Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Manipulación de la función del Gene en mexicano Cavefish

doi: 10.3791/59093 Published: April 22, 2019

Summary

Se describen métodos para la manipulación de genes en el sistema del modelo evolutivo Astyanax mexicanus. Se describen tres técnicas diferentes: transgénesis mediada de Tol2, manipulación dirigida del genoma utilizando CRISPR/Cas9 y caída de expresión usando morfolinos. Estas herramientas deben facilitar la investigación directa de los genes subyacentes a la variación entre las formas de la superficie y cavernas.

Abstract

Cueva de animales proporcionan un sistema convincente para la investigación de los mecanismos evolutivos y bases genéticas subyacen cambios en numerosos rasgos complejos, incluyendo degeneración de ojo, albinismo, pérdida de sueño, hiperfagia y procesamiento sensorial. Especies de cavefish de todo el mundo muestran una evolución convergente de rasgos morfológicos y de comportamiento debido a las presiones ambientales compartidos entre sistemas de diferentes cuevas. Cueva de diversas especies se han estudiado en el entorno de laboratorio. El tetra mexicano, Astyanax mexicanus, con formas visuales y ciegas, ha proporcionado perspectivas únicas en los procesos biológicos y moleculares subyacentes a la evolución de rasgos complejos y es bien posicionado como un sistema modelo emergente. Mientras que genes candidatos que regulan la evolución de diversos procesos biológicos han sido identificados en a. mexicanus, ha limitado la capacidad de validar una función de los genes individuales. La aplicación de la transgénesis y la tecnología de edición de gen tiene el potencial para superar este impedimento significativo e investigar los mecanismos subyacentes a la evolución de características complejas. Aquí, describimos una metodología diferente para manipular genes en a. mexicanus. Los enfoques incluyen el uso de morfolinos, transgénesis de Tol2 , y modelos de sistemas de edición génica, usadas en pez cebra y otros peces, para manipular funciones de los genes en a. mexicanus. Estos protocolos incluyen descripciones detalladas de los procedimientos de reproducción programada, la colección de huevos fecundados, las inyecciones y la selección de animales genéticamente modificados. Permitirán a estos enfoques metodológicos para la investigación de los mecanismos genéticos y de los nervios subyacentes a la evolución de diversos rasgos en a. mexicanus.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Desde el Origen de las especiesde Darwin1, los científicos han adquirido profundas penetraciones en cómo están formados evolutivamente rasgos frente a las presiones ambientales y ecológicas definidas, gracias a la cueva de organismos2. El tetra mexicano, a. mexicanus, se compone de ojos ancestrales poblaciones 'superficiales' que habitan en ríos en México y sur de Texas y de al menos 29 poblaciones geográficamente aisladas de morfos derivados cueva que habitan en la Sierra del Abra y otras áreas del noreste de México3. Se han identificado una serie de rasgos asociados de cueva en a. mexicanus, incluyendo consumo alterado de oxígeno, despigmentación, pérdida de ojos y alteraciones de la alimentación y forraje comportamiento4,5,6, 7,8,9. A. mexicanus presenta un potente modelo para investigar mecanismos de evolución convergente debido a una historia evolutiva bien definida, una detallada caracterización del ambiente ecológico y la presencia de manera independiente desarrolló cueva las poblaciones de10,11. Muchos de los rasgos derivados de cueva que están presentes en cavefish, incluyendo la pérdida del ojo, pérdida de sueño, mayor alimentación, pérdida de la escolaridad, reducción la agresión y reducción las respuestas de estrés, han evolucionado varias veces a través de orígenes independientes, a menudo utilizando diferentes vías genéticas entre cuevas8,12,13,14,15. Esto repite la evolución es un aspecto de gran alcance del sistema a. mexicanus y puede proporcionar la penetración en la cuestión más general de sistemas como genéticos puede ser perturbado para generar fenotipos similares.

Mientras que la aplicación de la tecnología genética para la investigación mecanicista de la función del gene ha sido limitada en muchas especies de peces (incluyendo a. mexicanus), avances recientes en el pez cebra proporcionan una base para el desarrollo de la tecnología genética en peces 16,17,18,19,20. Numerosas herramientas son ampliamente utilizados en el pez cebra para manipular la expresión genética, y la aplicación de estos procedimientos se han estandarizado mucho. Por ejemplo, la inyección de morfolino oligos (MOs) en la etapa unicelular selectivamente bloquea RNA y evita la traducción de una breve ventana temporal durante el desarrollo de21,22. Además, enfoques gene-edición, tales como agrupadas regularmente otro corto repite palindrómico (CRISPR) / CRISPR asociados proteína 9 (Cas9) y nucleasas efectoras como activador de transcripción (TALEN), permiten la generación de las canceladuras definidas o, en algunos casos, las inserciones a través de una recombinación en el genoma19,20,23,24. Transgénesis se usa para manipular la expresión génica estable o función de una manera específica de tipo celular. El sistema de Tol2 es utilizado con eficacia para generar animales transgénicos por coinjecting transposasa mRNA con un plásmido de DNA de Tol2 que contiene un transgen25,26. El sistema de Tol2 utiliza la transposasa de Tol2 de medaka generar del germline estable inserciones de construct17 transgénicos. Generación de Tol2 transgénicos implica coinjecting un plásmido que contiene un transgen flanqueado por sitios de integración Tol2 y mRNA para Tol2 transposasa17. Este sistema ha sido utilizado para generar una matriz de líneas transgénicas en el pez cebra y recientemente ha ampliado su uso a los sistemas adicionales del modelo emergente, incluyendo cichlids, killis, espinoso y, más recientemente, el mexicano cavefish27, 28,29,30.

Mientras que el cavefish es un sistema biológico fascinante para desdoblamiento los mecanismos de la evolución del rasgo, su plena capacidad como un modelo evolutivo no se ha reunido completamente. Esto ha sido parcialmente debido a una incapacidad para manipular la genética y celular función directamente31. Se han identificado genes candidatos que regulan características complejas mediante estudios de rasgos cuantitativos loci (QTL), pero la validación de estos genes candidatos ha sido difícil32,33,34. Recientemente, caída transitoria usando morfolinos, gene edición utilizando sistemas CRISPR y TALEN y el uso de Tol2-transgénesis mediadas se han utilizado para investigar la base genética subyacente a una serie de rasgos35,36,37 ,38. La implementación y normalización de estas técnicas permitirá manipulaciones que interrogan las bases moleculares y neurales de rasgos biológicos, incluyendo la manipulación de la función del gene, el etiquetado de la población definida de la célula, y la expresión de los periodistas funcionales. Considerando que la implementación exitosa de estas herramientas genéticas para manipular el gen o la función celular se ha demostrado en el modelo emergente de los sistemas, protocolos detallados aún carecen de a. mexicanus.

A. mexicanus proporcionan la penetración crítica en los mecanismos de la evolución en respuesta a un entorno cambiante y presentar la oportunidad de identificar nuevos genes que regulan diversos rasgos. Varios factores sugieren que a. mexicanus es un modelo muy manejable para la aplicación de herramientas genómicas establecidas actualmente disponible en los modelos genéticos establecidos, incluyendo la habilidad de fácilmente mantener peces en los laboratorios, cría de gran tamaño, transparencia, un genoma secuenciado y ensayos de comportamiento definido39. Aquí, describimos una metodología para el uso de gen edición en superficie y la cueva de las poblaciones de a. mexicanus, morfolinos y transgénesis. La aplicación más amplia de estas herramientas en a. mexicanus permitirá una investigación mecanicista de los procesos moleculares subyacentes a la evolución del desarrollo, fisiológicas y conductuales diferencias entre peces de superficie y cavefish.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. morfolino oligo diseño

Nota: Las secuencias de a. mexicanus están disponibles a través del Centro Nacional de información biotecnológica (NCBI) Gene y SRA de NCBI (https://www.ncbi.nlm.nih.gov), así como desde el navegador de genoma de Ensembl (https://www.ensembl.org). Al diseñar un morfolino para su uso en ambas formas de la superficie y cavernas, es fundamental para identificar cualquier variación genética entre los morfos en esta etapa, por lo que estas regiones genéticas pueden evitarse como blancos para morfolinos. Cualquier variación polimórfica dentro de un sitio de destino de morfolino puede conducir al atascamiento ineficaz. El diseño es similar a otros sistemas de peces como el pez cebra y se ha demostrado previamente para trabajar eficazmente en a. mexicanus21,36,40.

  1. Diseño de bloqueo de traducción morfolinos
    Nota: Morfolinos traducción de bloqueo bloquean traducción atando al sitio Inicio endógena e impiden traslacional maquinaria de atar la secuencia de ARNm a través obstáculo estérico.
    1. Identificar la región codificante del gen objetivo a partir de la página de inicio ATG.
    2. Grabar los primeros 25 pares de bases de la secuencia de destino copiar y pegar la secuencia en un cuaderno de texto editor o laboratorio.
    3. Utilizando software en línea (por ejemplo, http://reverse-complement.com) o traducción manual, generar el complemento reverso de la secuencia de destino. Guardar el complemento inverso resultante en un editor de texto o cuaderno de laboratorio.
    4. Ordenar un morfolino con la secuencia del complemento reverso de una compañía que genera morfolino oligonucleótidos. Véase Tabla de materiales para las empresas.
  2. Diseño de bloqueo de empalme morfolinos
    Nota: Bloqueo de empalme morfolinos bloquean de empalme y, así, evitan la formación de una molécula de ARNm maduro. Esto proporciona un método alternativo de caída cuando los sitios de inicio no están bien definidos, o un enfoque más óptimo cuando se desea la validación de la precipitación mediante reacción en cadena de polimerasa (PCR). Este beneficio del bloqueo de empalme morfolinos (sobre bloqueo de ATG MOs) es esa exclusión del exón o inserción del intrón puede evaluarse fácilmente con la transcriptasa reversa (RT)-polimerización en cadena y visualizadas en un gel de diferencias de tamaño. RT-PCR y gel electroforesis para determinar eficacia de morfolino debe hacerse utilizando procedimientos estándar del laboratorio.
    1. Identificar la secuencia de pre-mRNA del gen objetivo. Utilizar la información disponible desde el genoma de a. mexicanus vía NCBI o Ensembl para determinar límites de intrón-exón33.
    2. Objetivo del intrón-exón límite (aceptador del empalme) sitios de exclusión inclusión o exón intrón o (donante del empalme) del exón-intrón.
      Nota: El espliceosoma normalmente está dirigido a una secuencia de "GU" (U1 blanco) en el intrón en el 5' sitio del empalme y una secuencia de AG'' ''en el sitio del empalme intronic (U2 blanco) 3'. En condiciones normales, el espliceosoma U1 y U2 subunidades unen estos sitios blanco en la secuencia de pre-mRNA de empalme adecuado para ocurrir. Sin embargo, si cualquiera de estas secuencias de destino está bloqueado por un morfolino, el espliceosoma se trasladará al siguiente disponible U1 o U2 sitio, causando un exón o exclusión del intrón en la secuencia de ARNm. Esto implicará la planificación y optimización, dependiendo de la naturaleza del objetivo gen21. En general, bloqueo un sitio interno de U1 redirige el empalme al siguiente sitio disponible de U1, causando una supresión del exón. Por otra parte, bloqueando a la Unión de empalme de la primera o la última causa la inserción de un intrón porque no hay ningún otro sitio para redirigir el empalme a. Usar software de secuencia para predecir el efecto de diversas exclusiones versus inclusiones. Predicciones pueden indicar potencial mutágeno ' frameshift ' o codones de parada prematura, lo que indica un sitio objetivo más eficaz para la interrupción del mRNA.
    3. Una vez que se identifica el sitio de destino, registre su secuencia en un libro de texto editor o laboratorio. Asegúrese de que el sitio de destino es 25 pares de bases (PB) largo.
    4. Utilizando software en línea (por ejemplo, http://reverse-complement.com) o traducción manual, generar el complemento reverso de la secuencia de destino. Registre su secuencia en un libro de texto editor o laboratorio.
    5. Ordenar un morfolino con la secuencia del complemento reverso de una compañía que genera morfolino oligonucleótidos. Véase Tabla de materiales para las empresas de la muestra.

2. morfolinos para inyección

Nota: Varias concentraciones o volúmenes de inyección MO tendrá que llevar a cabo para establecer la concentración óptima para inyectar. Las cantidades típicas inyecciones son 400 – 800 pg de Mo. El efecto de la caída de morfolino puede persistir por hasta 6 postinjection de días.

  1. Obtener el morfolino stock. El morfolino stock llega liofilizado. Hidratar con estéril H2O antes a la concentración deseada de existencias (por ejemplo, 4 mM). Almacenar a-20 °C hasta su uso.

3. CRISPR gRNA diseño, transcripción in vitro y preparación

  1. Diseño de gRNA CRISPR
    Nota: gRNAs fueron generados utilizando los estudios previamente publicados por Varshney et al40 y Wierson et al41.
    1. Utilizando un browser del genoma, identificar la región codificante del gen de interés. Utilizando la secuencia genomic, identificar la secuencia de destino gRNA dentro de un exón buscando un 20 bp nucleótido objetivo la secuencia comienza con GG y seguido por una secuencia de PAM (NGG). Una región del gen después de inicio (ATG) estará dirigido.
      Nota: Si no se encuentra una secuencia de destino con GG en el extremo 5' en el exón deseado del gene, una o ambas de la G's puede sustituirse por el primeros y segundo nucleótidos en el extremo 5' de la secuencia. Sin embargo, lo dos G's debe ser incorporado en el oligo, como estos son necesarios para la transcripción de T7.
    2. Diseñar y ordenar un gene específico de oligonucleótidos (oligo A: 5'-TAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGC-3'). Agregar el gen específico 20 bp gRNA secuencia Diana (en negrita) sin la secuencia de PAM entre una secuencia de promotor de T7 (rojo) y una secuencia de superposición solía templar a un oligonucleótido segundo (azul). Recocido y amplificar (ver paso 3.2.1) este oligo A y un segundo oligo (oligo B: 5'-GATCCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTT AACTTGCTATTTCTAGCTCTAAAAC-3') para generar la plantilla de gRNA utilizada para la transcripción.
      Nota: Oligo B es el mismo para cada reacción y sólo se necesita pedir 1 x.
  2. transcripción y preparación de gRNA
    1. Recocido y amplificar los oligos. Incluyen los siguientes cebadores para amplificar el gRNA para aumentar producción: 5'-TAATACGACTCACTATA-3' (cartilla de T7) y 5'-GATCCGCACCGACTCGGTG-3' (3' gRNA cartilla). Llevar a cabo una polimerización en cadena con polimerasa de Thermococcus thermococcus (KOD).
      Nota: Para ambos primers oligo A y oligo B, 10 ciclos se recomienda para un buen rendimiento. Un protocolo detallado puede encontrarse en Wierson et al41.
    2. Transcribir la gRNA usando kits de transcripción in vitro disponibles comercialmente (véase Tabla de materiales). Esto se hace a través de modificaciones al fabricante'Protocolo s publicado por Klaassen et al42.
    3. Precipitado, lave y resuspender el gRNA descrito por Klaassen et al42.
      Nota: El gRNA debe se resuspendió en agua libre de ARNasa a evitar la degradación.
    4. Registro de la concentración de la gRNA, que puede ser determinada usando un espectrofotómetro. Evaluar la calidad del ARN mediante la ejecución de 2 μL en un gel de agarosa. RNA alícuota para evitar la congelación/descongelación y almacenar a-80 °C hasta inmediatamente antes de las inyecciones.
  3. Transcripción y preparación de Cas9
    1. Cas9 mRNA se puede transcribir utilizando kits de transcripción in vitro disponibles comercialmente (véase Tabla de materiales) como se describe anteriormente43. Utilice la versión de nls-Cas9-nls43.
    2. Registrar la concentración de la gRNA y evaluar su calidad mediante la ejecución de 2 μL en un gel de agarosa. RNA alícuota para evitar la descomposición que se presenta a través de múltiples ciclos de congelación y descongelación y almacena las alícuotas a-80 °C.

4. elaboración de constructos de Tol2, Tol2 transposasa y transgénesis

  1. Preparar Tol2 transgen construcciones para la inyección.
    Nota: Hemos utilizado con éxito publicados disponibles pez cebra y medaka construye en a. mexicanus. Estas construcciones son completamente funcionales en a. mexicanus, probablemente debido al alto nivel de homología de secuencia (consulte el repositorio de AddGene y la red de información del pez cebra [ZFIN] bases de datos de construcciones disponibles). Los fragmentos del promotor de pez cebra han expresado los transgenes en los tejidos esperados cuando se utiliza en a. mexicanus.
    1. Tol2 construcciones de adquirir o generar plásmidos con un promotor específico de tejido, el transgen deseado y brazos de Tol2 (véase Kwan et al44). Una vez recibida, la secuencia de la construcción para validar el plásmido.
    2. Realizar un midiprep de construcciones según el fabricante'las pautas de s. Eluir el plásmido final en libre de Rnasa H2O, determinar la concentración con un espectrofotómetro, diluir la concentración a 100300 ng /μL y la alícuota y la tienda de las construcciones a-20 °C.
  2. Tol2 transposasa plásmido de digerir y sintetizar mRNA.
    1. Obtener una copia del plásmido transposasa Tol2 (PC-zT2TP) como una plantilla para generar ARNm de Tol245.
    2. Midiprep PC-zT2TP construir según el fabricante'las pautas de s. Eluir en un bajo volumen de agua libre de ARNasa o búfer (50 μL). Almacenar las alícuotas a-20 °C.
    3. Digerir el Tol2 plásmido con una enzima de restricción.
      1. Realice un resumen de la restricción de 10 μg de plásmido circular PC-zT2TP utilizando la tabla 1.
      2. Dividir la reacción en 250 μL las reacciones e incubar las reacciones durante la noche a 37 °C en un termociclador.
      3. Al día siguiente, inactivar la enzima por calentamiento a 65 °C por 20 min.
      4. Purificar el plásmido linearizado inmediatamente después de la recopilación, uso disponible en el mercado kits PCR de purificación (véase Tabla de materiales) por las directrices de los fabricantes' . Eluir el plásmido en 15 μL de ARNasa-libre H2O y determinar la concentración del producto usando un espectrofotómetro.
      5. Ejecutar 1 μL del plásmido digerido y 1 μL del plásmido sin cortar en una agarosa 1.5% gel para confirmar plásmido linearizado.
    4. Realice una transcripción in vitro de Tol2 mRNA.
      1. Utilizar 1 μg de plásmido linearizado PC-zT2TP como plantilla para la transcripción. Siga el fabricante'las pautas de s para la transcripción in vitro (véase Tabla de materiales) como se describe en la tabla 2.
      2. Incubar a 37 °C en un termociclador por el fabricante del'las pautas de s.
      3. Añadir 1 μl de DNasa, incubar a 37 °C en un termociclador por el fabricante del'las pautas de s.
      4. Realizar la precipitación de cloruro de litio por el protocolo del kit de transcripción. Resuspender el precipitado de RNA ende ~ 20 30 μL de libre de Rnasa H2O.
      5. Determinar la concentración del producto mediante el uso de un espectrofotómetro y registrar la calidad del RNA.
      6. Diluir el producto al300 ng/μl y alícuota ~ 100 en 5 muestras de 10 μL depara evitar la congelación y descongelación repetida. Almacenar a-80 °C hasta su uso.
        Nota: Es posible comprobar 12 μl de mRNA de Tol2 purificada para frotis/banda con electroforesis en gel.

5. microinyecciones

  1. Preparación de herramientas en general para las inyecciones
    Nota: Los procedimientos de esta sección se han descrito en detalle por Kowalko et al.46, y aquí se presenta un resumen con modificaciones menores.
    1. Generan las placas de inyección por colada caliente agarosa 3% disuelto en el agua del sistema de pescado en un plato de Petri de 100 mL. Coloque cuidadosamente un molde de inyección de huevo en la agarosa recién a hacer pozos para que los huevos de peces. Coloque el lado del molde en agar en un ángulo de 45° y, luego, baje lentamente en agarosa; bajar lentamente el molde en un ángulo evita aire queden atrapado debajo del molde. Retire con cuidado el molde una vez que la agarosa se solidifica. Las placas pueden almacenarse, sellado, a 4 °C hasta 1 semana.
    2. Tirar agujas de Capillares de vidrio de borosilicato para la inyección en un extractor de aguja electrodo según el fabricante'las pautas de s. Este protocolo puede variar por el tirador de la pipeta; sin embargo, puede encontrarse un programa tirando de la aguja de la muestra en la tabla 3.
      Nota: Optimización de la aguja es importante para las inyecciones, como agujas que son demasiado largas de la curva en lugar de penetrar limpiamente el huevo.
    3. Hacer pipetas de vidrio de gran diámetro para la transferencia de huevo rompiendo pipetas de cristal estándar para que la apertura es lo suficientemente grande como para que los huevos. Utilizando un mechero Bunsen, pulir el extremo roto del vidrio exponiendo al final de las pipetas rotas a la llama hasta que esté suave.
  2. Configuración de reproducción
    Nota: Hay muchos diferentes protocolos utilizados para la cría a. mexicanus. Para un protocolo detallado, vea Borowsky39. Iniciar la instalación de cría una semana antes de las inyecciones.
    1. El día 1, coloque dos o tres hembras y tres machos en un tanque de 10 galones solo mantenido a 24 ± 1 °C.
    2. En los días 17, aumentar la alimentación ~ 3 x un día. Asegúrese de que la dieta incluye alimento vivo, como gusanos negros y camarón de salmuera.
    3. El día 6, añadir un calentador de tanque solo a 27 °C. laboratorio temperaturas del tanque pueden variar; por lo tanto, se trata de un aumento de 23 °C relativa a la temperatura normal del tanque.
    4. En la tarde del día 7, que es la noche (zeitgeber [ZT] 911) de la noche de la inyección, completamente limpia los tanques con una esponja empapada en agua y quitar cualquier exceso de comida o suciedad mediante una red de malla fina o un sifón.
    5. En la noche del día 7, iniciar control de huevos de peces de superficie en ZT15 y continuar comprobar cada 1530 min hasta ZT18. Cavefish, Comience comprobando huevos en ZT17 y continuar comprobar cada 1530 min hasta ZT20.
      Nota: Los tiempos se basan en una 14:10 ciclo de h luz: oscuridad usando tiempo zeitgeber. Tiempos de cría son estimaciones y los laboratorios deben determinar tiempos exactos. Es fundamental para recoger los huevos poco después son liberados/fertilizados para inyectar en la etapa unicelular.
  3. Recolección de huevos etapa unicelular
    1. La noche en la que se espera que cría, examinar los tanques cada 1530 min y monitor para los huevos en la parte inferior del tanque. Huevos aparecen traslúcidos, miden aproximadamente 1 mm de diámetro.
    2. Utilice una red de los pescados de malla fina para recoger huevos y transferirlos a un recipiente de vidrio llenado de agua del sistema de pescado fresco. Examinar los óvulos bajo un microscopio para confirmar que los huevos se encuentran en una célula.
    3. Usando pipetas de vidrio, transferencia de huevos unicelulares a las placas de inyección. Pipetas de vidrio se requieren en esta etapa, los huevos se adhieren al plástico.
    4. Cuidadosamente con una pipeta, liberan los huevos en los pocillos de la placa de inyección de la agarosa de la sección 5.1. Llenar las filas de la placa de inyección precalentado (a temperatura ambiente) con el máximo número de huevos (3040 por fila y hasta cinco filas). Completas filas ayudan a evitar los huevos durante las inyecciones. Mantenga los huevos hidratados en la placa de inyección con una pequeña cantidad de agua del sistema del pescado hasta la ejecución de las inyecciones.
  4. Configuración de pico-inyección y pautas de optimización de la inyección general
    1. Rellene las agujas de inyección con cada pipeta de carga de gel tips que encajan dentro del tubo capilar o utilizando puntas de micropipeta estándar y añadir un bolo de 4 μL de2 hasta el final. Una vez que la aguja se llena, use pinzas para recortar el exceso de longitud de la aguja de inyección.
    2. Realizar microinyecciones con una aguja montada en un micromanipulador, conectado a un microinyector picolitros.
    3. Configurar el tiempo de inyección a 0.03 s y la presión hacia fuera en ~0.0 psi. La presión de inyección variará por consiguiente con diferencias menores entre las agujas, así que optimizar para lograr un bolo de inyección ~1.0 nL.
      Nota: La presión de inyección es a menudo en la gama del ~ 1030 psi.
    4. Estandarizar el bolo inyección inyectar en aceite mineral y el bolo de medición con un micrómetro de diapositivas para lograr una ~ 1del tamaño volumen de inyección de 1,5 nL. Ajuste la presión de inyección (psi) para aumentar o disminuir el volumen del bolo.
    5. Sacar el agua de la parte superior de los huevos utilizando un tejido de laboratorio.
      Nota: El corion del huevo de Astyanax es ligeramente más difícil de penetrar que huevos de pez cebra. Nos encontramos con que el agua de la parte superior de los huevos ayuda a facilita la penetración de la aguja en el huevo. Optimización de la placa puede permitir ~ 200 huevos en un plato único.
    6. Utilizar el instrumental quirúrgico y penetrar en cada huevo con la aguja, inyectar directamente en la yema de huevo. Una vez colocado en la yema de huevo, inyectar el huevo presionando el pedal de botón o inyección de inyectar.
      Nota: Un plato completo puede ser inyectado dentro de ~ 15 minutos. La etapa sola célula dura 40 min.
  5. Inyección de morfolinos
    Nota: La cantidad de morfolino necesario por caída sin causar toxicidad necesitará optimizarse por objetivo gene; sin embargo, una concentración de 400 pg es un buen lugar para empezar.
    1. Preparar morfolino 400 pg de morfolino se inyectará por huevo. Morfolino de deshielo en hielo. La solución de la inyección se compone de morfolino (en la concentración deseada), libre de ARNasa H2O o Danieau's solución y rojo de fenol (10% del volumen final). Por ejemplo, véase el cuadro 4.
    2. Inyectar 1 nL por embrión.
  6. Inyecciones de CRISPR
    1. Preparar RNA 25 pg de gRNA y 300 pg de Cas9 mRNA total serán inyectados por el embrión. Para una mezcla de inyección CRISPR/Cas9 de muestra, vea la tabla 5.
    2. Inyectar 2 nL de gRNA/Cas9 mRNA por embrión directamente en el embrión.
  7. Inyección de Tol2 transposasa y plásmido Tol2 flanqueado por transgénesis
    1. Descongele la transposasa mRNA y plásmido de Tol2 en hielo. Combinar Cas9 mRNA (a 25 ng/μL), construcción de Tol2 deseada (25 ng /μL) y rojo de fenol (10% del volumen final) en agua libre de ARNasa. Para una mezcla de inyección muestra Tol2 transgénesis, ver tabla 6.
    2. Mantener la solución de la inyección y agujas de hielo para evitar la degradación del mRNA. Inyectar 1 nL en volumen por embrión.

6. cría y selección de peces inyectados

  1. Cría de peces inyectados
    1. Después se inyectan los huevos, inmediatamente transferir al cuencos de cristal (10 x 5 cm) llenado de ~ 200 mL de agua del sistema de pescado. Huevos se lavan fácilmente sumergiendo las placas de inyección en cuencos llenado de agua y enjuagar los huevos con una pipeta de pescado.
    2. Coloque los ~ 5080 embriones inyectados por tazón de fuente y posterior a 24de 22 °C.
    3. Limpiar los tazones de fuente con peces inyectado 2 veces por día para eliminar embriones muertos y cambiar de ~ 20% del agua cada día.
    4. Adicionales de cría se realiza según protocolos previamente publicado39.
  2. Detección de individuos morfolino-inyectado
    1. Visualizar los animales bajo un estereomicroscopio para detectar fenotipos. El efecto de morfolinos puede persistir hasta a ~ 5 días ClLi21.
    2. Medida fenotipos conductuales en el postinjection de 4 días.
  3. Detección de CRISPR indels
    1. Diseño de cebadores para amplificar la DNA de genomic en el sitio de destino. Cartillas de diseño para que el producto PCR de destino es de aproximadamente 100125 bp.
      Nota: por ejemplo, para el locus oca2 , la región que rodea el sitio de destino de gRNA fue amplificada con el primer forward 5'-CTCCTCTGTCAGGCTGTGC-3' y el primer reverse 5'-GAAGGGGATGTTGTCTATGAGC-3' de una longitud de producto PCR de 105 bp.
    2. Sacrificar embriones o aleta peces adultos clip según el protocolo institucional de animales.
    3. Recoger embriones o disecadas aletas en los tubos de PCR y extraer ADN y realizar protocolos de PCR PCRs. muestra para cartillas gene-específicas se pueden encontrar en Ma et al35.
    4. Evaluar para mutagénesis, ejecutar 5 μl del producto de PCR en gel de agarosa al 3% a 70 V de 3 h. (nonmutagenized) DNA de tipo salvaje resultará en un producto de la PCR como una banda distinta. ADN mutado resultará en una banda de graso en el gel.
    5. Para determinar la secuencia de alelos del mutante, TA clonar el producto PCR según el fabricante's instrucciones, recoger las colonias y las culturas miniprep. Enviar el ADN resultante de la secuencia.
    6. Para establecer y mantener líneas de transmisión de alelos del mutante de peces, Cruz peces adultos inyectados para peces de tipo salvaje y pantalla 510 embriones para determinar si cualquiera de los descendientes llevan un alelo mutante del gen siguiendo pasos 6.3.1-6.3.6.
      Nota: Personas de diferentes F1 del mismo pescado de fundador F0 pueden llevar diversas mutaciones. Asegúrese de que las líneas mutantes son ordenadas para obtener mutaciones predichas para producir alelos que están fuera de marco.
    7. Identificar el pescado lleva un alelo del mutante por PCR usando el ensayo de banda graso (medidas 6.3.1-6.3.6) o mediante el diseño de primers PCR alelo-específica que amplificarán mutante y el salvaje-tipo bandas (figura 2).
    8. Una vez establecida una línea de peces, alelos del mutante de homozygose para detectar fenotipos recesivos.
  4. Detección de individuos transgénicos
    Nota: Utilizando construcciones que contienen un fabricante fluorescente se recomienda para agilizar la detección de individuos transgénicos. Sin embargo, puede usarse la PCR estándar métodos de cribado para detectar la transmisión.
    1. Visualizar tejido-específico proteínas fluorescentes en los pescados0 F tan pronto como el postinjection de 2 días, con un alcance de disección de epifluorescencia.
      Nota: La expresión en las larvas de F0 es mosaico, y personas positivas pueden tener un rango de fenotipos de expresión.
    2. Mantener a individuos como F0 peces fundador.
    3. Cuando F0s alcanzan la madurez, regresar fundador pescado a personas nontransgenic derivadas el mismo stock de población/lab. Pantalla F1 descendencia utilizando el mismo protocolo como se describe en el paso 6.2.
      Nota: La expresión en las larvas de F1 es uniforme y asegura la consistencia entre F1 .
    4. Puesto que Tol2 la integración no es mediada por el sitio y la integración puede variar entre los fundadores, seleccione F1 hermanos derivan de un solo fundador de0 F y cruzarse hermanos de1 de F expresando positivo para generar F2s. Esta descendencia será la base para una línea estable.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Varias poblaciones de cavernas a. mexicanus muestran reducción de sueño y vigilia/actividad creciente en relación con su superficie sus congéneres14. Hipocretina/orexin (HCRT) es un neuropéptido altamente conservado, que actúa para aumentar la vigilia, y aberraciones en el camino HCRT causan narcolepsia en seres humanos y otros mamíferos47,48. Previamente hemos demostrado que cueva a. mexicanus aumentaron la expresión del péptido HCRT, sugiriendo que un aumento de la expresión de este péptido puede ser la base la pérdida de sueño en cavefish38. La caída en el mes de hcrt expresión proporciona un enfoque de gran alcance para examinar directamente el efecto de la expresión de mayor hcrt mediar la pérdida de sueño en cavefish.

Para examinar la relación entre expresión de hcrt y el sueño, hemos diseñado un morfolino traducción de bloqueo. MO objetivos el primer 25 bp del exón, incluyendo el ATG iniciar sitio (figura 1A,B). Como control, se utilizó un control MO revuelto comercialmente disponible (figura 1B). Usando el algoritmo BLAST en NCBI, confirmamos que hay ningunos efectos off-target para cualquier MO por todo el genoma (datos no mostrados). Pescados superficiales a. mexicanus y cavefish Pachón fueron criados y sus huevos fueron recogidos y luego se inyecta con 400 pg de MO en un nL-1 volumen en el estadio de una célula (figura 1,D). Los peces fueron elevados a 4 PD y luego ha medido la actividad y el comportamiento del sueño.

Cueva a. mexicanus inyectado con el control MO exhibió actividad significativamente más locomotor y reduce el sueño durante un período de 24 horas en comparación con peces de superficie también inyectada el revuelto MO (Figura 1E,F), lo que sugiere ningún efecto de la morfolino inyecciones de control como los resultados son consistentes con los patrones de actividad y sueño publicados previamente en cada morfotipo (t = 5.021, df = 88, p < 0.0001). La inyección de la HCRT-MO tenía poco efecto sobre el sueño en superficie pescado comparado con peces inyectados de control (t = 0.17, df = 88, p > 0,99). En cambio, caída de hcrt inyectable MO tuvo un efecto significativo sobre el sueño en peces cavernícolas. Larvas de cavefish Pachón demostraron menos que una reducción de cuatro veces en actividad locomotriz y dormir casi dos veces más que el control de larvas de Pachón (Figura 1E,F; t = 2.694, df = 88, p < 0.05). Una comparación de la actividad locomotriz y sueño en los peces de superficie y cavernas de MO-caída reveló cantidades comparables de locomoción y sueño (Figura 1E, F). Estos datos proporcionan un vínculo directo entre la expresión de hcrt y pérdida de sueño y proporcionan un método para interrogar los mecanismos biológicos para la pérdida de sueño en los morfos evolutivamente derivados de cavernícolas.

Pérdida de pigmentación es una característica de los organismos de la cueva, y varias cavernas Astyanax poblaciones demuestran pérdida de la pigmentación. Albinismo en Molino y Pachón cavefish se ha trazado con mapeo de QTL para una región genómica que contiene el gen, albinismo ocular 2 (oca2), sugiriendo que subyacen a las mutaciones en oca2 albinismo en cavefish6.

Para validar el oca2 como el locus causal para albinismo en Pachón cueva morfos, utilizamos CRISPR/Cas9 gene edición para mutar esta región en las poblaciones de peces de superficie. Puesto que el exón 21 se elimina en el Molino de pescado6, hemos diseñado un gRNA a esta región del gen (figura 2A). La secuencia genómica, incluyendo la secuencia de destino gRNA y PAM (en negrita), es GGTCATGTGGGTCTCAGCTT de 5'-TGG-3 '. Esta secuencia de destino (sin la secuencia de PAM) se utilizó para generar una gRNA para mutagénesis dirigida. Superficie criadores hicieron para aparearse, y los embriones resultantes se obtuvieron en la etapa de una célula. Embriones en estadío de una célula se inyectaron con Cas9 mRNA y dirigidos a la gRNA oca2, y los animales inyectados fueron levantados a la edad adulta43. Los adultos inyectados fueron hechos para aparearse a peces de superficie tipo salvaje, y los embriones de estas cruzas fueron genotipados para determinar transmisión de línea germinal, usando las cartillas de paso 6.3.1. Secuencia de un alelo mutante oca2 e identificó una canceladura de bp 2 germen de línea de transmisión en el oca2 (figura 2B,C). Para facilidad de genotipado, diseñamos cebadores alelo-específica para identificar los alelos de tipo salvaje y mutantes (Figura 2D) y los peces genotipo, utilizando PCR seguida de electroforesis en gel (Figura 2E). Nos incrossed superficie peces heterocigotos para este alelo mutado del oca2. La progenie resultante fueron pigmentada o albino (figura 2F-). Individuos pigmentados fueron tipo salvaje o heterozigótica en el locus oca2, mientras que los individuos albinos fueron mutante homocigótico (Figura 2E). Estos datos proporcionan un vínculo directo entre el lugar geométrico del gene oca2 y albinismo en a. mexicanus cavefish.

Innumerables conductas tales como el sueño, la alimentación y el estrés difieren en a. mexicanus cavefish en relación con sus congéneres superficiales, sin embargo, los determinantes neuronales subyacentes entre morfos permanecen confusos. Proyección de imagen de calcio de todo el cerebro ofrece un poderoso enfoque imparcial para examinar las correlaciones entre la actividad neuronal alterada y la conducta modificada. Hemos generado peces de superficie y cavefish con una expresión neuronal ubicua cerca del indicador de calcio genéticamente codificada, GCaMP6s, reactivos utilizados en la investigación del pez cebra. ELAV-como proteína de unión a RNA de enolase 3 (elavl3) se expresa endógenamente en las neuronas recién diferenciadas a lo largo del sistema nervioso central49 y se ha utilizado en el pez cebra para impulsar la expresión de proteínas a lo largo de la mayoría de los50años del sistema nervioso. Obtuvimos una construcción de Tol2 con ~2.8 kb pez cebra elavl3 promotor transcripción aguas arriba del indicador de calcio genéticamente codificados GCaMP6s (una fusión de proteína fluorescente verde [GFP], calmodulina y M13, una secuencia del péptido de miosina quinasa de cadena ligera), flanqueada en los extremos 5' y 3' con sitios de Tol2 (Tol2 -elavl3:GCaMP6s-Tol2)51.

Pescados superficiales a. mexicanus y Molino cavefish fueron criados, y los embriones resultantes eran coinyectados en la etapa unicelular con 25 ng/μL de Tol2 -elavl3:GCaMP6s-Tol2 construcción y 25 ng/μL Tol2 transposasa mRNA (Figura 3A). En 24 – 48 PD, las larvas fueron defendidas para una expresión neuronal transitoria de GCaMP6s. Esos embriones (F0) inyectados con una expresión de GCaMP6s fueron planteados a la edad adulta y retrocruzas con salvaje-tipo adultos derivados del mismo linaje de peces de superficie o cavefish. Los adultos resultantes de F1 fueron defendidos por una expresión estable de expresión GCaMP6s, y ésos larvas fueron mantenidas a generar líneas estables (figura 3B,C). Porque cada adulto de F1 con una expresión estable probablemente ha integrado Tol2 -elavl3: GCaMP6s-Tol2 en diferentes sitios genómicos, cada F1 se señala un alelo diferente. Usando este acercamiento, hemos generado F1s estable para pesca superficial y Molino cavefish poblaciones (figura 3B,C), calcio vivo permitiendo así la proyección de imagen para descubrir las diferencias en la actividad neuronal mediar cambios de comportamiento en la cueva medio ambiente (figura 3 C,D). Además, este enfoque sienta las bases para la expresión de los transgenes adicionales muchos para caracterizar y manipular las funciones de los genes en a. mexicanus.

Figure 1
Figura 1: Caída de morfolino de Hcrt reduce la actividad y aumenta el sueño en cavefish. (A) bloqueo de traducción morfolino objetivos el primer 25 bp de Hcrt codificación secuencia, incluyendo el sitio de inicio ATG. (B) Hcrt morfolino oligo (MO) y secuencias de control. (C) alineación de ~ 200 unicelular huevos en moldes de huevo de agarosa para la inyección. (D) microinyección de 1.0 nL de mezcla de inyección con el indicador rojo de fenol para la visualización. La barra de escala = 0.5 mm. (E) caída de morfolino de Hcrt reduce la actividad (distancia total recorrida) de cavefish Pachón (t = 5.021, df = 88, p < 0.0001) pero no de los peces de superficie (t = 1.318, df = 88, p > 0,72). Caída (F) aumenta el sueño en cavefish Pachón (t = 2.694, df = 88, p < 0.05) pero no tiene efecto sobre los peces de superficie (t = 0.17, df = 88, p > 0,99). La barra de escala = 1 mm. Las barras de error en los paneles de E y F denotan el error estándar de la media. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2: CRISPR gene-edición de oca2 presenta albinismo en superficie a. mexicanus. (A) esquema de los oca2 codificación regiones y RNA de la guía (gRNA) dirigidos a exón 21 para la edición de genes mediada por CRISPR. (B) cromatograma de tipo salvaje Oca2 + ) y (C) Oca2 - alelos del mutante de secuenciación. El cuadro rojo en el panel B indica la secuencia 2 de bp, que falta en el Oca2 - alelo mutado en panel C. (D) objetivo CRISPR introduce una canceladura de bp 2, alterar la función Oca2 . Imprimaciones están diseñados para la evaluación genotípica de 2 eliminación de bp en la descendencia de F0. (E) PCR y gel electroforesis de Oca2 en peces de superficie de tipo salvaje (banda tamaño = 134 bp) o inyección de F0 CRISPR (banda tamaño = 133 bp). Individuos homocigóticos o heterozigóticos para la variante de tipo salvaje de Oca2 (Oca2 +) son pigmentados, mientras F0s homocigótico para la canceladura de 2 puntos de ebullición (Oca2 -) albinismo del puerto. (F) imágenes de cuerpo entero del tipo salvaje pescado y (G) la superficie de superficie peces con albinismo CRISPR-mediada. La barra de escala = 5 mm. (H e I) Vista ampliada de las cabezas de los individuos representados en los paneles de F y G, respectivamente. La barra de escala = 2 mm. haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3: transgénesis Tol2 de GCAMP6s pan-neuronal permite la proyección de imagen viva de la actividad cerebral en a. mexicanus. (A) transgénesis mediada de Tol2 en a. mexicanus. Co-inyección de Tol2 mRNA y Tol2 -elav3l: GCAMP6s-Tol2 plásmido integra GCAMP6s transgen en fundadores de F0. Retrocruzamiento a la población original de tipo salvaje peces produce a individuos F1 con una expresión de cacerola-neuronal estable de GCAMP6s. (B y C) las crías resultantes son evaluadas para una expresión estable mediante disección y microscopía confocal. Estable TgAsty(elav3l: GCaMP6s) individuos de la F1 se han establecido para superficie (aparece en el panel B) y cavernas morfotipos (aparece en el panel C). La barra de escala = 200 μm.  Haga clic aquí para ver una versión más grande de esta figura.

Reactivo de Volumen o cantidad
10,0 μg de ADN del plásmido de PC-zT2TP X μl
NEB CutSmart Buffer 10.0 μl
Enzima NotI-HF 2.0 μl
Libre de nucleasas H2O X μl
BSA 1,0 μl
Total 100 μl

Tabla 1: Resumen de restricción de plásmido de Tol2.

Reactivo de Volumen o cantidad
1,0 μg de ADN del plásmido de PC-zT2TP en lineal X μl
10 x buffer de reacción 2.0 μl
2 x casquillo de NTP 10.0 μl
Mezcla de enzima SP6 2.0 μl
Libres de Rnasa H2O X μl
Total ≤20 μl

Cuadro 2: síntesis In vitro de Tol2 mRNA.

Nombre de la configuración Valor de ajuste
Calor 510
tirar 55
Velocidad 100
hora 40
Presión 500
Rampa de 534

Tabla 3: Muestra protocolo tirando de pipeta. 

Reactivo de Volumen o cantidad
Morfolino (acción congelador @ 4 m m) 1,0 μl
Libre de nucleasas H2O o solución de Danieau 17.0 μl
Rojo de fenol 2.0 μl
Total 20 μl

Tabla 4: Morfolino mezcla de inyección.

Reactivo de Volumen de la cantidad
gRNA (concentración final de trabajo @ 100ng/μl) 1 μl
Cas9 mRNA (concentración final de trabajo @ 1200ng/μl) 1 μl
Libres de Rnasa H2O 2 μl
Total 4 μl

Tabla 5: Muestra CRISPR/Cas9 mezcla de inyección.

Reactivo de Volumen de la cantidad
Plásmido de Tol2 (concentración final de trabajo @ 25ng/μl) X μl
MRNA de Tol2 (concentración final de trabajo @ 25ng/μl) X μl
Rojo de fenol 1,0 μl
Libres de Rnasa H2O X μl
Total 15 μl

Tabla 6: Muestra de Tol2 transgénesis mezcla de inyección

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Aquí, nos proporciona una metodología para manipular funciones de los genes usando morfolinos, gene CRISPR/Cas9 edición y metodología de la transgénesis. La riqueza de la tecnología genética y la optimización de estos sistemas en el pez cebra es probable que permitirá la transferencia de estas herramientas en a. mexicanus con facilidad52. Hallazgos recientes han utilizado estos métodos en a. mexicanus, pero siguen siendo subutilizados en la investigación de diversos rasgos morfológicos, conductuales y de desarrollo en este sistema de36,30,42 , 53.

Morfolinos han sido ampliamente utilizados en la investigación del pez cebra a caída en la expresión de genes. El enfoque es simplista y resulta en una caída fuerte de la expresión. Sin embargo, los efectos off-target han sido ampliamente documentados22,53; así, en que morfolinos han inyectado a los animales deben ser supervisados cuidadosamente para cualquier fenotipos inesperados22,55. Cuando sea posible, resultados obtenidos desde el knockdown morfolino deben validarse mediante el uso de otros métodos, como los enfoques de nocaut CRISPR/Cas9-mediada. Mientras morfolinos permite que la caída fuerte de la expresión génica, caída de morfolino-mediada es transitorio. Así, análisis de fenotipos adultos no es posible cuando se utiliza este método.

CRISPR/Cas9-mediada mutagénesis ofrece la manipulación directa de genes específicos. Además, a diferencia de la caída de morfolino-mediada, mutagénesis CRISPR/Cas9 permite el análisis de los fenotipos mutantes en la edad adulta. Para evitar efectos off-target de CRISPR/Cas9, líneas mutantes deben ser cruzadas varias generaciones, y siempre que sea posible, más de un alelo debe obtener y comprobado. El sistema CRISPR/Cas9 también proporciona el potencial para la utilización de enfoques gene-edición a golpear-en alelos o para producir cambios genéticos específicos. El sistema CRISPR/Cas9 se ha utilizado en el pez cebra para producir integraciones precisa de ADN exógeno y generar mutaciones de punto exacto19,20,56,57,58, 59. con la secuenciación del genoma cavefish, ahora es posible identificar polimorfismos de nucleótido único (SNPs) u otros cambios genéticos sutiles entre peces de superficie y de las poblaciones de cavefish33. La aplicación de edición de CRISPR/Cas9 gene proporciona la oportunidad para el intercambio de alelos entre cavefish y peces de superficie, o entre las diferentes poblaciones de cavefish, para examinar el papel de estos cambios genéticos en los diferentes procesos del desarrollo.

Los enfoques de transgénesis descritos en este protocolo proporcionan un método sencillo y potente para los estudios de ganancia de función y para la generación de herramientas para modificar procesos biológicos genéticamente. El sistema de Tol2 es ampliamente utilizado en la investigación de pez cebra, y hemos demostrado que es igualmente poderoso en a. mexicanus. Por otra parte, hemos demostrado una construcción transgénica generada en el pez cebra que utiliza un promotor de pez cebra y recapitula la expresión endógena en a. mexicanus. Hemos encontrado que cuatro otros promotores aislaron de pez cebra expresión de tejido-específica de unidad como era de esperar en a. mexicanus (datos no mostrados). Desde promotores de pez cebra recapitulan sus patrones de expresión conservada en a. mexicanus, esto sugiere que muchas de las herramientas genéticas pueden transferirse directamente del pez cebra a . mexicanus sin necesidad de modificación con A. mexicanus promotores. Por otra parte, con el avance en tecnologías de secuenciación en el33de a. mexicanus, los enfoques transgénicos aquí descritos permitirán un futuro de gran alcance para la investigación de reforzadores y promotores que pueden desempeñar un papel en la variación entre formas de superficie y de la cueva. Por último, las herramientas potentes para la manipulación genética de los procesos biológicos que han hecho valiosas de pez cebra son igualmente importantes en mexicanus a.60,61,62,63. Diferencias en diversos rasgos de comportamiento, tales como sueño, alimentación, estrés y agresividad, entre formas de superficie y cavernas a. mexicanus han sido ampliamente documentados12,14,15 ,38,64, sin embargo, el subyacente correlatos neuronales no están bien entendidas. Herramientas como Tg(elavl3:GCaMP6s) permite una disección de cómo las diferencias en la actividad neuronal todo el cerebro se correlacionan con diferencias en el comportamiento y ofrecen una visión única de cómo el cerebro ha ser modificado evolutivamente.

Tomados en conjunto, a. mexicanus está preparada para convertirse en un líder modelo para investigar la evolución de una variedad de caracteres morfológicos y conductuales. Las diversas diferencias en procesos biológicos complejos en a. mexicanus proporcionan una plataforma para la investigación de los mecanismos genéticos de la evolución del rasgo. La aplicación de herramientas para manipular funciones de los genes puede ayudar a desarrollar este organismo en un modelo que puede aplicarse para investigar enfermedades biológicas relacionadas con la degeneración del ojo, anomalías del desarrollo neurológico e insomnio.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

Los autores agradecen Sunishka Thakur de su asistencia en la genotipificación y el pez mutante de oca2 , representado en la figura 2la proyección de imagen. Este trabajo fue financiado por National Science Foundation (NSF) 1656574 a A.C.K., Premio NSF 1754321 J.K. y A.C.K. e institutos nacionales de salud (NIH) Premio R21NS105071 a A.C.K. y E.R.D.

Materials

Name Company Catalog Number Comments
Fish breeding & egg supplies
Fine mesh fish net Penn Plax BN4
Fish tank heater Aqueon 100106108
Egg traps Custom made NA Design and create plastic grate to place at bottom of tank to protect eggs
Glass pipettes Fisher Scientific 13-678-20C
Pipette bulbs Fisher Scientific 03-448-21
Agarose Fisher Scientific BP160-500
Egg molds Adaptive Science Tools TU-1
Morpholino supplies
Control Morpholino Gene Tools, LLC Standard control olio
Custom Morpholino Gene Tools, LLC NA
Phenol Red Sigma Aldrich P0290-100ML
CRISPR supplies
Cas9 Plasmid AddGene 46757
GoTaq DNA Polymerase Promega M3001
KOD Hot Start Taq EMD Millipore 71-842-3
Primers Integrated DNA Technologies Custom
T7 Megascript Kit Ambion/Thermofisher AM1333
miRNeasy Kit Qiagen 217004
mMessage mMachine T3 kit Ambion/Thermofisher AM1348
MinElute Kit Qiagen 28204
Tol2 transgenesis supplies
pCS-zT2TP plasmid Kawakami et al., 2004 Request from senior author
CutSmart Buffer New England Biolabs B7204
NotI-HF Restriction Enzyme New England Biolabs R3189
PCR purification Kit Qiagen 28104
SP6 mMessenger Kit Ambion/Thermofisher AM1340
Microinjection supplies
Glass Capillary Tubes Sutter Instruments BF100-58-10
Pipette puller Sutter Instruments P-97
Picoinjector Warner Instruments PLI-100A
Micromanipulator World Precision Instruments M3301R
Micromanipulator Stand World Precision Instruments M10
Micmanipulator Base World Precision Instruments Steel Plate Base, 10 lbs

DOWNLOAD MATERIALS LIST

References

  1. Darwin, C. On the Origin of Species by Means of Natural Selection. D. Appleton and Company. (1859).
  2. Culver, D. C., Pipan, T. The Biology of Caves and Other Subterranean Habitats. Oxford University Press. New York, NY. (2009).
  3. Mitchell, R. W., Russell, W. H., Elliott, W. R. Mexican Eyeless Characin Fishes, Genus Astyanax: Environment, Distribution, and Evolution. (1977).
  4. Huppop, K. Oxygen consumption of Astyanax fasciatus (Characidae, Pisces): A comparison of epigean and hypogean populations. Environmental Biology of Fishes. 17, 299-308 (1986).
  5. Moran, D., Softley, R., Warrant, E. J. Eyeless Mexican Cavefish Save Energy by Eliminating the Circadian Rhythm in Metabolism. PLoS ONE. 9, (9), e107877 (2014).
  6. Protas, M. E., et al. Genetic analysis of cavefish reveals molecular convergence in the evolution of albinism. Nature genetics. 38, 107-111 (2006).
  7. Wall, A., Volkoff, H. Effects of fasting and feeding on the brain mRNA expressions of orexin tyrosine hydroxylase (TH), PYY and CCK in the Mexican blind cavefish (Astyanax fasciatus mexicanus). General and Comparative Endocrinology. 183, 44-52 (2013).
  8. Aspiras, A., Rohner, N., Marineau, B., Borowsky, R., Tabin, J. Melanocortin 4 receptor mutations contribute to the adaptation of cavefish to nutrient-poor conditions. Proceedings of the National Academy of Sciences. 112, (31), 9668-9673 (2015).
  9. Yoshizawa, M., Gorički, Š, Soares, D., Jeffery, W. R. Evolution of a behavioral shift mediated by superficial neuromasts helps cavefish find food in darkness. Current Biology. 20, (18), 1631-1636 (2010).
  10. Jeffery, W. R. Regressive Evolution in Astyanax Cavefish. Annual Review of Genetics. 43, 25-47 (2009).
  11. Gross, J. B. The complex origin of Astyanax cavefish. BMC Evolutionary Biology. 12, 105 (2012).
  12. Elipot, Y., Hinaux, H., Callebert, J., Rétaux, S. Evolutionary shift from fighting to foraging in blind cavefish through changes in the serotonin network. Current Biology. 23, (1), 1-10 (2013).
  13. Kowalko, J. E. J., et al. Loss of schooling behavior in cavefish through sight-dependent and sight-independent mechanisms. Current Biology. 23, (19), 1874-1883 (2013).
  14. Duboué, E. R. E. R., Keene, A. C. A. C., Borowsky, R. L. R. L. Evolutionary convergence on sleep loss in cavefish populations. Current Biology. 21, (8), 671-676 (2011).
  15. Chin, J. S., et al. Convergence on reduced stress behavior in the Mexican blind cavefish. Developmental Biology. (2018).
  16. Scheer, N., Campos-Ortega, J. A. Use of the Gal4-UAS technique for targeted gene expression in the zebrafish. Mechanisms of Development. 80, (2), 153-158 (1999).
  17. Kawakami, K., Shima, A., Kawakami, N. Identification of a functional transposase of the Tol2 element, an Ac-like element from the Japanese medaka fish, and its transposition in the zebrafish germ lineage. Proceedings of the National Academy of Sciences. 97, (21), 11403-11408 (2000).
  18. Balciunas, D., et al. Enhancer trapping in zebrafish using the Sleeping Beauty transposon. BMC Genomics. (2004).
  19. Auer, T. O., Duroure, K., De Cian, A., Concordet, J. P., Del Bene, F. Highly efficient CRISPR/Cas9-mediated knock-in in zebrafish by homology-independent DNA repair. Genome Research. 24, (1), 142-153 (2014).
  20. Kimura, Y., Hisano, Y., Kawahara, A., Higashijima, S. I. Efficient generation of knock-in transgenic zebrafish carrying reporter/driver genes by CRISPR/Cas9-mediated genome engineering. Scientific Reports. 4, (2014).
  21. Bill, B. R., Petzold, A. M., Clark, K. J., Schimmenti, L. A., Ekker, S. C. A Primer for Morpholino Use in Zebrafish. Zebrafish. 6, (1), 69-77 (2009).
  22. Nasevicius, A., Ekker, S. C. Effective targeted gene “knockdown” in zebrafish. Nature Genetics. (2000).
  23. Sander, J. D., et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. Nature Biotechnology. (2011).
  24. Huang, P., et al. Heritable gene targeting in zebrafish using customized TALENs. Nature Biotechnology. (2011).
  25. Kawakami, K. Transposon tools and methods in zebrafish. Developmental Dynamics. 234, (2), 244-254 (2005).
  26. Urasaki, A., Morvan, G., Kawakami, K. Functional dissection of the Tol2 transposable element identified the minimal cis-sequence and a highly repetitive sequence in the subterminal region essential for transposition. Genetics. 174, (2), 639-649 (2006).
  27. Juntti, S. A., Hu, C. K., Fernald, R. D. Tol2-Mediated Generation of a Transgenic Haplochromine Cichlid, Astatotilapia burtoni. PLoS ONE. 8, (10), (2013).
  28. Harel, I., Valenzano, D. R., Brunet, A. Efficient genome engineering approaches for the short-lived African turquoise killifish. Nature Protocols. 11, (10), 2010-2028 (2016).
  29. Erickson, P. A., Ellis, N. A., Miller, C. T. Microinjection for Transgenesis and Genome Editing in Threespine Sticklebacks. Journal of Visualized Experiments. (111), e54055 (2016).
  30. Elipot, Y., Legendre, L., Père, S., Sohm, F., Rétaux, S. Astyanax transgenesis and husbandry: how cavefish enters the laboratory. Zebrafish. 11, (4), 291-299 (2014).
  31. Keene, A., Yoshizawa, M., McGaugh, S. Biology and Evolution of the Mexican Cavefish. Academic Press. New York, NY. (2015).
  32. Casane, D., Rétaux, S. Evolutionary Genetics of the Cavefish Astyanax mexicanus. Advances in Genetics. 95, 117-159 (2016).
  33. Mcgaugh, S., et al. The cavefish genome reveals candidate genes for eye loss. Nature Communications. 5, 5307 (2014).
  34. Yoshizawa, M., et al. Distinct genetic architecture underlies the emergence of sleep loss and prey-seeking behavior in the Mexican cavefish. BMC Biology. 13, (1), (2015).
  35. Ma, L., Jeffery, W. R., Essner, J. J., Kowalko, J. E. Genome editing using TALENs in blind Mexican cavefish, Astyanax mexicanus. PLoS ONE. 10, (3), (2015).
  36. Bilandzija, H., Ma, L., Parkhurst, A., Jeffery, W. A potential benefit of albinism in Astyanax cavefish: downregulation of the oca2 gene increases tyrosine and catecholamine levels as an alternative to melanin synthesis. PLoS ONE. 8, (11), e80823 (2013).
  37. Alie, A., et al. Developmental evolution of the forebrain in cavefish: from natural variations in neuropeptides to behavior. eLife. 7, e32808 (2018).
  38. Jaggard, J. B., et al. Hypocretin underlies the evolution of sleep loss in the Mexican cavefish. eLife. 7, e32637 (2018).
  39. Borowsky, R. Handling Astyanax mexicanus eggs and fry. Cold Spring Harbor Protocols. 3, (11), (2008).
  40. Varshney, G. K., Sood, R., Burgess, S. M. Understanding and Editing the Zebrafish Genome. Advances in Genetics. 92, 1-52 (2015).
  41. Wierson, W. A., et al. GeneWeld: a method for efficient targeted integration directed by short homology. BioRxiv. (2018).
  42. Klaassen, H., Wang, Y., Adamski, K., Rohner, N., Kowalko, J. E. CRISPR mutagenesis confirms the role of oca2 in melanin pigmentation in Astyanax mexicanus. Developmental Biology. (2018).
  43. Jao, L. E., Wente, S. R., Chen, W. Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proceedings of the National Academy of Sciences of the United States of America. 110, (34), 13904-13909 (2013).
  44. Kwan, K. M., et al. The Tol2kit: A multisite gateway-based construction Kit for Tol2 transposon transgenesis constructs. Developmental Dynamics. 236, (11), 3088-3099 (2007).
  45. Kawakami, K., et al. A transposon-mediated gene trap approach identifies developmentally regulated genes in zebrafish. Developmental Cell. 7, (1), 133-144 (2004).
  46. Kowalko, J., Ma, L., Jeffery, W. Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases (TALENs). Journal of Visualized Experiments. (112), e54113 (2016).
  47. Nishino, S., Ripley, B., Overeem, S., Lammers, G. J., Mignot, E. Hypocretin (orexin) deficiency in human narcolepsy. Lancet. (2000).
  48. Lin, L., et al. The sleep disorder canine narcolepsy is caused by a mutation in the hypocretin (orexin) receptor 2. Cell. (1999).
  49. Park, H. C., et al. Analysis of upstream elements in the HuC promoter leads to the establishment of transgenic Zebrafish with fluorescent neurons. Developmental Biology. 227, (2), 279-293 (2000).
  50. Higashijima, S., Masino, M. A., Mandel, G., Fetcho, J. R. Imaging Neuronal Activity During Zebrafish Behavior With a Genetically Encoded Calcium Indicator. Journal of Neurophysiology. (2003).
  51. Vladimirov, N., et al. Light-sheet functional imaging in fictively behaving zebrafish. Nature Methods. 11, (9), 883-884 (2014).
  52. Halpern, M. E., et al. Gal4/UAS transgenic tools and their application to zebrafish. Zebrafish. 5, (2), 97-110 (2008).
  53. Jaggard, J. B., Stahl, B. A., Lloyd, E., Prober, D. A., Duboue, E. R., Keene, A. C. Hypocretin underlies the evolution of sleep loss in the Mexican cavefish. bioRxiv. 7, e32637 (2018).
  54. Bedell, V. M., Westcot, S. E., Ekker, S. C. Lessons from morpholino-based screening in zebrafish. Briefings in Functional Genomics. (2011).
  55. Robu, M. E., et al. p53 activation by knockdown technologies. PLoS Genetics. (2007).
  56. Hisano, Y., et al. Precise in-frame integration of exogenous DNA mediated by CRISPR/Cas9 system in zebrafish. Scientific reports. 5, 8841 (2015).
  57. Prykhozhij, S., et al. Optimized knock-in of point mutations in zebrafish using CRISPR/Cas9. Nucleic Acids Res. 46, (17), (2018).
  58. Tessadori, F., et al. Effective CRISPR/Cas9-based nucleotide editing in zebrafish to model human genetic cardiovascular disorders. Disease Model Mechanisms. 11, (10), (2018).
  59. Armstrong, G., Liao, M., You, Z., Lissouba, A., Chen, B., Drapeau, P. Homology Directed Knockin of Point Mutations in the Zebrafish tardbp and fus Genes in ALS Using the CRISPR/Cas9 System. PLoS ONE. 11, (3), (2016).
  60. Friedrich, R. W., Jacobson, G. A., Zhu, P. Circuit Neuroscience in Zebrafish. Current Biology. 20, (8), (2010).
  61. Friedrich, R. W., Genoud, C., Wanner, A. A. Analyzing the structure and function of neuronal circuits in zebrafish. Frontiers in Neural Circuits. 7, (2013).
  62. Scott, E. K., et al. Targeting neural circuitry in zebrafish using GAL4 enhancer trapping. Nature Methods. 4, (4), 323-326 (2007).
  63. Asakawa, K., Kawakami, K. Targeted gene expression by the Gal4-UAS system in zebrafish. Development Growth and Differentiation. (2008).
  64. Lloyd, E., et al. Evolutionary shift towards lateral line dependent prey capture behavior in the blind Mexican cavefish. Developmental Biology. (2018).
Manipulación de la función del Gene en mexicano Cavefish
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Stahl, B. A., Jaggard, J. B., Chin, J. S. R., Kowalko, J. E., Keene, A. C., Duboué, E. R. Manipulation of Gene Function in Mexican Cavefish. J. Vis. Exp. (146), e59093, doi:10.3791/59093 (2019).More

Stahl, B. A., Jaggard, J. B., Chin, J. S. R., Kowalko, J. E., Keene, A. C., Duboué, E. R. Manipulation of Gene Function in Mexican Cavefish. J. Vis. Exp. (146), e59093, doi:10.3791/59093 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter