Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Manipulation de la fonction du gène en mexicain Agassizii

Published: April 22, 2019 doi: 10.3791/59093

Summary

Les auteurs décrivent les approches pour la manipulation des gènes dans le système de modèle évolutionniste Astyanax mexicanus. Trois techniques différentes sont décrites : Tol2 médiée par transgénèse, manipulation ciblée du génome à l’aide de CRISPR/Cas9 et précipitation d’expression utilisant les morpholinos. Ces outils devraient faciliter l’enquête directe des gènes qui sous-tendent la variation entre les formes de surface - et cavernicoles.

Abstract

Animaux de la grotte d’un système convaincant pour étudier les mécanismes évolutifs et bases génétiques des changements dans nombreux traits complexes, y compris la dégénérescence de l’oeil, l’albinisme, perte de sommeil, une hyperphagie et traitement sensoriel. Espèce d’agassizii de partout dans le monde affiche une évolution convergente des caractéristiques morphologiques et comportementales en raison des pressions environnementales partagées entre systèmes de grottes différentes. Grotte de diverses espèces ont été étudiés en laboratoire. Le tétra aveugle, Astyanax mexicanus, avec des formes voyants et aveugles, a fourni un aperçu unique des processus biologiques et moléculaires qui sous-tendent l’évolution des caractères complexes et est bien placée comme un système modèle émergent. Alors que les gènes candidats régissant l’évolution des divers processus biologiques ont été identifiés chez a. mexicanus, la capacité de valider un rôle des gènes individuels a été limitée. L’application de transgenèse et de la technologie de modification génétique a le potentiel pour surmonter cet obstacle significatif et d’étudier les mécanismes qui sous-tendent l’évolution des traits complexes. Nous décrivons ici une méthode différente pour manipuler l’expression des gènes chez a. mexicanus. Approches incluent l’utilisation de morpholinos, Tol2 transgénèse, et systèmes d’édition de gène, couramment utilisés en poisson-zèbre et autres poissons des modèles, pour manipuler la fonction du gène chez a. mexicanus. Ces protocoles incluent des descriptions détaillées des procédures de reproduction temporisée, la collecte des ovocytes fécondés, des injections et la sélection des animaux génétiquement modifiés. Permettront à ces approches méthodologiques pour l’étude des mécanismes génétiques et neuronales qui sous-tendent l’évolution des divers traits chez a. mexicanus.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Depuis l' Origine des espècesde Darwin1scientifiques ont gagné profonde mieux comprendre comment des traits sont en forme évolutives en réponse à des pressions environnementales et écologiques définies, grâce à la grotte organismes2. Le tétra aveugle, a. mexicanus, se compose d’eyed populations « surfaces » ancestrales qui peuplent les rivières dans tout le Mexique et le sud du Texas et d’au moins 29 populations géographiquement isolées des formes dérivées de la grotte qui habitent la Sierra del Abra et d’autres régions du Nord-est du Mexique3. Un certain nombre de traits associés à la grotte ont été identifié chez a. mexicanus, y compris la consommation d’oxygène altérée, dépigmentation, perte des yeux et changé d’alimentation et d’alimentation comportement4,5,6, 7,8,9. A. mexicanus présente un modèle puissant pour étudier les mécanismes de l’évolution convergente en raison de la présence d’une histoire évolutive bien définie et une caractérisation détaillée de l’environnement écologique indépendamment évolué grotte les populations de10,11. Bon nombre des traits dérivés de grotte qui sont présents dans spelaea, y compris la perte de l’oeil, perte de sommeil, a augmenté l’alimentation, perte de la scolarité, réduit l’agression et réduit les réactions au stress, ont évolué plusieurs fois à travers les origines indépendantes, souvent en utilisant différentes voies génétiques entre grottes8,12,13,14,15. Cette scène reproduit evolution est un aspect puissant du système a. mexicanus et peut fournir la perspicacité dans la question plus générale des systèmes comment génétiques peut être perturbée pour produire des phénotypes semblables.

Alors que l’application de la technologie génétique pour l’étude mécanistique de la fonction du gène a été limitée dans de nombreuses espèces de poissons (y compris a. mexicanus), les progrès récents dans le poisson-zèbre fournissent une base pour le développement de la technologie génétique chez les poissons 16,17,18,19,20. Nombreux outils sont largement utilisés chez le poisson zèbre pour manipuler l’expression des gènes, et la mise en œuvre de ces procédures ont longtemps été normalisés. Par exemple, l’injection de morpholino oligos (MOs) au stade unicellulaire sélectivement bloque RNA et empêche la traduction pour une brève fenêtre temporelle pendant développement21,22. En outre, édition de gène approches, telles que groupés régulièrement entrecoupées courtes répétitions palindromiques (CRISPR) / CRISPR-associated protein 9 (Cas9) et nucléase effecteur comme activateur de transcription (TALEN), permettent la génération de destructions définies ou, dans certains cas, insertions par une recombinaison dans les génomes19,20,23,24. Transgénèse est utilisé pour manipuler l’expression génétique stable ou la fonction d’une manière spécifique de type cellulaire. Le système Tol2 est utilisé efficacement pour produire des animaux transgéniques par coinjecting transposase ARNm avec un plasmide d’ADN Tol2 contenant un transgène25,26. Le système Tol2 utilise la transposase Tol2 des médakas pour générer des insertions de germline stable de construct17 transgénique. Génération Tol2 transgénèse consiste à coinjecting un plasmide contenant un transgène flanqué d’ARNm et des sites d’intégration Tol2 pour Tol2 transposase17. Ce système a été utilisé pour générer un tableau de lignées transgéniques chez le poisson zèbre et son utilisation a récemment élargi à supplémentaire modèle émergent, y compris des cichlidés, barrés, l’épinoche et, plus récemment, le mexicain agassizii27, 28,29,30.

Alors que le poulsoni est un système biologique fascinant pour élucider des mécanismes de l’évolution du trait, sa pleine capacité comme un modèle évolutionniste n’a pas été pleinement armée. Ceci a été partiellement due à une incapacité à manipuler génétiques et cellulaires fonctionnent directement31. Traits complexes de régulation des gènes candidats ont été identifiés à l’aide des études quantitative trait loci (QTL), mais la validation de ces gènes candidats a été difficile32,33,34. Récemment, knockdown transitoire à l’aide de morpholinos, gène d’édition à l’aide de systèmes CRISPR et TALEN et l’utilisation de Tol2-médiée par transgénèse ont été utilisés pour étudier le fondement génétique qui sous-tendent un certain nombre de traits,35,36,37 ,38. La mise en œuvre et la normalisation de ces techniques permettront de manipulations qui interrogent les bases neurales et moléculaires des traits biologiques, y compris la manipulation de la fonction du gène, l’étiquetage des populations de cellules déterminées, et l’expression de reporters fonctionnelles. Considérant que la mise en œuvre réussie de ces outils génétiques pour manipuler les gènes ou fonction cellulaire a été démontrée dans des systèmes modèles émergents, les protocoles détaillés font encore défaut dans a. mexicanus.

A. mexicanus fournissent la perspicacité critique dans les mécanismes de l’évolution en réponse à un environnement changeant et présenter l’occasion d’identifier de nouveaux gènes régissant les divers traits. Un certain nombre de facteurs suggère qu’a. mexicanus est un modèle extrêmement souple pour l’application des outils génomiques établis actuellement disponibles dans les modèles génétiques établis, y compris la capacité de maintenir facilement les poissons dans les laboratoires de grande taille de la couvée, transparence, un génome séquencé et analyses comportementales défini39. Nous décrivons ici une méthodologie pour l’utilisation des morpholinos, transgénèse et l’édition de gène chez des populations de surface et de la grotte d’a. mexicanus. L’application plus large de ces outils chez a. mexicanus permettra une enquête mécaniste sur les mécanismes moléculaires qui sous-tendent l’évolution des différences de développement, physiologiques et comportementales entre agassizii et poissons de surface.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Morpholino oligo design

Remarque : Les séquences pour a. mexicanus sont offerts par le Centre National d’Information sur la biotechnologie (NCBI) gène et NCBI SRA (https://www.ncbi.nlm.nih.gov), ainsi que depuis le navigateur de génome Ensembl (https://www.ensembl.org). Lorsque vous concevez un morpholino pour utilisation dans les deux formes de surface - et cavernicoles, il est essentiel d’identifier une variation génétique entre les morphes à ce stade, alors ces régions génétiques peuvent être évitées en tant que cibles pour les morpholinos. Toute variante polymorphe au sein d’un site cible de morpholino peut conduire à liaison inefficace. La conception est similaire à d’autres systèmes de poissons, comme le poisson-zèbre et a déjà démontrée à travailler efficacement dans a. mexicanus21,36,40.

  1. Conception de blocage traduction morpholinos
    NOTE : Traduction-blocage morpholinos bloquer traduction en se liant vers le site de départ endogène et entraver translationnelle machines de contraignantes de la séquence de l’ARNm par empêchement stérique.
    1. Identifier la région codante du gène cible à partir du site d’initiation ATG.
    2. Enregistrer les 25 premières paires de base de la séquence cible de copier et de coller la séquence dans un cahier de laboratoire ou de l’éditeur de texte.
    3. Utilisez le logiciel en ligne (p. ex., http://reverse-complement.com) ou traduction manuelle, générer le complément inverse de la séquence cible. Enregistrer le complément inverse qui en résulte dans un éditeur de texte ou un cahier de laboratoire.
    4. Commander un morpholino avec la séquence inverse complément d’une entreprise qui génère des oligonucléotides morpholino. Voir Table des matières pour les entreprises.
  2. Conception de blocage épissure morpholinos
    NOTE : Morpholinos Splice-blocage bloquer à épissage et, ainsi, éviter la formation d’une molécule d’ARNm matures. Cela fournit une méthode alternative pour la précipitation quand les sites de départ ne sont pas bien définies, ou de façon plus optimale lorsque la validation de la précipitation par amplification génique (PCR) est souhaitée. Cette prestation d’épissure bloquant les morpholinos (plus de blocage ATG MOs) est que l’exclusion exon ou inclusion intron pouvant être facilement évaluée par la transcriptase inverse (RT)-PCR et visualisés sur un gel des différences de taille. RT-PCR et gel d’électrophorèse pour déterminer l’efficacité morpholino devrait être faite à l’aide de procédures standard de laboratoire.
    1. Identifier la séquence pré-ARNm du gène cible. Utiliser les informations disponibles provenant du génome a. mexicanus par NCBI ou Ensembl pour déterminer l’intron-exon limites33.
    2. Cibler les exon-intron (donneur d’épissage) ou sites limite (accepteur d’épissage) intron-exon pour exclusion d’inclusion ou exon intron.
      Remarque : Le Splicéosome vise normalement une séquence de « GU » (U1 cible) dans l’intron dans le site d’épissage 5' et une séquence de AG "" "" sur le site d’épissage intronic 3' (cible de U2). Dans des conditions normales, le Splicéosome U1 et U2 sous-unités lient ces sites cibles sur la séquence de l’ARN pré-messager pour l’épissage adéquat pour se produire. Toutefois, si une de ces séquences cibles est bloquée par un morpholino, le Splicéosome passera à la prochain site U1 ou U2 disponible, provoquant soit une exclusion intron exon dans la séquence de l’ARNm. Il s’agira de planification/optimization, selon la nature du gène cible21. En règle générale, bloquer un site interne de U1 redirige l’épissure au prochain site disponible U1, causant une excision exon. Alternativement, la bloquant la jonction de la première ou dernière épissure provoque une inclusion de l’intron parce qu’il n’y a aucun autre site de rediriger l’épissure à. Logiciel de séquençage permet de prédire l’effet des diverses exclusions et inclusions. Prédictions peuvent indiquer des changements potentiels ou codons stop prématurés, indiquant un site cible plus efficace pour l’interruption de l’ARNm.
    3. Une fois que le site cible est identifié, enregistrer sa séquence dans un livre de laboratoire ou de l’éditeur de texte. Assurez-vous que le site cible est 25 paires de bases (pb) longs.
    4. Utilisez le logiciel en ligne (p. ex., http://reverse-complement.com) ou traduction manuelle, générer le complément inverse de la séquence cible. Enregistrer la séquence dans un livre de laboratoire ou de l’éditeur de texte.
    5. Commander un morpholino avec la séquence inverse complément d’une entreprise qui génère des oligonucléotides morpholino. Voir Table des matières pour les entreprises de l’échantillon.

2. les Morpholinos pour injection

Remarque : Plusieurs des concentrations ou des volumes d’injection MO devront être effectuées pour déterminer la concentration optimale d’injecter. Quantités des injections typiques sont 400 – 800 pg de Mo. L’effet de knockdown morpholino peut persister après l’injection jusqu'à 6 jours.

  1. Obtenir le stock morpholino. Le stock morpholino arrive lyophilisé. Il hydrate avec stérile H2O avant d’utiliser à la concentration de stock désirée (par exemple, 4 mM). Conserver à-20 °C jusqu'à l’utilisation.

3. CRISPR gRNA design, transcription in vitro et préparation

  1. Conception gRNA CRISPR
    NOTE : gRNAs ont été générés à l’aide de recherche déjà publié par VERITE et al.,40 et Wierson et al.,41.
    1. À l’aide d’un navigateur de génome, identifier la région codante du gène d’intérêt. À l’aide de la séquence génomique, identifier la séquence cible de gRNA au sein d’un exon en recherchant une 20 bp nucléotides cible séquençage qui commence par GG et suivi d’une séquence de PAM (NGG). Une région du gène après que le début (ATG) est ciblé.
      Remarque : Si une séquence cible avec GG à l’extrémité 5' est introuvable dans le désiré exon du gène, un ou les deux de la G's peut être substitué pour les premiers et le deuxième nucléotides à l’extrémité 5' de la séquence. Toutefois, le deux G's doivent être incorporés dans les oligo, car celles-ci sont nécessaires pour la transcription T7.
    2. Concevoir et de commander un oligonucléotide spécifique du gène (oligo r : 5'-TAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGC-3'). Ajouter la séquence cible de gène-spécifique 20 bp gRNA (en gras) sans la séquence de PAM entre une séquence promotrice de T7 (rouge) et une séquence de chevauchement utilisée de recuire à un oligonucléotide second (bleu). Recuire et amplifier (voir étape 3.2.1) cet oligo A et un second oligo (oligo B: 5'-GATCCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTT AACTTGCTATTTCTAGCTCTAAAAC-3') pour générer le modèle gRNA utilisé pour la transcription.
      NOTE : Oligo B est la même pour chaque réaction et doivent uniquement être commandé 1 x.
  2. transcription et préparation gRNA
    1. Recuire et amplifient les oligos. Inclure les amorces suivants afin d’amplifier la gRNA afin d’augmenter le rendement : 5'-TAATACGACTCACTATA-3' (amorce T7) et 5'-GATCCGCACCGACTCGGTG-3' (3' gRNA amorce). Effectuer une PCR à l’aide de polymérase Thermococcus kodakaraensis (KOD).
      Remarque : Pour les deux amorces oligo A et oligo B, 10 cycles est recommandé pour un bon rendement. Un protocole détaillé se trouvent dans Wierson et al.,41.
    2. Transcrire le gRNA utilisant des kits disponibles dans le commerce de transcription in vitro (voir Table des matières). Cela se fait grâce à des modifications le fabricant's protocole publié par Klaassen et al.,42.
    3. Précipiter, laver et remettre en suspension le gRNA tel que décrit par Klaassen et al.,42.
      Remarque : Le gRNA doit être remis en suspension dans l’eau exempte de RNase à prévenir la dégradation.
    4. On enregistre la concentration de la gRNA, qui peut être déterminé à l’aide d’un spectrophotomètre. Évaluer la qualité de l’ARN en exécutant 2 µL sur gel d’agarose. ARN aliquote pour éviter le gel/dégel et conserver à-80 °C jusqu'à immédiatement avant les injections.
  3. Transcription et préparation de Cas9
    1. Cas9 ARNm peut être transcrit à l’aide de trousses de transcription in vitro disponibles dans le commerce (voir Table des matières) comme décrit plus haut43. Utilisez la version de la nls-Cas9-nls43.
    2. On enregistre la concentration de la gRNA et évaluer sa qualité en exécutant 2 µL sur gel d’agarose. Aliquote ARN pour éviter la décomposition qui se pose à travers plusieurs cycles de gel-dégel et stocker les aliquotes à-80 °C.

4. préparation des constructions Tol2 Tol2 transposase et transgénèse

  1. Préparer des constructions de transgene Tol2 pour injection.
    NOTE : Nous avons utilisé avec succès le poisson-zèbre publié/disponible et médaka construit dans a. mexicanus. Ces constructions sont entièrement fonctionnelles dans a. mexicanus, probablement en raison du niveau élevé d’homologie de séquence (se référer au référentiel du AddGene et du réseau d’Information de poisson zèbre [ZFIN] bases de données pour des constructions disponibles). Les fragments de promoteur du poisson-zèbre ont exprimé les transgènes dans les tissus prévus lorsqu’il est utilisé dans a. mexicanus.
    1. Acquérir des constructions Tol2 ou générer le plasmide avec un promoteur spécifique aux tissus, le transgène désiré et Tol2 bras (voir Kwan et al.,44). Dès réception, séquence la construction pour valider le plasmide.
    2. Effectuer un midiprep des constructions selon le fabricant,'lignes directrices s. Éluer le plasmide final en exempte de RNase H2O, déterminer la concentration avec un spectrophotomètre, diluer la concentration à 100300 ng /μL et partie aliquote et magasin les constructions à-20 °C.
  2. Digérer Tol2 transposase plasmide et synthétiser les ARNm.
    1. Obtenir une copie du plasmide transposase Tol2 (pCS-zT2TP) comme modèle pour générer des ARNm Tol245.
    2. Midiprep le PC-zT2TP construire selon le fabricant,'lignes directrices s. Éluer il dans un faible volume d’eau exempte de RNase ou tampon (~ 50 μL). Stocker les aliquotes à-20 °C.
    3. Digérer le plasmide Tol2 à l’aide d’une enzyme de restriction.
      1. Effectuer un sommaire de restriction sur 10 µg de plasmide circulaire pCS-zT2TP à l’aide du tableau 1.
      2. Diviser la réaction dans les réactions de 250 μL et incuber les réactions pendant une nuit à 37 °C dans un thermocycleur.
      3. Le lendemain, inactivent l’enzyme en le chauffant à 65 °C pendant 20 min.
      4. Purifier le plasmide linéarisé immédiatement après recueil, à l’aide de commercialement PCR purification kits disponibles (voir Table des matières) selon les directives du fabricant,' . Éluer le plasmide dans 15 μL d’exempte de RNase H2O et déterminer la concentration du produit à l’aide d’un spectrophotomètre.
      5. Courir 1 μL de plasmide digéré et 1 μL de plasmide non circonci sur un gel d’agarose 1,5 % gel pour confirmer le plasmide linéarisé.
    4. Effectuer une transcription in vitro des ARNm de Tol2.
      1. Utiliser 1 µg de plasmide linéarisé pCS-zT2TP comme un modèle pour la transcription. Suivez le fabricant's lignes directrices pour transcription in vitro (voir Table des matières), comme décrit dans le tableau 2.
      2. Incuber à 37 °C dans un thermocycleur par le fabricant,'lignes directrices s.
      3. Ajouter 1 µL de DNase, il incuber à 37 °C dans un thermocycleur par le fabricant,'lignes directrices s.
      4. Effectuer des précipitations de chlorure de lithium par protocole de kit de transcription. Resuspendre le culot de RNA dans 20 ~30 μL d’exempte de RNase H2O.
      5. Déterminer la concentration du produit à l’aide d’un spectrophotomètre et enregistrer la qualité RNA.
      6. Diluer le produit à 100 ~300 ng/µL et partie aliquote dans 5 échantillons de 10 μL depour éviter le gel-dégel répété. Stocker à-80 °C jusqu'à l’utilisation.
        Remarque : Il est possible de vérifier 12 µL de purifiée Tol2 ARNm pour frottis/bande avec électrophorèse sur gel.

5. microinjections

  1. Préparation des outils généraux pour les injections
    Remarque : Les procédures décrites dans cette section ont été décrits en détail par Kowalko et al.,46, et on présente ici un aperçu avec des modifications mineures.
    1. Générer des plaques d’injection par coulée chaude 3 % d’agarose dissous dans l’eau du système de poisson dans une boîte de pétri de 100 mL. Placer soigneusement un moule d’injection oeuf dans l’agarose fraîchement coulé pour faire des puits pour les oeufs de poisson. Placez le côté de la moisissure dans la gélose à un angle de 45° et, puis, lentement il abaisser dans l’agarose ; abaissant lentement le moule sous un angle évite air obtenir emprisonné sous le moule. Retirez délicatement le moule une fois l’agarose est solidifié. Les plaques peuvent être stockées, scellé, à 4 °C pendant 1 semaine.
    2. Tirez les aiguilles de capillaires en verre de borosilicate pour injection dans un extracteur d’électrode/aiguille selon le fabricant,'lignes directrices s. Ce protocole peut varier par l’extracteur de la pipette ; Toutefois, un exemple de programme en tirant l’aiguille se trouvent dans le tableau 3.
      Remarque : Optimiser l’aiguille est important pour les injections, comme aiguilles trop longues vont plier plutôt que proprement pénètrent dans le œuf.
    3. Faire des pipettes de verre de gros calibre pour le transfert de le œuf en brisant les pipettes en verre standard donc l’ouverture est assez grande pour les oeufs. À l’aide d’un bec Bunsen, polir le bout cassé du verre en exposant la fin des pipettes cassées à la flamme jusqu'à ce qu’elle soit lisse.
  2. Le programme d’installation d’élevage
    Remarque : Il y a beaucoup de différents protocoles utilisés pour l’élevage a. mexicanus. Un protocole détaillé, voir Borowsky39. Lancer la configuration de reproduction 1 semaine avant les injections.
    1. Jour 1, placer deux ou trois femelles et trois à quatre hommes dans un réservoir unique de 10 gallons, maintenu à 24 ± 1 °C.
    2. Les jours 17, augmenter l’alimentation ~ 3 x par jour. S’assurer que le régime alimentaire comprend la nourriture vivante, comme les vers noir et crevette de saumure.
    3. Jour 6, ajouter un chauffe-eau unique réglé à 27 °C. Lab réservoir les températures peuvent varier ; par conséquent, il s’agit d’une augmentation de 23 °C par rapport à la température du réservoir normal.
    4. Dans la soirée du jour 7, qui est le soir (zeitgeber [ZT] 911) de la nuit de l’injection, nettoyez les réservoirs avec une éponge imbibée d’eau et enlever tout excès de nourriture ou les débris à l’aide d’une maille fine nette ou un siphon.
    5. Dans la nuit du jour 7, commencer à vérifier pour les oeufs de poissons de surface à ZT15 et continuer à vérifier toutes les 1530 min jusqu’au ZT18. Pour spelaea, commencer à vérifier pour les oeufs à ZT17 et continuer à vérifier toutes les 1530 min jusqu'à ZT20.
      NOTE : Les temps sont basées sur une 14:10 cycle h lumière : obscurité en utilisant zeitgeber fois. Temps d’élevage sont des estimations et laboratoires individuels doivent déterminer le moment exact. Il est essentiel de collecter des oeufs dès qu’ils sont libérés/fécondés afin de les injecter au stade unicellulaire.
  3. Collection des œufs de stade unicellulaire
    1. La nuit où élevage est attendue, examiner les réservoirs toutes les 1530 min et moniteur pour les oeufs au fond du réservoir. Œufs apparaissent translucides, mesurant environ 1 mm de diamètre.
    2. Utilisez un filet à maille fine pour ramasser les œufs et les transférer dans un bol de verre rempli d’eau du système de poisson frais. Examiner les oeufs au microscope afin de confirmer que les oeufs sont au stade unicellulaire.
    3. À l’aide de pipettes en verre, transfert unicellulaires oeufs aux plaques d’injection. Pipettes en verre sont nécessaires à ce stade car les oeufs seront en tiendra au plastique.
    4. À l’aide d’une pipette, libérer soigneusement les oeufs dans les puits de la plaque d’injection d’agarose de l’article 5.1. Remplir les lignes de la plaque d’injection réchauffé (température ambiante) avec le nombre maximal d’oeufs (3040 par ligne et jusqu'à cinq rangées). Lignes entières à garder les oeufs ne se déplace pendant les injections. Garder les oeufs hydratés sur la plaque d’injection avec une petite quantité d’eau du système de poisson jusqu'à l’exécution des injections.
  4. Installation de Pico-injection et directives d’optimisation générale injection
    1. Remblayer les aiguilles à injection à l’aide soit pipette gel-chargement conseils qui correspondent à l’intérieur du capillaire ou à l’aide de conseils de micropipette standard et ajouter un bolus de 4 µL2 à la fin. Lorsque l’aiguille est rempli, utiliser des pinces pour couper l’excédent de longueur de l’aiguille d’injection.
    2. Effectuer des microinjections à l’aide d’une aiguille montée dans un micromanipulateur, relié à un microinjector picolitre.
    3. Définir le temps d’injection à 0,03 s et la pression des ~0.0 psi. La pression d’injection peut varier en conséquence avec des différences mineures entre les aiguilles, donc optimiser pour atteindre un bolus d’injection nL ~1.0.
      Remarque : La pression d’injection est souvent de l’ordre de ~ 1030 lb/po2.
    4. Normaliser le bolus d’injection en injectant dans l’huile minérale et en mesurant le bolus dimensions avec un micromètre de diapositive pour réaliser un~ 1 1,5 volume d’injection nL. Ajuster la pression d’injection (lb/po2) pour augmenter ou diminuer le volume du bolus.
    5. Puiser de l’eau hors de tout en haut des oeufs à l’aide d’un tissu de laboratoire.
      Remarque : Le chorion d’oeuf Astyanax est légèrement plus difficile à pénétrer que les oeufs de poisson-zèbre. Nous constatons que l’eau hors de la partie supérieure des oeufs de dessin contribue à facilite la pénétration de l’aiguille dans le œuf. Optimisation de la plaque permet ~ 200 oeufs sur une seule plaque.
    6. Le micromanipulateur permet de pénétrer chaque oeuf avec l’aiguille et injecter directement dans le jaune d’oeuf. Une fois positionné dans le jaune d’oeuf, injecter le œuf en appuyant sur la pédale de pied inject bouton ou par injection.
      Remarque : Une assiette pleine peut être injectée dans environ 15 min. Le stade unicellulaire dure pendant environ 40 min.
  5. Injection de morpholinos
    Remarque : Le montant de morpholino nécessaire pour knockdown sans causer de toxicité devra être optimisé par cible de gène ; Toutefois, une concentration de 400 pg est un bon point de départ.
    1. Préparer morpholino afin que 400 pg de morpholino est injectés par oeuf. Dégel morpholino sur la glace. La solution injectable est composée de morpholino (à la concentration désirée), exempte de RNase H2O ou Danieau'solution s et le rouge de phénol (10 % du volume final). Pour obtenir un exemple, voir le tableau 4.
    2. Injecter 1 nL par embryon.
  6. Injections CRISPR
    1. Préparer l’ARN afin que pg 25 de gRNA et 300 pg de Cas9 ARNm total seront injectés par embryon. Pour un mélange d’injection échantillon CRISPR/Cas9, voir le tableau 5.
    2. Injecter 2 nL de gRNA/Cas9 ARNm par embryon directement dans l’embryon.
  7. Injection de Tol2 transposase et plasmide Tol2-flanqué de transgénèse
    1. Décongeler la transposase plasmide Tol2 sur la glace et l’ARNm. Moissonneuse-batteuse Cas9 ARNm (à 25 ng/µL), désiré Tol2 construct (à 25 ng /μL) et le rouge de phénol (10 % du volume final) dans de l’eau exempte de RNase. Pour un mélange d’injection témoin Tol2 transgénèse, voir le tableau 6.
    2. Conserver la solution injectable et les aiguilles sur la glace pour éviter la dégradation des ARNm. Injecter 1 nL en volume par embryon.

6. l’élevage et de criblage injecté poisson

  1. Elevage de poissons injecté
    1. Après que les oeufs sont injectés, immédiatement transférer sur des bols de verre (10 x 5 cm) remplis de ~ 200 mL d’eau du système de poissons. Œufs sont facilement rincés en plongeant les plaques d’injection dans les bols remplis de poissons de l’eau et rincer les oeufs avec une pipette.
    2. Placer 50 ~80 embryons injectées par bol et leur arrière à 2224 °C.
    3. Nettoyer les bols avec injection poisson 2 x par jour pour enlever les embryons morts et changer environ 20 % de l’eau sur une base quotidienne.
    4. Un élevage supplémentaire s’effectue selon des protocoles précédemment publiés39.
  2. Dépistage des individus morpholino-injecté
    1. Visualiser les animaux sous un stéréomicroscope pour dépister les phénotypes. L’effet des morpholinos peut persister jusqu'à ~ 5 jours post-injection21.
    2. Mesurer les phénotypes comportements à la post-injection de 4 jours.
  3. Dépistage des indels CRISPR
    1. Conception des amorces pour amplifier l’ADN génomique autour du site cible. Concevoir des amorces afin que le produit PCR de cible est d’environ 100125 bp.
      NOTE : par exemple, pour le locus oca2 , la région entourant le site cible gRNA a été amplifiée à l’aide de l’apprêt avant 5'-CTCCTCTGTCAGGCTGTGC-3' et l’amorce inverse 5'-GAAGGGGATGTTGTCTATGAGC-3' pour une longueur de produit PCR de 105 bp.
    2. Sacrifier les embryons ou nageoire des poissons adultes pince selon le protocole institutionnel animal.
    3. Recueillir des embryons ou des nageoires découpées dans des tubes PCR et extraire l’ADN et exécuter les protocoles PCR PCR. échantillon pour amorces gène-spécifiques se trouvent dans Ma et al.,35.
    4. À évaluer pour la mutagénèse, courir 5 µL du produit PCR sur un gel d’agarose à 3 % à 70 V pour 3 h. sauvage (le) ADN se traduira par un produit de la PCR comme une bande distincte. L’ADN mutant se traduira par une bande graisseux sur le gel.
    5. Pour déterminer la séquence des allèles mutants, TA cloner le produit PCR selon le fabricant,'s directives, prélever des colonies et cultures miniprep. Envoyer de l’ADN qui en résulte pour le séquençage.
    6. Établir et maintenir des lignes de transmission des allèles mutants de poissons, traverser les poissons adultes injectées poisson sauvage et écran 510 embryons afin de déterminer si un des descendants porteurs d’un allèle mutant du gène suite à des mesures 6.3.1-6.3.6.
      Remarque : Individus1 F différents du même poisson F0 fondateur peuvent porter différentes mutations. S’assurer que les lignées mutantes sont séquencées pour obtenir des mutations prévues pour produire des allèles qui sont hors du cadre.
    7. Identifier les poissons porteurs d’un allèle mutant par PCR en utilisant le test de bande graisseux (mesures 6.3.1-6.3.6) ou en concevant des amorces de PCR allèle spécifique qui vont amplifier mutant et bandes de sauvage (Figure 2).
    8. Lorsqu’on crée une ligne de poissons, homozygose des allèles mutants à tester pour les phénotypes récessifs.
  4. Dépistage des personnes séropositives transgéniques
    Remarque : En utilisant des constructions contenant un fabricant fluorescent est recommandé afin de rationaliser l’examen préalable pour les personnes séropositives transgéniques. Toutefois, la PCR standard, méthodes de dépistage peut être utilisé pour dépister les transmission.
    1. Visualiser tissu-spécifique des protéines fluorescentes dans le poisson0 F, dès après l’injection 2 jours, avec une épifluorescence dissection étendue.
      Remarque : L’expression chez les larves de0 F est mosaïque et personnes séropositives peuvent avoir une gamme de phénotypes d’expression.
    2. Que les personnes séropositives aussi F0 poissons fondateur.
    3. Lorsque F0s atteignent la maturité, rétrocroisement fondateur de poissons aux individus non transgéniques dérivées de la même souche de population/laboratoire. Écran F1 descendants utilisent le même protocole, comme indiqué au point 6.2.
      Remarque : L’expression chez les larves de1 F est uniforme et assure la cohérence entre les frères et sœurs de F1 .
    4. Tol2 intégration n’étant pas véhiculée par site et intégration peut varier selon les fondateurs, sélectionnez F1 frères provenant d’un seul fondateur de0 F et croiser positif exprimant la fratrie de F1 pour générer F2s. Cette descendance sera la base pour une ligne stable.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Plusieurs populations de roche troglodytique a. mexicanus montrent sommeil réduit et éveil/activité accrue par rapport à leurs congénères de surface-logement14. Hypocrétine/orexine (HCRT) est un neuropeptide hautement conservé, qui agit pour augmenter l’éveil, et des aberrations dans la voie HCRT causent la narcolepsie chez les humains et autres mammifères47,48. Nous avons déjà démontré cette grotte a. mexicanus ont augmenté expression du peptide HCRT, ce qui suggère qu’une augmentation de l’expression de ce peptide pourrait expliquer la perte de sommeil réparateur à agassizii38. Le knockdown MO d’expression hcrt offre une approche puissante pour étudier directement l’effet de l’expression accrue hcrt médiant la perte de sommeil réparateur à agassizii.

Afin d’examiner la relation entre l’expression hcrt et sommeil, nous avons conçu un morpholino blocage de traduction. Le bp de cibles les 25 premiers MO de l’exon, y compris l’ATG démarrer site (Figure 1 a,B). Comme un contrôle, nous avons utilisé un contrôle disponible dans le commerce de MO brouillé (Figure 1 b). À l’aide de l’algorithme BLAST sur NCBI, nous a confirmé qu’il n’y a pas d’effets hors cible pour chaque MO dans tout le génome (données non présentées). A. mexicanus poissons de surface et Pachón agassizii ont été élevés et leurs oeufs ont été recueillies et ensuite injectés avec 400 pg de MO dans un 1 nL-volume au stade unicellulaire (Figure 1,D). Les poissons ont été soulevés à dpf 4 et ensuite mesurés l’activité et le comportement de sommeil.

Grotte a. mexicanus injecté avec le contrôle MO présenté l’activité sensiblement plus locomotrice et réduit le sommeil pendant une période de 24 h par rapport aux poissons de surface aussi injecté avec le MO brouillé (Figure 1E,F), ce qui laisse supposer aucun effet de la contrôler les injections morpholino où les résultats sont compatibles avec les modèles de l’activité et de sommeil publiées antérieurement dans chaque morphotype (t = 5.021, df = 88, p < 0,0001). L’injection de la HCRT-MO a peu d’effet sur le sommeil en poissons de surface par rapport aux poissons contrôle injection (t = 0,17, df = 88, p > 0.99). En revanche, hcrt knockdown par injection MO avait un effet significatif sur le sommeil chez les poissons cavernicoles. Pachón agassizii larves ont montré moins d’une réduction par quatre dans l’activité locomotrice et dorment près de deux fois plus de contrôler les larves Pachón (Figure 1E,F; t = 2.694, df = 88, p < 0,05). Une comparaison de l’activité locomotrice et le sommeil chez les poissons de surface - et cavernicoles MO-knockdown a révélé des quantités comparables de locomotion et le sommeil (Figure 1E, F). Ces données fournissent un lien direct entre l’expression hcrt et perte de sommeil et fournissent une méthode pour interroger les mécanismes biologiques pour la perte de sommeil dans les morphes cavernicoles évolutivement dérivés.

Perte de la pigmentation est une caractéristique des organismes de la grotte, et plusieurs populations d’Astyanax cavernicoles démontrent la perte de la pigmentation. Albinisme dans Molino et Pachón agassizii a été cartographié à l’aide de cartographie QTL à une région génomique contenant le gène, l’albinisme oculaire 2 (oca2), suggérant des mutations oca2 sous-tendent l’albinisme dans agassizii6.

Pour valider oca2 comme du locus causal de l’albinisme dans Pachón grotte morphes, nous avons utilisé CRISPR/Cas9 gène édition pour muter cette région dans les populations de poissons de surface. Depuis exon 21 est supprimé à Molino poisson6, nous avons conçu un gRNA pour cibler cette région du gène (Figure 2 a). La séquence génomique, y compris la séquence cible de gRNA et la PAM (en gras), est 5'-GGTCATGTGGGTCTCAGCTTTGG-3 '. Cette séquence cible (sans la séquence de PAM) a été utilisée pour générer un gRNA de mutagenèse ciblée. Éleveurs de surface ont été faites pour s’accoupler, et les embryons qui en résultent ont été prélevés au stade unicellulaire. Embryons au stade unicellulaire ont été injectés avec Cas9 ARNm et ciblage gRNA oca2, et les animaux injectées est portés à l’âge adulte43. Les adultes injectées sont faites pour s’accoupler aux poissons de surface de type sauvage, et les embryons issus de ces croisements ont été génotypés pour déterminer la transmission de la lignée germinale, en utilisant des amorces de l’étape 6.3.1. Nous avons séquencé un allèle mutant oca2 et nous avons identifié une délétion de bp 2 germe-ligne-transmis en oca2 (Figure 2 b,C). Par souci de génotypage, nous avons conçu amorces allèle-spécifiques d’identifier les allèles sauvage et mutantes (Figure 2D) et génotypés poissons, à l’aide de la PCR suivie par électrophorèse sur gel (Figure 2E). Nous incrossed poissons de surface hétérozygotes pour cet allèle mutant oca2. La progéniture résultante était pigmentée ou albinos (Figure 2F-je). Pigmentées individus étaient sauvage ou hétérozygotes au locus oca2, tandis que les personnes albinos sont homozygote mutant (Figure 2E). Ces données fournissent un lien direct entre le locus du gène oca2 et albinisme dans mexicanus a. agassizii.

Myriades comportements tels que le sommeil, l’alimentation et le stress se distinguent par mexicanus a. agassizii par rapport à la surface de la même espèce, mais les déterminants fondamentaux neuronales entre les formes restent floues. Imagerie calcique ensemble-cerveau fournit une approche impartiale puissante pour l’examen des corrélations entre l’activité neurale modifiée et mis à jour le comportement. Nous avons généré des poissons de surface et poulsoni avec une expression neuronale près omniprésent de l’indicateur de calcium génétiquement encodé, GCaMP6s, à l’aide de réactifs utilisés largement dans la recherche de poisson-zèbre. Protéine de liaison à l’ARN semblable à ELAV neurone-spécifique 3 (elavl3) s’exprime endogène dans les neurones nouvellement différenciées dans tout le système nerveux central49 et a été utilisé chez le poisson zèbre à conduire l’expression des protéines dans la majeure partie du système nerveux50. Nous avons obtenu une construction Tol2 contenant ~2.8 Ko zebrafish elavl3 promoteur transcription en amont de l’indicateur de calcium codé génétiquement GCaMP6s (une fusion de la protéine fluorescente verte [GFP], la calmoduline et M13, une séquence peptidique de la myosine kinase des chaînes légères), flanqué aux extrémités 5' et 3' avec des sites de Tol2 (Tol2 -elavl3:GCaMP6s-Tol2)51.

A. mexicanus poissons de surface et Molino agassizii ont été élevés, et les embryons qui en résultent ont été coïnjectés au stade unicellulaire avec 25 ng/μL de la Tol2 -elavl3:GCaMP6s-Tol2 construction et 25 ng/μL Tol2 transposase ARNm (Figure 3 a). À 24 – 48 dpf, les larves ont été examinés pour une expression transitoire neuronale de GCaMP6s. Ces embryons (F0) injectés avec une expression de GCaMP6s ont été soulevés à l’âge adulte et rétrocroisés avec sauvage adultes provenant de la même lignée de poissons de surface ou poulsoni. Les adultes qui en résulte de la F1 ont été testés pour une expression stable d’expression GCaMP6s et ces larves ont été maintenus à produire des lignes stables (Figure 3 b,C). Parce que chaque adulte F1 avec une expression stable a probablement intégré Tol2 -elavl3: GCaMP6s-Tol2 à différents sites génomiques, chaque F1 est désigné un allèle différent. En utilisant cette approche, nous avons généré F1s stable pour les poissons de surface et les populations agassizii Molino (Figure 3 b,C), permettant ainsi aux calcium direct d’imagerie afin de découvrir des différences dans l’activité neuronale des changements de comportement dans la grotte de médiation environnement (Figure 3 C,D). En outre, cette approche jette les bases pour l’expression de nombreux autres transgènes à caractériser et à manipuler la fonction du gène chez a. mexicanus.

Figure 1
Figure 1 : Morpholino knockdown de Hcrt réduit l’activité et augmente le sommeil en agassizii. (A) blocage traduction morpholino cibles les 25 premiers bp du Hcrt coding sequence, y compris le site de départ ATG. (B) Hcrt morpholino oligo (MO) et des séquences de contrôle. (C) l’alignement des oeufs unicellulaires ~ 200 sur moules œuf d’agarose pour injection. (D) la Microinjection de 1,0 ml d’injection mélange avec indicateur rouge de phénol pour la visualisation. La barre d’échelle = 0,5 mm. (E) Morpholino knockdown de Hcrt réduit l’activité (distance totale parcourue) de Pachón agassizii (t = 5.021, df = 88, p < 0,0001) mais pas de poissons de surface (t = 1.318, df = 88, p > 0,72). (F) Knockdown augmente sommeil dans Pachón agassizii (t = 2.694, df = 88, p < 0,05) mais n’a aucun effet sur les poissons de surface (t = 0,17, df = 88, p > 0.99). La barre d’échelle = 1 mm. Les barres d’erreur dans les séries E et F indiquent l’erreur-type de la moyenne. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 : CRISPR édition de gène de oca2 introduit l’albinisme dans surface-logement a. mexicanus. (A) schéma de l’oca2 codage des régions et l’ARN guide (gRNA) ciblant les exon 21 pour la modification des gènes CRISPR. (B) séquençage chromatogramme de type sauvage Oca2 + ) et (C) Oca2 - allèles mutants. La zone rouge dans le groupe B indique la séquence bp 2, qui est absent de l’allèle mutant Oca2 - représenté dans le groupe C. (D) ciblés CRISPR introduit une délétion de bp 2, fonction de Oca2 perturbateurs. Amorces sont conçus pour le dépistage génotypique de suppression de bp 2 chez la progéniture de F0. (E) PCR et gel d’électrophorèse de Oca2 en poissons de surface de type sauvage (taille de la bande = 134 bp) et injection de F0 CRISPR progéniture (taille de la bande = 133 bp). Les individus homozygotes ou hétérozygotes pour la variante de la souche sauvage Oca2 (Oca2 +) sont pigmentés, tandis que F0s homozygotes pour la suppression de bp 2 (Oca2 -) port d’albinisme. (F) des images de corps de type sauvage (G) et poissons de surface de poissons de surface avec l’albinisme CRISPR-mediated. La barre d’échelle = Magnified vue. 5 mm (H et I) sur les têtes des personnes représentées dans les séries F et G, respectivement. La barre d’échelle = 2 mm. s’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 3
Figure 3 : transgénèse Tol2 de GCAMP6s pan-neuronale permet l’imagerie direct de l’activité cérébrale en a. mexicanus. (A) Tol2-mediated transgenèse chez a. mexicanus. Co-injection d’ARNm Tol2 et Tol2 -elav3l: GCAMP6s-Tol2 plasmide intègre GCAMP6s transgene dans F0 fondateurs. Croisement en retour au stock original de poisson sauvage donne individus F1 avec une expression stable pan-neuronale de GCAMP6s. (B et C) la progéniture résultante est testée pour une expression stable à l’aide de la dissection et la microscopie confocale. Stable TgAsty(elav3l: GCaMP6s) individus F1 ont été établies pour les deux surface (représenté dans le groupe B) et cavernicoles morphotypes (représenté en groupe C). La barre d’échelle = 200 μm.  S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Réactif Volume ou quantité
10,0 µg d’ADN plasmidique pCS-zT2TP X μl
NEB CutSmart tampon 10,0 μl
Enzyme de NotI-HF 2.0 μl
Exempte de nucléase H2O X μl
BSA 1,0 μl
Total 100 μl

Tableau 1 : Sommaire de Restriction du plasmide Tol2.

Réactif Volume ou quantité
1,0 µg d’ADN linéarisé plasmidique pCS-zT2TP X μl
10 x tampon de réaction 2.0 μl
2 x NTP/CAP 10,0 μl
Mélange enzymatique SP6 2.0 μl
Exempte de RNase H2O X μl
Total ≤ 20 μl

Tableau 2 : synthèse In vitro des ARNm de Tol2.

Nom du paramètre Mise en valeur
Chaleur 510
Tirez 55
Vitesse 100
Temps 40
Pression 500
Rampe 534

Tableau 3 : Échantillon protocole pipette-traction. 

Réactif Volume ou quantité
Morpholino (stock congélateur @ 4mM) 1,0 μl
Exempte de nucléase H2O ou solution de Danieau 17,0 μl
Rouge de phénol 2.0 μl
Total 20 μl

Tableau 4 : Morpholino injection mélange.

Réactif Volume du montant
gRNA (concentration finale de travail @ 100ng/μl) 1 μl
Cas9 ARNm (concentration finale de travail @ 1200ng/μl) 1 μl
Exempte de RNase H2O 2 μl
Total 4 μl

Tableau 5 : Échantillon CRISPR/Cas9 injection mélange.

Réactif Volume du montant
Tol2 plasmidique (concentration finale de travail @ 25ng/μl) X μl
Tol2 mRNA (concentration finale de travail @ 25ng/μl) X μl
Rouge de phénol 1,0 μl
Exempte de RNase H2O X μl
Total 15 μl

Tableau 6 : Exemple Tol2 transgénèse injection mélange

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Ici, nous avons fourni une méthodologie permettant de manipuler la fonction du gène en utilisant les morpholinos, gène CRISPR/Cas9 édition et méthodologie de la transgénèse. La richesse des technologies génétiques et l’optimisation de ces systèmes chez le poisson zèbre permettra probablement pour le transfert de ces outils dans a. mexicanus avec facilité,52. Des découvertes récentes ont utilisé ces approches dans a. mexicanus, mais elles restent sous-utilisées dans l’enquête de divers traits morphologiques, développementaux et comportements dans ce système de36,30,42 , 53.

Les Morpholinos ont été largement utilisées dans la recherche de poisson-zèbre et défiant l’expression des gènes. L’approche est facile et se traduit par une précipitation solide d’expression. Cependant, les effets hors-cible ont été largement documentés22,53; ainsi, animaux dans lequel les morpholinos ont été injectés à doit être soigneusement surveillés pour n’importe quel imprévu phénotypes22,55. Lorsque cela est possible, résultats obtenus par précipitation morpholino doivent être validées par l’utilisation d’autres méthodes, comme les approches de knockout CRISPR/Cas9-médiée. Tandis que les morpholinos permettent le knockdown robuste de l’expression génique, morpholino-mediated knockdown est transitoire. Ainsi, analyser les phénotypes adultes n’est pas possible lorsque vous utilisez cette méthode.

Mutagenèse CRISPR/Cas9-mediated offre une manipulation directe des gènes spécifiques. En outre, contrairement à la médiation morpholino knockdown, mutagenèse CRISPR/Cas9 permet l’analyse des phénotypes mutants à l’âge adulte. Pour éviter les effets hors cible de CRISPR/Cas9, lignées mutantes devraient être croisées à plusieurs générations, et lorsque cela est possible, plus d’un allèle doit être obtenu et testé. Le système CRISPR/Cas9 offre également le potentiel pour l’utilisation des approches gène-édition de frapper-dans les allèles ou de produire des changements génétiques spécifiques. Le système CRISPR/Cas9 a été utilisé chez le poisson zèbre pour produire des intégrations précises d’ADN exogène et de générer des mutations ponctuelles précises19,20,56,57,58, 59. avec le séquençage du génome spelaea, il est maintenant possible d’identifier des polymorphismes de nucléotides simples (SNP) ou d’autres changements génétiques subtils entre les poissons de surface et de populations agassizii33. L’application de la modification des gènes CRISPR/Cas9 offre la possibilité d’échanger des allèles entre agassizii et poissons de surface, ou entre différentes populations de spelaea, d’examiner le rôle de ces modifications génétiques dans différents processus de développement.

Les transgénèse les approches décrites dans le présent protocole offrent une méthode simple et puissante pour les études de gain de fonction et pour générer des outils pour modifier génétiquement les processus biologiques. Le système Tol2 est largement utilisé dans la recherche de poisson-zèbre, et nous avons montré qu’il est de même puissant chez a. mexicanus. En outre, nous avons démontré une construction transgénique générée chez le poisson zèbre qui utilise un promoteur de poisson-zèbre et récapitule l’expression endogène chez a. mexicanus. Nous avons identifié que quatre autres promoteurs isolement de poisson-zèbre cette expression tissu-spécifique de voiture comme prévu chez a. mexicanus (données non présentées). Étant donné que le poisson-zèbre promoteurs récapitulent leurs profils d’expression conservée chez a. mexicanus, cela donne à penser que bon nombre des outils génétiques peuvent être transférés directement à partir de poisson-zèbre à A. mexicanus , sans besoin de modification avec A. mexicanus promoteurs. En outre, avec l’avance dans les technologies de séquençage dans a. mexicanus33, les approches transgéniques décrites ici permettra un avenir puissant pour l’étude des exhausteurs et promoteurs qui peuvent jouer un rôle dans la variation entre les formes de surface et de la grotte. Enfin, les outils puissants pour la manipulation génétique des processus biologiques qui ont fait le poisson-zèbre précieux sont également importantes dans a. mexicanus,60,61,62,63. Différences dans les caractéristiques comportementales diverses, comme le sommeil, alimentation, stress et agressivité, entre a. mexicanus surface - et cavernicoles formes ont été largement documentés12,14,15 ,38,64, pourtant sous-jacent corrélats neurones ne sont pas bien comprises. Des outils tels que Tg(elavl3:GCaMP6s) permettra une dissection du comment des différences dans l’activité neuronale à l’échelle du cerveau sont en corrélation avec les différences de comportement et offrent une perspective unique sur la façon dont le cerveau a être modifié évolutives.

L’ensemble a. mexicanus est appelée à devenir un modèle pour l’étude de l’évolution d’une variété de caractéristiques morphologiques et comportementales. Les différences entre les divers processus biologiques complexes chez a. mexicanus fournissent une plate-forme pour l’étude des mécanismes génétiques de l’évolution du trait. L’utilisation d’outils permettant de manipuler la fonction du gène peut contribuer à cet organisme dans un modèle qui peut être appliqué pour étudier les maladies biologiques liés à la dégénérescence de l’oeil, anomalies du développement neurologique et l’insomnie.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n’ont rien à divulguer.

Acknowledgments

Les auteurs remercient Sunishka Thakur pour son aide dans le génotypage et imagerie le poisson mutant oca2 illustrée au tableau 2. Ce travail a été soutenu par la National Science Foundation (NSF) prix 1656574 à A.C.K., award NSF 1754321 J.K. et A.C.K. et prix National Institutes of Health (NIH) R21NS105071 A.C.K. et E.R.D.

Materials

Name Company Catalog Number Comments
Fish breeding & egg supplies
Fine mesh fish net Penn Plax BN4
Fish tank heater Aqueon 100106108
Egg traps Custom made NA Design and create plastic grate to place at bottom of tank to protect eggs
Glass pipettes Fisher Scientific 13-678-20C
Pipette bulbs Fisher Scientific 03-448-21
Agarose Fisher Scientific BP160-500
Egg molds Adaptive Science Tools TU-1
Morpholino supplies
Control Morpholino Gene Tools, LLC Standard control olio
Custom Morpholino Gene Tools, LLC NA
Phenol Red Sigma Aldrich P0290-100ML
CRISPR supplies
Cas9 Plasmid AddGene 46757
GoTaq DNA Polymerase Promega M3001
KOD Hot Start Taq EMD Millipore 71-842-3
Primers Integrated DNA Technologies Custom
T7 Megascript Kit Ambion/Thermofisher AM1333
miRNeasy Kit Qiagen 217004
mMessage mMachine T3 kit Ambion/Thermofisher AM1348
MinElute Kit Qiagen 28204
Tol2 transgenesis supplies
pCS-zT2TP plasmid Kawakami et al., 2004 Request from senior author
CutSmart Buffer New England Biolabs B7204
NotI-HF Restriction Enzyme New England Biolabs R3189
PCR purification Kit Qiagen 28104
SP6 mMessenger Kit Ambion/Thermofisher AM1340
Microinjection supplies
Glass Capillary Tubes Sutter Instruments BF100-58-10
Pipette puller Sutter Instruments P-97
Picoinjector Warner Instruments PLI-100A
Micromanipulator World Precision Instruments M3301R
Micromanipulator Stand World Precision Instruments M10
Micmanipulator Base World Precision Instruments Steel Plate Base, 10 lbs

DOWNLOAD MATERIALS LIST

References

  1. Darwin, C. On the Origin of Species by Means of Natural Selection. D. Appleton and Company. (1859).
  2. Culver, D. C., Pipan, T. The Biology of Caves and Other Subterranean Habitats. Oxford University Press. New York, NY. (2009).
  3. Mitchell, R. W., Russell, W. H., Elliott, W. R. Mexican Eyeless Characin Fishes, Genus Astyanax: Environment, Distribution, and Evolution. (1977).
  4. Huppop, K. Oxygen consumption of Astyanax fasciatus (Characidae, Pisces): A comparison of epigean and hypogean populations. Environmental Biology of Fishes. 17, 299-308 (1986).
  5. Moran, D., Softley, R., Warrant, E. J. Eyeless Mexican Cavefish Save Energy by Eliminating the Circadian Rhythm in Metabolism. PLoS ONE. 9, (9), e107877 (2014).
  6. Protas, M. E., et al. Genetic analysis of cavefish reveals molecular convergence in the evolution of albinism. Nature genetics. 38, 107-111 (2006).
  7. Wall, A., Volkoff, H. Effects of fasting and feeding on the brain mRNA expressions of orexin tyrosine hydroxylase (TH), PYY and CCK in the Mexican blind cavefish (Astyanax fasciatus mexicanus). General and Comparative Endocrinology. 183, 44-52 (2013).
  8. Aspiras, A., Rohner, N., Marineau, B., Borowsky, R., Tabin, J. Melanocortin 4 receptor mutations contribute to the adaptation of cavefish to nutrient-poor conditions. Proceedings of the National Academy of Sciences. 112, (31), 9668-9673 (2015).
  9. Yoshizawa, M., Gorički, Š, Soares, D., Jeffery, W. R. Evolution of a behavioral shift mediated by superficial neuromasts helps cavefish find food in darkness. Current Biology. 20, (18), 1631-1636 (2010).
  10. Jeffery, W. R. Regressive Evolution in Astyanax Cavefish. Annual Review of Genetics. 43, 25-47 (2009).
  11. Gross, J. B. The complex origin of Astyanax cavefish. BMC Evolutionary Biology. 12, 105 (2012).
  12. Elipot, Y., Hinaux, H., Callebert, J., Rétaux, S. Evolutionary shift from fighting to foraging in blind cavefish through changes in the serotonin network. Current Biology. 23, (1), 1-10 (2013).
  13. Kowalko, J. E. J., et al. Loss of schooling behavior in cavefish through sight-dependent and sight-independent mechanisms. Current Biology. 23, (19), 1874-1883 (2013).
  14. Duboué, E. R. E. R., Keene, A. C. A. C., Borowsky, R. L. R. L. Evolutionary convergence on sleep loss in cavefish populations. Current Biology. 21, (8), 671-676 (2011).
  15. Chin, J. S., et al. Convergence on reduced stress behavior in the Mexican blind cavefish. Developmental Biology. (2018).
  16. Scheer, N., Campos-Ortega, J. A. Use of the Gal4-UAS technique for targeted gene expression in the zebrafish. Mechanisms of Development. 80, (2), 153-158 (1999).
  17. Kawakami, K., Shima, A., Kawakami, N. Identification of a functional transposase of the Tol2 element, an Ac-like element from the Japanese medaka fish, and its transposition in the zebrafish germ lineage. Proceedings of the National Academy of Sciences. 97, (21), 11403-11408 (2000).
  18. Balciunas, D., et al. Enhancer trapping in zebrafish using the Sleeping Beauty transposon. BMC Genomics. (2004).
  19. Auer, T. O., Duroure, K., De Cian, A., Concordet, J. P., Del Bene, F. Highly efficient CRISPR/Cas9-mediated knock-in in zebrafish by homology-independent DNA repair. Genome Research. 24, (1), 142-153 (2014).
  20. Kimura, Y., Hisano, Y., Kawahara, A., Higashijima, S. I. Efficient generation of knock-in transgenic zebrafish carrying reporter/driver genes by CRISPR/Cas9-mediated genome engineering. Scientific Reports. 4, (2014).
  21. Bill, B. R., Petzold, A. M., Clark, K. J., Schimmenti, L. A., Ekker, S. C. A Primer for Morpholino Use in Zebrafish. Zebrafish. 6, (1), 69-77 (2009).
  22. Nasevicius, A., Ekker, S. C. Effective targeted gene “knockdown” in zebrafish. Nature Genetics. (2000).
  23. Sander, J. D., et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. Nature Biotechnology. (2011).
  24. Huang, P., et al. Heritable gene targeting in zebrafish using customized TALENs. Nature Biotechnology. (2011).
  25. Kawakami, K. Transposon tools and methods in zebrafish. Developmental Dynamics. 234, (2), 244-254 (2005).
  26. Urasaki, A., Morvan, G., Kawakami, K. Functional dissection of the Tol2 transposable element identified the minimal cis-sequence and a highly repetitive sequence in the subterminal region essential for transposition. Genetics. 174, (2), 639-649 (2006).
  27. Juntti, S. A., Hu, C. K., Fernald, R. D. Tol2-Mediated Generation of a Transgenic Haplochromine Cichlid, Astatotilapia burtoni. PLoS ONE. 8, (10), (2013).
  28. Harel, I., Valenzano, D. R., Brunet, A. Efficient genome engineering approaches for the short-lived African turquoise killifish. Nature Protocols. 11, (10), 2010-2028 (2016).
  29. Erickson, P. A., Ellis, N. A., Miller, C. T. Microinjection for Transgenesis and Genome Editing in Threespine Sticklebacks. Journal of Visualized Experiments. (111), e54055 (2016).
  30. Elipot, Y., Legendre, L., Père, S., Sohm, F., Rétaux, S. Astyanax transgenesis and husbandry: how cavefish enters the laboratory. Zebrafish. 11, (4), 291-299 (2014).
  31. Keene, A., Yoshizawa, M., McGaugh, S. Biology and Evolution of the Mexican Cavefish. Academic Press. New York, NY. (2015).
  32. Casane, D., Rétaux, S. Evolutionary Genetics of the Cavefish Astyanax mexicanus. Advances in Genetics. 95, 117-159 (2016).
  33. Mcgaugh, S., et al. The cavefish genome reveals candidate genes for eye loss. Nature Communications. 5, 5307 (2014).
  34. Yoshizawa, M., et al. Distinct genetic architecture underlies the emergence of sleep loss and prey-seeking behavior in the Mexican cavefish. BMC Biology. 13, (1), (2015).
  35. Ma, L., Jeffery, W. R., Essner, J. J., Kowalko, J. E. Genome editing using TALENs in blind Mexican cavefish, Astyanax mexicanus. PLoS ONE. 10, (3), (2015).
  36. Bilandzija, H., Ma, L., Parkhurst, A., Jeffery, W. A potential benefit of albinism in Astyanax cavefish: downregulation of the oca2 gene increases tyrosine and catecholamine levels as an alternative to melanin synthesis. PLoS ONE. 8, (11), e80823 (2013).
  37. Alie, A., et al. Developmental evolution of the forebrain in cavefish: from natural variations in neuropeptides to behavior. eLife. 7, e32808 (2018).
  38. Jaggard, J. B., et al. Hypocretin underlies the evolution of sleep loss in the Mexican cavefish. eLife. 7, e32637 (2018).
  39. Borowsky, R. Handling Astyanax mexicanus eggs and fry. Cold Spring Harbor Protocols. 3, (11), (2008).
  40. Varshney, G. K., Sood, R., Burgess, S. M. Understanding and Editing the Zebrafish Genome. Advances in Genetics. 92, 1-52 (2015).
  41. Wierson, W. A., et al. GeneWeld: a method for efficient targeted integration directed by short homology. BioRxiv. (2018).
  42. Klaassen, H., Wang, Y., Adamski, K., Rohner, N., Kowalko, J. E. CRISPR mutagenesis confirms the role of oca2 in melanin pigmentation in Astyanax mexicanus. Developmental Biology. (2018).
  43. Jao, L. E., Wente, S. R., Chen, W. Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proceedings of the National Academy of Sciences of the United States of America. 110, (34), 13904-13909 (2013).
  44. Kwan, K. M., et al. The Tol2kit: A multisite gateway-based construction Kit for Tol2 transposon transgenesis constructs. Developmental Dynamics. 236, (11), 3088-3099 (2007).
  45. Kawakami, K., et al. A transposon-mediated gene trap approach identifies developmentally regulated genes in zebrafish. Developmental Cell. 7, (1), 133-144 (2004).
  46. Kowalko, J., Ma, L., Jeffery, W. Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases (TALENs). Journal of Visualized Experiments. (112), e54113 (2016).
  47. Nishino, S., Ripley, B., Overeem, S., Lammers, G. J., Mignot, E. Hypocretin (orexin) deficiency in human narcolepsy. Lancet. (2000).
  48. Lin, L., et al. The sleep disorder canine narcolepsy is caused by a mutation in the hypocretin (orexin) receptor 2. Cell. (1999).
  49. Park, H. C., et al. Analysis of upstream elements in the HuC promoter leads to the establishment of transgenic Zebrafish with fluorescent neurons. Developmental Biology. 227, (2), 279-293 (2000).
  50. Higashijima, S., Masino, M. A., Mandel, G., Fetcho, J. R. Imaging Neuronal Activity During Zebrafish Behavior With a Genetically Encoded Calcium Indicator. Journal of Neurophysiology. (2003).
  51. Vladimirov, N., et al. Light-sheet functional imaging in fictively behaving zebrafish. Nature Methods. 11, (9), 883-884 (2014).
  52. Halpern, M. E., et al. Gal4/UAS transgenic tools and their application to zebrafish. Zebrafish. 5, (2), 97-110 (2008).
  53. Jaggard, J. B., Stahl, B. A., Lloyd, E., Prober, D. A., Duboue, E. R., Keene, A. C. Hypocretin underlies the evolution of sleep loss in the Mexican cavefish. bioRxiv. 7, e32637 (2018).
  54. Bedell, V. M., Westcot, S. E., Ekker, S. C. Lessons from morpholino-based screening in zebrafish. Briefings in Functional Genomics. (2011).
  55. Robu, M. E., et al. p53 activation by knockdown technologies. PLoS Genetics. (2007).
  56. Hisano, Y., et al. Precise in-frame integration of exogenous DNA mediated by CRISPR/Cas9 system in zebrafish. Scientific reports. 5, 8841 (2015).
  57. Prykhozhij, S., et al. Optimized knock-in of point mutations in zebrafish using CRISPR/Cas9. Nucleic Acids Res. 46, (17), (2018).
  58. Tessadori, F., et al. Effective CRISPR/Cas9-based nucleotide editing in zebrafish to model human genetic cardiovascular disorders. Disease Model Mechanisms. 11, (10), (2018).
  59. Armstrong, G., Liao, M., You, Z., Lissouba, A., Chen, B., Drapeau, P. Homology Directed Knockin of Point Mutations in the Zebrafish tardbp and fus Genes in ALS Using the CRISPR/Cas9 System. PLoS ONE. 11, (3), (2016).
  60. Friedrich, R. W., Jacobson, G. A., Zhu, P. Circuit Neuroscience in Zebrafish. Current Biology. 20, (8), (2010).
  61. Friedrich, R. W., Genoud, C., Wanner, A. A. Analyzing the structure and function of neuronal circuits in zebrafish. Frontiers in Neural Circuits. 7, (2013).
  62. Scott, E. K., et al. Targeting neural circuitry in zebrafish using GAL4 enhancer trapping. Nature Methods. 4, (4), 323-326 (2007).
  63. Asakawa, K., Kawakami, K. Targeted gene expression by the Gal4-UAS system in zebrafish. Development Growth and Differentiation. (2008).
  64. Lloyd, E., et al. Evolutionary shift towards lateral line dependent prey capture behavior in the blind Mexican cavefish. Developmental Biology. (2018).
Manipulation de la fonction du gène en mexicain Agassizii
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Stahl, B. A., Jaggard, J. B., Chin, J. S. R., Kowalko, J. E., Keene, A. C., Duboué, E. R. Manipulation of Gene Function in Mexican Cavefish. J. Vis. Exp. (146), e59093, doi:10.3791/59093 (2019).More

Stahl, B. A., Jaggard, J. B., Chin, J. S. R., Kowalko, J. E., Keene, A. C., Duboué, E. R. Manipulation of Gene Function in Mexican Cavefish. J. Vis. Exp. (146), e59093, doi:10.3791/59093 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter