNA ללא תווית מודגרת עם התווית על-ידי כפול dsDNA FAM ורוקס. כאשר exchange סטרנד הושלמה, סיפרתי את תווית ssDNA הוא שוחרר מן סטרנד שלוש ביניים, הפליטה של המשפחה עולה כי המשפחה אינה בסמיכות רוקס (איור 1B). מבחני אלה מאפשרים לנו להתבונן היווצרות של שלוש-strand intermediates ועיבוד שלהם לתוך המוצרים הסופיים ב בזמן אמת ללא כל הפרעות על התגובה.

באמצעות מערכת זו תצפית בזמן אמת, מצאנו כי התגובה exchange גדיל DNA מתווכת על-ידי Rad51 ממשיך בשלבים 3-כולל היווצרות של התגובה הראשונה ביניים (C1), בתהליכי שינוי של ביניים הראשון ביניים שנייה (C2), ואת שחרורו של ssDNA מ C219. מצאנו גם כי שמרים ביקוע (ס' הביקוע) Swi5-Sfr1, אשר שנשמרת אבולוציונית Rad51 אביזר חלבונים מורכבים13,16,20,21,22, מעוררת מעבר מיגדרי C1-C2 ושחרור של ssDNA מ C2 באופן התלויים ATP-הידרוליזה על ידי Rad5119.

ממצאים אלה אבולוציונית נשמרים נותר עלום. פרוטוקול זה מסופק עם תקווה כי החוקרים בתחום משאבי אנוש, בייחוד אלה שעבדו עם חלבונים של אורגניזמים שאינם ס הביקוע, עשויים לחול טכניקות אלה כדי לקבוע את גודל שאליו המנגנון המולקולרי של Rad51 מונחה סטרנד exchange הוא לחסוך... יתר על כן, טכניקות אלו הוכיחו מוצלח ביותר בקביעת את התפקיד של ס' הביקוע Swi5-Sfr1. לכן, יש חיזוי רציונלית כי שיטות אלה יהיה יקר ערך חשיפת התפקידים המדויקת גורמים עזר אחרים HR.

Protocol

1. הכנת חלבונים ותערובות דנ א

  1. לטהר חלבונים Rad51 הביקוע ס ו- Swi5-Sfr1 עד הומוגניות (פי by Coomassie מכתים), כפי שדווחה בעבר13,21.
  2. להכין oligonucleotide DNA סובסטרטים המפורטים בטבלה 118.
    הערה: oligonucleotides נרכשו (ראה טבלה של חומרים), מסונתז ב- hplc, קורס כיתה. עבור סטרנד DNA זיווג תגובה, oligonucleotides 16FA(-), 16A (-) _40bp ו- 16AR (+) _40bp נדרשים. עבור DNA הזחה וזמינותו, oligonucleotides 16A(-), 16FA (-) _40bp ו- 16AR (+) _40bp הינם נדרשים (איור 1 טבלה 1). כל ריכוזי ה-DNA ב פרוטוקול זה מתייחסים קטע ריכוזים בניגוד נוקלאוטיד ריכוזים.
  3. כדי ליצור dsDNA התורם, מערבבים כמויות equimolar של גדילים משלימים צינור PCR עם קירות דקים עם מאגר מחזק (10 מ מ טריס-HCl pH 7.5, 100 מ מ NaCl, 10 מ מ MgCl2), המבטיח הנפח הכולל גדול מ- µL 20. לבצע את השילוב הזה על מתלה מתכת prechilled על קרח (בין 2 ° C 4 ° C).
    הערה: השילוב של oligonucleotides עבור שיוך וזמינותו הם 16A (-) _40bp ו- 16AR (+) _40bp. עבור וזמינותו הזחה, anneal oligonucleotides 16FA _40bp (-), 16AR (+) _40bp.
  4. מחממים את התערובת מחזק ב 90 מעלות צלזיוס למשך 5 דקות, לקרר יותר מ 3 שעות עד 30 ° C באמצעות מכונת ה-PCR. מאגר ה-DNA annealed ב-20 ° C.

2. DNA סטרנד זיווג, מבחני הזחה

  1. לבצע צירוף ד. נ זיווג וזמינותו.
    1. להכין 1.6 מ של מאגר התגובה A (30 מ מ HEPES-KOH pH 7.5, 1 מ dithiothreitol [DTT], 15 מ מ MgCl2, 0.25 מ מ ATP, 0.1 מ"ג/מ"ל אלבומין שור [BSA] ו- 0.0075% polyoxyethylenesorbitan monolaurate) המכילה 36 nM 16FA(-) 2.0 mL micro-ומפרידה צינור פלסטיק (פוליפרופילן) מראש דגירה זה ב 37 מעלות צלזיוס במשך 5 דקות.
    2. כדי ליצור Rad51-ssDNA חוטים, להוסיף חלבון Rad51 ריכוז סופי של מיקרומטר 1.5 במאגר טרום מודגרות התגובה, דגירה זה ב 37 מעלות צלזיוס במשך 5 דקות.
    3. להוסיף התערובת ריכוז סופי של 0.15 µM חלבון Swi5-Sfr1, דגירה זה ב 37 מעלות צלזיוס במשך 5 דקות נוספות.
    4. קח 1.5 מ של התערובת להעבירו cuvette 1.0 x 1.0 ס מ קוורץ המכיל של פגים, המקשטים את cuvette מצלמות-דיגיטליות. להגדיר את בקר טמפרטורה peltier של ספקטרופוטומטרים עד 37 ° C ולהגדיר את פגים 450 סל ד כדי להבטיח ערבוב מהיר של המדגם מוזרק.
    5. . תתחילי למדוד קרינה פלואורסצנטית הפליטה של FAM-525-nm (רוחב פס: 20 ננומטר) על עירור-493 nm (רוחב פס: 1 ננומטר). איסוף נתונים בכל שנייה.
    6. לאחר הפעלת את המידה עבור 100 s, להזריק התווית על-ידי רוקס התורם dsDNA כדי ריכוז סופי של 36 nM לתוך התערובת באמצעות מזרק ואת למדוד השינוי בפליטה במרווחי s 1 במשך 30 דקות נוספות.
  2. לבצע assay הזחה גדיל דנ א.
    1. להכין 1.6 מ של מאגר התגובה A המכילה 36 nM 16A(-) ב 2.0 mL micro-צנטריפוגה פלסטיק צינור מראש דגירה זה ב 37 מעלות צלזיוס במשך 5 דקות.
    2. בצורת חוטים Rad51-ssDNA בנוכחות Swi5-Sfr1-37 מעלות צלזיוס, כמתואר בצעדים 2.1.2. 2.1.3.
    3. קח 1.5 מ של התערובת להעבירו cuvette קוורץ המכיל של פגים, המקשטים את cuvette ספקטרופוטומטרים, כפי שמתואר בשלב 2.1.4.
    4. . תתחילי למדוד את פליטת קרינה פלואורסצנטית ואחרי 100 s, להזריק FAM ו רוקס-שכותרתו dsDNA התורם כפי שמתואר בשלב 2.1.6. למדוד את השינוי שחל פליטת קרינה פלואורסצנטית במרווחי s 1 במשך 30 דקות נוספות.

3. ניתוח נתונים ניסיוני הזיווג, מבחני הזחה

  1. הערכת יעילות מקסימלית סריג.
    1. להכין 16FA(-) annealed עם 16AR (+) _40bp, 16FA _40bp (-) annealed עם 16AR (+) _40bp באמצעות ההליך אותו תיאר בשלבים 1.3 ו- 1.4.
    2. להכין μL 130 התגובה מאגר A המכילה 36 nM של גם 16FA(-), 16FA(-) annealed עם 16AR (+) _40bp, 16FA _40bp (-) annealed עם 16AR (+) _40bp או 16FA (-) _40bp ב cuvette קוורץ 0.2 x 1.0 ס מ.
    3. להגדיר את cuvette לתוך מצלמות-דיגיטליות, דגירה ב 37 מעלות צלזיוס במשך 5 דקות.
    4. למדוד קרינה פלואורסצנטית ספקטרה בין 500 ל- 600 ננומטר על עירור-493 ננומטר.
    5. כדי לבדוק את ההשפעה של Rad51 על הפליטה של FAM ו שכבתה של המשפחה על-ידי רוקס, להוסיף Rad51 ריכוז סופי של 1.5 μM לתערובת, דגירה ב 37 מעלות צלזיוס במשך 5 דקות.
    6. למדוד קרינה פלואורסצנטית ספקטרה בין 500 ל- 600 ננומטר על עירור-493 ננומטר.
    7. לחשב סריג יעילות מקסימלית (Eהמרבי) באמצעות המשוואה המתוארים להלן:
      Eמרבי = (עוצמת קרינה פלואורסצנטית ב 525 nm של dsDNA עם המשפחה וגם רוקס תוויות) / (עוצמת קרינה פלואורסצנטית ב 525 nm של FAM הנקרא ssDNA)
  2. ניתוח נתונים ניסיוני וזמינותו העקירה.
    1. כדי להמיר את השינוי בזריחה שנצפתה וזמינותו הזחה לשינוי בכמות המוצר הסופי, לנרמל את הנתונים הגולמיים ניסיוני המתקבל הזה assay באמצעות המשוואה המתוארים להלן, Fraw איפה עוצמת קרינה פלואורסצנטית מ הנתונים הגולמיים ו- Fמנורמל הוא השינוי פלורסצנטיות מחושב על ידי המשוואה הבאה.
      Fמנורמל = ([Fraw בזמן x]-[Fraw בזמן 0]) / (([Fraw בזמן 0] / Eהמרבית)-[Fraw בזמן 0])
      Fraw בזמן 0 הוא ממוצע ידי קרינה פלואורסצנטית במעקב במשך הראשון 5 s אחרי הפעם מת (קרי, הזמן הנדרש עבור ערבוב לאחר injectant מוחדרים את cuvette).
    2. כדי לא לכלול את ההשפעות של photobleaching ותזוזה ספונטנית, להחסיר Fמנורמל ללא חלבון מ Fמנורמל לדוגמה כדי להשיג נד, וזה השינוי בכמות המוצר הסופי בזה וזמינותו.
      FD = [Fמנורמל מדגם] - [Fמנורמל ללא חלבון]
  3. ניתוח נתונים ניסיוני של שיוך וזמינותו.
    1. לנרמל את הנתונים הגולמיים ניסיוני המתקבל וזמינותו שיוך באמצעות המשוואה המתוארים להלן, כאשר Fraw היא עוצמת קרינה פלואורסצנטית נתונים גולמיים, Fמנורמל הוא בשינוי פלורסצנטיות מחושב על ידי המשוואה הבאה.
      Fמנורמל = (Fraw בזמן x) / (Fraw זמן 0)
      Fraw בזמן 0 הוא ממוצע ידי קרינה פלואורסצנטית במעקב מזה 20 s לפני ביצוע התגובה על ידי הזרקת המצע dsDNA.
    2. כדי להמיר את השינוי בזריחה אל תוך שינוי כמות המצע, לא לכלול את ההשפעות של photobleaching זיווג ספונטנית, לנרמל Fמנורמל מדגם באמצעות המשוואה המתוארים להלן, איפה FP הוא השינוי בכמות של המצע ב זה וזמינותו.
      FP = 1 - (([Fמנורמל ללא חלבון] - [Fמנורמל מדגם]) / [1-Eהמרבי])
    3. כדי לבחון את התגובה קינטיקה של exchange גדיל ה-DNA, לבצע ניתוח רגרסיה ליניארי האחרון-כיכר התגובה שיוך באמצעות ניתוח תוכנית23 (ראה טבלה של חומרים).
      1. להכין קובץ בתבנית. txt המכיל נתוני זמן הקורס של FP.
      2. הפעלת התוכנית והדבק את התסריט קובץ קוד משלים אל חלון של התוכנית:
      3. להתחיל ניתוח רגרסיה האחרון-כיכר ליניארי. התוצאות של ניתוח זה יוצגו באותו חלון.

Representative Results

על מנת ביעילות לנתח את הנתונים ניסיוני מבחני ההתאמה ותזוזה, זה צורך להגדיר כיצד שינוי פליטת קרינה פלואורסצנטית FAM מקביל המרה של סובסטרטים DNA לתוך מוצרים. כדי להשיג זאת, הטווח הרלוונטי של עוצמת קרינה פלואורסצנטית צריכה להיקבע. עבור שיוך וזמינותו, פליטת קרינה פלואורסצנטית 16FA(-), המתאים המצע ssDNA, מושווה הפליטה של 16FA(-) annealed עם 16AR (+) _40bp, המתאים המוצרים הסופיים של תגובה זו (איור 2 א). זה משווה ל סריג היעילות המרבית, ומכאן ההפחתה המקסימלית בעוצמתם פלורסצנטיות זה היה צפוי אם כל המצע ssDNA הוסב המוצר dsDNA. עבור וזמינותו הזחה, הפליטה של 16FA _40bp (-) annealed עם 16AR (+) _40bp, המתאים המצע, מושווה הפליטה של 16FA _40bp (-), התואם למזהה המוצר הסופי (איור 2B). במקרה זה, הגדלת עוצמת קרינה פלואורסצנטית FAM המרבי מעביר תרחיש שבו כל המצע dsDNA מומר ssDNA המוצר. ס הביקוע Rad51 לא השפיע על פליטת קרינה פלואורסצנטית FAM או להרוות את היעילות של המשפחה על-ידי רוקס בשני מבחני (איור 2). סריג היעילות המרבית צריכה להיות נמדד מחדש עם כל הכנה החדש של oligonucleotides כפי שהוא תלוי על יעילות תיוג oligonucleotides.

נציג נתונים של ה-DNA סטרנד זיווג ותזוזה תגובות מוצגים באיור3. ההשפעות של תגובות ספונטני בין המצע DNAs photobleaching היו קטנים בשני מבחני, חשף את השינויים שחלו זניח ראיתי את פליטת FAM ללא Rad51 בהשוואה לשינויים נכבד אובחנה Rad51 (איור 3 א ו איור 3B). בהתבסס על הנתונים המוצגים באיור 3A או איור 3B, בשינוי פלורסצנטיות הוסב בשינוי כמות המצע (FP) או המוצר הסופי (נד), בהתאמה, באמצעות המשוואות המתואר (3.2.2 או 3.3.2 צעדים 3C איור ותלת מימד איור).

התגובה זיווג היה מדומה באמצעות מודל התגובה שלושה שלבים רציפים, המורכב של היווצרות ביניים 3-strand הראשון (C1), של ביניים הראשון בתהליכי הביניים השנייה (C1 עד C2), ועד לפרסומו של ssDNA מרגיל השני כדי ליצור שני המוצרים (D + E) (איור 3E). כדי לבדוק אם היו תמלוגים בין נתוני הניסוי של סטרנד DNA זיווג assay, עיקול תיאורטי מתקבל על ידי הסימולציה ההדמיה באמצעות התאמה מודל התגובה שלושה שלבים רציפים הנתונים ניסיוני, מחושב (איור 3F). בנוסף, תמלוגים בין התגובה שיוך עיקול תיאורטי שנוצר באמצעות מודל התגובה של שני שלבים רציפים היו גם מחושב (איור 3G). שנשאר משהו עבור התגובה שיוך ודגם שני שלבים להראות סטייה שיטתית בשלב מוקדם, ואילו שנשאר משהו עבור התגובה שיוך ודגם שלושה שלבים לא מראים על סטייה כזו. הדבר מציין כי הדגם שלושה שלבים מתאים יותר מאשר הדגם בשני שלבים כדי לדמות את התגובה שיוך.

כדי לבדוק אם הדגם שלושה שלבים הוא עקבי עם תגובת הדחק שמזהה לשלב מאוחר של exchange גדיל ה-DNA, יצרנו עיקול תיאורטי של תגובת הדחק באמצעות הפרמטרים קינטי המתקבל סימולציה של הזיווג התגובה שמוצג באיור 3C , לעומת זה המידע מהניסוי של תגובת הדחק שמוצג באיור 3D (איור 3 H). העקומה תיאורטי להתאים לנתונים ניסיוני של עקירה וזמינותו. תוצאות אלה, נוכל להסיק כי הדמיה באמצעות מודל שלושה שלבים הוא מסוגל להעריך באופן סביר את התגובה exchange גדיל DNA מתווכת על-ידי Rad51.

נציג נתונים של סטרנד DNA זיווג התגובה המכילה Rad51, מתחם Swi5-Sfr1, חלבון פריטי של Rad51, מוצגים באיור 4A. המתחם Swi5-Sfr1 מגורה בחריפות את הפעילות שיוך של Rad51. כפי שניתן היה לראות בהיעדר Swi5-Sfr1, התגובה זיווג מתאים יותר למודל שלושה שלבים מאשר הדגם בשני שלבים בנוכחות Swi5-Sfr1 (איור 4B). דרך סימולציה של התגובה באמצעות מודל שלושה שלבים, חושבו התגובה קבועי שיווי משקל של כל שלב התגובה עם או בלי Swi5-Sfr1. קבועי שיווי משקל התגובה ציינו כי המתחם Swi5-Sfr1 לא לעורר את הצעד הראשון של התגובה (איור 4C, לוח), שבו בינוני שלוש-strand נוצר, אבל בחום מעוררת C1-C2 מעבר מיגדרי ( איור 4C, פאנל b) ועד לפרסומו של ssDNA מרגיל C2 (איור 4C, לוח ג).

Figure 1
איור 1: תכנון ניסויים של ה-DNA לנטישה של מבחני ההתאמה ותזוזה. שרטוטים של ה-DNA לנטישה של זיווג (A), מבחני הזחה (B). עיגולים צהובים מייצגים Rad51 מונומרים. ירוק במעגלים המכיל "F", המכיל "R" עיגולים אדומים מייצגים fluorescein amidite (FAM) ו- carboxy-X-rhodamine (רוקס), בהתאמה. גדילי DNA שחור זהים ברצף ומשלימים לכחול גדילי ה-DNA. קווים שחורים דקים בעלי ראשי חץ הצבע על השם של כל oligonucleotide, כפי שהיא מתוארת בטבלה 1. איור זה כבר ממאמרו של איטו. et al. 19 , ששונה. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2: מדידות של יעילות סריג מרבי מבחני ההתאמה ותזוזה. (א) השוואה של ספקטרום קרינה פלואורסצנטית בין המצע ssDNA, 16FA(-) את המוצר dsDNA, 16FA(-) יחד עם 16AR (+) _40bp, של שיוך וזמינותו. קווים כחול ואדום מייצגים את ספקטרום קרינה פלואורסצנטית של המצע ללא ועם Rad51, בהתאמה. קווים ירוק וסגול להראות ספקטרום קרינה פלואורסצנטית של המוצר הסופי ללא ועם Rad51, בהתאמה. (B) השוואה של ספקטרום קרינה פלואורסצנטית בין המצע dsDNA, 16FA (-) _40bp יחד עם 16AR (+) 16FA _40bp, ssDNA מוצר, _40bp (-), של עקירה וזמינותו. קווים כחול ואדום מייצגים את ספקטרום קרינה פלואורסצנטית של המוצר הסופי ללא ועם Rad51, בהתאמה. קווים ירוק וסגול להראות את ספקטרום קרינה פלואורסצנטית של המצע ללא ועם Rad51, בהתאמה. נתון זה ממאמרו של איטו. et al. 19 , ששונה. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 3
איור 3: תגובות זיווג ותזוזה גדיל DNA מתווכת על-ידי Rad51. (א) מסלול הזמן של זריחה מנורמל התגובה זיווג עם או בלי Rad51. (B) מהלך הזמן זריחה המנורמל של תגובת הדחק עם או בלי Rad51. (ג) הזמן קורס על השינוי בסכום של המצע ב התגובה זיווג עם Rad51. (ד) מסלול הזמן על השינוי בסכום של המצע ב תגובת הדחק עם Rad51. תיאור סכמטי של המודל תגובה שלושה שלבים רציפים (E) א. A ו- B שיתאימו dsDNA presynaptic הלהט של התורם. C1 מקביל ביניים 3-strand הראשון (לא בשלה). C2 מקביל הביניים שלוש-strand השני (בוגר). D ו- E מקבילים heteroduplex ו ssDNA שוחררו C2. (F ו- G) תמלוגים בין נתוני הניסוי של סטרנד DNA זיווג assay, עיקול תיאורטי מתקבל על ידי הדמיה באמצעות שלושה שלבים (F) או דגם שני שלבים (G). (H) העיגולים האדומים מצביעים על נתונים ניסיוני תגובת הדחק עם Rad51 המוצגים בלוח ד' כחול וקו מציין את עקומת תיאורטי של המוצרים הסופיים. העקומה תיאורטי נוצר על ידי הדמיה באמצעות הקבועים קצב התגובה המתקבל וזמינותו השיוך מוצג בחלונית C. נתון זה ממאמרו של איטו. et al. 19 , ששונה. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 4
איור 4: Swi5-Sfr1 מעוררת את השני ואת השלבים השלישי של ה-DNA לנטישה של exchange התגובה. (א) מסלול הזמן על השינוי בסכום של המצע ב התגובה זיווג עם או בלי Swi5-Sfr1 (S5S1). (B) תמלוגים בין נתוני הניסוי של גדיל DNA הזיווג assay עם Swi5-Sfr1, עיקול תיאורטי מתקבל על ידי הדמיה באמצעות שני שלבים (קו כחול) או דגם 3 שלבים (הקו האדום). (ג) הזיווג התגובה באיור איור 4A היה מדומה על ידי המודל שלושה שלבים באמצעות ניתוח תוכנית23 (ראה טבלה של חומרים). קבועי שיווי משקל התגובה של כל שלב התגובה, K1 (), K2 (b), K3 (c), התקבלו הסימולציה. נתון זה ממאמרו של איטו. et al. 19 , ששונה. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Oligonucleotides עבור נ זיווג assay
16FA(-) 5'-[FAM] - AAATGAACATAAAGTAAATAAGTATAAGGATAATACA
AAATAAGTAAATGAATAAACATAGAAAATAAAGTAAAGGATAT AAA-3'
16A (-) _40bp 5'-AAATGAACATAAAGTAAATAAGTATAAGGATAATACAAAA-3'
16AR (+) _40bp 5 '- TTTTGTATTATCCTTATACTTATTTACTTTATGTTCATTT-[רוקס]-3'
Oligonucleotides עבור assay הזחה גדיל דנ א
16A(-) 5'-AAATGAACATAAAGTAAATAAGTATAAGGATAATACAAAATA
AGTAAATGAATAAACATAGAAAATAAAGTAAAGGATAT AAA-3'
16FA _40bp (-) 5'-[FAM] - AAATGAACATAAAGTAAATAAGTATAAGGATAATACAAAA-3'
16AR (+) _40bp 5 '- TTTTGTATTATCCTTATACTTATTTACTTTATGTTCATTT-[רוקס]-3'

טבלה 1: רשימת oligonucleotides המשמשים את ה-DNA סטרנד זיווג ותזוזה מבחני. ובמידת הצורך, העמדות של fluorophores (fluorescein amidite, FAM; carboxy-x-rhodamine, לוקאס סולאס) הם הצביעו על כיכר סוגריים.

Discussion

. הנה, תארנו פרוטוקול מפורט אשר מנצל סריג למדידת exchange גדיל DNA מונחה Rad51 בזמן אמת. חשוב, מדידות אלה מאפשרות קביעת קינטיקה התגובה. בעוד התיאורים הכלול לעיל מספיקים לשחזר את התוצאות שפורסמו שלנו, יש מספר נקודות קריטיות שיפורטו בסעיף זה. יתר על כן, היתרונות והחסרונות של מבוסס סריג מתודולוגיות לימוד exchange גדיל DNA יידונו, יחד עם היישום של טכניקות אלה ללמוד היבטים אחרים של ה-DNA חילוף החומרים.

כמו עם כל reconstitutions הביוכימי, ולהבטיח כי כל תגובה מצעים הם של טוהר גבוהה היא חיונית. . זה רשלני להניח העדר הפעילות ההרסנית על סמך טוהר לכאורה של הכנה חלבון שפטו Coomassie מכתים. בפרט, הנוכחות של כמויות קטנות של nucleases או helicases באופן דרסטי יכול להשפיע על תוצאות מבחני ההתאמה ותזוזה. לפיכך, אנו מעודדים בדיקות עבור פעילויות כגון בכל פעם שאוסף חדש של חלבון מטוהרים. יתר על כן, הוא זהיר לבדוק את טוהר סובסטרטים DNA מסונתז יליד בג'ל לזיהוי. למרות חברות רבות המבטיח את הטוהר של oligonucleotides, מצאנו לעתים קרובות באמצעות בדיקות משלנו כי הטוהר של ה-DNA מסונתז יכול להשתנות בין קבוצות.

חשוב לקחת בחשבון שתי הנקודות הבאות בעת ביצוע ניסויים עם קוורץ וואקום. ראשית, חלבונים מסוימים נוטים לכרוך וואקום קוורץ nonspecifically. כדי לשנות זאת, BSA, polyoxyethylenesorbitan monolaurate הינם כלולים המאגרים התגובה. שנית, טמפרטורה השפעה דרסטית על עוצמת קרינה פלואורסצנטית ומהירות התגובה. כדי למזער את האפקט הזה, cuvette קוורץ צריך להיות incubated מראש ב- 37 מעלות צלזיוס לפני השימוש.

למרות קונבנציונאלי מבחני הביוכימי היו שימושיים עצומה בלימוד exchange גדיל ה-DNA, יש להם מספר חסרונות. בניסוי זמן-קורס טיפוסי, תגובה מודגרת בטמפרטורה מסוימת, aliquots נסוגה ב- timepoints הרצויה, deproteinized על ידי טיפול עם חומרי ניקוי, פרוטאז לסיים את התגובה. עם סיומו של הקורס-הזמן, דוגמאות הם נתון ואז אלקטרופורזה להפריד DNA סובסטרטים מוצרים. היתרון העיקרי של השיטה המתוארת כאן היא שהוא מאפשר התבוננות התגובה ללא כל הפרעה בזמן אמת. כל timepoint במהלך התגובה יכולה להיבדק ללא הפרעה התגובה עצמה, אין צורך deproteinize דוגמאות או מעמיד אותם בפני הכוחות בפוטנציאל של אלקטרופורזה. זה רלוונטי במיוחד בעת פיקוח על מבנים DNA יציב.

למרות העוצמות האלה על-קונבנציונאלי מבחני, השיטה המתוארת כאן יש כמה חסרונות. בזמן השימוש oligonucleotide DNA סובסטרטים לחילופי סטרנד מפשט פרשנות של התוצאות, חשוב לזכור כי מצעים כאלה לא דומים סובסטרטים דנ א מעורב ביממה בתא. כמה מבחני קונבנציונאלי לנצל בגודל פלסמיד מצעים הדנ א, אשר נוטים יותר לשקף מספר בסיסי-זוגות כי הם החליפו בתוך vivo. יתר על כן, השימוש topologically המאולץ dsDNA מעגלי סובסטרטים בקבוצת משנה של מבחני קונבנציונאלי לפחות באופן חלקי יכול לשחזר את המתחים בדנ א פיזיולוגיים.

היישום של השיטה המתוארת כאן החלה לפענח את המנגנונים המולקולריים של exchange גדיל DNA Rad51 מונחה. למרות זאת, ישנם שאלות מעניינות רבות שנותרו ייענו. יש ראיות ברורות כי ביממה במהלך המיוזה דורש Rad51 והן Dmc1, recombinase רקה-סוג ספציפי מיוזה פרוקריוטים24. עם זאת, העדר הבדלים ביוכימיים משמעותיים בין recombinases שני אלה יש התמלאה חוקרים בתחום במשך שנים. יתר על כן, התפקידים של קבוצות רבות של גורמים אביזר רקומבינציה כבר נושא מוקד המחקר בתחום משאבי אנוש. בנוסף שחקרתי הביוכימי ההבדלים Rad51 לבין Dmc1, אנו שואפים לחקור ולהשוות את ההשפעות של גורמים אביזר רקומבינציה שונים על קינטיקה של exchange גדיל דנ א בתקופה הקרובה. לבסוף, חשוב להדגיש כי המתודולוגיה מבוסס סריג המתוארים כאן אינה מוגבלת במחקר של exchange גדיל ה-DNA. עם שינויים קלים יחסית, נוכל לדמות סוגים רבים של יישומים עבור טכניקה זו בחקירת מגוונת מבחינה פונקציונלית החלבונים המעורבים DNA חילוף החומרים25,26,27,28. אנו מקווים ההתפתחויות המתוארות כאן יספק עוד אפשרויות כדי החוקרים השייכים רבות ושונות.

Disclosures

המחברים אין לחשוף.

Acknowledgments

עבודה זו מומן על ידי Grants-in-Aid למחקר מדעי (א) (18H 03985), בתחומים חדשניים (15H 05974) ל- HI, מדענים ומפתחים צעירים (B) (17K 15061) ל BA ועבור מדעי מחקר (B) (18H 02371) ל HT מן האגודה יפן (קידום של מדע JSPS).

Materials

Name Company Catalog Number Comments
0.2 x 1.0 cm quartz cuvette Hellma Analytics 105-250-15-40
1.0 x 1.0 cm quartz cuvette Hellma Analytics 101-10-40
adenosine triphosphate (ATP) Sigma A2383
DynaFit BioKin, Ldt. DynaFit is a program to analyze kinetics of biochemical reactions.
Fluorescent labeled and non-labeled oligonucleotides Eurofins Genomics The sequences of oligos are listed in Table. 1.
Magnetic stirrer Aisis (Japan) CM1609
PCR machine TAKARA (Japan) TP600 TAKARA PCR Thermal Cycler Dice
Spectrofluorometer JASCO FP8300 Contains a peltier temperature controller and magnetic stirrer system
Syringe HAMILTON 1702RN 25ul SYR (22s/2"/2)

DOWNLOAD MATERIALS LIST

References

  1. Camerini-Otero, R. D., Hsieh, P. Homologous recombination proteins in prokaryotes and eukaryotes. Annual Review of Genetics. 29, (1), 509-552 (1995).
  2. Cromie, G. A., Connelly, J. C., Leach, D. R. Recombination at double-strand breaks and DNA ends: conserved mechanisms from phage to humans. Molecular Cell. 8, (6), 1163-1174 (2001).
  3. Pierce, A. J., et al. Double-strand breaks and tumorigenesis. Trends in cell biology. 11, (11), S52-S59 (2001).
  4. Haber, J. E. Genome Stability. Garland Science. (2013).
  5. Kowalczykowski, S. C. An Overview of the Molecular Mechanisms of Recombinational DNA Repair. Cold Spring Harbor perspectives in biology. 7, (11), a016410 (2015).
  6. Bianco, P. R., Tracy, R. B., Kowalczykowski, S. C. DNA strand exchange proteins: a biochemical and physical comparison. Frontiers in bioscience: a journal and virtual library. 3, D570-D603 (1998).
  7. Renkawitz, J., Lademann, C. A., Jentsch, S. Mechanisms and principles of homology search during recombination. Nature Reviews Molecular Cell Biology. 15, (6), 369-383 (2014).
  8. Greene, E. C. DNA Sequence Alignment during Homologous Recombination. The Journal of biological chemistry. 291, (22), 11572-11580 (2016).
  9. Sung, P., Krejci, L., Van Komen, S., Sehorn, M. G. Rad51 recombinase and recombination mediators. Journal of Biological Chemistry. 278, (44), 42729-42732 (2003).
  10. Prakash, R., Zhang, Y., Feng, W., Jasin, M. Homologous recombination and human health: the roles of BRCA1, BRCA2, and associated proteins. Cold Spring Harbor perspectives in biology. 7, (4), a016600 (2015).
  11. Sung, P. Function of yeast Rad52 protein as a mediator between replication protein A and the Rad51 recombinase. Journal of Biological Chemistry. 272, (45), 28194-28197 (1997).
  12. Sung, P. Yeast Rad55 and Rad57 proteins form a heterodimer that functions with replication protein A to promote DNA strand exchange by Rad51 recombinase. Genes & Development. 11, (9), 1111-1121 (1997).
  13. Kurokawa, Y., Murayama, Y., Haruta-Takahashi, N., Urabe, I., Iwasaki, H. Reconstitution of DNA strand exchange mediated by Rhp51 recombinase and two mediators. PLoS biology. 6, (4), e88 (2008).
  14. Jensen, R. B., Carreira, A., Kowalczykowski, S. C. Purified human BRCA2 stimulates RAD51-mediated recombination. Nature. 467, (7316), 678-683 (2010).
  15. Liu, J., et al. Rad51 paralogues Rad55-Rad57 balance the antirecombinase Srs2 in Rad51 filament formation. Nature. 479, (7372), 245-248 (2011).
  16. Lu, C. -H., et al. Swi5-Sfr1 stimulates Rad51 recombinase filament assembly by modulating Rad51 dissociation. Proceedings of the National Academy of Sciences of the United States of America. (2018).
  17. Bazemore, L. R., Takahashi, M., Radding, C. M. Kinetic analysis of pairing and strand exchange catalyzed by RecA. Detection by fluorescence energy transfer. Journal of Biological Chemistry. 272, (23), 14672-14682 (1997).
  18. Gupta, R. C., Bazemore, L. R., Golub, E. I., Radding, C. M. Activities of human recombination protein Rad51. Proceedings of the National Academy of Sciences. 94, (2), 463-468 (1997).
  19. Ito, K., Murayama, Y., Takahashi, M., Iwasaki, H. Two three-strand intermediates are processed during Rad51-driven DNA strand exchange. Nature Structural & Molecular Biology. 25, (1), 29-36 (2018).
  20. Akamatsu, Y., Dziadkowiec, D., Ikeguchi, M., Shinagawa, H., Iwasaki, H. Two different Swi5-containing protein complexes are involved in mating-type switching and recombination repair in fission yeast. Proceedings of the National Academy of Sciences. 100, (26), 15770-15775 (2003).
  21. Haruta, N., et al. The Swi5-Sfr1 complex stimulates Rhp51/Rad51- and Dmc1-mediated DNA strand exchange in vitro. Nature Structural & Molecular Biology. 13, (9), 823-830 (2006).
  22. Argunhan, B., Murayama, Y., Iwasaki, H. The differentiated and conserved roles of Swi5-Sfr1 in homologous recombination. FEBS Letters. 591, (14), 2035-2047 (2017).
  23. Kuzmic, P. Program DYNAFIT for the analysis of enzyme kinetic data: application to HIV proteinase. Analytical biochemistry. 237, (2), 260-273 (1996).
  24. Brown, M. S., Bishop, D. K. DNA strand exchange and RecA homologs in meiosis. Cold Spring Harbor perspectives in biology. 7, (1), a016659 (2014).
  25. Rudert, W. A., et al. Double-labeled fluorescent probes for 5' nuclease assays: purification and performance evaluation. BioTechniques. 22, (6), 1140-1145 (1997).
  26. Xiao, J., Singleton, S. F. Elucidating a key intermediate in homologous DNA strand exchange: structural characterization of the RecA-triple-stranded DNA complex using fluorescence resonance energy transfer. Journal of Molecular Biology. 320, (3), 529-558 (2002).
  27. Grimme, J. M., et al. Human Rad52 binds and wraps single-stranded DNA and mediates annealing via two hRad52-ssDNA complexes. Nucleic Acids Research. 38, (9), 2917-2930 (2010).
  28. Algasaier, S. I., et al. DNA and Protein Requirements for Substrate Conformational Changes Necessary for Human Flap Endonuclease-1-catalyzed Reaction. The Journal of biological chemistry. 291, (15), 8258-8268 (2016).
תצפית בזמן אמת של התגובה Exchange גדיל DNA מתווכת על-ידי Rad51
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ito, K., Argunhan, B., Tsubouchi, H., Iwasaki, H. Real-time Observation of the DNA Strand Exchange Reaction Mediated by Rad51. J. Vis. Exp. (144), e59073, doi:10.3791/59073 (2019).More

Ito, K., Argunhan, B., Tsubouchi, H., Iwasaki, H. Real-time Observation of the DNA Strand Exchange Reaction Mediated by Rad51. J. Vis. Exp. (144), e59073, doi:10.3791/59073 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter