Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

멕시코 Cavefish에서 유전자 기능 조작

Published: April 22, 2019 doi: 10.3791/59093

Summary

진화 모델 시스템 Astyanax mexicanus유전자의 조작 방법을 설명합니다. 세 가지 다른 기술 설명: 중재 하는 Tol2 transgenesis, CRISPR/Cas9, 및 morpholinos를 사용 하 여 식의 최저 사용 하 여 게놈의 타겟된 조작. 이 도구는 기본 표면 및 동굴 주거 형태 사이의 변형 유전자의 직접 조사를 용이 해야.

Abstract

동굴 동물 진화 메커니즘 및 기본 변경 눈 변성, 獸, 수 면 감소, hyperphagia, 및 감각 처리를 포함 하 여 수많은 복잡 한 특색에 유전 기초 조사를 위한 경쟁력 있는 시스템을 제공 합니다. 세계 각국에서 cavefish의 종 다른 동굴 시스템 간의 공유 환경 압력 때문에 형태학과 행동 특성의 수렴 진화를 표시합니다. 다양 한 동굴 종 실험실 조정에서 공부 되었습니다 했다. 시력, 눈 먼 형태와 멕시코 tetra Astyanax mexicanus, 밑에 복잡 한 특성의 진화 생물학과 분자 프로세스에 대 한 독특한 통찰력을 제공 하고있다 그리고 신흥 모델 시스템으로 잘 태세입니다. 다양 한 생물 학적 과정의 진화를 규제 하는 후보 유전자 A. mexicanus에 확인 되었습니다, 하는 동안 개별 유전자에 대 한 역할의 유효성을 검사 하는 기능 제한 되었습니다. Transgenesis 및 유전자 편집 기술을의 적용이 중요 한 장애를 극복 하 고 복잡 한 특성의 진화를 기본 메커니즘을 조사 가능성이 있다. 여기, A. mexicanus에서 유전자 발현을 조작 하기 위한 다른 방법을 설명 합니다. Morpholinos, Tol2 transgenesis의 사용을 포함 하는 접근 하 고 유전자 편집 시스템, 제 브라에서 일반적으로 사용 되 고 다른 물고기 모형, A. mexicanus에서 유전자 기능을 조작 하. 이러한 프로토콜 초과 사육 절차에 대 한 자세한 설명, 수정 된 계란, 주사, 그리고 유전자 변형된 동물의 선택의 컬렉션을 포함합니다. 이 방법론 접근 A. mexicanus에서 다양 한 특성의 진화를 기본 유전과 신경 메커니즘의 조사에 대 한 수 있습니다.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

다윈의 종의 기원1, 이후 과학자 들은 어떻게 특성 정의 된 환경 및 생태 압력, 동굴 생물2덕분에 진화론 모양에 대 한 깊은 통찰력을 얻고 있다. 멕시코 tetra, A. mexicanus, 강 멕시코와 남부 텍사스 살고 눈된 조상 '표면' 인구와 파생된 동굴 변경해 거주 시에라 델 Abra의 적어도 29 지리적으로 고립 된 인구 구성 및 북동 멕시코3의 다른 지역입니다. A. mexicanus, 바꾸 인된 산소 소비, depigmentation, 눈를 포함 하 여 그리고 유와 구하고 행동4,,56, 변경에 확인 된 동굴 관련 된 특성의 수 7,,89. A. mexicanus 선물 잘 정의 된 진화 역사, 생태 환경, 상세한 특성화 및의 존재로 인해 수렴 진화의 메커니즘을 독립적으로 조사를 위한 강력한 모델 진화 동굴 인구10,11. 많은 눈의 손실을 포함 한 cavefish에, 손실 자, 먹이, 훈련의 손실 증가, 침략, 및 스트레스 응답을 감소, 감소 독립 기원, 자주 활용을 통해 여러 번 진화 하는 동굴에서 파생 된 특성은 다른 유전 통로 사이 동굴8,12,13,,1415. 이 반복은 A. mexicanus 시스템의 강력한 측면 이다 진화와 비슷한 고기를 생성 하 어떻게 유전자 시스템의 보다 일반적인 질문에 대 한 통찰력을 불안정 수 있습니다 제공할 수 있습니다.

유전자 기능의 기계 조사에 대 한 유전자 기술의 응용 ( A. mexicanus를 포함 하 여) 많은 물고기 종에 제한 되어는 제 브라의 최근 발전 제공 기준 물고기에서 유전자 기술 개발 16,17,18,19,20. 수많은 도구는에서 널리 이용 되 zebrafish 유전자 발현, 조작 하 고 이러한 절차의 구현 표준화 오래 있다. 예를 들어 단일 셀 단계에서 morpholino oligos (MOs)의 주입은 선택적으로 RNA를 차단 하 고 개발21,22동안 간단한 임시 창에 대 한 번역을 방지. 또한, 유전자 편집 방법, 정기적으로 클러스터 된 같이 interspaced 짧은 구조 반복 (CRISPR) / CRISPR-관련 단백질 9 (Cas9) 및 녹음 방송 활성 제 같은 이펙터 nuclease (TALEN), 정의 된 삭제의 세대에 대 한 허용 또는, 경우에 따라 게놈19,20,,2324에서 재결합을 통해 삽입. Transgenesis 셀 형식을 특정 방식으로 안정적인 유전자 발현 또는 기능을 조작 하는 데 사용 됩니다. Tol2 시스템은 transposase coinjecting에 의해 유전자 변형 동물을 생성 하기 위해 효과적으로 사용 transgene25,26를 포함 하는 Tol2 DNA 플라스 미드와 mRNA. Tol2 시스템 생성 유전자 변형 construct17의 안정적인 생식 삽입 하 메 다카의 Tol2 transposase를 사용 합니다. Tol2 제 닉 생성 coinjecting Tol2 transposase17 Tol2 통합 사이트 및 mRNA에 의해 형벌 transgene를 포함 하는 플라스 미드 포함 됩니다. 이 시스템 zebrafish에 유전자 변형 라인의 배열을 생성 하는 데 사용 되었습니다 및 사용 시 클 리드, 송사리, stickleback를 포함 하 여 추가 긴급 모델 시스템을 최근 확장 했다 그리고, 최근에, 멕시코 cavefish27, 28,29,30.

cavefish 특성이 진화의 elucidating 메커니즘에 대 한 매혹적인 생물 학적 시스템은, 진화 모델로 서의 전체 능력은 하지 되었습니다 완전히 무력화. 이것은 부분적으로 유전자를 조작 하는 무 능력 때문 이었고 휴대 기능 직접31. 양적 특성 loci (QTL) 연구를 사용 하 여 복잡 한 특성을 조절 하는 후보 유전자 확인 되었습니다 하지만이 후보 유전자의 유효성 검사는 어려운32,33,34되었습니다. 최근, morpholinos, CRISPR 및 TALEN 시스템 및 Tol2를 사용 하 여를 사용 하 여 편집 하는 유전자를 사용 하 여 일시적인 최저-중재 transgenesis 유전으로 기본 특성35,36,37의 수를 조사 하는 데 사용 되었습니다 ,38. 구현 및 이러한 기술의 표준화의 생물 학적 특성, 유전자 기능, 정의 된 세포 인구의 라벨의 조작을 포함 한 분자 및 신경 토대를 심문 하는 조작에 대 한 수 고 식 기능 기자입니다. 반면 유전자 또는 세포 기능 하 유전 이러한 도구를 성공적으로 구현 응급 모델 시스템에서 입증 되었습니다, 상세한 프로토콜은 여전히 A. mexicanus부족.

A. mexicanus 변화 하는 환경에 대 한 응답에서 진화의 메커니즘에 대 한 중요 한 통찰력을 제공 하 고 다양 한 특성을 조절 하는 새로운 유전자를 식별 하는 기회. 요인의 수는 A. mexicanus 는 쉽게 큰 무리 크기는 실험실에서 물고기를 유지 하는 기능을 포함 하 여 설립된 유전자 모델에서 현재 사용할 수 있는 설립된 게놈 도구를 적용 하기 위한 매우 온순한 모델 제안 투명성, 시퀀스 된 게놈 및 정의 된 행동 분석39. 여기, 우리는 morpholinos, transgenesis, A. mexicanus의 표면 및 동굴 인구에서 유전자 편집의 사용에 대 한 방법론을 설명 합니다. A. mexicanus 에서 이러한 도구의 광범위 한 응용 프로그램의 발달, 생리, 및 행동 차이 cavefish 및 표면 물고기의 진화를 기본 분자 과정에 기계 조사에 대 한 수 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Morpholino 올리고 디자인

참고: A. mexicanus 시퀀스 합 게놈 브라우저 (https://www.ensembl.org)에서 뿐만 아니라 국가 중심의 생명 공학 정보 (NCBI) 유전자와 NCBI SRA (https://www.ncbi.nlm.nih.gov)를 통해 사용할 수 있습니다. 두 표면 및 동굴 주거 형태에 사용 하기 위해 morpholino를 디자인할 때 그것은이 단계에서이 유전 지역 morpholinos에 대 한 대상으로 피할 수 있다 그래서 변경해 사이 어떤 유전 변이 식별 하는 중요 한. 효과 없는 바인딩 morpholino 대상 사이트 내에서 어떤 다형성 변이 발생할 수 있습니다. 디자인과 유사한 zebrafish, 다른 물고기 시스템 이전 A. mexicanus21,36,40. 에서 효과적으로 작동 하도록 표시 되었습니다.

  1. 번역 차단 morpholinos의 디자인
    참고: 번역 차단 morpholinos 생 시작 사이트에 바인딩하여 번역을 차단 하 고 입체 hinderance 통해 mRNA 순서를 바인딩에서 변환 기계 장치를 방해.
    1. ATG 시작 사이트와 시작 하는 대상 유전자의 코딩 영역을 식별 합니다.
    2. 대상 시퀀스의 첫 번째 25 기초 쌍 복사 및 붙여넣기 하 여 시퀀스에에서 기록 텍스트 편집기 또는 실험실 노트북.
    3. 온라인 소프트웨어 (예: http://reverse-complement.com) 또는 수동 번역을 사용 하 여, 대상 시퀀스의 반전 보수 생성할. 텍스트 편집기 또는 실험실 노트북에 결과 역방향 보수를 저장 합니다.
    4. 역방향 보완 시퀀스 morpholino morpholino oligonucleotides 생성 하는 회사에서 주문. 회사 테이블의 자료 를 참조 하십시오.
  2. 스플라이스 차단 morpholinos의 디자인
    참고: 스플라이스 차단 morpholinos 차단 접합 하 고, 따라서, 성숙한 mRNA 분자의 형성을 방지. 연쇄 반응 (PCR)을 통해 최저의 유효성 검사를 원할 때이 최저 시작 사이트는 잘 정의 된 때 또는 더 최적의 접근에 대 한 대체 방법의 제공 한다. (ATG 차단 MOs) 이상 결합 차단 morpholinos의이 혜택은 그 엑손 제외 또는 intron 포함 역전사 (RT)으로 쉽게 평가 될 수 있다-PCR 및 크기 차이 젤에 시각. RT-PCR 및 젤 전기 이동 법 morpholino 효능 행해져야 한다 결정 표준 실험실 절차를 사용 하 여.
    1. 대상 유전자의 사전 mRNA 순서를 식별 합니다. NCBI 또는 합 intron-엑손 경계33결정을 통해 A. mexicanus 게놈에서 사용할 수 있는 정보를 활용 합니다.
    2. 엑손-intron (스플라이스 기증자) 또는 intron-엑손 경계 (스플라이스 수락자) 사이트 intron 포함 또는 exon 제외 대상.
      참고: spliceosome는 일반적으로 5' 스플라이스 사이트에서 intron 고 3' (U2 대상) intronic 스플라이스 사이트에서 "" AG 시퀀스에서 "서울 특별시" 시퀀스 (U1 대상) 대상. 정상적인 조건 하에서 spliceosome U1 및 U2 subunits이 대상 사이트를 적절 한 접합에 대 한 사전 mRNA 순서에 바인딩합니다. 그러나, 이러한 대상 시퀀스 중 하나는 morpholino에 의해 차단 된 경우는 spliceosome 이동 합니다 다음 사용 가능한 U1 또는 u 2 사이트에, mRNA 순서에서 intron 제외 또는 exon를 일으키는. 이것은 기획/최적화, 대상 유전자21의 특성에 따라 포함 됩니다. 일반적으로, 다음 사용 가능한 u 1 사이트는 exon 절단을 일으키는 원인이 되는 결합을 리디렉션합니다 내부 U1 사이트 차단. 스플라이스를 리디렉션할 다른 사이트가 있기 때문에 또는 intron 포함을 하면 첫 번째 또는 마지막 스플라이스 연결을 차단 합니다. 시퀀스 소프트웨어를 사용 하 여 다양 한 예외 포함 대의 효과 예측 하기. 예측 가능성 frameshifts 또는 조 정지 codons, mRNA 붕괴에 대 한 더 효과적인 대상 사이트를 나타내는 나타낼 수 있습니다.
    3. 대상 사이트를 식별 하는 일단 텍스트 편집기 또는 연구소도 서에 그것의 순서를 기록 합니다. 대상 사이트는 25 기초 쌍 (bp) 긴 다는 것을 확인 하십시오.
    4. 온라인 소프트웨어 (예: http://reverse-complement.com) 또는 수동 번역을 사용 하 여, 대상 시퀀스의 반전 보수 생성할. 텍스트 편집기 또는 연구소도 서에 그것의 순서를 기록 합니다.
    5. 역방향 보완 시퀀스 morpholino morpholino oligonucleotides 생성 하는 회사에서 주문. 샘플 회사 테이블의 자료 를 참조 하십시오.

2입니다. 주입에 대 한 Morpholinos

참고: 여러 농도 또는 양의 모 주입 주사를 최적 농도 설정 하기 위해 수행 필요 합니다. 일반적인 주사 수량은 400-800 페이지 모의 Morpholino 최저의 효과 최대 6 일 postinjection에 대 한 유지 수 있습니다.

  1. 재고 morpholino 얻을. 재고 morpholino 동결 건조 된 도착합니다. 원하는 사진 농도 (예를 들어, 4 mM)에서 사용 하 여 살 균 H2O 사전으로 그것을 하이드 레이트. -20 °C에서 사용까지 저장 합니다.

3. CRISPR gRNA 디자인, 생체 외에서 전사, 및 준비

  1. CRISPR gRNA 디자인
    참고: gRNAs 생성 되었다 이전 출판된 연구를 사용 하 여 Varshney 외.40 와 Wierson 외.41.
    1. 게놈 브라우저를 사용 하 여 관심사의 유전자의 코딩 영역을 식별 합니다. 20 bp 뉴클레오티드 대상 시퀀싱으로 시작 하는 GG에 대 한 검색 하 여 내는 exon gRNA 대상 시퀀스를 식별 하 고 팸 시퀀스 (NGG) 뒤 게놈 시퀀스를 사용 하 여. 시작 (ATG) 타겟이 될 것입니다 후 유전자의 지역.
      참고: 지금까지 유전자, 중 하나 또는 모두'G의 원하는 exon에 5' 끝에 GG와 대상 시퀀스를 찾을 수 없는 경우에 s 5'는 시퀀스의 끝에서 첫 번째 및 두 번째 뉴클레오티드에 대 한 교체하실 수 있습니다. 그러나, 두 개의 G's 이들은 T7 전사에 필요한 만큼 올리고에 통합 되어야 합니다.
    2. 디자인과 유전자 특정 oligonucleotide 주문 (올리고 a: 5'-TAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGC-3'). T7 발기인 순서 (빨간색)와 anneal 두 번째 oligonucleotide (파란색)을 하는 데 사용 하는 중첩 시퀀스 사이의 팸 시퀀스 없이 유전자 특정 20 bp gRNA 대상 시퀀스 (굵게 표시)을 추가 합니다. Anneal 및 증폭 (단계 3.2.1 참조)이이 올리고 A 두 번째 올리고 (올리고 b: 5'-GATCCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTT AACTTGCTATTTCTAGCTCTAAAAC-3') 필 사를 위해 사용 하는 gRNA 템플릿을 생성 하.
      참고: 올리고 B 모든 반응에 대해 동일 하 고 1x만 주문 필요.
  2. gRNA 준비 및 녹음 방송
    1. Anneal 고는 oligos를 증폭. 수율을 증가 하기 위하여는 gRNA 증폭 다음 뇌관을 포함: 5'-TAATACGACTCACTATA-3' (T7 뇌관) 및 5'-GATCCGCACCGACTCGGTG-3' (3' gRNA 뇌관). Thermococcus kodakaraensis (로그인) 중 합 효소를 사용 하 여 PCR을 수행 합니다.
      참고: 두 뇌관 올리고 A에 올리고 B 10 주기 것이 좋습니다 좋은 수확량을 위해. 자세한 프로토콜 Wierson 외41에서 찾을 수 있습니다.
    2. GRNA 상용 생체 외 녹음 장비 ( 재료의 표참조)를 사용 하 여 녹음 제조 업체'을 수정 이렇게 s 프로토콜 Klaassen 외.42에 의해 출판.
    3. 침전, 세척, 그리고 Klaassen 외.42에 의해 설명 된 대로 gRNA resuspend.
      참고: 있는 gRNA RNase 무료 물 저하를 방지 하기 위해 resuspended 해야 합니다.
    4. 분 광 광도 계를 사용 하 여 결정 될 수 있는 gRNA의 농도 기록 합니다. Agarose 젤에 2 µ L을 실행 하 여 RNA의 품질을 평가 합니다. 동결/동결 해제를 피하기 위해-80 °C까지 주사 직전에 그것을 저장 하는 aliquot RNA
  3. Cas9 준비 및 녹음 방송
    1. Cas9 mRNA 상용 생체 외 녹음 장비 ( 재료의 표참조)를 사용 하 여 복사할 수 있습니다 앞에서 설명한43. Nls-Cas9-nls 버전43을 사용 합니다.
    2. gRNA의 농도 기록 하 고는 agarose 젤에 2 µ L을 실행 하 여 그 품질을 평가. Aliquot RNA 분해를 여러 freeze-thaw 주기를 통해 발생-80 °c.에 aliquots를 저장 하지 않으려면

4. Tol2 구문, Tol2 transposase, 및 transgenesis의 준비

  1. 주입에 대 한 Tol2 transgene 구조를 준비 합니다.
    참고: 우리가 성공적으로 출판/사용할 수 zebrafish 활용 그리고 메 다카 A. mexicanus에서 생성. 이러한 구조는 순서 상 동의 높은 수준 때문에 A. mexicanus에서 완벽 하 게 기능 가능성이 (AddGene 저장소를 참조 하십시오 그리고 Zebrafish 정보 네트워크 [ZFIN] 데이터베이스를 사용할 수 있는 구문에 대 한). Zebrafish 발기인 조각에서 사용 될 때 예상된 조직에서 transgenes 표현 했다 A. mexicanus.
    1. Tol2 구조를 취득 하거나 생성 하 플라스 미드와 조직 특정 발기인, 원하는 transgene Tol2 팔 (관 외.44참조). 접수, 플라스 미드를 확인 하기 위해 구문 순서.
    2. midiprep'제조 업체에 따라 구문에 대 한 수행의 지침. Elute RNase 무료 H2O에서에서 최종 플라스 미드는 분 광 광도와 농도 결정, 100-농도 희석 300 ng /μL, 및 약 수 및 스토어-20 °c.에 구문
  2. Tol2 transposase 플라스 미드, 소화 그리고 mRNA 합성.
    1. Tol2 mRNA45를 생성 하기 위한 템플릿으로 Tol2 transposase 플라스 미드 (Pc-zT2TP)의 복사본을 가져옵니다.
    2. Midiprep Pc-zT2TP'제조 업체에 따르면 s 지침을 생성 합니다. RNase 무료 물 또는 버퍼 (~ 50 μ)의 낮은 볼륨에 elute. -20 °c.에 aliquots 저장
    3. 제한 효소를 사용 하 여 Tol2 플라스 미드를 소화.
      1. 표 1을 사용 하 여 원형 Pc-zT2TP 플라스 미드의 10 µ g에 제한 다이제스트를 수행 합니다.
      2. 분할 2-50 μ 반응으로 반응 하 고 37 °C에서 열 cycler에서 하룻밤 반응을 품 어.
      3. 다음 날, 65 °C 20 분 동안가 열 하 여 효소 비활성화.
      4. 상업적으로 이용 가능한 PCR 정화 키트 ( 재료의 표참조) 제조 업체' 지침 당을 사용 하 여 다이제스트 직후 선형화 플라스 미드 정화. RNase 무료 H2O의 15 μ에서 플라스 미드 elute 고는 분 광 광도 계를 사용 하 여 제품의 농도 결정 합니다.
      5. 소화 플라스 미드의 1 μ를 실행 하 고 1.5 %agarose 포경된 플라스 미드의 1 μ 선형화 플라스 미드 확인 하 젤.
    4. Tol2 mRNA의 생체 외 녹음을 수행 합니다.
      1. 전사에 대 한 템플릿으로 선형화 Pc-zT2TP 플라스 미드의 1 µ g를 사용 합니다. '제조 업체에 따라 생체 외 녹음 방송에 대 한 s 지침 ( 재료의 표참조) 표 2에 설명 된 대로.
      2. S 지침 37 °C에서'제조 업체 당 열 cycler에서 품 어.
      3. 37 °C에서'제조 업체 당 열 cycler에서 품 어, DNase의 1 µ L을 추가 s 지침.
      4. 리튬 염화 물 강 수 전사 키트 프로토콜 당 수행 합니다. RNase 무료 H2o. ~ 20-30 μ에 RNA 펠 릿 resuspend
      5. 분 광 광도 계를 사용 하 여 제품의 농도 결정 하 고 RNA 품질을 기록 합니다.
      6. ~ 100-300 ng / µ L을 약 수 제품을 희석을 피하기 위해 반복된 동결-해 동 5-10 μ 샘플으로. -80 °C에서 사용까지 그들을 저장 합니다.
        참고: 1-를 확인 하는 얼룩/밴드 젤 전기 이동 법에 대 한 정화 Tol2 mRNA의 2 µ L.

5입니다. microinjections

  1. 주사에 대 한 일반적인 도구 준비
    참고:이 섹션의 절차에서는 Kowalko 외.46에 의해 상세히에서 설명 되었습니다 그리고 사소한 수정 개요는 여기에 제시.
    1. 쏟아지는 따뜻한 3% agarose 100ml 페 트리 접시에 생선 시스템 물에 용 해 하 여 주입 접시를 생성 합니다. 신중 하 게 우물 물고기 계란에 대 한 수 있도록 갓 부 agarose 계란 사출 금형 장소. 금형의 측면에 45° 각도에서 천 하 고, 다음, 천천히 agarose;으로 그것을 낮은합니다 각도에서 몰드를 천천히 낮추는 공기 금형 아래 갇혀 점점 피할 수 있습니다. 부드럽게는 agarose 경화 되 면 금형을 제거 합니다. 번호판, 봉인, 4 °C 최대 1 주일에 저장 수 있습니다.
    2. 당겨 바늘 주입'제조 업체에 따라 전극/바늘 끌어당기는 사람에 대 한 붕 규 산 유리 모 세관에서 s 지침. 이 프로토콜 당 피 펫 끌어당기는; 달라 집니다. 그러나, 샘플 바늘 당기 프로그램 표 3에서 찾을 수 있습니다.
      참고: 최적화 바늘은 주사, 바늘 너무 긴 것 이다 구 부 보다는 깔끔하게 계란을 관통 하는 중요 하다.
    3. 오프닝은 계란에 대 한 충분히 큰 그래서 표준 유리 펫을 끊어서 계란 전송에 대 한 큰 구멍 유리 펫을 확인 합니다. 분 젠 버너를 사용 하 여 부드러운 때까지 불꽃에 깨진된 펫의 끝을 노출 하 여 유리의 깨진된 끝 폴란드어.
  2. 번 식 설정
    참고: A. mexicanus번 식에 사용 되는 많은 다른 프로토콜 있습니다. 자세한 프로토콜에 대 한 Borowsky39를 참조 하십시오. 번 식 설치 주사 전에 1 주 시작 합니다.
    1. 하루에 1, 2 ~ 3 명의 여성 및 3 ~ 4 남성에에서 배치 24 ± 1 °c.에 유지 단일 10 갤런 탱크
    2. 7, 1-일에 ~ 3 배 하루에 먹이 증가. 라이브 음식, 검은 벌레와 소금물 새우 등을 포함 하는 다이어트를 확인 하십시오.
    3. 6 일에 27 °C. 실험실 탱크 온도가 다를 수 있습니다;로 설정 단일 탱크 히터 추가 따라서,이 2-3 °C 상대 일반 탱크 온도를 증가 될 것입니다.
    4. 하루 7, 사출 밤의 저녁 (zeitgeber [ZT] 9-11)는 저녁에 철저 하 게 물에 젖은 스폰지와 탱크를 청소 하 고 어떤 과잉 음식 든 지 또는 좋은 메쉬 그물을 사용 하 여 파편 또는 싸이 펀을 제거 합니다.
    5. 7 일의 밤에 ZT15에 표면 물고기 계란에 대 한 검사 시작 하 고 계속 해 서 ZT18까지 30 분 마다 15-를 확인 합니다. Cavefish, ZT17에 계란에 대 한 검사를 시작 하 고 계속 해 서 ZT20까지 30 분 마다 15-를 확인.
      참고: 시간 기반 14시 10분 h 빛: 다크 주기 zeitgeber 시간을 사용 하 여. 번 식 시간 추정 되며 개별 실험실 정확한 시간을 결정 해야 합니다. 그것은 곧 후 발표/단일 셀 단계에서 그들을 투입 하기 위하여 수정 된 달걀을 수집에 중요 한.
  3. 단일 셀 단계 계란의 컬렉션
    1. 번 식으로 예상 된다 밤 탱크 매 15-30 분 및 탱크의 바닥에 계란에 대 한 모니터를 검사 합니다. 계란 나타납니다 반투명, 직경에 있는 대략 1 밀리미터를 측정.
    2. 좋은 메쉬 물고기 그물을 사용 하 여 계란을 수집 하 고 신선한 생선 시스템 물으로 채워진 유리 그릇에 그들을 전송. 계란 계란 1 셀 단계에 되는지 확인을 현미경으로 검사 합니다.
    3. 유리 펫을 사용 하 여 단일 셀 계란 주입 격판덮개 전송. 유리 펫은이 단계에서 처럼 계란 플라스틱에 충실 합니다.
    4. 섹션 5.1 agarose 주입 접시의 우물에 계란을 풀어 신중 하 게는 피 펫을 사용 하 여. 계란의 최대 수 (실 온)에서 prewarmed 주입 접시의 행 채우기 (30-40 행, 당 및 5 행까지). 전체 행 주사 동안 이동에서 계란을 계속 도움이 됩니다. 계란 주사의 성능까지 작은 양의 물고기 시스템 물 주입 접시에 충분 한지 체크 해를 유지.
  4. 피코-주입 설치 및 일반 사출 최적화 지침
    1. 백필 중 젤 로드 피 펫을 사용 하 여 주사 바늘 팁 모 세관 또는 표준 micropipette 팁을 사용 하 고 2-4 µ L bolus 끝에 추가 안쪽에 맞는. 일단 바늘 가득 집게를 사용 하 여 주사 바늘에서 초과 길이 트림.
    2. Microinjections picoliter microinjector에 연결 하는 micromanipulator에 바늘을 사용 하 여 수행 합니다.
    3. 0.03 주입 시간 설정 및 ~0.0 psi에 밖으로 압력. 사출 압력 달라 집니다 따라 바늘 사이의 작은 차이와 최적화 ~1.0 nL 주입 bolus를 달성 하기 위해.
      참고: 사출 압력은 종종 ~ 10-30 psi의 범위에서.
    4. 미네랄 오일에 주입 된 bolus를 측정 하 여 사출 bolus 표준화 ~ 1-를 달성 하기 위해 슬라이드 마이크로 미터와 1.5 nL 주입 볼륨 크기. Bolus 볼륨을 늘리거나 사출 압력 (psi)를 조정 합니다.
    5. 연구소 조직을 사용 하 여 계란의 맨의 물을 그립니다.
      참고: Astyanax 계란 chorion 약간 강하다는 zebrafish 달걀 보다 관통 하는. 우리는 계란의 상단에서 물을 그리기 도움이 촉진 달걀으로 바늘 침투 찾으십시오. 플레이트 최적화 한 접시에 200 ~ 계란에 대 한 수 있습니다.
    6. 바늘, 각 계란을 관통 하 고 노 른 자에 직접 주입 하는 micromanipulator를 사용 합니다. 노른자위에 위치, 일단 넣기 버튼 또는 주입 발 페달을 눌러 계란을 주입.
      참고: 전체 접시 ~ 15 분 내에서 주입 수 있습니다. 단일 셀 무대 ~ 40 분 지속 됩니다.
  5. Morpholinos의 주입
    참고: morpholino 최저 독성을 유발 하지 않고 필요한 양의 유전자 대상; 당 최적화가 필요 합니다. 그러나, 400의 농도 세 시작 하는 좋은 장소입니다.
    1. 계란 당 morpholino의 400 페이지를 주입 됩니다 있도록 morpholino를 준비. Morpholino 얼음에 녹여 주입 솔루션 (원하는 농도)에서 morpholino, RNase 무료 H2O 또는 Danieau'의 구성 s 솔루션 및 페 놀 레드 (마지막 볼륨의 10%). 예를 들어, 표 4를 참조 하십시오.
    2. 1 주입 태아 당 nL.
  6. CRISPR 주사
    1. GRNA의 25 세에 총 Cas9 mRNA의 300 pg 태아 당 주입 됩니다 있도록 RNA를 준비. 샘플 CRISPR/Cas9 주입 혼합 표 5를 참조 하십시오.
    2. 2 주사 gRNA/Cas9의 nL 태아 태아에 직접 당 mRNA.
  7. Tol2 transposase 및 transgenesis에 대 한 Tol2을가지고 있는 플라스 미드의 주입
    1. 해 동 transposase mRNA와 얼음에 플라스 미드 Tol2. (25 ng / µ L)에서 결합 Cas9 mRNA, 원하는 Tol2 구문 (25 ng /μL), 및 RNase 무료 물에 페 놀 레드 (마지막 볼륨의10%). 샘플 Tol2 transgenesis 주입 혼합, 표 6참조.
    2. 주입 솔루션 및 mRNA의 저하를 방지 하는 얼음에 바늘을 유지. 1 주입 태아 당 볼륨에서 nL.

6. 양육 및 심사 물고기 주입

  1. 주입 된 생선 농업
    1. 계란은 주입 후 즉시 전송 그들 유리 그릇 (10 x 5 cm) ~ 200 mL 물고기 시스템 물로 가득. 계란은 쉽게 주입 접시 가득 그릇에 담거 서 씻어 서 물고기 물과 달걀을 피 펫을 rinsing.
    2. 그릇 당 50 ~-80 주입된 태아를 놓고 22-24 °c.에 리어
    3. 주입 된 물고기 2 그릇 청소 죽은 태아를 제거 하 여 매일 물 ~ 20%를 변경할 하루 x.
    4. 추가 양육 이전 게시 프로토콜39에 따라 수행 됩니다.
  2. Morpholino 주입 개인의 심사
    1. 고기에 대 한 화면을 stereomicroscope에서 동물을 시각화. Morpholinos의 효과 ~ 5 일 postinjection21을 유지 수 있습니다.
    2. 4 일 postinjection에서 행동 고기를 측정 합니다.
  3. CRISPR indels에 대 한 심사
    1. 대상 사이트 genomic DNA를 증폭 하기 위하여 뇌관을 디자인 합니다. 대상 PCR 제품이 약 100-뇌관 디자인 125 bp.
      참고: 예를 들어 oca2 로커 스에 대 한 gRNA 대상 사이트를 둘러싼 지역 증폭 되었다 앞으로 뇌관 5'-CTCCTCTGTCAGGCTGTGC-3를 사용 하 여 '와 역방향 뇌관 5'-GAAGGGGATGTTGTCTATGAGC-3'의 PCR 제품 길이 대 한 혈압.
    2. 배아를 희생 또는 기관 동물 프로토콜에 따라 클립 성인 물고기 지 느 러 미.
    3. PCR 튜브 배아 또는 해 부 지 느 러 미를 수집 하 고 DNA를 추출 하 고 유전자 특정 뇌관 엄마 외.35에서 찾을 수 있습니다 PCRs. 샘플 PCR 프로토콜을 수행.
    4. 5 실행 mutagenesis에 대 한 평가를 µ L 70 V 3 h. 야생-타입 (nonmutagenized) DNA에서 3 %agarose 젤에 PCR 제품의 독특한 밴드 PCR 제품에서 발생 합니다. 돌연변이 DNA 젤에 더럽혀진 밴드에서 발생 합니다.
    5. 돌연변이 체 대립 유전자의 순서를 확인 하려면 TA'제조 업체에 따라 PCR 제품을 복제 s 지침 선택 식민지, 및 miniprep 문화. 시퀀싱에 대 한 결과 DNA를 보냅니다.
    6. 설정 하 고 돌연변이 체 대립 유전자를 전송 하는 물고기의 라인을 유지, 야생-타입, 생선과 화면 5-는 자손의 다음 단계 6.3.1-6.3.6 유전자의 돌연변이 체 대립 유전자를 수행 하는 경우 확인 하려면 10 배아를 성인 주입 된 물고기를 교차.
      참고: 동일한 F0 설립자 물고기에서 다른 F1 개인 다른 돌연변이 수행할 수 있습니다. 돌연변이 라인 예측 프레임은 대립 유전자를 생산 하는 돌연변이를 시퀀싱 되 있는지 확인 합니다.
    7. 더럽혀진 밴드 분석 결과 (단계 6.3.1-6.3.6)를 사용 하 여 PCR에 의해 또는 돌연변이 야생-타입 밴드 (그림 2C) 증폭 것 이다 대립 유전자 특정 PCR 뇌관 설계 하 여 돌연변이 체 대립 유전자를 운반 하는 물고기를 식별.
    8. 물고기의 라인 설립 되 면, homozygose 돌연변이 체 대립 유전자를 열성 고기에 대 한 테스트.
  4. 유전자 변형 긍정적인 개인에 대 한 심사
    참고: 형광 메이커를 포함 하는 구문을 사용 하 여 유전자 변형 긍정적인 개인에 대 한 심사를 간소화 하도록 것이 좋습니다. 그러나, 표준 PCR 검사 방법을 사용할 수 있습니다 전송에 대 한 화면으로.
    1. 빠르면 2 일 postinjection, 범위를 해 부하는 epifluorescence와 F0 물고기에서 조직 관련 형광 단백질을 시각화 합니다.
      참고: F0 애벌레에 식은 모자이크, 그리고 긍정적인 개인 다양 한 식 고기를 할 수 있습니다.
    2. 창립자 물고기 F0 으로 긍정적인 개인을 유지.
    3. F0s 도달 성숙, backcross 같은 인구/연구소 주식에서 파생 하는 nontransgenic 개인 창립 물고기. 화면 F1 아들 아 단계 6.2에서에서 설명한 대로 동일한 프로토콜을 사용 하 여
      참고: F1 애벌레에 식 유니폼 이며 F1 형제 간의 일관성을 보장 합니다.
    4. Tol2 통합 사이트 중재 이며 통합 설립자 마다 다를 수 있습니다, 선택 F1 형제 파생 된 단일 F0 설립자 고 긍정적인 표현 F1 형제 F2s 생성을 견디며. 이 자손 안정적인 라인에 대 한 기초가 될 것입니다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

동굴 주거 A. mexicanus 의 여러 인구 감소 수 면과 깨어/활동 그들의 표면-주거 conspecifics14상대적 증가 보여줍니다. Hypocretin/orexin (HCRT)는 깨어 증가, 높은 보존된 neuropeptide 이며 HCRT 통로에서 착오 발생 narcolepsy 인간과 다른 포유류47,48에. 우리는 이전 그 동굴을 증명 하고있다 A. mexicanus 이 펩 티이 드의 증가 식 cavefish38수 면의 손실을 기초 수 있습니다 제안 하는 HCRT 펩 티 드의 식을 증가 했다. Hcrt 식의 모 최저 직접 중재 cavefish 수 면의 손실 증가 hcrt 식의 효과 조사 하기 위한 강력한 접근 방식을 제공 합니다.

Hcrt 식과 수 면의 관계를 검토, 우리는 번역 차단 morpholino 설계 되었습니다. Exon, ATG 등의 모 대상 첫 번째 25 bp 사이트 (그림 1A,B)를 시작 합니다. 컨트롤, 우리 활용 상용 뒤섞여 모 컨트롤 (그림 1B). NCBI에 폭발 알고리즘을 사용 하 여, 우리는 게놈 (데이터 표시 되지 않음)에 걸쳐 어느 모에 대 한 아무 오프 대상 효과 확인 했다. A. mexicanus 표면 물고기와 Pachón cavefish 사육 했다 그리고 그들의 계란 수집 다음 (그림 1 c,D) 1 셀 단계에서 1 nL-볼륨에 미주리의 400 세 주사 했다. 물고기 4 dpf에 발생 하 고 활동 및 수 면 행동에 대 한 측정 했다.

동굴 A. mexicanus 주입 제어 모 전시 훨씬 더 운동 활동 및 수 면 감소의 영향을 주지 않습니다 제안 24 시간 기간 동안 표면 물고기 또한 뒤섞여 모 (그림 1E,F)와 함께 주입에 비해는 결과 각 morphotype에서 이전에 게시 활동 및 수 면 패턴 일치 morpholino 주사 제어 (t = 5.021, df = 88, p < 0.0001). HCRT-모의 주입 제어 주입 물고기에 비해 표면 물고기에 수 면에 거의 영향을 했다 (t = 0.17, df = 88, p > 0.99). 반면, 모 주입을 통해 hcrt 최저 동굴 주거 물고기에 수 면에 큰 영향을 했다. Pachón cavefish 애벌레 사중 감소 보다는 더 적은 운동 활동, 그리고 거의 두 배 이상 Pachón 애벌레 (그림 1E,F; 제어 자 t = 2.694, df = 88, p < 0.05). 운동 활동 및 모-최저 표면 및 동굴 주거 물고기 수 면의 비교 비교 운동 및 수 면 금액을 (그림 1E, F)을 공개 했다. 이러한 데이터는 hcrt 식과 수 면 손실 사이의 직접 링크를 제공 하 고 진화론 파생된 동굴 주거 변경해 수 면의 손실에 대 한 생물 학적 메커니즘을 검사 하는 방법을 제공.

착 색 손실은 동굴 생물의 특징을 여러 동굴 주거 Astyanax 인구 설명 착 색의 손실. 몰리 노와 Pachón cavefish에서 獸눈 albinism 2 (oca2) oca2에 돌연변이 기초 cavefish6獸 제안, 유전자를 포함 하는 게놈 지역 QTL 매핑을 사용 하 여 매핑 되었습니다.

Oca2獸 Pachón 동굴 변경해에 대 한 원인이 로커 스로를 검증 하려면 우리는 CRISPR/Cas9 유전자 변이 표면 물고기 인구에 있는이 지역에 편집 활용. Exon 21 Molino 물고기6삭제, 이후 우리 gRNA 유전자 (그림 2A)의이 영역을 대상으로 설계 되었습니다. GRNA 대상 시퀀스와 팸 (굵게)를 포함 하 여 게놈 시퀀스는 5'-GGTCATGTGGGTCTCAGCTTTGG-3 '. 이 대상 시퀀스 (PAM 시퀀스) 없이 타겟된 mutagenesis에 대 한 gRNA 생성 하 사용 되었다. 표면 브리 더 짝짓기를 하 고 결과 배아 1 셀 단계에서 수집 된. 1 셀 단계 배아 Cas9 mRNA와 gRNA 타겟팅 oca2주입 했다 그리고 주입 된 동물 성인43을 제기 했다. 주입 된 성인 야생-타입 표면 물고기, 친구 하 고이 십자가에서 배아 단계 6.3.1에서에서 뇌관을 사용 하 여 세균-라인 전송 확인 genotyped 했다. 우리는 돌연변이 oca2 대립 유전자 시퀀싱 하 고 세균 선 전송 2 bp 삭제 oca2 (그림 2B,C)에서 확인. 유전형의 용이성, 우리 뒤에 젤 전기 이동 법 (그림 2E) PCR를 사용 하 여 (그림 2D) 야생 형 및 돌연변이 체 대립 유전자 및 genotyped 물고기 식별에 대립 유전자 특정 뇌관 설계. 우리 incrossed 표면 물고기 heterozygous이 oca2 돌연변이 체 대립 유전자에 대 한. 결과 자손 착 했다 또는 알 비 노 (그림 2F-). 흰둥이 개인 homozygous 돌연변이 (그림 2E) 동안 안료 개인 야생-타입 또는 heterozygous oca2 로커 스에서 했다. 이러한 데이터 oca2 유전자 소재 시 사이 獸A. mexicanus cavefish에 대 한 직접 링크를 제공합니다.

수 면, 수 유, 스트레스 등 무수 한 행동 변경해 사이 기본 신경 결정 불분명 남아 아직 A. mexicanus cavefish 표면 conspecifics 기준으로 다릅니다. 전체 뇌 칼슘 이미징 변경 된 신경 활동과 수정된 행동 사이의 상관 관계를 조사 강력한 편견된 접근법을 제공 합니다. 우리 zebrafish 연구에서 널리 이용 되는 시 약을 사용 하 여 표면 물고기와 cavefish 유전자 인코딩된 칼슘 표시기, GCaMP6s의 가까이 유비쿼터스 신경 식이 생성. ELAV 같은 신경 특정 RNA 의무적인 단백질 3 (elavl3)은49 중앙 신 경계 걸쳐 새로 차별화 된 뉴런에서 endogenously 표현 되며 신 경계50의 대부분에 걸쳐 단백질의 표현을 드라이브 zebrafish에 사용 되었습니다. 우리가 얻은 ~2.8 kb zebrafish elavl3 발기인 상류의 전사 유전자 인코딩된 칼슘 표시기 GCaMP6s (퓨전 [GFP] 녹색 형광 단백질, calmodulin, 및 M13, myosin에서 펩 티 드 순서를 포함 하는 Tol2 구문 빛-체인 키), Tol2 사이트와 5'과 3' 끝에 형벌 (Tol2-elavl3:GCaMP6s-Tol2)51.

A. mexicanus 표면 물고기와 몰리 노 cavefish 사육 했다, 그리고 결과 배아 25 ng/Tol2-elavl3:GCaMP6s의 μ와 단일 셀 단계에서 coinjected 했다-Tol2 구축 및 25 ng/μ Tol2 transposase mRNA (그림 3A). 24-48 dpf에 애벌레는 GCaMP6s의 일시적인 신경 식 상영 했다. GCaMP6s의 표현으로 그 주입된 (F0) 배아 성인 제기 되었고 야생-타입 성인 표면 물고기 또는 cavefish의 동일한 계보에서 파생 된 backcrossed. 결과 F1 성인 GCaMP6s 식의 안정적인 표현에 대 한 검사를 했다 그리고 그 애벌레는 안정적인 라인 (그림 3B,C)를 생성 하기 위해 유지 되었다. 안정적인 식 각 F1 성인 Tol2-elavl3통합 가능성이 있기 때문에: 다른 게놈 사이트에서 GCaMP6s Tol2, 각 F1 다른 대립 유전자를 지정 된다. 이 방식을 사용 하 여, 우리는 생성 된 안정적인 F1s 표면 물고기와 몰리 노 cavefish 인구 (그림 3B,C), 따라서 사용 하면 라이브 칼슘 동굴에 행동 변화를 중재 하는 신경 활동에 차이 밝히기 위해 이미징 환경 (그림 3 C,D). 또한,이 방법은 특징 A. mexicanus에서 유전자 기능을 조작 하는 많은 추가적인 transgenes의 표현에 대 한 기초를 낳는다.

Figure 1
그림 1: Hcrt 의 Morpholino 최저 활동 감소 및 cavefish 수 면 증가. (A) 코딩 시퀀스, ATG 시작 사이트를 포함 하 여 Hcrt의 morpholino 대상 첫 번째 25 bp 번역 차단. (B) Hcrt morpholino 올리고 (MO) 및 제어 시퀀스. (C) agarose 계란 금형 사출에 ~ 200 단일 셀 계란의 맞춤입니다. (D) Microinjection 1.0의 시각화를 위한 페 놀 레드 표시기 주입 혼합물의 nL. 눈금 막대 = 0.5 mm. (E) Morpholino 최저 Hcrt 의 감소 활동 (총 주행 거리) Pachón cavefish의 (t = 5.021, df = 88, p < 0.0001) 하지만 표면 물고기 (t 1.318, df = = 88, p > 0.72). (F) 최저 증가 Pachón cavefish 수 면 (t = 2.694, df = 88, p < 0.05) 하지만 표면 물고기에 영향을 주지 않습니다 (t 0.17, df = = 88, p > 0.99). 눈금 막대 = 1 밀리미터. EF 패널에서 오차 막대는 뜻의 표준 오류를 나타냅니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
그림 2: CRISPR 유전자-편집 oca2 의 표면-집에서 獸를 소개 하 고 있다 A. mexicanus. (A) 회로도 oca2 코딩 영역과 exon 21 CRISPR 중재 유전자 편집에 대 한 대상으로 가이드 RNA (gRNA). (B) 연속 크로마 야생-타입 Oca2 + 및 (C) 돌연변이 Oca2- 대립 유전자의. 패널 B 의 빨간색 상자 돌연변이 Oca2- 대립 패널 C에 묘사에서 누락 2 bp 시퀀스를 나타냅니다. (D) 대상 CRISPR 2 bp 삭제, 방해 Oca2 기능을 소개합니다. 프라이 머는 F0 자손에 2 bp 삭제의 genotypic 검사에 대 한 설계 되었습니다. (E) PCR 및 젤 전기 이동 법 Oca2 의 야생-타입 표면 물고기에서 (밴드 크기 134 = bp) F0 CRISPR 주입 자손 (밴드 크기 133 = bp). 개인 homozygous Oca2 (Oca2 +)의 야생-타입 변종 heterozygous F0s homozygous 2 bp 삭제 하면서 색소는 (Oca2-) 獸 항구. (F) 야생-타입의 전신 이미지 CRISPR 중재 獸 표면 물고기의 물고기 (G)를 표면. 눈금 막대 = 5 mm. (H) 확대 보기 각각 FG, 패널에 표시 된 개인의 머리의. 눈금 막대 = 2 m m. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 3
그림 3: 팬-신경 GCAMP6s의 Tol2 transgenesis 수 있는 두뇌 활동의 라이브 영상 A. mexicanus. (A) A. mexicanus에서 transgenesis Tol2 중재. Tol2 mRNA와 Tol2-elav3lcoinjection: GCAMP6s Tol2 플라스 미드 GCAMP6s transgene F0 창시자에 통합. 야생-타입 물고기의 원래 재고 backcrossing F1 개인 GCAMP6s의 안정적인 팬-신경 식이 생성 됩니다. (BC) 결과 자손 해 부 그리고 confocal 현미경 검사 법을 사용 하 여 안정적인 식 상영 됩니다. 안정적인 TgAsty(elav3l: GCaMP6s) F1 개인 표면-(패널 B에에서 묘사 된)와 동굴 주거 morphotypes (패널 C에에서 묘사 된)에 대 한 설립 되었습니다. 눈금 막대 = 200 μ m.  이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

시 약 볼륨 또는 금액
Pc zT2TP 플라스 미드 DNA의 10.0 μ g X μl
코 CutSmart 버퍼 10.0 μ
노트-HF 효소 2.0 μ
Nuclease 무료 H2O X μl
BSA 1.0 μ
100 μ

표 1: Tol2 플라스 미드의 제한 다이제스트입니다.

시 약 볼륨 또는 금액
Pc-zT2TP 플라스 미드 DNA 오는지 의 1.0 μ g X μl
10x 반응 버퍼 2.0 μ
2 x NTP/모자 10.0 μ
SP6 효소 혼합 2.0 μ
RNase 무료 H2O X μl
≤20 μ

표 2: Tol2 mRNA의 생체 외에서 합성.

설정 이름 설정 값
510
55
속도 100
시간 40
압력 500
진입로 534

표 3: 샘플 피펫은 당기 프로토콜입니다. 

시 약 볼륨 또는 금액
Morpholino (4 m m @ 재고 냉동 고) 1.0 μ
Nuclease 무료 H2O 또는 Danieau의 솔루션 17.0 μ
페 놀 레드 2.0 μ
20 μ

표 4: Morpholino 주입 혼합입니다.

시 약 금액의 볼륨
gRNA (최종 작업 농도 100ng/μ @) 1 μ
Cas9 mRNA (최종 작업 농도 1200ng/μ @) 1 μ
RNase 무료 H2O 2 μ
4 μ

표 5: 샘플 CRISPR/Cas9 주입 혼합.

시 약 금액의 볼륨
Tol2 플라스 미드 (최종 작업 농도가 25ng/μ @) X μl
Tol2 mRNA (최종 작업 농도가 25ng/μ @) X μl
페 놀 레드 1.0 μ
RNase 무료 H2O X μl
15 μ

표 6: 샘플 Tol2 transgenesis 주입 혼합

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

여기, 우리는 morpholinos, CRISPR/Cas9 유전자 편집, transgenesis 방법론을 사용 하 여 유전자 기능을 조작 하기 위한 방법론을 제공 합니다. 유전자 기술의 부와 제 브라에서 이러한 시스템의 최적화 이러한 도구를 쉽게52A. mexicanus 에 이전 하면 가능성이 있습니다. 최근 연구 결과 A. mexicanus를 이러한 방식을 사용 하지만 그들은이 시스템30,,3642 에 다양 한 형태학, 발달, 및 행동 특성 조사에 충분히 남아 , 53.

Morpholinos는 최저 유전자 표현의 zebrafish 연구에 널리 사용 되어 왔습니다. 접근 손쉬운 이며 식의 강력한 최저에서 결과. 그러나, 오프 대상 효과 광범위 하 게 문서화 된22,53; 되었습니다. 따라서, 동물에 있는 morpholinos에 주입 되어 어떤 예기치 않은 고기22,55신중 하 게 모니터링 될 해야 합니다. 가능한 경우, CRISPR/Cas9-중재 녹아웃 접근 등 다른 방법을 통해 morpholino 최저에서 얻은 결과 확인 합니다. Morpholinos 유전자 발현의 강력한 최저 허용, 중재 하는 morpholino 최저 과도입니다. 따라서, 성인 고기 분석 불가능이 메서드를 사용 하는 경우.

CRISPR/Cas9-중재 mutagenesis 특정 유전자의 직접 조작을 제공합니다. 또한, 중재 하는 morpholino 최저 달리 CRISPR/Cas9 mutagenesis는 성인으로 돌연변이 고기의 분석에 대 한 수 있습니다. CRISPR/Cas9의 대상에서 효과 방지 하기 위해, 돌연변이 라인 해야 될 outcrossed 여러 세대, 그리고 더 이상의 대립 유전자를 얻은 고 테스트 가능한 경우. CRISPR/Cas9 시스템 노크 유전자 편집 방식을 활용에 대 한 가능성을 제공 합니다 또한-대립 유전자 또는 특정 유전자 변화를 생산 하. CRISPR/Cas9 시스템 사용 되었습니다 zebrafish 외 인 DNA의 정확한 통합 생산 하 고 정확한 포인트 돌연변이19,20,56,,5758, 를 생성 하 59. cavefish 게놈 시퀀싱, 그것은 지금 단 하나 뉴클레오티드 동 질 다 상 (Snp) 또는 표면 물고기와 cavefish 인구33사이 미묘한 다른 유전 변화를 식별 가능. CRISPR/Cas9 유전자 편집 응용 표면 물고기와 cavefish, 또는 이러한 유전자 변화는 다른 개발 프로세스의 역할을 검토 하 cavefish의 다른 인구 사이의 대립 유전자 교환 기회를 제공 한다.

이 프로토콜에서 설명 하는 transgenesis 방법 이득의 기능 연구 및 유전자 생물 학적 프로세스를 변경 하는 도구를 생성 하기 위한 간단 하 고 강력한 방법을 제공 합니다. Tol2 시스템은 zebrafish 연구에서 널리 이용 된다 그리고 우리 그것은 A. mexicanus에서 유사 하 게 강력한 것으로 나타났습니다. 또한, 우리 zebrafish zebrafish 발기인을 활용 하 고 A. mexicanus에 내 인 성 식이에 생성 하는 유전자 변형 구조를 설명 했다. 우리는 4 명의 다른 발기인에서에서 고립 된 zebrafish 드라이브 조직 특정 식 A. mexicanus (데이터 표시 되지 않음)에 예상 대로 나타났습니다. Zebrafish 발기인 A. mexicanus에 그들의 보존된 식 패턴 정리, 이후이 유전 도구의 많은 옮겨질 수 있다 제 브라에서 직접 mexicanus A. A. 와 수정에 대 한 필요 없이 나왔다 mexicanus promotors. 또한, A. mexicanus33시퀀싱 기술의 진보와 함께 여기에 설명 된 유전자 변형 접근 강화 및 발기인 사이 변이에 역할을 할 수의 조사에 대 한 강력한 미래를 허용 한다 표면 및 동굴 형태입니다. 마지막으로, zebrafish 귀중 한 만든 생물 학적 과정의 유전자 조작에 대 한 강력한 도구는 A. mexicanus60,61,62,63에서 동등 하 게 중요 하다. 수 면, 수 유, 등 다양 한 행동 특성의 차이, 스트레스 그리고 침략, A. mexicanus 표면 및 동굴 주거 형태 사이의 광범위 하 게 문서화 된12,14,15 ,38,64, 아직 기본 신경 관계가 잘 이해 되지 않는다. Tg(elavl3:GCaMP6s) 같은 도구 어떻게 신경 활동 두뇌 전체에에서 차이 연관 동작에 차이와 진화론 수정할 두뇌가 어떻게에 대 한 독특한 통찰력을 제공 해 부를 허용 됩니다.

함께 찍은, A. mexicanus 는 다양 한 형태와 행동 특성의 진화를 조사 하 고 최고의 모델이 될 태세 이다. A. mexicanus 에서 복잡 한 생물 학적 과정에 다양 한 차이 특성이 진화의 유전 메커니즘을 조사를 위한 플랫폼을 제공 합니다. 유전자 기능을 조작 하기 위한 도구 응용 생물학 질병 눈 변성, neurodevelopmental 이상, 및 불면증 관련 조사에 적용할 수 있는 모델에이 유기 체를 개발 하는 데 도움이 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 공개 없다.

Acknowledgments

저자는 유전형에 oca2 돌연변이 물고기 그림2 이미징 그녀의 지원에 대 한 Sunishka Thakur 감사 합니다. 이 작품은 국립 과학 재단 (NSF) 수상 1656574 A.C.K., NSF 상을 조 앤을 A.C.K., 1754321 및 국립 보건원 (NIH) 수상 R21NS105071 A.C.K. 및 E.R.D.에 의해 지원 되었다

Materials

Name Company Catalog Number Comments
Fish breeding & egg supplies
Fine mesh fish net Penn Plax BN4
Fish tank heater Aqueon 100106108
Egg traps Custom made NA Design and create plastic grate to place at bottom of tank to protect eggs
Glass pipettes Fisher Scientific 13-678-20C
Pipette bulbs Fisher Scientific 03-448-21
Agarose Fisher Scientific BP160-500
Egg molds Adaptive Science Tools TU-1
Morpholino supplies
Control Morpholino Gene Tools, LLC Standard control olio
Custom Morpholino Gene Tools, LLC NA
Phenol Red Sigma Aldrich P0290-100ML
CRISPR supplies
Cas9 Plasmid AddGene 46757
GoTaq DNA Polymerase Promega M3001
KOD Hot Start Taq EMD Millipore 71-842-3
Primers Integrated DNA Technologies Custom
T7 Megascript Kit Ambion/Thermofisher AM1333
miRNeasy Kit Qiagen 217004
mMessage mMachine T3 kit Ambion/Thermofisher AM1348
MinElute Kit Qiagen 28204
Tol2 transgenesis supplies
pCS-zT2TP plasmid Kawakami et al., 2004 Request from senior author
CutSmart Buffer New England Biolabs B7204
NotI-HF Restriction Enzyme New England Biolabs R3189
PCR purification Kit Qiagen 28104
SP6 mMessenger Kit Ambion/Thermofisher AM1340
Microinjection supplies
Glass Capillary Tubes Sutter Instruments BF100-58-10
Pipette puller Sutter Instruments P-97
Picoinjector Warner Instruments PLI-100A
Micromanipulator World Precision Instruments M3301R
Micromanipulator Stand World Precision Instruments M10
Micmanipulator Base World Precision Instruments Steel Plate Base, 10 lbs

DOWNLOAD MATERIALS LIST

References

  1. Darwin, C. On the Origin of Species by Means of Natural Selection. D. Appleton and Company. (1859).
  2. Culver, D. C., Pipan, T. The Biology of Caves and Other Subterranean Habitats. Oxford University Press. New York, NY. (2009).
  3. Mitchell, R. W., Russell, W. H., Elliott, W. R. Mexican Eyeless Characin Fishes, Genus Astyanax: Environment, Distribution, and Evolution. (1977).
  4. Huppop, K. Oxygen consumption of Astyanax fasciatus (Characidae, Pisces): A comparison of epigean and hypogean populations. Environmental Biology of Fishes. 17, 299-308 (1986).
  5. Moran, D., Softley, R., Warrant, E. J. Eyeless Mexican Cavefish Save Energy by Eliminating the Circadian Rhythm in Metabolism. PLoS ONE. 9, (9), e107877 (2014).
  6. Protas, M. E., et al. Genetic analysis of cavefish reveals molecular convergence in the evolution of albinism. Nature genetics. 38, 107-111 (2006).
  7. Wall, A., Volkoff, H. Effects of fasting and feeding on the brain mRNA expressions of orexin tyrosine hydroxylase (TH), PYY and CCK in the Mexican blind cavefish (Astyanax fasciatus mexicanus). General and Comparative Endocrinology. 183, 44-52 (2013).
  8. Aspiras, A., Rohner, N., Marineau, B., Borowsky, R., Tabin, J. Melanocortin 4 receptor mutations contribute to the adaptation of cavefish to nutrient-poor conditions. Proceedings of the National Academy of Sciences. 112, (31), 9668-9673 (2015).
  9. Yoshizawa, M., Gorički, Š, Soares, D., Jeffery, W. R. Evolution of a behavioral shift mediated by superficial neuromasts helps cavefish find food in darkness. Current Biology. 20, (18), 1631-1636 (2010).
  10. Jeffery, W. R. Regressive Evolution in Astyanax Cavefish. Annual Review of Genetics. 43, 25-47 (2009).
  11. Gross, J. B. The complex origin of Astyanax cavefish. BMC Evolutionary Biology. 12, 105 (2012).
  12. Elipot, Y., Hinaux, H., Callebert, J., Rétaux, S. Evolutionary shift from fighting to foraging in blind cavefish through changes in the serotonin network. Current Biology. 23, (1), 1-10 (2013).
  13. Kowalko, J. E. J., et al. Loss of schooling behavior in cavefish through sight-dependent and sight-independent mechanisms. Current Biology. 23, (19), 1874-1883 (2013).
  14. Duboué, E. R. E. R., Keene, A. C. A. C., Borowsky, R. L. R. L. Evolutionary convergence on sleep loss in cavefish populations. Current Biology. 21, (8), 671-676 (2011).
  15. Chin, J. S., et al. Convergence on reduced stress behavior in the Mexican blind cavefish. Developmental Biology. (2018).
  16. Scheer, N., Campos-Ortega, J. A. Use of the Gal4-UAS technique for targeted gene expression in the zebrafish. Mechanisms of Development. 80, (2), 153-158 (1999).
  17. Kawakami, K., Shima, A., Kawakami, N. Identification of a functional transposase of the Tol2 element, an Ac-like element from the Japanese medaka fish, and its transposition in the zebrafish germ lineage. Proceedings of the National Academy of Sciences. 97, (21), 11403-11408 (2000).
  18. Balciunas, D., et al. Enhancer trapping in zebrafish using the Sleeping Beauty transposon. BMC Genomics. (2004).
  19. Auer, T. O., Duroure, K., De Cian, A., Concordet, J. P., Del Bene, F. Highly efficient CRISPR/Cas9-mediated knock-in in zebrafish by homology-independent DNA repair. Genome Research. 24, (1), 142-153 (2014).
  20. Kimura, Y., Hisano, Y., Kawahara, A., Higashijima, S. I. Efficient generation of knock-in transgenic zebrafish carrying reporter/driver genes by CRISPR/Cas9-mediated genome engineering. Scientific Reports. 4, (2014).
  21. Bill, B. R., Petzold, A. M., Clark, K. J., Schimmenti, L. A., Ekker, S. C. A Primer for Morpholino Use in Zebrafish. Zebrafish. 6, (1), 69-77 (2009).
  22. Nasevicius, A., Ekker, S. C. Effective targeted gene “knockdown” in zebrafish. Nature Genetics. (2000).
  23. Sander, J. D., et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. Nature Biotechnology. (2011).
  24. Huang, P., et al. Heritable gene targeting in zebrafish using customized TALENs. Nature Biotechnology. (2011).
  25. Kawakami, K. Transposon tools and methods in zebrafish. Developmental Dynamics. 234, (2), 244-254 (2005).
  26. Urasaki, A., Morvan, G., Kawakami, K. Functional dissection of the Tol2 transposable element identified the minimal cis-sequence and a highly repetitive sequence in the subterminal region essential for transposition. Genetics. 174, (2), 639-649 (2006).
  27. Juntti, S. A., Hu, C. K., Fernald, R. D. Tol2-Mediated Generation of a Transgenic Haplochromine Cichlid, Astatotilapia burtoni. PLoS ONE. 8, (10), (2013).
  28. Harel, I., Valenzano, D. R., Brunet, A. Efficient genome engineering approaches for the short-lived African turquoise killifish. Nature Protocols. 11, (10), 2010-2028 (2016).
  29. Erickson, P. A., Ellis, N. A., Miller, C. T. Microinjection for Transgenesis and Genome Editing in Threespine Sticklebacks. Journal of Visualized Experiments. (111), e54055 (2016).
  30. Elipot, Y., Legendre, L., Père, S., Sohm, F., Rétaux, S. Astyanax transgenesis and husbandry: how cavefish enters the laboratory. Zebrafish. 11, (4), 291-299 (2014).
  31. Keene, A., Yoshizawa, M., McGaugh, S. Biology and Evolution of the Mexican Cavefish. Academic Press. New York, NY. (2015).
  32. Casane, D., Rétaux, S. Evolutionary Genetics of the Cavefish Astyanax mexicanus. Advances in Genetics. 95, 117-159 (2016).
  33. Mcgaugh, S., et al. The cavefish genome reveals candidate genes for eye loss. Nature Communications. 5, 5307 (2014).
  34. Yoshizawa, M., et al. Distinct genetic architecture underlies the emergence of sleep loss and prey-seeking behavior in the Mexican cavefish. BMC Biology. 13, (1), (2015).
  35. Ma, L., Jeffery, W. R., Essner, J. J., Kowalko, J. E. Genome editing using TALENs in blind Mexican cavefish, Astyanax mexicanus. PLoS ONE. 10, (3), (2015).
  36. Bilandzija, H., Ma, L., Parkhurst, A., Jeffery, W. A potential benefit of albinism in Astyanax cavefish: downregulation of the oca2 gene increases tyrosine and catecholamine levels as an alternative to melanin synthesis. PLoS ONE. 8, (11), e80823 (2013).
  37. Alie, A., et al. Developmental evolution of the forebrain in cavefish: from natural variations in neuropeptides to behavior. eLife. 7, e32808 (2018).
  38. Jaggard, J. B., et al. Hypocretin underlies the evolution of sleep loss in the Mexican cavefish. eLife. 7, e32637 (2018).
  39. Borowsky, R. Handling Astyanax mexicanus eggs and fry. Cold Spring Harbor Protocols. 3, (11), (2008).
  40. Varshney, G. K., Sood, R., Burgess, S. M. Understanding and Editing the Zebrafish Genome. Advances in Genetics. 92, 1-52 (2015).
  41. Wierson, W. A., et al. GeneWeld: a method for efficient targeted integration directed by short homology. BioRxiv. (2018).
  42. Klaassen, H., Wang, Y., Adamski, K., Rohner, N., Kowalko, J. E. CRISPR mutagenesis confirms the role of oca2 in melanin pigmentation in Astyanax mexicanus. Developmental Biology. (2018).
  43. Jao, L. E., Wente, S. R., Chen, W. Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proceedings of the National Academy of Sciences of the United States of America. 110, (34), 13904-13909 (2013).
  44. Kwan, K. M., et al. The Tol2kit: A multisite gateway-based construction Kit for Tol2 transposon transgenesis constructs. Developmental Dynamics. 236, (11), 3088-3099 (2007).
  45. Kawakami, K., et al. A transposon-mediated gene trap approach identifies developmentally regulated genes in zebrafish. Developmental Cell. 7, (1), 133-144 (2004).
  46. Kowalko, J., Ma, L., Jeffery, W. Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases (TALENs). Journal of Visualized Experiments. (112), e54113 (2016).
  47. Nishino, S., Ripley, B., Overeem, S., Lammers, G. J., Mignot, E. Hypocretin (orexin) deficiency in human narcolepsy. Lancet. (2000).
  48. Lin, L., et al. The sleep disorder canine narcolepsy is caused by a mutation in the hypocretin (orexin) receptor 2. Cell. (1999).
  49. Park, H. C., et al. Analysis of upstream elements in the HuC promoter leads to the establishment of transgenic Zebrafish with fluorescent neurons. Developmental Biology. 227, (2), 279-293 (2000).
  50. Higashijima, S., Masino, M. A., Mandel, G., Fetcho, J. R. Imaging Neuronal Activity During Zebrafish Behavior With a Genetically Encoded Calcium Indicator. Journal of Neurophysiology. (2003).
  51. Vladimirov, N., et al. Light-sheet functional imaging in fictively behaving zebrafish. Nature Methods. 11, (9), 883-884 (2014).
  52. Halpern, M. E., et al. Gal4/UAS transgenic tools and their application to zebrafish. Zebrafish. 5, (2), 97-110 (2008).
  53. Jaggard, J. B., Stahl, B. A., Lloyd, E., Prober, D. A., Duboue, E. R., Keene, A. C. Hypocretin underlies the evolution of sleep loss in the Mexican cavefish. bioRxiv. 7, e32637 (2018).
  54. Bedell, V. M., Westcot, S. E., Ekker, S. C. Lessons from morpholino-based screening in zebrafish. Briefings in Functional Genomics. (2011).
  55. Robu, M. E., et al. p53 activation by knockdown technologies. PLoS Genetics. (2007).
  56. Hisano, Y., et al. Precise in-frame integration of exogenous DNA mediated by CRISPR/Cas9 system in zebrafish. Scientific reports. 5, 8841 (2015).
  57. Prykhozhij, S., et al. Optimized knock-in of point mutations in zebrafish using CRISPR/Cas9. Nucleic Acids Res. 46, (17), (2018).
  58. Tessadori, F., et al. Effective CRISPR/Cas9-based nucleotide editing in zebrafish to model human genetic cardiovascular disorders. Disease Model Mechanisms. 11, (10), (2018).
  59. Armstrong, G., Liao, M., You, Z., Lissouba, A., Chen, B., Drapeau, P. Homology Directed Knockin of Point Mutations in the Zebrafish tardbp and fus Genes in ALS Using the CRISPR/Cas9 System. PLoS ONE. 11, (3), (2016).
  60. Friedrich, R. W., Jacobson, G. A., Zhu, P. Circuit Neuroscience in Zebrafish. Current Biology. 20, (8), (2010).
  61. Friedrich, R. W., Genoud, C., Wanner, A. A. Analyzing the structure and function of neuronal circuits in zebrafish. Frontiers in Neural Circuits. 7, (2013).
  62. Scott, E. K., et al. Targeting neural circuitry in zebrafish using GAL4 enhancer trapping. Nature Methods. 4, (4), 323-326 (2007).
  63. Asakawa, K., Kawakami, K. Targeted gene expression by the Gal4-UAS system in zebrafish. Development Growth and Differentiation. (2008).
  64. Lloyd, E., et al. Evolutionary shift towards lateral line dependent prey capture behavior in the blind Mexican cavefish. Developmental Biology. (2018).
멕시코 Cavefish에서 유전자 기능 조작
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Stahl, B. A., Jaggard, J. B., Chin, J. S. R., Kowalko, J. E., Keene, A. C., Duboué, E. R. Manipulation of Gene Function in Mexican Cavefish. J. Vis. Exp. (146), e59093, doi:10.3791/59093 (2019).More

Stahl, B. A., Jaggard, J. B., Chin, J. S. R., Kowalko, J. E., Keene, A. C., Duboué, E. R. Manipulation of Gene Function in Mexican Cavefish. J. Vis. Exp. (146), e59093, doi:10.3791/59093 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter