Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Manipolazione di funzione del Gene in caverna messicano

Published: April 22, 2019 doi: 10.3791/59093

Summary

Descriviamo gli approcci per la manipolazione dei geni nel sistema modello evolutivo Astyanax mexicanus. Sono descritti tre diverse tecniche: transgenesi Tol2-mediata, mirata manipolazione del genoma utilizzando CRISPR/Cas9 e atterramento di espressione utilizzando morpholinos. Questi strumenti dovrebbero facilitare l'indagine diretta di geni alla base della variazione tra forme di superficie e caverne.

Abstract

Grotta di animali forniscono un sistema convincente per indagare i meccanismi evolutivi e le basi genetiche alla base di cambiamenti in numerosi tratti complessi, tra cui la degenerazione degli occhi, albinismo, perdita di sonno, iperfagia ed elaborazione sensoriale. Specie di caverna da tutto il mondo visualizzare un'evoluzione convergente dei tratti morfologici e comportamentali a causa di pressioni ambientali condivisi tra sistemi differenti della caverna. Grotta diverse specie sono state studiate nell'impostazione del laboratorio. Il tetra messicano, Astyanax mexicanus, con forme di ipovedenti e non vedenti, ha fornito le comprensioni uniche nei processi biologici e molecolari che sono alla base dell'evoluzione dei tratti complessi ed è ben studiato come sistema modello emergenti. Mentre in a. mexicanus, sono stati identificati geni che regolano l'evoluzione di diversi processi biologici, la possibilità di convalidare un ruolo per singoli geni è stata limitata. L'applicazione della transgenesi e modifica del gene tecnologia ha il potenziale per superare questo ostacolo significativo e per studiare i meccanismi alla base dell'evoluzione dei tratti complessi. Qui, descriviamo una metodologia diversa per la manipolazione di espressione genica in a. mexicanus. Approcci includono l'uso di morpholinos, Tol2 transgenesi, e modelli di sistemi gene-editing, comunemente utilizzati in zebrafish e altri pesci di funzione del gene in a. mexicanusdi manipolare. Questi protocolli includono le descrizioni dettagliate delle procedure di allevamento temporizzata, la raccolta di uova fecondate, iniezioni e la selezione di animali geneticamente modificati. Questi approcci metodologici permetterà per l'indagine dei meccanismi genetici e neurali che l'evoluzione dei diversi tratti in a. mexicanus.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Da allora di Origine delle speciedi Darwin1, gli scienziati hanno acquisito profonde intuizioni come tratti sono modellati evolutivamente in risposta a pressioni ambientali ed ecologiche definite, grazie alla grotta organismi2. Il tetra messicano, a. mexicanus, consiste di eyed popolazioni 'superficie' ancestrale che popolano fiumi tutto il Messico e il Texas del sud e di almeno 29 popolazioni geograficamente isolate di morph grotta derivata che abitano la Sierra del Abra e altre zone del Messico nord-orientale3. Un numero di tratti di grotta-collegati è stato identificato in a. mexicanus, compreso consumo di ossigeno alterata, depigmentazione, perdita degli occhi e alterata alimentazione e foraggiamento comportamento4,5,6, 7,8,9. A. mexicanus presenta un potente modello per studiare i meccanismi di evoluzione convergente a causa di una ben definita storia evolutiva, una dettagliata caratterizzazione dell'ambiente ecologico e la presenza di indipendentemente evoluto grotta popolazioni10,11. Molti dei tratti grotta-derivati che sono presenti nella caverna, compresa la perdita dell'occhio, perdita di sonno, alimentazione, perdita di scolarizzazione è aumentato, ridotto di aggressione e ridotto le risposte allo stress, più volte si sono evoluti attraverso origini indipendenti, spesso utilizzando diverse vie genetiche tra grotte8,12,13,14,15. Questo ripetuto evolution è un aspetto potente del sistema a. mexicanus e può fornire spaccato la questione più generale dei sistemi genetici come può essere perturbato per generare fenotipi simili.

Mentre l'applicazione della tecnologia genetica per l'indagine meccanicistica della funzione del gene è stato limitato in molte specie di pesci (tra cui a. mexicanus), gli avanzamenti recenti in zebrafish forniscono una base per lo sviluppo della tecnologia genetica nei pesci 16,17,18,19,20. Numerosi strumenti sono ampiamente utilizzati in zebrafish per manipolare l'espressione genica e l'attuazione di queste procedure a lungo sono stati standardizzati. Ad esempio, l'iniezione di morpholino oligos (MOs) a livello di singola cellula selettivamente blocca RNA e impedisce la traduzione per una breve finestra temporale durante sviluppo21,22. Inoltre, modifica del gene approcci, come cluster regolarmente intervallate brevi ripetizioni palindromi (CRISPR) / CRISPR-collegato della proteina 9 (Cas9) e nucleasi di trascrizione attivatore-come effettore (TALEN), consentire per la generazione delle omissioni definite o, in alcuni casi, gli inserimenti attraverso una ricombinazione in genomi19,20,23,24. Transgenesi sono utilizzata per modificare l'espressione genica stabile o funzione in un modo specifico di cellula-tipo. Il sistema Tol2 viene utilizzato efficacemente per generare animali transgenici di pre transposase mRNA con un plasmide DNA Tol2 contenente un transgene25,26. Il sistema Tol2 utilizza la transposase Tol2 di medaka per generare gli inserimenti di germline stabile di transgenici construct17. Generazione di Tol2 transgenetica coinvolge pre un plasmide contenente un transgene affiancato da siti di integrazione Tol2 e mRNA per Tol2 transposase17. Questo sistema è stato utilizzato per generare una matrice di linee transgeniche in zebrafish e il suo utilizzo ha recentemente ampliato ai sistemi modello emergente addizionali, tra cui ciclidi, killifish, spinarello e, più recentemente, la caverna messicano27, 28,29,30.

Mentre la caverna è un affascinante sistema biologico per meccanismi di comprensione dell'evoluzione del tratto, sua piena capacità come un modello evolutivo non è stata pienamente sfruttata. Ciò è parzialmente dovuto un'incapacità di manipolazione genetica e cellulare direttamente funzionare31. Geni candidati tratti complessi di regolazione sono stati identificati usando quantitative trait loci (QTL) gli studi, ma la convalida di questi geni candidati è stato difficile32,33,34. Recentemente, transitoria atterramento utilizzando morpholinos, gene editing utilizzando sistemi CRISPR e TALEN e l'uso di Tol2-transgenesi mediate sono stati usati per studiare le basi genetiche alla base di un numero di tratti35,36,37 ,38. L'implementazione e la standardizzazione di queste tecniche vi permetterà per le manipolazioni che interrogano le basi molecolari e neurali di tratti biologici, tra cui la manipolazione della funzione genica, l'etichettatura delle popolazioni di cellule definito, e l'espressione dei reporter funzionale. Considerando che l'efficace attuazione di questi strumenti genetici per manipolare gene o funzione cellulare è stata dimostrata in sistemi modello emergente, protocolli dettagliati sono ancora carenti in a. mexicanus.

A. mexicanus forniscono approfondimenti critici i meccanismi dell'evoluzione in risposta ai cambiamenti ambientali e presentare l'opportunità di identificare nuovi geni che regolano diversi tratti. Una serie di fattori suggeriscono che a. mexicanus è un modello estremamente trattabile per l'applicazione degli strumenti genomici stabiliti attualmente disponibile in modelli genetici consolidati, tra cui la possibilità di mantenere facilmente il pesce nei laboratori di grandi dimensioni di covata, trasparenza, un genoma sequenziato e analisi comportamentali definiti39. Qui, descriviamo una metodologia per l'uso di morpholinos, transgenesi e gene editing in superficie e Grotta di popolazioni di a. mexicanus. La più ampia applicazione di questi strumenti in a. mexicanus consentirà un'indagine meccanicistica di processi molecolari che sono alla base dell'evoluzione delle differenze inerenti allo sviluppo, fisiologiche e comportamentali tra caverna e pesci di superficie.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Morpholino oligo design

Nota: Sequenze per a. mexicanus sono disponibili attraverso National Center di Biotechnology Information (NCBI) Gene e NCBI SRA (https://www.ncbi.nlm.nih.gov), nonché dal browser genoma Ensembl (https://www.ensembl.org). Quando si progetta un morpholino per l'uso in entrambe le forme caverna-dimora e di superficie, è fondamentale per identificare qualsiasi variazione genetica tra il morphing in questa fase, quindi queste regioni genetiche possono essere evitate come bersagli per morpholinos. Qualsiasi variazione polimorfica all'interno di un sito di destinazione di morpholino può condurre all'associazione inefficace. Il design è simile ad altri sistemi di pesce, come pesce zebra e precedentemente è stato indicato di lavorare efficacemente in a. mexicanus21,36,40.

  1. Progettazione di morpholinos traduzione-blocco
    Nota: Traduzione-blocco morpholinos bloccare traduzione legandosi al sito inizio endogeno e ostacolare traslazionale macchinari da associazione la sequenza di mRNA attraverso impedimento sterico.
    1. Identificare la regione di codificazione del gene dell'obiettivo a partire con il sito di inizio ATG.
    2. Registrare le prime 25 coppie di basi della sequenza dell'obiettivo di copia-e-incolla la sequenza in un quaderno di laboratorio o editor di testo.
    3. Utilizzando software online (ad esempio, http://reverse-complement.com) o traduzione manuale, generare il complemento inverso della sequenza di destinazione. Salvare il complemento inverso risultante in un editor di testo o il taccuino del laboratorio.
    4. Ordinare un morpholino con la sequenza inversa complemento da una società che genera oligonucleotidi morfolino. Vedi Tabella materiali per le aziende.
  2. Progettazione di morpholinos bloccante della giuntura
    Nota: Splice-blocco morpholinos bloccare splicing e, quindi, prevenire la formazione di una molecola di mRNA maturo. Questo fornisce un metodo alternativo per atterramento quando i siti di inizio non sono ben definiti, o un approccio più ottimale quando si desidera ottenere convalida di atterramento via reazione a catena della polimerasi (PCR). Questo vantaggio di morpholinos bloccante della giuntura (sopra ATG-blocco MOs) è che l'esclusione dell'esone o l'inclusione dell'introne può essere facilmente valutata con trascrittasi inversa (RT)-PCR e dimensione differenze fruite su un gel. RT-PCR ed elettroforesi su gel per determinare l'efficacia di morpholino dovrebbe essere fatto utilizzando le procedure standard di laboratorio.
    1. Identificare la sequenza di pre-mRNA del gene target. Utilizzare le informazioni disponibili dal genoma a. mexicanus via NCBI o Ensembl per determinare introne-esone confini33.
    2. Target dell'esone-introne (donatore della giuntura) o siti di contorno (accettore di splice) introne-esone per esclusione inclusione o esone introne.
      Nota: Lo spliceosoma normalmente gli obiettivi di una sequenza di "GU" (U1 destinazione) dell'introne al 5' impiombi il luogo e una sequenza di AG" "al luogo della giuntura intronic di (U2 destinazione) 3'. In condizioni normali, lo spliceosoma U1 e U2 subunità associare questi siti di destinazione nella sequenza di pre-mRNA per splicing corretto per verificarsi. Tuttavia, se una di queste sequenze di destinazione è bloccata da un morpholino, lo spliceosoma avrà avanti al prossimo sito disponibile U1 o U2, causando sia un introne esclusione o essone nella sequenza di mRNA. Ciò comporterà la pianificazione/ottimizzazione, a seconda della natura del gene bersaglio21. In genere, bloccando un sito interno U1 reindirizza l'impiombatura al sito U1 disponibile successivo, causando un'asportazione di esone. In alternativa, bloccando la giunzione della giuntura prima o l'ultima causa un'inclusione introne perché non c'è nessun altro sito di reindirizzare l'impiombatura a. Utilizzare software di sequenza per prevedere l'effetto di varie esclusioni contro inclusioni. Le previsioni possono indicare potenziali frameshift o codoni di stop prematuri, che indica un sito di destinazione più efficace per rottura del mRNA.
    3. Una volta identificato il sito di destinazione, è possibile registrare la sequenza in un libro di laboratorio o editor di testo. Assicurarsi che il sito di destinazione è 25 paia di basi (bp).
    4. Utilizzando software online (ad esempio, http://reverse-complement.com) o traduzione manuale, generare il complemento inverso della sequenza di destinazione. La sequenza di record in un libro di laboratorio o editor di testo.
    5. Ordinare un morpholino con la sequenza inversa complemento da una società che genera oligonucleotidi morfolino. Vedi Tabella materiali per le aziende del campione.

2. Morpholinos iniettabile

Nota: Diverse concentrazioni o volumi di iniezione MO saranno necessario essere eseguiti per stabilire la concentrazione ottimale per iniettare. Quantità tipiche iniezioni sono 400 – 800 pg di MO. L'effetto di morpholino knockdown può persistere per fino a 6 di postinjection giorni.

  1. Ottenere il morpholino stock. Il morpholino stock arriva liofilizzato. Idratare e con sterile H2O prima dell'uso alla concentrazione stock desiderata (ad es., 4 mM). Conservare a-20 °C fino all'utilizzo.

3. CRISPR gRNA design, trascrizione in vitro e preparazione

  1. Progettazione di gRNA CRISPR
    Nota: gRNAs sono stati generati utilizzando ricerca precedentemente pubblicata da Varshney et al.40 e41di Wierson et al.
    1. Utilizzando un browser del genoma, identificare la regione di codificazione del gene di interesse. Utilizzando la sequenza genomic, identificare la sequenza di destinazione gRNA all'interno di un esone ricercando un 20 bp del nucleotide destinazione sequenziamento che cominciano con GG e seguito da una sequenza di PAM (NGG). Una regione del gene dopo l'inizio (ATG) sarà mirato.
      Nota: Se una sequenza di destinazione con GG all'estremità 5' non può essere trovata nel desiderato esone del gene, uno o entrambi i G's può essere sostituito per i nucleotidi primi e la secondo all'estremità 5' della sequenza. Tuttavia, le due G's deve essere incorporata in oligo, come questi sono richiesti per la trascrizione di T7.
    2. Progettare e ordinare un oligonucleotide di gene-specific (oligo r: 5'-TAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGC-3'). Aggiungere la sequenza bersaglio di gene-specifico 20 bp gRNA (in grassetto) senza la sequenza di PAM tra una sequenza del promotore T7 (rossa) e una sequenza di sovrapposizione utilizzato tempri un secondo oligonucleotide (blu). Tempri e amplificare (Vedi punto 3.2.1) questo oligo A e una seconda oligo (oligo b: 5'-GATCCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTT AACTTGCTATTTCTAGCTCTAAAAC-3') per generare il modello gRNA utilizzato per la trascrizione.
      Nota: È lo stesso per ogni reazione e bisogno di essere ordinato solo 1x Oligo B.
  2. trascrizione e gRNA preparazione
    1. Tempri e amplificare i oligos. Includono i seguenti primer per amplificare il gRNA al fine di aumentare la resa: 5'-TAATACGACTCACTATA-3' (T7 primer) e 5'-GATCCGCACCGACTCGGTG-3' (3' gRNA primer). Eseguire una PCR utilizzando Thermococcus Thermococcus (KOD) polimerasi.
      Nota: Per entrambi primer oligo A e oligo B, 10 cicli è consigliato per una buona resa. Un protocollo dettagliato può essere trovato in Wierson et al.41.
    2. Trascrivere il gRNA usando i kit di trascrizione in vitro commercialmente disponibili (Vedi Tabella materiali). Questo viene fatto attraverso modifiche il produttore'protocollo s pubblicato da Klaassen et al42.
    3. Precipitare, lavare e risospendere il gRNA come descritto da Klaassen et al42.
      Nota: Il gRNA deve essere risospeso in acqua RNAsi-libera per prevenire il degrado.
    4. Si trascrive la concentrazione di gRNA, che possa essere determinata utilizzando uno spettrofotometro. Valutare la qualità del RNA mediante l'esecuzione di 2 µ l su un gel di agarosio. Aliquota RNA per evitare congelamento/scongelamento e conservare a-80 °C fino a immediatamente prima le iniezioni.
  3. Trascrizione e preparazione Cas9
    1. Cas9 mRNA può essere trascritto usando i kit di trascrizione in vitro commercialmente disponibili (Vedi Tabella materiali) come descritto in precedenza43. Utilizzare la versione nls-Cas9-nls43.
    2. Si trascrive la concentrazione del gRNA e valutarne la qualità tramite l'esecuzione di 2 µ l su un gel di agarosio. Aliquota RNA per evitare la decomposizione che si pone nei diversi cicli di gelo-disgelo e conservare le aliquote a-80 °C.

4. preparazione di costrutti Tol2, transposase Tol2 e transgenesi

  1. Preparare Tol2 transgene costrutti per l'iniezione.
    Nota: Abbiamo utilizzato con successo pubblicato/disponibile zebrafish e medaka costruisce in a. mexicanus. Questi costrutti sono completamente funzionali in a. mexicanus, probabilmente a causa del livello elevato di omologia di sequenza (fare riferimento al repository AddGene e la rete di informazioni di Zebrafish [ZFIN] databases per costrutti disponibile). I frammenti del promotore di zebrafish hanno espresso i transgeni nei tessuti previsti quando utilizzato in a. mexicanus.
    1. Acquisire Tol2 costrutti o generare plasmide con un promotore tessuto-specifici, il transgene desiderato e Tol2 braccia (Vedi Kwan et al.44). Al ricevimento, sequenza il costrutto per convalidare il plasmide.
    2. Eseguire una midiprep per costrutti secondo il produttore'degli orientamenti. Eluire il plasmide finale privo di RNasi H2O, determinare la concentrazione con uno spettrofotometro, diluire la concentrazione a 100300 ng /μL e aliquota e store i costrutti a-20 °C.
  2. Digerire Tol2 transposase plasmide e sintetizzare mRNA.
    1. Ottenere una copia del plasmide transposase Tol2 (pCS-zT2TP) come modello per la generazione di mRNA Tol245.
    2. Midiprep pz-zT2TP costruire secondo il produttore'degli orientamenti. Eluire esso in un basso volume di acqua RNAsi-libera o buffer (~ 50 μL). Conservare le aliquote a-20 °C.
    3. Digerire il plasmide Tol2 usando un enzima di restrizione.
      1. Eseguire una raccolta di limitazione su 10 µ g di plasmide circolare pCS-zT2TP utilizzando la tabella 1.
      2. Dividere la reazione in 250 reazioni di μL e incubare le reazioni durante la notte a 37 °C in un termociclatore.
      3. Il giorno seguente, inattivare l'enzima riscaldandolo a 65 °C per 20 min.
      4. Purificare il plasmide linearizzato immediatamente dopo il digest, utilizzando commercialmente disponibili PCR Kit di purificazione (Vedi Tabella materiali) per la Guida di riferimento di produttori' . Eluire il plasmide in 15 μL di RNAsi-libera H2O e determinare la concentrazione del prodotto utilizzando uno spettrofotometro.
      5. Eseguire 1 μL di plasmide digerito e 1 μL del plasmide non tagliato su un 1,5% di agarosio gel per confermare il plasmide linearizzato.
    4. Eseguire una trascrizione in vitro di Tol2 mRNA.
      1. Utilizzare 1 µ g di plasmide linearizzato pz-zT2TP come un modello per la trascrizione. Seguire il produttore'degli orientamenti per la trascrizione in vitro (Vedi Tabella materiali), come descritto nella tabella 2.
      2. Incubare a 37 °C in un termociclatore per il produttore'degli orientamenti.
      3. Aggiungere 1 µ l di DNasi, incubare a 37 °C in un termociclatore per il produttore'degli orientamenti.
      4. Eseguire precipitazioni di cloruro di litio per protocollo di kit di trascrizione. Risospendere il pellet di RNA in ~ 2030 μL di RNAsi-libera H2O.
      5. Determinare la concentrazione del prodotto utilizzando uno spettrofotometro e registrare la qualità di RNA.
      6. Diluire il prodotto a ~ 100300 ng / µ l e aliquota in 5 campioni di 10 μL diper evitare ripetuti di congelamento-scongelamento. Conservarli a-80 °C fino all'utilizzo.
        Nota: È possibile controllare 12 µ l di purificato Tol2 mRNA per sbavatura/band con elettroforesi su gel.

5. microiniezioni

  1. Preparazione di strumenti generali per iniezioni
    Nota: Le procedure descritte in questa sezione sono stati descritti dettagliatamente da Kowalko et al.46, e qui viene presentata una panoramica con modifiche minori.
    1. Generare piastre iniezione di agarosio 3% caldo versando disciolto in acqua sistema di pesci in un mL 100 di Petri. Posizionare un stampaggio ad iniezione di uovo nell'agarosio appena spillata a fare pozzi per le uova di pesce. Posizionare il lato dello stampo in agar a un angolo di 45° e, quindi, abbassarlo lentamente in agarosio; abbassare lentamente la muffa in un angolo evita aria rimanere intrappolato sotto lo stampo. Rimuovere delicatamente lo stampo una volta l'agarosio è solidificato. Le piastre possono essere memorizzate, sigillato, a 4 °C fino a 1 settimana.
    2. Tirare aghi dai vasi capillari di vetro borosilicato per iniezione in un estrattore di elettrodo/aghi secondo il produttore'degli orientamenti. Questo protocollo varierà per estrattore pipetta; Tuttavia, un programma di esempio tirando ago può essere trovato nella tabella 3.
      Nota: Ottimizzare l'ago è importante per iniezioni, come gli aghi che sono troppo lunghi saranno piegare piuttosto che penetrare in modo pulito l'uovo.
    3. Fare pipette in vetro di grosso calibro per il trasferimento di uovo rompendo pipette in vetro standard, quindi l'apertura è abbastanza grande per le uova. Utilizza un bruciatore di Bunsen, polacco alla fine rotta del vetro esponendo alla fine delle pipette rotte alla fiamma fino a quando non è liscia.
  2. Installazione di allevamento
    Nota: Ci sono diversi protocolli utilizzati per l'allevamento a. mexicanus. Per un protocollo dettagliato, vedere Borowsky39. Avviare il setup di allevamento 1 settimana prima le iniezioni.
    1. Il giorno 1, posizionare due o tre femmine e tre o quattro maschi in una vasca singola 10 galloni mantenuta a 24 ± 1 °C.
    2. Nei giorni 17, aumentare l'alimentazione di ~ 3 volte al giorno. Garantire che la dieta include cibo vivo, come vermi neri e gambero di salamoia.
    3. Il giorno 6, aggiungere un riscaldatore serbatoio singolo impostato a 27 °C. Lab serbatoio le temperature variano; Pertanto, si tratta di un aumento di 2parente di 3 °C alla temperatura normale del carro armato.
    4. La sera del giorno 7, ovvero la sera (zeitgeber [ZT] 911) della notte di iniezione, accuratamente pulire i serbatoi con una spugna imbevuta di acqua e rimuovere qualsiasi cibo in eccesso o detriti utilizzando una rete a maglia fine o un sifone.
    5. La notte del giorno 7, avviare il controllo per le uova di pesce superficie alle ZT15 e continuare a controllare ogni 1530 min fino a ZT18. Per caverna, avviare il controllo per le uova alla ZT17 e continuare a controllare ogni 1530 min fino a ZT20.
      Nota: I tempi sono basati su un 14:10 h luce: ciclo scuro utilizzando zeitgeber tempo. Tempi di allevamento sono stime e laboratori individuali devono comunicare l'orario esatto. È fondamentale per raccogliere le uova subito dopo sono rilasciato/fertilizzato per iniettare loro a livello di singola cellula.
  3. Raccolta di uova di cella singola fase
    1. La notte in cui è previsto l'allevamento, esaminare i carri armati ogni 1530 min e monitor per le uova nella parte inferiore del serbatoio. Le uova appaiono traslucide, misura circa 1 mm di diametro.
    2. Utilizzare una rete a maglia fine dei pesci per raccogliere uova e trasferirli in una ciotola di vetro riempita di acqua del sistema di pesce fresco. Esaminare le uova sotto un microscopio per confermare che le uova sono in fase di un cella.
    3. Utilizzando pipette in vetro, trasferire uova cella singola per le piastre di iniezione. Pipette in vetro sono necessari in questa fase, come le uova si attaccano alla plastica.
    4. Utilizzando una pipetta, rilasciare con attenzione le uova nei pozzetti della piastra iniezione dell'agarosi dalla sezione 5.1. Riempire le righe della piastra iniezione preriscaldata (a temperatura ambiente) con il numero massimo di uova (3040 per ogni riga e fino a cinque righe). Intere righe aiutano a mantenere le uova di muoversi durante le iniezioni. Mantenere le uova idratate sulla piastra con una piccola quantità di acqua di pesci sistema iniezione fino al compimento delle iniezioni.
  4. Installazione di Pico-iniezione e iniezione generale ottimizzazione linee guida
    1. Recupero informazioni gli aghi per iniezione utilizzando una pipetta di gel-caricamento suggerimenti che corrispondono all'interno del capillare o usando puntali standard micropipetta e l'aggiunta di un bolo di 4 µ l di2 fino alla fine. Una volta che l'ago è pieno, è possibile utilizzare pinze per tagliare la lunghezza in eccesso dall'ago per iniezione.
    2. Eseguire microiniezioni con un ago montato in un micromanipolatore, collegato ad un microinjector picolitri.
    3. Impostare il tempo di iniezione di 0.03 s e la pressione fuori a ~0.0 psi. La pressione di iniezione varierà di conseguenza con le differenze secondarie fra gli aghi, così ottimizzare per ottenere un bolo di iniezione nL ~1.0.
      Nota: La pressione di iniezione è spesso nella gamma di ~ 1030 psi.
    4. Standardizzare il bolo iniezione iniezione in olio minerale e misurando il bolo dimensione con una slitta micrometrica per ottenere un ~ 11.5 volume di iniezione di nL. Regolare la pressione di iniezione (psi) per aumentare o diminuire il volume del bolo.
    5. Attingere acqua al largo della parte superiore delle uova utilizzando un tessuto di laboratorio.
      Nota: Il corion uovo Astyanax è leggermente più difficile da penetrare rispetto alle uova di pesce zebra. Troviamo che l'acqua al largo della parte superiore delle uova di disegno aiuta a facilita la penetrazione dell'ago nella cellula uovo. Ottimizzazione di piastra può consentire per ~ 200 uova su un piatto unico.
    6. Utilizzare il micromanipolatore di penetrare ogni uovo con l'ago e iniettare direttamente nel tuorlo. Una volta posizionata nel tuorlo, iniettare l'uovo premendo il pedale del piede inject pulsante o iniezione.
      Nota: Un piatto completo può essere iniettato all'interno di ~ 15 min. La fase di cella singola dura per ~ 40 min.
  5. Iniezione di morpholinos
    Nota: La quantità di morpholino necessaria per atterramento senza causare tossicità dovrà essere ottimizzato al gene bersaglio; Tuttavia, una concentrazione di 400 pg è un buon punto di partenza.
    1. Preparare morpholino affinché 400 pg di morpholino sarà iniettato per ogni uovo. Disgelo morpholino sul ghiaccio. La soluzione iniettabile è costituita di morpholino (alla concentrazione desiderata), privo di RNasi H2O o Danieau's soluzione e rosso fenolo (10% del volume finale). Per un esempio, vedere la tabella 4.
    2. Iniettare 1 nL per embrione.
  6. Iniezioni di CRISPR
    1. Preparare il RNA affinché 25 pg di gRNA e 300 pg di Cas9 mRNA totale verrà iniettati per embrione. Per una miscela di iniezione CRISPR/Cas9 campione, cfr. tabella 5.
    2. Iniettare 2 nL di gRNA/Cas9 mRNA per embrione direttamente nell'embrione.
  7. Iniezione di transposase Tol2 e plasmide Tol2-affiancata per transgenesi
    1. Scongelare transposase mRNA e plasmide Tol2 su ghiaccio. Combinare Cas9 mRNA (a 25 ng / µ l), desiderato Tol2 costrutto (25 ng /μL) e rosso fenolo (10% del volume finale) in acqua RNAsi-libera. Per una miscela di iniezione di campione Tol2 transgenesi, vedere tabella 6.
    2. Conservare la soluzione per iniezione e aghi sul ghiaccio per evitare la degradazione del mRNA. Iniettare 1 nL in volume per ogni embrione.

6. allevamento e screening iniettato pesce

  1. Allevamento di pesci iniettato
    1. Dopo le uova vengono iniettate, immediatamente di trasferirli a ciotole di vetro (10 x 5 cm) riempito con ~ 200 mL di acqua sistema di pesci. Le uova sono facilmente risciacquabile immergendo le piastre di iniezione in ciotole piene di pesce acqua e risciacquo le uova con una pipetta.
    2. Posto di ~ 5080 embrioni iniettati per ciotola e allevarli a 2224 °C.
    3. Pulire le ciotole con iniettato pesce 2 volte al giorno per rimuovere embrioni morti e modificare ~ 20% dell'acqua su una base quotidiana.
    4. Ulteriori allevamento viene eseguita secondo protocolli precedentemente pubblicati39.
  2. Screening degli individui morpholino-iniettato
    1. Visualizzare gli animali sotto un microscopio stereoscopico a schermo per i fenotipi. L'effetto di morpholinos può persist fino a ~ 5 giorni postinjection21.
    2. Misura fenotipi comportamentali presso postinjection 4 giorni.
  3. Screening per CRISPR indels
    1. Disegnare primers per amplificare il DNA di genomic intorno al sito di destinazione. Disegnare primers, in modo che il prodotto di PCR di destinazione è di circa 100125 bp.
      Nota: ad esempio, per il locus oca2 , la regione che circonda il sito di destinazione gRNA è stata amplificata utilizzando il forward primer 5'-CTCCTCTGTCAGGCTGTGC-3' e il reverse primer 5'-GAAGGGGATGTTGTCTATGAGC-3' per una lunghezza di prodotto PCR di 105 bp.
    2. Sacrificare embrioni o pinna pesci adulti clip secondo il protocollo istituzionale degli animali.
    3. Raccogliere embrioni o pinne dissecati in provette per PCR ed estrarre il DNA ed esecuzione dei protocolli di PCR di PCRs. campione per gli iniettori di gene-specific possono essere trovati in Ma et al.35.
    4. Per valutare per mutagenesi, eseguire 5 µ l di prodotto di PCR su un gel di agarosio al 3% a 70 V per 3 h. Wild-type (nonmutagenized) del DNA si tradurrà in un prodotto PCR come un gruppo distinto. DNA mutante si tradurrà in una band untuosa sul gel.
    5. Per determinare la sequenza degli alleli del mutante, TA clonare il prodotto PCR secondo il produttore's istruzioni, scegliere colonie e culture miniprep. Inviare il DNA risultante per il sequenziamento.
    6. Per stabilire e mantenere linee di pesce trasmettendo gli alleli del mutante, attraversare pesci adulti iniettato di selvaggio-tipo pesce e schermo 510 embrioni per determinare se uno qualsiasi della prole trasportare un allele del mutante del gene seguendo passaggi 6.3.1-6.3.6.
      Nota: Gli individui di1 F diverso dal pesce stesso del fondatore F0 possono trasportare diverse mutazioni. Garantire linee mutanti sono in sequenza per ottenere le mutazioni possono produrre gli alleli che sono fuori dall'inquadratura.
    7. Identificare il pesce che trasportano un allele del mutante di PCR usando l'analisi di banda untuosa (misure 6.3.1-6.3.6) o di progettazione degli iniettori PCR allele-specifico che amplificheranno mutante e bande di selvaggio-tipo (Figura 2).
    8. Una volta stabilita una linea di pesce, gli alleli del mutante di homozygose per testare per fenotipi recessivi.
  4. Screening per individui positivi transgenici
    Nota: Utilizzando costrutti contenenti un bollitore fluorescente è consigliato per snellire lo screening per individui positivi transgenici. Tuttavia, i metodi di screening standard di PCR può essere utilizzato a schermo per la trasmissione.
    1. Visualizzare le proteine fluorescenti tessuto-specifica nel pesce0 F più presto di postinjection 2 giorni, con un ambito di dissezione di epifluorescenza.
      Nota: L'espressione nelle larve0 F è mosaico, e gli individui positivi possono avere una gamma di fenotipi di espressione.
    2. Mantenere gli individui positivi come F0 fondatore pesci.
    3. Quando F0s raggiungono la maturità, incrocio fondatori pesce a nontransgenic individui che deriva da uno stesso stock di popolazione/laboratorio. Schermo F1 prole usando lo stesso protocollo, come descritto al punto 6.2.
      Nota: L'espressione nelle larve di F1 è uniforme e garantisce la coerenza fra i fratelli germani1 F.
    4. Poiché non è Tol2 integrazione sito-mediata e integrazione può variare tra fondatori, selezionare F1 fratelli derivato un singolo fondatore0 F e incrociarsi esprimendo la positiva fratelli germani di1 F per generare F2s. Questa prole sarà la base per una linea stabile.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Popolazioni più della caverna-dimora a. mexicanus mostrano ridotta sonno e veglia/attività aumentata rispetto al loro conspecifici di superficie-abitazione14. Ipocretina/orexina (HCRT) è un neuropeptide altamente conservato, che agisce per aumentare lo stato di Veglia, e aberrazioni nella via HCRT causano narcolessia in esseri umani ed altri mammiferi47,48. Precedentemente abbiamo dimostrato quella grotta a. mexicanus hanno aumentato espressione del peptide HCRT, suggerendo che un'aumentata espressione di questo peptide può essere alla base della perdita di sonno nella caverna38. L'atterramento di MO di hcrt espressione fornisce un approccio potente per esaminare direttamente l'effetto dell'espressione aumentata hcrt mediando la perdita di sonno nella caverna.

Per esaminare la relazione tra espressione di hcrt e sonno, abbiamo progettato un morpholino traduzione-blocco. Il MO obiettivi le prime 25 bp dell'essone uno, tra cui l'ATG avviare sito (Figura 1A,B). Come controllo, abbiamo utilizzato un controllo di MO strapazzato commercialmente disponibili (Figura 1B). Usando l'algoritmo BLAST su NCBI, abbiamo confermato che non ci sono effetti fuori bersaglio per entrambi MO in tutto il genoma (dati non mostrati). A. mexicanus superficie pesce e Pachón caverna sono stati allevati e le loro uova sono stati raccolti e poi iniettate con 400 pg di MO in un 1 nL-volume nella fase di un cella (Figura 1,D). Il pesce erano sollevato a 4 dpf e quindi misurato per attività e il comportamento di sonno.

Grotta a. mexicanus iniettato con il controllo attività significativamente più locomotrice MO ha esibito e ridotto di sonno su un periodo di 24 h rispetto alla superficie pesce anche iniettato con il MO strapazzata (Figura 1E,F), non suggerendo alcun effetto dei iniezioni di morpholino di controllo come i risultati sono coerenti con i modelli di sonno e di attività precedentemente pubblicati in ogni morfotipo (t = 5.021, df = 88, p < 0,0001). L'iniezione di HCRT-MO ha avuto scarso effetto sul sonno in superficie pesce rispetto ai pesci di controllo-iniettato (t = 0.17, df = 88, p > 0,99). Al contrario, hcrt atterramento mediante iniezione di MO ha avuto un effetto significativo sul sonno in caverne pesce. Le larve di caverna Pachón mostrato meno di una quadruplice riduzione nell'attività locomotrice e dormono quasi due volte più che controllare le larve di Pachón (Figura 1E,F; t = 2.694, df = 88, p < 0,05). Un confronto delle attività locomotrice e sonno in pesci di superficie e caverna-dimora di MO-atterramento ha rivelato importi paragonabili di locomozione e sonno (Figura 1E, F). Questi dati forniscono un collegamento diretto tra hcrt espressione e perdita di sonno e forniscono un metodo per interrogare i meccanismi biologici per la perdita di sonno nel morphing di caverne evolutivamente derivato.

Perdita di pigmentazione è un segno distintivo della grotta organismi e popolazioni di Astianatte caverne multiple dimostrano perdita di pigmentazione. Albinismo in caverna Molino e Pachón è stata mappata utilizzando la mappatura QTL per una regione genomica contenente il gene, albinismo oculare 2 (oca2), suggerendo che le mutazioni in oca2 sono alla base di albinismo in caverna6.

Per convalidare oca2 come il locus causativo per albinismo in Pachón grotta morph, abbiamo utilizzato CRISPR/Cas9 gene editing per mutare questa regione in popolazioni di pesci di superficie. Poiché esone 21 viene eliminato in Molino pesce6, abbiamo progettato una gRNA di indirizzare questa regione del gene (Figura 2A). È la sequenza genomic, inclusi la sequenza di destinazione gRNA e il PAM (in grassetto), 5'-GGTCATGTGGGTCTCAGCTTTGG-3 '. Questa sequenza di destinazione (senza la sequenza di PAM) è stata utilizzata per generare una gRNA per mutagenesi mirata. Allevatori di superficie sono state fatte per accoppiarsi, e gli embrioni risultanti sono stati raccolti nella fase uno-cella. Embrioni in fase uno-cellula sono stati iniettati con Cas9 mRNA e gRNA-targeting oca2, e gli animali iniettati sono stati sollevati all'età adulta43. Gli adulti iniettati sono state fatte da accoppiare ai pesci di superficie di selvaggio-tipo, e gli embrioni da questi incroci sono stati genotipizzati per determinare la germe-linea di trasmissione, utilizzando primers dal punto 6.3.1. Abbiamo ordinato un allele mutante oca2 ed abbiamo identificato un'omissione di bp 2 germe-linea-trasmessi in oca2 (Figura 2B,C). Per facilità di genotipizzazione, abbiamo progettato il primer allele-specifici per identificare gli alleli wild-type e mutanti (Figura 2D) e pesce genotipizzati, usando la PCR seguita da elettroforesi del gel (Figura 2E). Abbiamo incrossed superficie pesce eterozigote per questo allele mutante oca2. La prole risultante sono stata pigmentata o albino (Figura 2F-io). Gli individui pigmentati erano wild-type o eterozigoti del locus oca2, mentre gli individui albino erano omozigote mutante (Figura 2E). Questi dati forniscono un collegamento diretto tra il luogo del gene oca2 e l'albinismo in a. mexicanus caverna.

Una miriade comportamenti come il sonno, alimentazione e stress differiscono nella caverna a. mexicanus relativa superficie conspecifici, eppure le determinanti di un neurone sottostante tra morph rimangono poco chiare. Formazione immagine del calcio del intero-cervello fornisce un potente approccio imparziale per l'esame di correlazioni tra attività neurale alterata e comportamento modificato. Abbiamo generato superficie pesce e caverna con un'espressione di un neurone vicino-ubiquitaria dell'indicatore codificato geneticamente calcio, GCaMP6s, utilizzando reagenti ampiamente usati nella ricerca di zebrafish. ELAV-like neurone-specific RNA-binding protein 3 (elavl3) è espresso in modo endogeno nei neuroni appena differenziati in tutto il sistema nervoso centrale49 ed è stato usato in zebrafish per guidare l'espressione di proteine in tutta la maggior parte del sistema nervoso50. Abbiamo ottenuto un costrutto Tol2 contenente ~2.8 kb zebrafish elavl3 promotore trascrizione a monte dell'indicatore codificato geneticamente calcio GCaMP6s (una fusione di proteina fluorescente verde [GFP], calmodulina e M13, una sequenza del peptide da miosina chinasi della luce-catena), affiancato alle estremità 5' e 3' con Tol2 siti (Tol2 -elavl3:GCaMP6s-Tol2)51.

A. mexicanus superficie pesce e Molino caverna sono stati allevati e gli embrioni risultanti erano coiniettati nella fase di cella singola con 25 ng/μL del Tol2 -elavl3:GCaMP6s-Tol2 costrutto e 25 ng/μL Tol2 transposase mRNA (Figura 3A). Alle 24 – 48 dpf, le larve sono state schermate per un'espressione transitoria di un neurone di GCaMP6s. Tali embrioni iniettati (F0) con un'espressione di GCaMP6s erano sollevati all'età adulta e backcrossed con selvaggio-tipo adulti derivati dalla stessa stirpe di superficie pesce o caverna. Gli adulti di F1 risultanti sono stati schermati per un'espressione stabile di espressione GCaMP6s, e quelli larve sono stati mantenuti per generare le righe stabili (Figura 3B,C). Perché ogni adulto di F1 con un'espressione stabile probabilmente ha integrato Tol2 -elavl3: GCaMP6s-Tol2 presso diversi siti genomici, ogni F1 viene designato un allele differente. Utilizzando questo approccio, abbiamo generato F1s stabile per pesci di superficie e Molino caverna popolazioni (Figura 3B,C), quindi permettente calcio live imaging per scoprire le differenze nell'attività neuronale cambiamenti comportamentali nella grotta di mediazione ambiente (Figura 3 C,D). Inoltre, questo approccio pone le basi per l'espressione dei transgeni molti ulteriori per la caratterizzazione e la funzione del gene in a. mexicanus di manipolare.

Figure 1
Figura 1: Morpholino atterramento di Hcrt riduce l'attività e aumenta il sonno in caverna. (A) traduzione-blocco morpholino obiettivi le prime 25 bp di Hcrt sequenza, compreso il sito di inizio ATG di codificazione. (B) Hcrt morpholino oligo (MO) e sequenze di controllo. (C) allineamento di ~ 200 uova per cella singola su stampi di uovo di agarosio per iniezione. (D) microiniezione di 1.0 nL della miscela di iniezione con indicatore rosso fenolo per la visualizzazione. La barra della scala = 0.5 mm. (E) Morpholino atterramento di Hcrt riduce l'attività (distanza totale percorsa) della caverna Pachón (t = 5.021, df = 88, p < 0,0001) ma non di superficie pesce (t = 1,318, df = 88, p > 0,72). (F) Knockdown aumenta sonno in caverna Pachón (t = 2.694, df = 88, p < 0,05) ma non ha alcun effetto sui pesci di superficie (t = 0.17, df = 88, p > 0,99). La barra della scala = 1 mm. Le barre di errore nei pannelli E ed F indicano l'errore standard della media. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2: CRISPR gene-editing di oca2 introduce albinismo in superficie, gli a. mexicanus. (A) schema dell'oca2 codifica regioni e guida RNA (gRNA) targeting esone 21 per l'editing di CRISPR-mediata del gene. (B) sequenziamento cromatogramma di selvaggio-tipo Oca2 + e (C) Oca2 - alleli del mutante. La scatola rossa nel pannello B indica la sequenza 2 bp, che manca nell'allele del mutante Oca2 - raffigurato nel pannello C. (D) mirati CRISPR introduce un'omissione di bp 2, endocrini Oca2 funzione. Gli iniettori sono progettati per lo screening genotipico di omissione di bp 2 nella prole di F0. (E) PCR ed elettroforesi su gel di Oca2 in superficie pesce selvaggio-tipo (dimensione di banda = 134 bp) e prole CRISPR F0-iniettato (dimensione di banda = 133 bp). Gli individui omozigoti o eterozigoti per la variante di selvaggio-tipo di Oca2 (Oca2 +) sono pigmentati, mentre F0s omozigoti per la delezione di bp 2 (Oca2 -) Porto di albinismo. (F) immagini del corpo intero di selvaggio-tipo di superficie (G) e pesce di superficie pesce con albinismo CRISPR-mediata. La barra della scala = 5 mm. (H e I) Magnified vista delle teste degli individui raffigurati nei pannelli F e G, rispettivamente. La barra della scala = 2 mm. per favore clicca qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3: Tol2 transgenesi di pan-di un neurone GCAMP6s consente l'imaging dal vivo dell'attività cerebrale in a. mexicanus. (A) Tol2-mediata di transgenesi in a. mexicanus. Co-iniezione di Tol2 mRNA e Tol2 -elav3l: GCAMP6s-Tol2 plasmide integra GCAMP6s transgene in F0 fondatori. Retroincroci allo stock originale di selvaggio-tipo pesce produce individui F1 con un espressione stabile di pan-di un neurone di GCAMP6s. (B e C) la prole risultante sono proiettata per un'espressione stabile mediante dissezione e microscopia confocale. Stabile TgAsty(elav3l: GCaMP6s) gli individui F1 sono stati stabiliti per superficie-(raffigurato nel pannello B) e caverne morfotipi (raffigurato nel pannello C). La barra della scala = 200 μm.  Clicca qui per visualizzare una versione più grande di questa figura.

Reagente Volume o quantità
10,0 μg di DNA del plasmide pz-zT2TP X μl
NEB CutSmart Buffer Μl 10.0
Degli enzimi NotI-HF Μl 2.0
Nuclease-free H2O X μl
BSA 1,0 µ l
Totale 100 μl

Tabella 1: Raccolta di limitazione del plasmide Tol2.

Reagente Volume o quantità
1,0 μg di DNA del plasmide linearizzato di pz-zT2TP X μl
tampone di reazione 10x Μl 2.0
2 x NTP/CAP Μl 10.0
Mix di enzima SP6 Μl 2.0
Privo di RNasi H2O X μl
Totale ≤20 μl

Tabella 2: sintesi In vitro di Tol2 mRNA.

Nome dell'impostazione Impostazione valore
Calore 510
Tirare 55
Velocità 100
Tempo 40
Pressione 500
Rampa 534

Tabella 3: Protocollo di pipetta-trazione del campione. 

Reagente Volume o quantità
Morpholino (Freezer stock @ 4mM) 1,0 µ l
Privo di nucleasi H2O o soluzione di Danieau 17.0 μl
Rosso fenolo Μl 2.0
Totale 20 μl

Tabella 4: Morpholino miscela da iniezione.

Reagente Volume di quantità
gRNA (concentrazione finale di lavoro @ 100 ng/μl) 1 μl
Cas9 mRNA (concentrazione finale di lavoro @ 1200ng/μl) 1 μl
Privo di RNasi H2O 2 μl
Totale 4 μl

Tabella 5: Campione CRISPR/Cas9 miscela di iniezione.

Reagente Volume di quantità
Plasmide Tol2 (concentrazione finale di lavoro @ 25ng/μl) X μl
Tol2 mRNA (concentrazione finale di lavoro @ 25ng/μl) X μl
Rosso fenolo 1,0 µ l
Privo di RNasi H2O X μl
Totale 15 μl

Tabella 6: Esempio Tol2 transgenesi miscela da iniezione

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Qui, abbiamo fornito una metodologia per la manipolazione di funzione del gene usando morpholinos, CRISPR/Cas9 gene editing e metodologia di transgenesi. La ricchezza della tecnologia genetica e l'ottimizzazione di questi sistemi in zebrafish consentirà probabilmente per il trasferimento di questi strumenti a. mexicanus con facilità52. Recenti scoperte hanno utilizzato questi approcci in a. mexicanus, ma rimangono sottoutilizzate nell'indagine su diversi tratti morfologici, dello sviluppo e del comportamentali in questo sistema30,36,42 , 53.

Morpholinos sono stati ampiamente usati nella ricerca di zebrafish per atterramento l'espressione dei geni. L'approccio è facile e si traduce in un robusto atterramento di espressione. Tuttavia, gli effetti fuori bersaglio sono stati ampiamente documentati22,53; così, gli animali in cui sono state iniettate morpholinos a devono essere attentamente monitorati per qualsiasi imprevisto fenotipi22,55. Quando possibile, risultati ottenuti da atterramento di morpholino devono essere convalidati mediante l'utilizzo di altri metodi, quali approcci di knockout CRISPR/Cas9-mediata. Mentre morpholinos consentire l'atterramento robusto dell'espressione genica, atterramento di morpholino-mediata è transitoria. Così, analizzando il fenotipo adulto non è possibile quando si utilizza questo metodo.

CRISPR/Cas9-mediata mutagenesi offre manipolazione diretta di specifici geni. Inoltre, a differenza di morpholino-mediata atterramento, mutagenesi CRISPR/Cas9 permette l'analisi dei fenotipi mutanti nell'età adulta. Per evitare effetti di fuori bersaglio di CRISPR/Cas9, linee mutanti dovrebbero essere outcrossed diverse generazioni, e quando possibile, più di un allele dovrebbe essere ottenuto e testato. Il sistema CRISPR/Cas9 fornisce anche il potenziale per utilizzando approcci modifica del gene a bussare-in alleli o per produrre cambiamenti genetici specifici. Il sistema CRISPR/Cas9 è stato utilizzato in zebrafish per produrre precisi integrazioni di DNA esogeno e generare mutazioni puntiformi precisa19,20,56,57,58, 59. con il sequenziamento del genoma di caverna, è ora possibile identificare polimorfismi a singolo nucleotide (SNPs) o altri sottili cambiamenti genetici tra superficie pesce e caverna popolazioni33. L'applicazione di CRISPR/Cas9 gene editing offre l'opportunità per lo scambio di alleli tra caverna e pesci di superficie, o tra diverse popolazioni di caverna, di esaminare il ruolo di questi cambiamenti genetici in diversi processi di sviluppo.

Il transgenesi approcci descritti in questo protocollo forniscono un metodo semplice e potente per gli studi di guadagno di funzione e per la generazione di strumenti per modificare processi biologici geneticamente. Il sistema Tol2 è ampiamente usato nella ricerca di zebrafish, e abbiamo dimostrato che è allo stesso modo potente in a. mexicanus. Inoltre, abbiamo dimostrato un costrutto transgenico generato in zebrafish che utilizza un promotore di zebrafish e ricapitola l'espressione endogena in a. mexicanus. Abbiamo trovato che quattro altri promotori isolato dallo zebrafish quell'espressione tessuto-specifica unità come previsto in a. mexicanus (dati non mostrati). Dal momento che i promotori di zebrafish ricapitolano loro pattern di espressione conservati in a. mexicanus, ciò suggerisce che molti degli strumenti genetici possono essere trasferiti direttamente dallo zebrafish per a. mexicanus senza la necessità di modificarle con A. mexicanus promotori. Inoltre, con l'avanzare delle tecnologie di sequenziamento in a. mexicanus33, gli approcci transgenici descritti qui permetterà un futuro potente per l'indagine dei rinforzatori e promotori che possono svolgere un ruolo nella variazione tra forme di superficie e grotta. Infine, i potenti strumenti per la manipolazione genetica dei processi biologici che hanno reso prezioso zebrafish sono ugualmente importanti in a. mexicanus60,61,62,63. Differenze nei diversi tratti comportamentali, come il sonno, alimentazione, stress e aggressioni, tra forme di superficie e caverne a. mexicanus sono stati ampiamente documentati12,14,15 ,38,64, eppure il sottostante correla un neurone non è buono capiti. Strumenti quali Tg(elavl3:GCaMP6s) permetterà una dissezione di come le differenze nell'attività neuronale del cervello livello correlano con le differenze nel comportamento e offrono una visione unica come il cervello ha essere modificato nel corso dell'evoluzione.

Presi insieme, a. mexicanus è destinato a diventare un modello di punta per indagare l'evoluzione di una varietà di caratteristiche morfologiche e comportamentali. Le diverse differenze in complessi processi biologici in a. mexicanus forniscono una piattaforma per lo studio di meccanismi genetici dell'evoluzione del tratto. L'applicazione di strumenti per la manipolazione di funzione del gene può aiutare a sviluppare questo organismo in un modello che può essere applicato per studiare malattie biologiche legate alla degenerazione degli occhi, le anomalie dello sviluppo neurologico e insonnia.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno nulla a rivelare.

Acknowledgments

Gli autori ringraziano Sunishka Thakur per la sua assistenza in genotipizzazione e imaging il pesce mutante oca2 rappresentato nella Figura 2. Questo lavoro è stato sostenuto dalla National Science Foundation (NSF) award 1656574 a A.C.K, NSF award 1754321 J.K. e A.C.K e premio National Institutes of Health (NIH) R21NS105071 a A.C.K ed E.R.D.

Materials

Name Company Catalog Number Comments
Fish breeding & egg supplies
Fine mesh fish net Penn Plax BN4
Fish tank heater Aqueon 100106108
Egg traps Custom made NA Design and create plastic grate to place at bottom of tank to protect eggs
Glass pipettes Fisher Scientific 13-678-20C
Pipette bulbs Fisher Scientific 03-448-21
Agarose Fisher Scientific BP160-500
Egg molds Adaptive Science Tools TU-1
Morpholino supplies
Control Morpholino Gene Tools, LLC Standard control olio
Custom Morpholino Gene Tools, LLC NA
Phenol Red Sigma Aldrich P0290-100ML
CRISPR supplies
Cas9 Plasmid AddGene 46757
GoTaq DNA Polymerase Promega M3001
KOD Hot Start Taq EMD Millipore 71-842-3
Primers Integrated DNA Technologies Custom
T7 Megascript Kit Ambion/Thermofisher AM1333
miRNeasy Kit Qiagen 217004
mMessage mMachine T3 kit Ambion/Thermofisher AM1348
MinElute Kit Qiagen 28204
Tol2 transgenesis supplies
pCS-zT2TP plasmid Kawakami et al., 2004 Request from senior author
CutSmart Buffer New England Biolabs B7204
NotI-HF Restriction Enzyme New England Biolabs R3189
PCR purification Kit Qiagen 28104
SP6 mMessenger Kit Ambion/Thermofisher AM1340
Microinjection supplies
Glass Capillary Tubes Sutter Instruments BF100-58-10
Pipette puller Sutter Instruments P-97
Picoinjector Warner Instruments PLI-100A
Micromanipulator World Precision Instruments M3301R
Micromanipulator Stand World Precision Instruments M10
Micmanipulator Base World Precision Instruments Steel Plate Base, 10 lbs

DOWNLOAD MATERIALS LIST

References

  1. Darwin, C. On the Origin of Species by Means of Natural Selection. D. Appleton and Company. (1859).
  2. Culver, D. C., Pipan, T. The Biology of Caves and Other Subterranean Habitats. Oxford University Press. New York, NY. (2009).
  3. Mitchell, R. W., Russell, W. H., Elliott, W. R. Mexican Eyeless Characin Fishes, Genus Astyanax: Environment, Distribution, and Evolution. (1977).
  4. Huppop, K. Oxygen consumption of Astyanax fasciatus (Characidae, Pisces): A comparison of epigean and hypogean populations. Environmental Biology of Fishes. 17, 299-308 (1986).
  5. Moran, D., Softley, R., Warrant, E. J. Eyeless Mexican Cavefish Save Energy by Eliminating the Circadian Rhythm in Metabolism. PLoS ONE. 9, (9), e107877 (2014).
  6. Protas, M. E., et al. Genetic analysis of cavefish reveals molecular convergence in the evolution of albinism. Nature genetics. 38, 107-111 (2006).
  7. Wall, A., Volkoff, H. Effects of fasting and feeding on the brain mRNA expressions of orexin tyrosine hydroxylase (TH), PYY and CCK in the Mexican blind cavefish (Astyanax fasciatus mexicanus). General and Comparative Endocrinology. 183, 44-52 (2013).
  8. Aspiras, A., Rohner, N., Marineau, B., Borowsky, R., Tabin, J. Melanocortin 4 receptor mutations contribute to the adaptation of cavefish to nutrient-poor conditions. Proceedings of the National Academy of Sciences. 112, (31), 9668-9673 (2015).
  9. Yoshizawa, M., Gorički, Š, Soares, D., Jeffery, W. R. Evolution of a behavioral shift mediated by superficial neuromasts helps cavefish find food in darkness. Current Biology. 20, (18), 1631-1636 (2010).
  10. Jeffery, W. R. Regressive Evolution in Astyanax Cavefish. Annual Review of Genetics. 43, 25-47 (2009).
  11. Gross, J. B. The complex origin of Astyanax cavefish. BMC Evolutionary Biology. 12, 105 (2012).
  12. Elipot, Y., Hinaux, H., Callebert, J., Rétaux, S. Evolutionary shift from fighting to foraging in blind cavefish through changes in the serotonin network. Current Biology. 23, (1), 1-10 (2013).
  13. Kowalko, J. E. J., et al. Loss of schooling behavior in cavefish through sight-dependent and sight-independent mechanisms. Current Biology. 23, (19), 1874-1883 (2013).
  14. Duboué, E. R. E. R., Keene, A. C. A. C., Borowsky, R. L. R. L. Evolutionary convergence on sleep loss in cavefish populations. Current Biology. 21, (8), 671-676 (2011).
  15. Chin, J. S., et al. Convergence on reduced stress behavior in the Mexican blind cavefish. Developmental Biology. (2018).
  16. Scheer, N., Campos-Ortega, J. A. Use of the Gal4-UAS technique for targeted gene expression in the zebrafish. Mechanisms of Development. 80, (2), 153-158 (1999).
  17. Kawakami, K., Shima, A., Kawakami, N. Identification of a functional transposase of the Tol2 element, an Ac-like element from the Japanese medaka fish, and its transposition in the zebrafish germ lineage. Proceedings of the National Academy of Sciences. 97, (21), 11403-11408 (2000).
  18. Balciunas, D., et al. Enhancer trapping in zebrafish using the Sleeping Beauty transposon. BMC Genomics. (2004).
  19. Auer, T. O., Duroure, K., De Cian, A., Concordet, J. P., Del Bene, F. Highly efficient CRISPR/Cas9-mediated knock-in in zebrafish by homology-independent DNA repair. Genome Research. 24, (1), 142-153 (2014).
  20. Kimura, Y., Hisano, Y., Kawahara, A., Higashijima, S. I. Efficient generation of knock-in transgenic zebrafish carrying reporter/driver genes by CRISPR/Cas9-mediated genome engineering. Scientific Reports. 4, (2014).
  21. Bill, B. R., Petzold, A. M., Clark, K. J., Schimmenti, L. A., Ekker, S. C. A Primer for Morpholino Use in Zebrafish. Zebrafish. 6, (1), 69-77 (2009).
  22. Nasevicius, A., Ekker, S. C. Effective targeted gene “knockdown” in zebrafish. Nature Genetics. (2000).
  23. Sander, J. D., et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. Nature Biotechnology. (2011).
  24. Huang, P., et al. Heritable gene targeting in zebrafish using customized TALENs. Nature Biotechnology. (2011).
  25. Kawakami, K. Transposon tools and methods in zebrafish. Developmental Dynamics. 234, (2), 244-254 (2005).
  26. Urasaki, A., Morvan, G., Kawakami, K. Functional dissection of the Tol2 transposable element identified the minimal cis-sequence and a highly repetitive sequence in the subterminal region essential for transposition. Genetics. 174, (2), 639-649 (2006).
  27. Juntti, S. A., Hu, C. K., Fernald, R. D. Tol2-Mediated Generation of a Transgenic Haplochromine Cichlid, Astatotilapia burtoni. PLoS ONE. 8, (10), (2013).
  28. Harel, I., Valenzano, D. R., Brunet, A. Efficient genome engineering approaches for the short-lived African turquoise killifish. Nature Protocols. 11, (10), 2010-2028 (2016).
  29. Erickson, P. A., Ellis, N. A., Miller, C. T. Microinjection for Transgenesis and Genome Editing in Threespine Sticklebacks. Journal of Visualized Experiments. (111), e54055 (2016).
  30. Elipot, Y., Legendre, L., Père, S., Sohm, F., Rétaux, S. Astyanax transgenesis and husbandry: how cavefish enters the laboratory. Zebrafish. 11, (4), 291-299 (2014).
  31. Keene, A., Yoshizawa, M., McGaugh, S. Biology and Evolution of the Mexican Cavefish. Academic Press. New York, NY. (2015).
  32. Casane, D., Rétaux, S. Evolutionary Genetics of the Cavefish Astyanax mexicanus. Advances in Genetics. 95, 117-159 (2016).
  33. Mcgaugh, S., et al. The cavefish genome reveals candidate genes for eye loss. Nature Communications. 5, 5307 (2014).
  34. Yoshizawa, M., et al. Distinct genetic architecture underlies the emergence of sleep loss and prey-seeking behavior in the Mexican cavefish. BMC Biology. 13, (1), (2015).
  35. Ma, L., Jeffery, W. R., Essner, J. J., Kowalko, J. E. Genome editing using TALENs in blind Mexican cavefish, Astyanax mexicanus. PLoS ONE. 10, (3), (2015).
  36. Bilandzija, H., Ma, L., Parkhurst, A., Jeffery, W. A potential benefit of albinism in Astyanax cavefish: downregulation of the oca2 gene increases tyrosine and catecholamine levels as an alternative to melanin synthesis. PLoS ONE. 8, (11), e80823 (2013).
  37. Alie, A., et al. Developmental evolution of the forebrain in cavefish: from natural variations in neuropeptides to behavior. eLife. 7, e32808 (2018).
  38. Jaggard, J. B., et al. Hypocretin underlies the evolution of sleep loss in the Mexican cavefish. eLife. 7, e32637 (2018).
  39. Borowsky, R. Handling Astyanax mexicanus eggs and fry. Cold Spring Harbor Protocols. 3, (11), (2008).
  40. Varshney, G. K., Sood, R., Burgess, S. M. Understanding and Editing the Zebrafish Genome. Advances in Genetics. 92, 1-52 (2015).
  41. Wierson, W. A., et al. GeneWeld: a method for efficient targeted integration directed by short homology. BioRxiv. (2018).
  42. Klaassen, H., Wang, Y., Adamski, K., Rohner, N., Kowalko, J. E. CRISPR mutagenesis confirms the role of oca2 in melanin pigmentation in Astyanax mexicanus. Developmental Biology. (2018).
  43. Jao, L. E., Wente, S. R., Chen, W. Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proceedings of the National Academy of Sciences of the United States of America. 110, (34), 13904-13909 (2013).
  44. Kwan, K. M., et al. The Tol2kit: A multisite gateway-based construction Kit for Tol2 transposon transgenesis constructs. Developmental Dynamics. 236, (11), 3088-3099 (2007).
  45. Kawakami, K., et al. A transposon-mediated gene trap approach identifies developmentally regulated genes in zebrafish. Developmental Cell. 7, (1), 133-144 (2004).
  46. Kowalko, J., Ma, L., Jeffery, W. Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases (TALENs). Journal of Visualized Experiments. (112), e54113 (2016).
  47. Nishino, S., Ripley, B., Overeem, S., Lammers, G. J., Mignot, E. Hypocretin (orexin) deficiency in human narcolepsy. Lancet. (2000).
  48. Lin, L., et al. The sleep disorder canine narcolepsy is caused by a mutation in the hypocretin (orexin) receptor 2. Cell. (1999).
  49. Park, H. C., et al. Analysis of upstream elements in the HuC promoter leads to the establishment of transgenic Zebrafish with fluorescent neurons. Developmental Biology. 227, (2), 279-293 (2000).
  50. Higashijima, S., Masino, M. A., Mandel, G., Fetcho, J. R. Imaging Neuronal Activity During Zebrafish Behavior With a Genetically Encoded Calcium Indicator. Journal of Neurophysiology. (2003).
  51. Vladimirov, N., et al. Light-sheet functional imaging in fictively behaving zebrafish. Nature Methods. 11, (9), 883-884 (2014).
  52. Halpern, M. E., et al. Gal4/UAS transgenic tools and their application to zebrafish. Zebrafish. 5, (2), 97-110 (2008).
  53. Jaggard, J. B., Stahl, B. A., Lloyd, E., Prober, D. A., Duboue, E. R., Keene, A. C. Hypocretin underlies the evolution of sleep loss in the Mexican cavefish. bioRxiv. 7, e32637 (2018).
  54. Bedell, V. M., Westcot, S. E., Ekker, S. C. Lessons from morpholino-based screening in zebrafish. Briefings in Functional Genomics. (2011).
  55. Robu, M. E., et al. p53 activation by knockdown technologies. PLoS Genetics. (2007).
  56. Hisano, Y., et al. Precise in-frame integration of exogenous DNA mediated by CRISPR/Cas9 system in zebrafish. Scientific reports. 5, 8841 (2015).
  57. Prykhozhij, S., et al. Optimized knock-in of point mutations in zebrafish using CRISPR/Cas9. Nucleic Acids Res. 46, (17), (2018).
  58. Tessadori, F., et al. Effective CRISPR/Cas9-based nucleotide editing in zebrafish to model human genetic cardiovascular disorders. Disease Model Mechanisms. 11, (10), (2018).
  59. Armstrong, G., Liao, M., You, Z., Lissouba, A., Chen, B., Drapeau, P. Homology Directed Knockin of Point Mutations in the Zebrafish tardbp and fus Genes in ALS Using the CRISPR/Cas9 System. PLoS ONE. 11, (3), (2016).
  60. Friedrich, R. W., Jacobson, G. A., Zhu, P. Circuit Neuroscience in Zebrafish. Current Biology. 20, (8), (2010).
  61. Friedrich, R. W., Genoud, C., Wanner, A. A. Analyzing the structure and function of neuronal circuits in zebrafish. Frontiers in Neural Circuits. 7, (2013).
  62. Scott, E. K., et al. Targeting neural circuitry in zebrafish using GAL4 enhancer trapping. Nature Methods. 4, (4), 323-326 (2007).
  63. Asakawa, K., Kawakami, K. Targeted gene expression by the Gal4-UAS system in zebrafish. Development Growth and Differentiation. (2008).
  64. Lloyd, E., et al. Evolutionary shift towards lateral line dependent prey capture behavior in the blind Mexican cavefish. Developmental Biology. (2018).
Manipolazione di funzione del Gene in caverna messicano
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Stahl, B. A., Jaggard, J. B., Chin, J. S. R., Kowalko, J. E., Keene, A. C., Duboué, E. R. Manipulation of Gene Function in Mexican Cavefish. J. Vis. Exp. (146), e59093, doi:10.3791/59093 (2019).More

Stahl, B. A., Jaggard, J. B., Chin, J. S. R., Kowalko, J. E., Keene, A. C., Duboué, E. R. Manipulation of Gene Function in Mexican Cavefish. J. Vis. Exp. (146), e59093, doi:10.3791/59093 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter