Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

Rad51 tarafından aracılı DNA Strand Exchange tepki gerçek zamanlı gözlem

Published: February 13, 2019 doi: 10.3791/59073

Summary

DNA'ın sistemleri tarafından Rad51 aracılı Satım tepki strand floresans rezonans enerji transferi tabanlı gerçek zamanlı gözlem için geliştirilmiştir. Burada sunulan iletişim kurallarını kullanarak, biz tepki ara ürün ve ayrıca reaksiyon enzimatik kinetik analiz ederken onların dönüşüm ürünlerde, oluşumu tespit edebiliyoruz.

Abstract

RAD51 tarafından aracılı DNA strand Satım tepki Homolog rekombinasyon kritik bir adımdır. Bu reaksiyon Rad51 nükleoprotein filaman tek iplikçikli DNA ' (ssDNA) oluşturur ve özellikle sigara için bir homolog sıra sorgulamaya çift iplikçikli DNA (dsDNA) yakalar. Homoloji karşılaştıktan sonra Rad51 ssDNA dsDNA bir iplikçik ile eşleştirme arabuluculuk DNA strand Satım tromboksan. Bu tepki çok çok sayıda accessary proteinler vivo içindetarafından düzenlenir. Her ne kadar geleneksel biyokimyasal testleri başarıyla böyle aksesuar protein vitrorolünü incelemek için istihdam edilmiştir, ara oluşumu ve ilerlemesi içine a sonda gelen ürün kinetik Analizi nedeniyle zorlu kanıtlamıştır reaksiyon ara ürün kararsız ve geçici doğası. Reaksiyon adımları doğrudan çözüm, floresans rezonans enerji transferi (FRET) gözlemlemek için-tabanlı gerçek zamanlı gözlem sistemleri bu tepki kuruldu. Gerçek zamanlı gözlemler kinetik analizini Rad51 tarafından aracılı DNA strand Satım tepki içeren üç iplikçikli DNA ara oluşumu, bu orta olgunlaşma ve ssDNA yayın üç adımlı tepki manken itaat gösterir olgun orta. Swi5-Sfr1 kompleksi, ökaryotlarda korunmuş bir accessary protein güçlü ikinci ve üçüncü adımları bu tepki geliştirir. Burada sunulan FRET tabanlı deneyleri bize hangi rekombinasyon accessary proteinler DNA strand Satım etkinliklerini Rad51 teşvik moleküler mekanizmaları ortaya çıkarmak sağlar. Bu iletişim kuralı birincil amacı teknikler kullanılabilir Homolog rekombinasyon, alanındaki araştırmacılar için repertuar özellikle bu tür Schizosaccharomyces pombebaşka proteinler ile çalışma artırmaktır böylece Burada sunulan bulgular evrimsel koruma belirlenebilir.

Introduction

Homolog rekombinasyon (HR) genetik bilgilerini iki farklı DNA molekülleri arasında karıştırma kolaylaştırır. İnsan kaynakları için iki temel biyolojik fenomen esastır: iki iplikçikli DNA tamiri ve gametogenesis1 sırasında genetik çeşitliliğin nesil tatili (DSBs)2 mitoz sırasında. DSBs DNA hasarı en ağır şeklidir ve kromozom bir kırılma oluşturmaktadır. Yanlış DSBs tamiri kanser3her iki özellikleridir geniş kromozomal düzenlemeler ve genomik istikrarsızlık, neden olabilir.

DNA iplikçik Satım tepki İK merkezi aşamasıdır. Adlandırılan son derece korunmuş RecA tipi ailesinin bir üyesidir, Rad51 protein bu reaksiyon Ökaryotlar4,5tromboksan anahtar proteindir. Bu reaksiyon Rad51 DSB sonuna nucleolytic işlem tarafından oluşturulan tek iplikçikli DNA (ssDNA) bağlanır ve formlar helisel nükleoprotein karmaşık presynaptic filaman olarak adlandırdığı. Bu filaman nonspecifically homolog sıra için aramak için olduğu gibi çift iplikçikli DNA (dsDNA) yakalar. Filaman homolog sıra bulduğunda bir reaksiyonu üç sarmallı DNA içeren ara oluşan ve Rad51 filaman bu yapısı6,7,8içinde strand Satım aracılık eder. Bu reaksiyon etkili bir şekilde başarmak için birkaç tür BRCA1 ve BRCA2, meme kanseri yatkınlık genleri9,10ürünleri gibi aksesuar proteinlerin Rad51 gerektirir.

Aksesuar faktörler Rad51 düzenleyen nasıl anlayış genomik istikrarsızlık nedenlerini tumorigenesis sırasında açığa çıkarmak, ayrılmaz bir adımdır. Her ne kadar çok araştırma presynaptic filaman oluşumu ve istikrar11,12,13,14,15,16, bu faktörlerin etkileri ile ilgilidir Bu faktörlerin üç-strand orta ve nihai ürün içine onun işleme oluşumu için katkı hala belirsizdir. Reaksiyon adımları konvansiyonel biyokimyasal deneyler yoluyla gözlemlemek çok zor üç-strand orta kararsız ve deproteinization örnekleri gibi yaygın deneysel manipülasyonlar tarafından daraltmak eğilimli olduğundan veya Elektroforez.

Bu sorunu çözmek için biz iki daha önce gelişmiş gerçek zamanlı gözlem sistemleri floresans rezonans enerji transferi (FRET) kullanarak DNA strand Satım tepki adapte: DNA strand eþleþtirme ve DNA strand deplasman deneyleri17, 18 (Şekil 1). Floresein ile presynaptic bir filament tahlil, Rad51 formları eşleştirme DNA dizisi - ssDNA ve sonra homolog carboxy-x-rodamine (ROX) etiketli - amidite (FAM) dsDNA etiketli strand değişimi reaksiyonu başlatmak için eklenir. Filament ROX etiketli dsDNA yakalar ve üç-strand orta formlar zaman iki fluorophores yakın gelip FAM floresans emisyon ROX (Şekil 1A) tarafından söndürülür. DNA iplikçik deplasman tahlil etiketlenmemiş ssDNA oluşan bir presynaptic filaman FAM ve ROX çift etiketli dsDNA ile inkübe. Strand değişimi tamamlandıktan ve ssDNA etiketli FAM üç-strand yayımlanan orta, emisyon FAM artar çünkü FAM artık yakın ROX (Şekil 1B). Bu deneyleri üç-strand ara ürün ve bunların işlenmesini içinde son ürünlerde gözlemlemek için bize etkinleştirmek tepki için herhangi bir rahatsızlık olmadan gerçek zamanlı.

Bu gerçek zamanlı gözlem sistemi kullanarak, bulduk Rad51 tarafından aracılı DNA strand Satım tepki üç adımda ilk tepki ara (C1) oluşumu da dahil olmak üzere, ilk orta ikinci bir ara geçiş devam eder (C2) ve ssDNA sürümünden C219. Biz de o fisyon mayası (S. pombe) bulundu bir evrimsel korunmuş Rad51 aksesuar protein kompleksi13,16,20,21,22yaşında, Swi5-Sfr1 uyarır C1-C2 geçiş ve açıklaması, ssDNA C2 Rad5119tarafından ATP-hidroliz üzerinde bağımlı bir şekilde.

Bu bulgular örümceklerle korunmuş gizemini koruyor. Bu iletişim kuralı HR, özellikle bu organizmalar S. pombedışında gelen proteinler ile çalışma alanındaki araştırmacılar hangi ölçüde belirlemek için bu teknikleri uygulanabilir umut ile sağlanan Rad51 odaklı moleküler mekanizması Strand Satım korunmuş. Ayrıca, bu tekniklerin S. pombe Swi5-Sfr1 rolünü belirlemede son derece başarılı kanıtlamıştır. Böylece, bu tekniklerin kesin rolleri diğer İK aksesuar faktörlerin ortaya çıkararak paha biçilmez olacak mantıklı bir tahmin olduğunu.

Protocol

1. proteinler ve DNA yüzeylerde hazırlanması

  1. S. pombe Rad51 ve Swi5-Sfr1 proteinleri (Coomassie boyama tarafından değerlendirilecektir), homojenizasyon için daha önce raporlanmış13,21arındırmak.
  2. Tablo 118' listelenen oligonükleotid DNA yüzeylerde hazırlayın.
    Not: Oligonucleotides satın alınan ( Tablo malzemelerigörmek) ve HPLC sınıfta sentezledim. Tepki, oligonucleotides eşleştirme DNA dizisi için 16FA(-), 16A (-) _40bp ve 16AR (+) _40bp gereklidir. DNA deplasman tahlil, oligonucleotides için 16A(-), 16FA (-) _40bp ve 16AR (+) _40bp gerekli (resim 1 ve Tablo 1) vardır. Bu iletişim kuralı tüm DNA konsantrasyonlarda konsantrasyonları nükleotit konsantrasyonları aksine parçası bakın.
  3. Donör dsDNA oluşturmak için ince duvarlı PCR tüp içinde tamamlayıcı iplikçiklerinin ekimolar tutarları ile tavlama tampon (10 mM Tris-HCl pH 7.5, 100 mM NaCl, 10 mM MgCl2) mix, toplam hacim 20 µL. büyük sağlanması gerçekleştirmek bu prechilled bir metal raf üzerinde karıştırma Buz (2 ° C ve 4 ° C arasında).
    Not: Oligonucleotides eşleştirme tahlil için kombinasyon vardır 16A (-) _40bp ve 16AR (+) _40bp. Deplasman tahlil için oligonucleotides 16FA tavlama (-) _40bp ve 16AR (+) _40bp.
  4. Tavlama karışımı 5 min için 90 ° C'de ısı ve 3 h ile 30 ° C arasında bir PCR makinesi kullanarak üzerinden aşağı serin. -20 ° C'de tavlanmış DNA depolamak

2. DNA Strand eþleþtirme ve yer değiştirme deneyleri

  1. DNA iplik tahlil eşleştirme gerçekleştirmek.
    1. Reaksiyon arabelleği A 1.6 mL hazırlamak (30 mM HEPES-KOH pH 7.5, 1 mM dithiothreitol [DTT], 15 mM MgCl2, 0,25 mM ATP, 0.1 mg/mL Sığır serum albümin [BSA] ve %0,0075 polyoxyethylenesorbitan monolaurate) 36 içeren nM 2.0 mL mikro-santrifüj 16FA(-) plastik tüp (Polipropilen) ve 5 min için 37 ° C'de önceden kuluçkaya.
    2. RAD51-ssDNA filamentler oluşturmak için önceden inkübe tepki arabellekte 1,5 µM son bir konsantrasyon Rad51 protein ekleyin ve 5 min için 37 ° C'de kuluçkaya.
    3. Swi5-Sfr1 protein 0.15 µM son bir konsantrasyon karışıma ekleyin ve bir daha da 5 min için 37 ° C'de kuluçkaya.
    4. 1.5 mL karışımı alın ve bir manyetik karıştırıcı içeren 1.0 x 1.0 cm kuvars küvet aktarmak ve küvet spectrofluorometer. 37 ° c spektrofotometre peltier sıcaklık denetleyicisi yapılandırmak ve manyetik karıştırıcı 450 rpm hızlı enjekte örneği karıştırma sağlamak için ayarlayın.
    5. FAM floresans emisyon 525, ölçümünü başlatmak nm (bant genişliği: 20 nm) uyarma, 493 üzerine nm (bant genişliği: 1 nm). Her saniye veri toplama.
    6. 100 ölçümlerinde başladıktan sonra s, ROX etiketli donör dsDNA 36 son bir konsantrasyon için enjekte nM bir şırınga ve ölçü değişikliği emisyon için başka bir 30 dk 1 s aralıklarla kullanarak karışımı içine.
  2. DNA iplikçik deplasman tahlil gerçekleştirin.
    1. Reaksiyon arabelleği A 1.6 mL hazırlamak 36 içeren nM 16A(-) 2.0 mL mikro-santrifüj plastik tüp ve 5 min için 37 ° C'de önceden kuluçkaya.
    2. Swi5-Sfr1 huzurunda Rad51-ssDNA filamentler 37 ° C'de 2.1.2 adımlarda açıklandığı gibi oluşturur. ve 2.1.3.
    3. 1.5 mL karışımı alın ve bir manyetik karıştırıcı içeren kuvars küvet aktarmak ve küvet spektrofotometre, 2.1.4 adımda anlatıldığı gibi.
    4. Floresans emisyon ölçümünü başlatmak ve sonra 100 s, donör dsDNA FAM ve ROX etiketli 2.1.6. adımda açıklandığı gibi enjekte. Floresans emisyon için başka bir 30 dk 1 s aralıklarla değişikliği ölçmek.

3. eşleştirme üzerinden deneysel verilerin analizi ve yer değiştirme deneyleri

  1. Maksimum FRET verimlilik tahmin ediyoruz.
    1. 16FA(-) 16AR ile komplementer hazırlamak (+) _40bp ve 16FA 16AR ile komplementer (-) _40bp (+) _40bp 1.3 ve 1.4 adımlarda açıklanan yordamın aynısını kullanarak.
    2. Reaksiyon arabelleği A 130 μL hazırlamak 36 içeren her iki 16FA(-) nM, 16FA(-) 16AR ile komplementer (+) _40bp, 16FA 16AR ile komplementer (-) _40bp (+) _40bp veya 16FA (-) _40bp 0.2 x 1.0 cm kuvars küvet içinde.
    3. Küvet spectrofluorometer ayarla ve 5 min için 37 ° C'de kuluçkaya.
    4. Ölçmek floresans spectra 500 600 nm uyarma, 493 üzerine nm.
    5. Rad51 FAM emisyon ve FAM tarafından ROX, Şoklama üzerindeki etkisini test etmek için karışıma 1,5 mikron son bir konsantrasyon Rad51 ekleyin ve 5 min için 37 ° C'de kuluçkaya.
    6. Ölçmek floresans spectra 500 600 nm uyarma, 493 üzerine nm.
    7. Aşağıda açıklanan denklemi kullanarak maksimum FRET verimlilik (EMaksimum) hesaplamak:
      Een fazla = (525 yoğunlukta floresans FAM ve ROX ile etiketli dsDNA nm) / (525 yoğunlukta floresans FAM nm etiketli ssDNA)
  2. Deplasman tahlil deneysel verileri çözümlemek.
    1. Nihai ürün miktarında değişiklik için deplasman tahlil gözlenen floresans değiştirmek dönüştürmek, bu tahlil aşağıda açıklanan denklem kullanılarak elde edilen ham deneysel verileri normalleştirmek için FHam floresan yoğunluğu nerede ham veriler ve Fnormalleştirilmiş değil aşağıdaki denklemi tarafından hesaplanan floresan değişimi.
      Fnormalleştirilmiş = ([FHam zaman x]-[FHam zaman 0]) / (([FHam zaman 0] / EMaksimum)-[FHam zaman 0])
      FHam zaman 0 olduğu için ilk 5 izlenen ortalama floresans ölü zaman (yani, bir injectant küvet giriliyor sonra karıştırma için gereken süre) sonra s.
    2. Photobleaching ve spontan deplasman etkileri dışlamak için Fnormalleştirilmiş Fnormalleştirilmiş FD, bu tahlil son üründe miktarında değişiklik olduğu elde etmek için örnek protein olmadan çıkarın.
      FD [Fnormalleştirilmiş örnek] - = [Fnormalleştirilmiş protein olmadan]
  3. Eşleştirme tahlil deneysel verileri çözümlemek.
    1. Aşağıda açıklanan denklemi kullanarak eşleştirme tahlil elde edilen ham deneysel verileri normalleştirmek, FHam ham veri ve Fnormalleştirilmiş floresan yoğunluğu nerede aşağıdaki denklemi tarafından hesaplanan floresans değişimdir.
      Fnormalleştirilmiş = (FHam zaman x) / (FHam zaman 0)
      FHam zaman 0 olduğu için son 20 izlenen ortalama floresans dsDNA substrat enjekte edilerek reaksiyon Başlatan önce s.
    2. Floresans substrat miktarı değişim içine değiştirmek dönüştürmek ve photobleaching ve spontan eşleştirme etkileri hariç, Fnormalleştirilmiş örneği aşağıda açıklanan denklemi kullanarak normalleştirmek için FP üstü miktarda nerede Bu tahlil alt katman.
      FP = 1 - (([Fnormalleştirilmiş protein olmadan] - [Fnormalleştirilmiş örnek]) / [1-EMaksimum])
    3. DNA iplikçik değişiminin reaksiyon kinetiği incelemek için analiz programı23 kullanarak eşleştirme tepki doğrusal olmayan son kare regresyon çözümlemesi yapma ( Tablo malzemelerigörmek).
      1. FPsaat ders veri içeren .txt biçiminde bir dosya hazırla.
      2. Programı başlatın ve komut dosyası Ek kod dosyasını program penceresine yapıştırın:
      3. Doğrusal olmayan son kare regresyon analizi başlatın. Bu incelemenin sonuçlarını aynı pencerede görüntülenir.

Representative Results

Etkili bir biçimde çözümlemenize deneysel veri eşleştirme ve yer değiştirme deneyleri için nasıl bir değişiklik FAM floresans emisyon DNA yüzeylerde bir dönüşüm ürünlerde karşılık gelen tanımlamak gereklidir. Bunu başarmak için floresan yoğunluğu ilgili aralığı belirlenmelidir. Eşleştirme tahlil için floresans emisyon ssDNA substrat karşılık gelen, 16FA(-), 16FA(-) 16AR ile komplementer emisyon ile karşılaştırılır (+) Bu reaksiyon (Şekil 2A) nihai ürünler için karşılık gelen _40bp. Bu maksimum FRET verimlilik için eşittir ve bu nedenle floresan yoğunluğu en fazla azalma olacak beklenen tüm ssDNA substrat dsDNA ürün haline dönüştürüldü. Deplasman tahlil, 16FA emisyon için (-) _40bp 16AR ile komplementer (+) için belgili tanımlık substrate karşılık gelir, _40bp 16FA emisyon ile karşılaştırıldığında nihai ürün (Şekil 2B) karşılık gelen (-) _40bp. Bu durumda, FAM floresan yoğunluğu en fazla artış içinde tüm dsDNA substrat ssDNA ürün haline dönüştürülür bir senaryo taşır. S. pombe Rad51 floresans emisyon FAM veya her iki deneyleri (Şekil 2) FAM tarafından ROX, verimliliği Şoklama etkilemedi. Oligonucleotides etiketleme verimliliğini bağımlı olduğu gibi maksimum FRET verimlilik yeniden oligonucleotides her yeni hazırlanması ile ölçülen olmalıdır.

DNA strand eþleþtirme ve yer değiştirme reaksiyonları temsilcisi veri Şekil 3' te gösterilmektedir. Substrat DNA'lar ve photobleaching arasındaki spontan tepkiler etkileri Rad51 ile görülen önemli değişiklikler karşılaştırıldığında Rad51 olmadan FAM emisyon içinde görülen önemsiz değişiklikler ortaya her iki deneyleri, küçük (Şekil 3A ve Şekil 3B). Şekil 3A veya Şekil 3Biçinde gösterilen verilere dayanarak, floresan değişimi substrat (FP) veya nihai ürün (FD) miktarı değişikliği içine sırasıyla, açıklanan adımları 3.2.2 veya 3.3.2 (denklemleri kullanarak dönüştürüldü Şekil 3 c ve 3D şekil).

Eşleştirme reaksiyon ilk üç-strand Orta (C1) oluşumu oluşan, ilk orta ikinci ara geçiş bir sıralı üç adımlı tepki modelini kullanarak simüle (C1 C2) ve ssDNA sürümü iki ürün (D + E) oluşturmak için ikinci orta üzerinden (Şekil 3E). İster bir sıralı üç adımlı tepki modeli uyum deneysel veriler simülasyonlarının gerçeklenmesi, tahlil ve simülasyon tarafından elde edilen teorik bir eğri eşleştirme DNA iplikçiğinin deneysel veriler arasında kalanlar olduğunu test etmek için (Şekil 3F) hesaplanır. Buna ek olarak, bir sıralı iki aşamalı reaksiyon modeli kullanılarak oluşturulan bir teorik eğrisi arasındaki eşleşme reaksiyon kalıntıları da hesaplanan (Şekil 3 g) idi. Eşleştirme tepki ve üç adım modeli için kalıntıları gibi bir sapma görünmüyor ise kalanlar eşleştirme tepki ve iki adım modeli için sistematik bir sapma erken dönemde göster. Bu üç adım modeli eşleştirme tepki simülasyonu için iki adım modeli daha daha uygun olduğunu gösterir.

Üç adım modeli DNA strand değişiminin geç adım algılar yer değiştirme reaksiyonu ile tutarlı olup olmadığını sınamak için biz eşleştirme simülasyonu elde edilen kinetik parametreleri kullanarak yer değiştirme reaksiyonu teorik bir eğri oluşturulan reaksiyon Şekil 3 c içinde gösterilen ve şekil 3D (Şekil 3 H) gösterildiği yer değiştirme reaksiyonu deneysel verilerle karşılaştırıldığında. Teorik eğrisi deplasman tahlil deneysel verilerin uygun. Bu sonuçlar, üç adım modeli simülasyonlarının gerçeklenmesi makul Rad51 tarafından aracılı DNA strand Satım tepki değerlendirmek mümkün olduğu sonucuna varıldı.

Rad51 ve Swi5-Sfr1 kompleksi, Rad51, accessary bir protein içeren tepki eşleştirme DNA iplikçiğinin temsilcisi veri Şekil 4Aiçinde gösterilir. Swi5-Sfr1 kompleksi şiddetle Rad51 eşleştirme etkinliği teşvik. Swi5-Sfr1 yokluğunda görülen eşleştirme reaksiyon iki adım modeli Swi5-Sfr1 (Şekil 4B) varlığında daha üç adım modeli daha uygun. Üç adım modeli kullanarak tepki simülasyon tepki denge sabitleri veya Swi5-Sfr1 olmadan her reaksiyon adımının hesaplanır. Swi5-Sfr1 kompleksi ilk tepki adım teşvik değil tepki denge sabitleri belirtilen (Şekil 4 c, paneli bir), hangi üç-strand orta oluşturulur, ancak kuvvetle C1-C2 ( geçiş uyarır Şekil 4 c, Masası b) ve (Şekil 4 c, paneli c) C2 orta ssDNA sürümünden.

Figure 1
Şekil 1: DNA'ın deneysel tasarım strand eþleþtirme ve yer değiştirme deneyleri. DNA'ın şemalarını eşleştirme (A) strand ve deplasman (B) deneyleri. Sarı daire Rad51 monomerleri temsil eder. Yeşil daireler içeren "F" ve "R" içeren kırmızı daireler floresein amidite (FAM) ve carboxy-X-rodamine (ROX), sırasıyla temsil eder. Siyah DNA dizilerini aynı sıra ve tamamlayıcı DNA ipliklerini mavi. İnce siyah çizgiler ok başları içeren Tablo 1' de gösterildiği gibi her oligonükleotid adının üzerine gelin. Bu rakam Ito ve ark. adapte edilmiş 19 ve değiştirilmiş. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Şekil 2: eşleştirme ve yer değiştirme deneyleri maksimum FRET verimliliğini ölçümleri. (A)floresan spectra ssDNA substrat, 16FA(-) ve dsDNA ürün arasında karşılaştırılması, 16FA(-) 16AR ile eşleştirilmiş (+) _40bp, eşleştirme testin. Mavi ve kırmızı çizgiler olmadan ve Rad51, substrat floresans spectra sırasıyla gösterir. Yeşil ve mor çizgiler olmadan ve Rad51, nihai ürünün floresans spectra sırasıyla gösterir. Floresans spectra dsDNA substrat, 16FA arasında karşılaştırılması (B) (-) _40bp 16AR ile eşleştirilmiş (+) _40bp ve ssDNA ürün, 16FA deplasman testin (-) _40bp. Mavi ve kırmızı çizgiler olmadan ve Rad51, nihai ürünün floresans spectra sırasıyla gösterir. Yeşil ve mor çizgiler olmadan ve Rad51, substrat floresans spectra sırasıyla gösterir. Bu rakam Ito ve ark. adapte 19 ve değiştirilmiş. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 3
Şekil 3: DNA strand eþleþtirme ve yer değiştirme reaksiyonları aracılık tarafından Rad51. (A)eşleştirme tepki ile ya da ezelî Rad51 normalleştirilmiş floresans zaman tabii. (B) yer değiştirme reaksiyonu ile ya da ezelî Rad51 normalleştirilmiş floresans zaman tabii. (C) Substrat Rad51 ile eşleştirme tepki miktarında değişiklik zaman tabii. (D) saat ders değişikliği Rad51 ile yer değiştirme reaksiyonu substrat miktarı. (E) A şematik sıralı üç adımlı tepki modeli. A ve B presynaptic filaman ve donör dsDNA karşılık gelir. C1 ilk (olgunlaşmamış) üç-strand orta ve karşılık gelir. C2 ikinci (Olgun) üç-strand orta ve karşılık gelir. D ve E heteroduplex ve C2 yayımlanan ssDNA karşılık gelir. (F ve G) kalıntıları tahlil ve teorik bir eğri eşleştirme DNA iplikçiğinin deneysel veriler arasında elde edilen üç adımlı (F) veya iki aşamalı (G) model kullanarak simülasyon tarafından. (H) kırmızı noktalar onların panel ö. mavi çizgi gösterir son ürünlerin teorik eğrisi gösterilen Rad51 ile yer değiştirme reaksiyonu deneysel verilerden gösteriyor. Teorik eğri Cpanel gösterilen eşleştirme tahlil elde edilen reaksiyon hızı sabitler simülasyonlarının gerçeklenmesi tarafından oluşturuldu. Bu rakam Ito ve ark. adapte 19 ve değiştirilmiş. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 4
Şekil 4: Swi5-Sfr1 uyarır ikinci ve üçüncü adımları DNA strand Satım tepki. (A)substrat eşleştirme tepki veya Swi5-Sfr1 (S5S1) olmadan miktarında değişiklik zaman tabii. (B) kalıntıları DNA strand eşleştirme deneysel veriler arasında Swi5-Sfr1 ile tahlil ve teorik bir eğri iki aşamalı (mavi çizgi) veya üç adımlı (kırmızı çizgi) modeli kullanarak simülasyon tarafından elde. 4A rakam gösterilir (eşleştirmeC) tepki analiz programı23 kullanarak üç adım modeli tarafından simüle ( Tablo malzemelerigörmek). Reaksiyon denge sabitleri K1 her reaksiyon adımının (bir) ve K3 K2 (b) (c), simülasyon elde edilmiştir. Bu rakam Ito ve ark. adapte 19 ve değiştirilmiş. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

DNA iplik tahlil eşleştirme için oligonucleotides
16FA(-) 5'-[AİLE] - AAATGAACATAAAGTAAATAAGTATAAGGATAATACA
AAATAAGTAAATGAATAAACATAGAAAATAAAGTAAAGGATAT AAA -3 '
16A (-) _40bp 5'-AAATGAACATAAAGTAAATAAGTATAAGGATAATACAAAA-3'
16AR (+) _40bp 5 '- TTTTGTATTATCCTTATACTTATTTACTTTATGTTCATTT-[ROX] -3'
DNA iplikçik deplasman tahlil için oligonucleotides
16A(-) 5'-AAATGAACATAAAGTAAATAAGTATAAGGATAATACAAAATA
AGTAAATGAATAAACATAGAAAATAAAGTAAAGGATAT AAA -3 '
16FA (-) _40bp 5'-[AİLE] - AAATGAACATAAAGTAAATAAGTATAAGGATAATACAAAA-3'
16AR (+) _40bp 5 '- TTTTGTATTATCCTTATACTTATTTACTTTATGTTCATTT-[ROX] -3'

Tablo 1: DNA strand eþleþtirme ve yer değiştirme deneyleri içinde kullanılan oligonucleotides listesi. Uygun olduğunda, fluorophores (floresein amidite, FAM; carboxy-x-rodamine, ROX) konumları içinde belirtilen kare parantez.

Discussion

Burada, FRET Rad51 tahrik DNA strand Satım gerçek zamanlı olarak ölçmek için kullanır detaylı bir protokol anlatmıştık. Önemlisi, bu ölçümler reaksiyon kinetiği belirlenmesi için izin verir. Yukarıda verilen açıklamaları yayımlanmış sonuçlarımız çoğaltmak için yeterli olsa da, bu bölümde açıklanan birkaç kritik noktaları vardır. Ayrıca, avantajları ve dezavantajları DNA strand exchange eğitim için FRET tabanlı yöntemleri, bu tür teknikler uygulama DNA metabolizmasının diğer yönleri çalışma ile birlikte ele alınacaktır.

Tüm biyokimyasal reconstitutions gibi ile tüm reaksiyon yüzeylerde yüksek saflık vardır sağlanması esastır. Bulaşıcı faaliyetleri Coomassie boyama tarafından değerlendirilecektir bir protein hazırlık belirgin saflığı dayalı yokluğu varsaymak ihmalkar. Özellikle, eser miktarda nükleaz ve helikazlar varlığı büyük ölçüde eþleþtirme ve yer değiştirme deneyleri sonuçlarını etkileyebilir. Böylece, bu tür faaliyetleri için yeni bir toplu işlemi protein saf her zaman test kesinlikle öneririz. Ayrıca, yerel polyacrylamide jel elektroforez tarafından sentezlenmiş DNA yüzeylerde saflığı kontrol etmek ihtiyatlı olduğunu. Oligonucleotides saflığı garanti eden birçok şirket rağmen sık sık kendi saflık sentezlenmiş DNA'ın toplu işlemleri arasında değişebilir testler vasıtasıyla bulduk.

Kuvars cuvettes ile deneyler aşağıdaki iki nokta dikkate önemlidir. İlk olarak, bazı proteinler nonspecifically kuvars cuvettes bağlamak yatkındır. Reaksiyon arabellekleri dahil BSA ve polyoxyethylenesorbitan monolaurate bu karşı için. İkinci olarak, sıcaklık reaksiyon hızı ve floresan yoğunluğu üzerinde ciddi bir etkisi bulunmaktadır. Bu etkiyi en aza indirmek için kuvars küvet kullanmadan 37 ° C önce önceden inkübe olmalıdır.

Konvansiyonel biyokimyasal deneyleri DNA strand exchange eğitim derece yararlı olmasına rağmen onlar birkaç dezavantajları var. Tipik bir zaman ders denemede bir tepki belirli bir sıcaklıkta inkübe ve aliquots istenen timepoints içine kapanık ve deterjan ve proteaz reaksiyon sona erdirme ile tedavi tarafından deproteinized. Zaman ders tamamlandığında, örnekleri sonra Elektroforez DNA yüzeylerde urun ayırmak için tabi. Burada açıklanan yöntemi en büyük avantajı bu reaksiyon herhangi bir rahatsızlık olmadan gerçek zamanlı gözlem için sağlanmıştır. Reaksiyon sırasında herhangi bir timepoint reaksiyon kendisi kesintiye uğratmadan teftiş ve örnekleri deproteinize veya onları Elektroforez potansiyel olarak yıkıcı güçleri tabi için gerek yoktur. Bu değişken DNA yapıları izlerken özellikle önemlidir.

Geleneksel deneyleri üzerinde bu güçlü rağmen burada açıklanan yöntemi bazı dezavantajları var. Oligonükleotid DNA yüzeylerde kullanımı strand değişimi için yorumu sonuçları basitleştirir, bu gibi yüzeylerde hücredeki DNA yüzeylerde HR dahil benzer değil hatırlamak önemlidir. Geleneksel bazı deneyleri olan baz çifti sayısı içinde vivoalışverişinde yansıtmak muhtemeldir plazmid ölçekli DNA yüzeylerde, kullanmaktadır. Ayrıca, geleneksel deneyleri alt kümesinde topolojik kısıtlanmış dairesel dsDNA yüzeylerde kullanımı en azından kısmen fizyolojik DNA gerginlik yeniden oluşturabilirsiniz.

Burada açıklanan yöntemi uygulanması Rad51 tahrik DNA strand Satım moleküler mekanizmaları çözülmeye başladı. Yine de, cevaplanması gereken kalır birçok ilginç sorular vardır. İK mayoz sırasında Rad51 ve Dmc1, mayoz özgü RecA tipli recombinase yılında Ökaryotlar24gerektirir açık kanıtlar vardır. Ancak, bu iki adlandırılan arasında büyük biyokimyasal farklılıklar eksikliği alanındaki araştırmacılar yıllardır şaşkın. Ayrıca, çok sayıda farklı gruplar rekombinasyon aksesuar faktörlerin rol İK alanında araştırmaların odak bir konu olmuştur. Rad51 ve Dmc1 biyokimyasal farklılıkları elucidating ek olarak, biz araştırmak ve yakın gelecekte DNA strand Satım kinetik farklı rekombinasyon aksesuar faktörlerin etkilerini karşılaştırmak hedefliyoruz. Son olarak, burada açıklanan FRET tabanlı metodoloji DNA strand Satım çalışma odasına sınırlı değildir stres önemlidir. Nispeten küçük değişiklikler ile biz pek çok işlevsel olarak farklı proteinler DNA metabolizma25,26,27,28içinde ilgili soruşturma bu tekniği uygulamalarda öngörülüyor. Biz burada açıklanan gelişmeler ait birçok farklı disiplinlerden araştırmacılar için daha fazla seçenekler sağlayacaktır umuyoruz.

Disclosures

Yazarlar ifşa gerek yok.

Acknowledgments

Bu eser Grants-in-Aid tarafından bilimsel araştırma (A) (18 H 03985) ve yenilikçi alanlarda (15 H 05974) HI için genç bilim adamları için BA (B) (17 K 15061) ve için bilimsel araştırma (B) (18 H 02371) HT için promosyon of Science (Japonya toplumdan finanse edildi JSP'LER).

Materials

Name Company Catalog Number Comments
0.2 x 1.0 cm quartz cuvette Hellma Analytics 105-250-15-40
1.0 x 1.0 cm quartz cuvette Hellma Analytics 101-10-40
adenosine triphosphate (ATP) Sigma A2383
DynaFit BioKin, Ldt. DynaFit is a program to analyze kinetics of biochemical reactions.
Fluorescent labeled and non-labeled oligonucleotides Eurofins Genomics The sequences of oligos are listed in Table. 1.
Magnetic stirrer Aisis (Japan) CM1609
PCR machine TAKARA (Japan) TP600 TAKARA PCR Thermal Cycler Dice
Spectrofluorometer JASCO FP8300 Contains a peltier temperature controller and magnetic stirrer system
Syringe HAMILTON 1702RN 25ul SYR (22s/2"/2)

DOWNLOAD MATERIALS LIST

References

  1. Camerini-Otero, R. D., Hsieh, P. Homologous recombination proteins in prokaryotes and eukaryotes. Annual Review of Genetics. 29, (1), 509-552 (1995).
  2. Cromie, G. A., Connelly, J. C., Leach, D. R. Recombination at double-strand breaks and DNA ends: conserved mechanisms from phage to humans. Molecular Cell. 8, (6), 1163-1174 (2001).
  3. Pierce, A. J., et al. Double-strand breaks and tumorigenesis. Trends in cell biology. 11, (11), S52-S59 (2001).
  4. Haber, J. E. Genome Stability. Garland Science. (2013).
  5. Kowalczykowski, S. C. An Overview of the Molecular Mechanisms of Recombinational DNA Repair. Cold Spring Harbor perspectives in biology. 7, (11), a016410 (2015).
  6. Bianco, P. R., Tracy, R. B., Kowalczykowski, S. C. DNA strand exchange proteins: a biochemical and physical comparison. Frontiers in bioscience: a journal and virtual library. 3, D570-D603 (1998).
  7. Renkawitz, J., Lademann, C. A., Jentsch, S. Mechanisms and principles of homology search during recombination. Nature Reviews Molecular Cell Biology. 15, (6), 369-383 (2014).
  8. Greene, E. C. DNA Sequence Alignment during Homologous Recombination. The Journal of biological chemistry. 291, (22), 11572-11580 (2016).
  9. Sung, P., Krejci, L., Van Komen, S., Sehorn, M. G. Rad51 recombinase and recombination mediators. Journal of Biological Chemistry. 278, (44), 42729-42732 (2003).
  10. Prakash, R., Zhang, Y., Feng, W., Jasin, M. Homologous recombination and human health: the roles of BRCA1, BRCA2, and associated proteins. Cold Spring Harbor perspectives in biology. 7, (4), a016600 (2015).
  11. Sung, P. Function of yeast Rad52 protein as a mediator between replication protein A and the Rad51 recombinase. Journal of Biological Chemistry. 272, (45), 28194-28197 (1997).
  12. Sung, P. Yeast Rad55 and Rad57 proteins form a heterodimer that functions with replication protein A to promote DNA strand exchange by Rad51 recombinase. Genes & Development. 11, (9), 1111-1121 (1997).
  13. Kurokawa, Y., Murayama, Y., Haruta-Takahashi, N., Urabe, I., Iwasaki, H. Reconstitution of DNA strand exchange mediated by Rhp51 recombinase and two mediators. PLoS biology. 6, (4), e88 (2008).
  14. Jensen, R. B., Carreira, A., Kowalczykowski, S. C. Purified human BRCA2 stimulates RAD51-mediated recombination. Nature. 467, (7316), 678-683 (2010).
  15. Liu, J., et al. Rad51 paralogues Rad55-Rad57 balance the antirecombinase Srs2 in Rad51 filament formation. Nature. 479, (7372), 245-248 (2011).
  16. Lu, C. -H., et al. Swi5-Sfr1 stimulates Rad51 recombinase filament assembly by modulating Rad51 dissociation. Proceedings of the National Academy of Sciences of the United States of America. (2018).
  17. Bazemore, L. R., Takahashi, M., Radding, C. M. Kinetic analysis of pairing and strand exchange catalyzed by RecA. Detection by fluorescence energy transfer. Journal of Biological Chemistry. 272, (23), 14672-14682 (1997).
  18. Gupta, R. C., Bazemore, L. R., Golub, E. I., Radding, C. M. Activities of human recombination protein Rad51. Proceedings of the National Academy of Sciences. 94, (2), 463-468 (1997).
  19. Ito, K., Murayama, Y., Takahashi, M., Iwasaki, H. Two three-strand intermediates are processed during Rad51-driven DNA strand exchange. Nature Structural & Molecular Biology. 25, (1), 29-36 (2018).
  20. Akamatsu, Y., Dziadkowiec, D., Ikeguchi, M., Shinagawa, H., Iwasaki, H. Two different Swi5-containing protein complexes are involved in mating-type switching and recombination repair in fission yeast. Proceedings of the National Academy of Sciences. 100, (26), 15770-15775 (2003).
  21. Haruta, N., et al. The Swi5-Sfr1 complex stimulates Rhp51/Rad51- and Dmc1-mediated DNA strand exchange in vitro. Nature Structural & Molecular Biology. 13, (9), 823-830 (2006).
  22. Argunhan, B., Murayama, Y., Iwasaki, H. The differentiated and conserved roles of Swi5-Sfr1 in homologous recombination. FEBS Letters. 591, (14), 2035-2047 (2017).
  23. Kuzmic, P. Program DYNAFIT for the analysis of enzyme kinetic data: application to HIV proteinase. Analytical biochemistry. 237, (2), 260-273 (1996).
  24. Brown, M. S., Bishop, D. K. DNA strand exchange and RecA homologs in meiosis. Cold Spring Harbor perspectives in biology. 7, (1), a016659 (2014).
  25. Rudert, W. A., et al. Double-labeled fluorescent probes for 5' nuclease assays: purification and performance evaluation. BioTechniques. 22, (6), 1140-1145 (1997).
  26. Xiao, J., Singleton, S. F. Elucidating a key intermediate in homologous DNA strand exchange: structural characterization of the RecA-triple-stranded DNA complex using fluorescence resonance energy transfer. Journal of Molecular Biology. 320, (3), 529-558 (2002).
  27. Grimme, J. M., et al. Human Rad52 binds and wraps single-stranded DNA and mediates annealing via two hRad52-ssDNA complexes. Nucleic Acids Research. 38, (9), 2917-2930 (2010).
  28. Algasaier, S. I., et al. DNA and Protein Requirements for Substrate Conformational Changes Necessary for Human Flap Endonuclease-1-catalyzed Reaction. The Journal of biological chemistry. 291, (15), 8258-8268 (2016).
Rad51 tarafından aracılı DNA Strand Exchange tepki gerçek zamanlı gözlem
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ito, K., Argunhan, B., Tsubouchi, H., Iwasaki, H. Real-time Observation of the DNA Strand Exchange Reaction Mediated by Rad51. J. Vis. Exp. (144), e59073, doi:10.3791/59073 (2019).More

Ito, K., Argunhan, B., Tsubouchi, H., Iwasaki, H. Real-time Observation of the DNA Strand Exchange Reaction Mediated by Rad51. J. Vis. Exp. (144), e59073, doi:10.3791/59073 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter