Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Manipulation av geners funktion i mexikanska släktet

Published: April 22, 2019 doi: 10.3791/59093

Summary

Vi beskriver metoder för manipulering av gener i den evolutionära modellsystem Astyanax mexicanus. Beskrivs tre olika tekniker: Tol2-medierad genmodifiering, riktade manipulering av genomet med CRISPR/Cas9 och överväldigande uttryck med hjälp av morpholinos. Dessa verktyg bör underlätta direkt undersökning av gener som ligger bakom variationen mellan surface - och grotta-bostad former.

Abstract

Cave djur ger ett tvingande system för att undersöka den evolutionära mekanismer och genetiska baser underliggande förändringar i många komplexa egenskaper, inklusive ögat degeneration, albinism, sömnbrist, hyperfagi och sensorisk bearbetning. Arter av släktet från hela världen visar en konvergent evolution av morfologiska och beteendemässiga egenskaper på grund av delade miljöbelastningar mellan olika grottsystem. Skiftande cave arter har studerats i en laboratoriemiljö. Den mexikanska tetra, Astyanax mexicanus, med synskadade och blinda former, har gett unika insikter i biologiska och molekylära processer som ligger bakom utvecklingen av komplexa egenskaper och är väl redo som en framväxande modellsystem. Även kandidatgener reglera utvecklingen av olika biologiska processer har identifierats i A. mexicanus, har möjligheten att validera en roll för enskilda gener begränsats. Tillämpningen av genmodifiering och genredigering tekniken har potential att övervinna denna påtagligt hämmas och att undersöka mekanismerna bakom utvecklingen av komplexa egenskaper. Här beskriver vi en annan metod för att manipulera genuttryck i A. mexicanus. Metoder inkluderar användning av morpholinos, Tol2 genmodifiering, och genredigering system, vanligen används i Zebrafiskar och andra fiskar modeller, för att manipulera geners funktion i A. mexicanus. Dessa protokoll innehåller detaljerade beskrivningar av tidsbestämda avel förfaranden, insamling av befruktade ägg, injektioner och valet av genetiskt modifierade djur. Dessa metoder kommer att möjliggöra utredningen av genetiska och neurala mekanismerna bakom utvecklingen av olika drag i A. mexicanus.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Sedan Darwins Origin of Species1, har forskare fått djupa insikter om hur egenskaper är formade evolutionärt svar på definierade miljömässiga och ekologiska tryck, tack vare cave organismer2. Den mexikanska tetra, A. mexicanus, består av eyed fäderneärvda 'yta' populationer som bebor floder i hela Mexiko och södra Texas och minst 29 geografiskt isolerade populationer av härledda cave morphs bebor den Sierra del Abra och andra områden i nordöstra Mexiko3. Ett antal grottan-associerade egenskaper har identifierats i A. mexicanus, inklusive förändrad syreförbrukning, pigmentborttagning, förlust av ögon och förändrad utfodring och födosök beteende4,5,6, 7,8,9. A. mexicanus presenterar en kraftfull modell för att undersöka mekanismer av konvergent evolution på grund av en väldefinierad evolutionära historia, en detaljerad karakterisering av ekologiska miljön och förekomsten av självständigt utvecklats cave populationer10,11. Många av de cave-härledda egenskaper som finns i släktet, inklusive ögat förlust, sova förlust, ökade utfodring, förlust av skolgång, minskad aggressivitet, och minska stressreaktioner, har utvecklats flera gånger genom oberoende ursprung, ofta utnyttja olika genetiska vägar mellan grottorna8,12,13,14,15. Detta upprepas evolution är en kraftfull aspekt av A. mexicanus systemet och kan ge insikt i den mer allmänna frågan om hur genetiska system kan vara orolig för att generera liknande fenotyper.

Medan tillämpningen av genteknik för mekanistiska utredning av geners funktion har begränsats i många fiskarter (inklusive A. mexicanus), ger senaste framstegen inom Zebrafiskar en grund för genetiska teknikutveckling i fisk 16,17,18,19,20. Många verktyg används allmänt i Zebrafiskar för att manipulera genuttryck och genomförandet av dessa förfaranden har länge standardiserats. Till exempel injektion av morpholino oligos (MOs) i singel-cellstadie selektivt blockerar RNA och förhindrar översättning för en kort tidsmässiga fönster under utveckling21,22. Dessutom genredigering metoder, såsom klustrade regelbundet mellanliggande kort palindromic repetitioner (CRISPR) / CRISPR-associerade protein 9 (Cas9) och transkription aktivator-liknande effektor nuclease (TALEN), möjliggör generering av definierade borttagningar eller, i vissa fall, infogningar genom en rekombination i genomen19,20,23,24. Genmodifiering används för att manipulera stabil genuttryck eller funktion i en cell-typ specifika sätt. Tol2 systemet används effektivt att generera transgena djur genom coinjecting transposase mRNA med en Tol2 DNA plasmid som innehåller en transgenens25,26. Tol2 systemet utnyttjar den Tol2 transposase av medaka att generera stabila könsceller införanden av transgena construct17. Generera Tol2 transgenics innebär coinjecting en plasmid som innehåller en transgenens flankerad av Tol2 integration platser och mRNA för Tol2 transposase17. Detta system har använts för att generera en array av transgena linjerna i Zebrafiskar och dess användning har nyligen expanderat till ytterligare framväxande modellsystem, inklusive ciklider, killifish, Småspigg, och, mer nyligen, den mexikanska släktet27, 28,29,30.

Medan släktet är ett fascinerande biologiska system för klarlägga mekanismer av drag evolution, har dess fulla kapacitet som en evolutionär modell inte varit fullt utnyttjas. Detta har delvis berott på en oförmåga att manipulera genetiska och cellulär funktion direkt31. Kandidatgener reglera komplexa egenskaper har identifierats med hjälp av kvantitativa loci (QTL) studier, men validering av dessa kandidatgener har varit svårt32,33,34. Nyligen, övergående knockdown använder morpholinos, gen redigering med CRISPR och TALEN, och användning av Tol2-medierad genmodifiering har använts för att undersöka den genetiska grunden bakom ett antal drag35,36,37 ,38. Genomförande och standardisering av dessa tekniker möjliggör manipulationer som förhöra den molekylära och neurala underbyggnaden av biologiska egenskaper, inklusive manipulering av geners funktion, märkning av definierade cellpopulationer, och uttrycket av funktionella reportrar. Medan ett framgångsrikt genomförande av dessa genetiska verktyg för att manipulera genen eller cellulär funktion har påvisats i framväxande modellsystem, saknas fortfarande detaljerade protokoll i A. mexicanus.

A. mexicanus ger kritisk insikt om mekanismerna för evolution i svar på en föränderlig miljö och närvarande möjlighet att identifiera nya gener som reglerar olika egenskaper. Ett antal faktorer tyder på att A. mexicanus är en extremt lätthanterlig modell för att tillämpa etablerade genomisk verktyg som för närvarande finns i etablerade genetiska modeller, inklusive möjligheten att enkelt underhålla fisk i laboratorier, stor barnaskara storlek, öppenhet, ett sekvenserat genomet och definierade beteendemässiga analyser39. Här, beskriver vi en metod för användning av morpholinos, genmodifiering och gen redigering i ytan och grottan populationer av A. mexicanus. En bredare tillämpning av dessa verktyg i A. mexicanus möjliggör en mekanistisk utredning de molekylära processer som ligger bakom utvecklingen av utvecklingsmässiga, fysiologiska och beteendemässiga skillnader mellan släktet och ytan fisk.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Morpholino oligo design

Obs: Sekvenser för A. mexicanus finns tillgängliga genom nationella Center of Biotechnology Information (NCBI) genen och NCBI SRA (https://www.ncbi.nlm.nih.gov), samt från häckning genomet webbläsaren (https://www.ensembl.org). När du utformar en morpholino för användning i båda yta - och grotta-bostad bildar, är det viktigt att identifiera någon genetisk variation mellan morphs i detta skede, så dessa genetiska regioner kan undvikas som mål för morpholinos. En morpholino målwebbplats polymorfa variationen kan leda till ineffektiva bindande. Designen liknar andra fisk-system, såsom zebrafisk, och har tidigare visats att arbeta effektivt i A. mexicanus21,36,40.

  1. Utformningen av översättning-blockerande morpholinos
    Obs: Översättning-blockerande morpholinos blockera översättning genom bindning till endogena start platsen och hindra translationell maskiner från bindande mRNA sekvensen genom Sterisk hinderance.
    1. Identifiera kodande regionen av målgenen börjar med ATG start platsen.
    2. Spela in de första 25 baspar av sekvensen mål genom klippa-och-klistra sekvensen i en text editor eller lab notebook.
    3. Med online-programvara (t.ex. http://reverse-complement.com) eller manuell översättning, generera ett omvänd komplement till mål sekvensen. Spara det resulterande omvänd komplementet i en textredigerare eller lab notebook.
    4. Beställ en morpholino med omvänd komplement sekvens från ett företag som genererar morpholino oligonukleotider. Se Tabell för material för företag.
  2. Utformningen av skarv-blockerande morpholinos
    Obs: Splice-blockerande morpholinos blockera skarvning och således förhindra bildandet av en mogen mRNA-molekyl. Detta ger en alternativ metod för knockdown när start webbplatser inte är väldefinierade, eller en mer optimal strategi när validering av knockdown via polymeras-kedjereaktion (PCR) önskas. Denna förmån av skarv-blockerande morpholinos (över ATG-blockerande MOs) är att exon uteslutning eller intron inkludering lätt kan bedömas med omvänt transkriptas (RT)-PCR och storlek skillnader visualiseras på en gel. RT-PCR och gel elektrofores att avgöra morpholino effekt bör göras med hjälp av standard laboratorierutiner.
    1. Identifiera den pre-mRNA-sekvensen av målgenen. Utnyttja tillgänglig information från A. mexicanus genomet via NCBI eller häckning för att bestämma intron-exon gränser33.
    2. Rikta exon-intron (splice givare) eller intron-exon gräns (splice acceptor) platser för intron införande eller exon uteslutning.
      Obs: Spliceosome normalt riktar sig till en ”GU” sekvens (U1 mål) i intron på webbplatsen 5' skarv och en ''AG'' sekvens på 3' (U2) intronic skarv målwebbplatsen. Under normala förhållanden binda den spliceosome U1 och U2 subenheter dessa mål platser på den pre-mRNA-sekvensen för korrekt skarvning sker. Men om något av dessa mål sekvenser blockeras av en morpholino, kommer att spliceosome flytta till nästa tillgängliga U1 eller U2 webbplats, orsakar antingen en intron uteslutning eller exon i sekvensen mRNA. Detta kommer att innebära planering/optimering, beroende på vilken typ av mål gen21. Allmänhet, blockerar en intern U1 plats omdirigerar skarven till nästa tillgängliga U1 webbplats, orsakar en exon excision. Alternativt, blockerar korsningen första eller sista skarv orsakar en intron integration eftersom det finns ingen annan webbplats omdirigera skarven till. Använda sekvens programvara för att förutsäga effekten av olika undantag kontra inneslutningar. Förutsägelser kan indikera potentiella bassubstitutioner eller förtida stop kodon, som anger en effektivare målplatsen för mRNA störningar.
    3. När målplatsen är identifierat, registrera dess sekvens i en text editor eller lab bok. Kontrollera att målplatsen är 25 baspar (bp) lång.
    4. Med online-programvara (t.ex. http://reverse-complement.com) eller manuell översättning, generera ett omvänd komplement till mål sekvensen. Spela in dess sekvens i en text editor eller lab bok.
    5. Beställ en morpholino med omvänd komplement sekvens från ett företag som genererar morpholino oligonukleotider. Se Tabell för material för provet företag.

2. Morpholinos för injektion

Obs: Flera koncentrationer eller volymer av MO injektion behöver utföras för att fastställa den optimala koncentrationen att injicera. Typiska injektioner kvantiteter är 400 – 800 pg av MO. Effekten av morpholino knockdown kan kvarstå i upp till 6 dagar postinjection.

  1. Få den lager morpholino. De lager morpholino anländer frystorkade. Fukta det med sterila H2O före användning på önskad lager koncentration (t.ex. 4 mM). Förvaras vid-20 °C fram till användning.

3. CRISPR gärna design, in vitro-transkription och förberedelse

  1. CRISPR gärna design
    Obs: gRNAs genererades med hjälp av tidigare publicerade forskning av Varshney et al.40 och Wierson et al.41.
    1. Använder en genomet webbläsare, identifiera den kodande regionen av genen av intresse. Med den genomiska sekvensen, identifiera sekvensen gärna mål inom en exon genom att söka efter en 20 bp nukleotid mål sekvensering början med GG och följt av en PAM-sekvens (NGG). En region av genen efter start (ATG) kommer att riktas.
      Obs: Om en target sekvens med GG i slutet 5' inte kan hittas i den önskad exon genen, en eller båda av G's kan ersätta de första och andra nukleotiderna i 5' slutet av sekvensen. Dock de två G's måste införlivas i oligo, eftersom dessa är krävs för T7 transkription.
    2. Utforma och beställa en gen-specifika oligonukleotiden (oligo A: 5'-TAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGC-3'). Lägga till gen-specifika 20 bp gärna mål sekvensen (fetstil) utan den PAM sekvensen mellan en T7 Promotorn sekvens (röd) och en överlappning sekvens som används att glödga till en andra oligonukleotiden (blå). Glödga och förstärka (se steg 3.2.1) denna oligo A och en andra oligo (oligo B: 5'-GATCCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTT AACTTGCTATTTCTAGCTCTAAAAC-3') att generera gärna mallen används för transkription.
      Obs: Oligo B är samma för varje reaktion och behöver endast beställas 1 x.
  2. Gärna förberedelse och transkription
    1. Glödga och förstärka oligos. Inkludera följande grundfärger för att förstärka gärna för att öka avkastningen: 5'-TAATACGACTCACTATA-3' (T7 primer) och 5'-GATCCGCACCGACTCGGTG-3' (gärna primer 3'). Utföra en PCR med Thermococcus kodakaraensis (KOD) polymeras.
      Obs: För både grundfärger i oligo A och oligo B, 10 cykler rekommenderas för en bra avkastning. Ett detaljerat protokoll kan hittas i Wierson et al.41.
    2. Transkribera den gärna med kommersiellt tillgängliga in vitro-transkription kits (se Tabell för material). Detta görs genom ändringar av tillverkaren's protokollet publiceras med Klaassen et al.42.
    3. Fällning, tvätta och resuspendera gärna som beskrivs med Klaassen et al.42.
      Obs: Gärna måste vara resuspended i RNase-fritt vatten för att förhindra nedbrytning.
    4. Registrera koncentrationen av den gärna, som kan bestämmas med hjälp av en spektrofotometer. Bedöma kvaliteten på RNA genom att köra 2 µL på en agarosgel. Alikvotens RNA att undvika frysning/upptining och förvara den vid-80 °C tills omedelbart före injektionerna.
  3. Cas9 förberedelse och transkription
    1. Cas9 mRNA kan transkriberas med kommersiellt tillgängliga in vitro-transkription kits (se Tabell för material) som tidigare beskrivits43. Använd nls-Cas9-nls version43.
    2. Registrera koncentrationen av gärna och bedöma dess kvalitet genom att köra 2 µL på en agarosgel. Alikvotens RNA att undvika nedbrytning som uppstår genom flera frysning-tining cykler, och lagra alikvoter vid-80 °C.

4. beredning av Tol2 konstruktioner, Tol2 transposase och genmodifiering

  1. Förbered Tol2 transgenens konstruktioner för injektion.
    Obs: Vi har framgångsrikt använt publicerade/tillgängliga Zebrafiskar och medaka konstruerar i A. mexicanus. Dessa konstruktioner är fullt fungerande i A. mexicanus, sannolikt på grund av den höga sekvenshomologi (se AddGene databasen och Zebrafiskar informationsnätverket [ZFIN] databaser för tillgängliga konstruktioner). Zebrafiskar arrangören fragment har uttryckt transgener i förväntade vävnader när den används i A. mexicanus.
    1. Förvärva Tol2 konstruktioner eller generera plasmid med en vävnad-specifika Promotorn, önskad transgenens och Tol2 armar (se Kwan et al.44). Vid mottagandet, sekvens konstruktionen för att validera Plasmiden.
    2. Utför en midiprep för konstruktioner enligt tillverkaren's riktlinjer. Eluera slutliga plasmiden i RNase-fri H2O, fastställa koncentrationen med en spektrofotometer, späda ut koncentrationen till 100300 ng /μL, och delprov och store konstruktioner vid-20 °C.
  2. Smälta Tol2 transposase plasmid och syntetisera mRNA.
    1. Få en kopia av Tol2 transposase plasmiden (pCS-zT2TP) som en mall för att skapa Tol2 mRNA45.
    2. Midiprep den St-zT2TP konstruera enligt tillverkaren's riktlinjer. Eluera det i en låg volym RNase-fritt vatten eller buffert (~ 50 μL). Lagra alikvoter vid-20 °C.
    3. Smälta Tol2 plasmiden med ett restriktionsenzym.
      1. Utföra en begränsning sammanfattad på 10 µg av cirkulär pCS-zT2TP plasmid med hjälp av tabell 1.
      2. Dela upp reaktionen in 250 μL reaktioner och inkubera reaktionerna över natten vid 37 °C i en termocykel.
      3. Följande dag, inaktivera enzymet genom att värma det till 65 °C i 20 min.
      4. Rena linearized plasmid omedelbart efter sammanfattningen, använder kommersiellt tillgängliga PCR rening Kit (se Tabell för material) per tillverkare' riktlinjerna. Eluera plasmiden i 15 μL av RNase-fri H2O och bestämma koncentrationen av produkten med en spektrofotometer.
      5. Kör 1 μL av smält plasmid och 1 μL av uncut plasmid på en 1,5% agaros gel för att bekräfta linearized plasmid.
    4. Utföra en in vitro-transkription av Tol2 mRNA.
      1. Utnyttja 1 2µg linearized pCS-zT2TP plasmid som en mall för transkription. Följ tillverkarens's riktlinjer för in vitro-transkription (se Tabell för material) som beskrivs i tabell 2.
      2. Inkubera vid 37 °C i en termocykel per tillverkaren's riktlinjer.
      3. Tillsätt 1 µL av DNAS, Inkubera det vid 37 °C i en termocykel per tillverkaren's riktlinjer.
      4. Utföra litium klorid nederbörd per transcription kit protokoll. Återsuspendera pelleten RNA i ~ 2030 μL av RNase-fri H2O.
      5. Bestämma koncentrationen av produkten genom att använda en spektrofotometer och registrera RNA kvaliteten.
      6. Späd produkten till ~ 100300 ng/µL och alikvot till 510 μL prov att undvika upprepad frysning-tining. Lagra dem vid-80 °C fram till användning.
        Obs: Det är möjligt att kontrollera 12 µL av renat Tol2 mRNA för utstryk/band med gelelektrofores.

5. microinjections

  1. Beredning av generella verktyg för injektioner
    Obs: I det här avsnittet har beskrivits i detalj av Kowalko et al.46och en översikt med smärre ändringar presenteras här.
    1. Generera injektion plattor av hälla varma 3% agaros upplöst i fisk systemet vatten till en 100 mL petriskål. Placera försiktigt en ägg injektion mögel i nyligen hällde Agarens att göra brunnar för fiskägg. Placera sidan av mögel i agar i 45° vinkel och, sedan långsamt sänka den i Agarens; långsamt sänka formen vinkel undviker luft att fastna under mögel. Ta försiktigt bort mögel när Agarens är stelnat. Plattorna kan lagras, förseglade, vid 4 °C i upp till 1 vecka.
    2. Dra nålar från borosilikatglas kapillärer injektionsvätska i en elektrod nål avdragare enligt tillverkaren's riktlinjer. Detta protokoll kommer att variera per pipett avdragare; dock kan prov nål-pulling program hittas i tabell 3.
      Obs: Optimera nålen är viktigt för injektioner, nålar som är för lång kommer böja i stället för att rent tränga in i ägget.
    3. Gör stora-bore glas Pipetter för ägg överföring genom att bryta standard glas pipetter så öppningen är tillräckligt stor för äggen. Med hjälp av en bunsenbrännare, polska trasiga slutet av glaset genom att exponera i slutet av de trasiga pipetterna till lågan tills den är slät.
  2. Installationsprogrammet för avel
    Obs: Det finns många olika protokoll som används för avel A. mexicanus. För en detaljerad protokollet, se Borowsky39. Starta avel installation 1 vecka före injektionerna.
    1. Dag 1, placera två till tre kvinnor och tre män i en enda 10 gallon tank upprätthålls på 24 ± 1 °C.
    2. På dagar 17, öka utfodring av ~ 3 x per dag. Se till att kosten innehåller levande föda, som svarta maskar och artemia.
    3. På dag 6, lägga till en enda tank värmare inställd på 27 °C. Lab tank temperaturer kan variera; Därför blir detta en ökning med 23 °C i förhållande till den normala tank temperaturen.
    4. På kvällen den dag 7, vilket är kvällen (zeitgeber [ZT] 911) injektion natt, grundligt Rengör tankarna med en vatten-indränkt svamp och ta bort eventuella överskott mat eller skräp med hjälp av ett finmaskigt nät eller en sifon.
    5. På natten till dag 7, börja kontrollera för surface fiskägg på ZT15 och fortsätta att kontrollera var 1530 min tills ZT18. För släktet, börja kontrollera för ägg på ZT17 och fortsätta att kontrollera var 1530 min tills ZT20.
      Obs: Tider baseras på en 14:10 h ljus: mörk cykel använda zeitgeber tid. Avel tider är uppskattningar och enskilda labs måste fastställa exakta tider. Det är viktigt att samla in ägg snart efter att de släppt/befruktas för att injicera dem i encelliga skede.
  3. Samling av single-cell skede ägg
    1. Natten som förväntas avel, undersöka tankarna var 1530 min och monitor för ägg på botten av tanken. Ägg visas genomskinligt, mäter cirka 1 mm i diameter.
    2. Använd en finmaskig fisk netto för att samla ägg och överföra dem till en glasskål fylld med färsk fisk systemet vatten. Undersöka äggen under ett Mikroskop för att bekräfta att äggen är i one-cellstadie.
    3. Använda glas Pipetter, överföra encelliga ägg till injektion plattorna. Glas pipetter krävs i detta skede som äggen kommer att hålla sig till plast.
    4. Med pipett noggrant att släppa äggen i brunnar av agaros injektion plattan från avsnitt 5.1. Fyll raderna av förvärmd (vid rumstemperatur) injektion plattan med det maximala antalet ägg (3040 per rad och upp till fem rader). Hela rader att hålla äggen rör sig under injektioner. Håll äggen hydratiserade på injektion plattan med en liten mängd fisk systemet vatten fram till utförandet av injektionerna.
  4. Pico-injektion setup och allmänna injektion optimering riktlinjer
    1. Återfyllning injektionsnålar använder antingen gel-lastning pipett tips som passar inuti kapillär eller använder standard mikropipett tips och lägga till en 24 µL bolus på slutet. När nålen är fylld, Använd pincett för att trimma överflödig längd från injektionsnålen.
    2. Utföra microinjections med hjälp av en nål som monteras i en micromanipulator, ansluten till en picoliter microinjector.
    3. Ställa in injektion till 0,03 s och pressa ut vid ~0.0 psi. Injekteringstryck varierar således med smärre skillnader mellan nålar, så optimera för att uppnå en ~1.0 nL injektion bolus.
      Obs: Injekteringstryck är ofta i spänna av ~ 1030 psi.
    4. Standardisera bolus injektion genom att injicera i mineralolja och mäta bolus storlek med en slide mikrometer att uppnå en ~ 11,5 nL Injektionsvolym. Justera Injekteringstryck (psi) för att öka eller minska volymen bolus.
    5. Dra vatten från toppen av äggen med en lab-vävnad.
      Obs: Astyanax ägg chorion är lite tuffare att penetrera än zebrafisk ägg. Vi finner att rita vattnet bort toppen av äggen hjälper underlätta nål penetration in i ägget. Plattan optimering kan tillåta för ~ 200 ägg på en enda plåt.
    6. Använda micromanipulator för att penetrera varje ägg med nålen och injicera direkt i äggulan. När placerad i äggulan, injicera ägget genom att trycka på fotpedalen injicera knappen eller injektion.
      Obs: En full tallrik kan injiceras inom ~ 15 min. Encelliga scenen varar för ~ 40 min.
  5. Injektion av morpholinos
    Obs: Mängden morpholino nödvändiga för knockdown utan att orsaka toxicitet kommer att behöva optimeras per gen mål; dock en koncentration av 400 pg är ett bra ställe att börja.
    1. Förbereda morpholino så att 400 pg av morpholino kommer att injiceras per ägg. Tina morpholino på is. Injektionslösningen består av morpholino (vid önskad koncentration), fritt från RNase H2O eller Danieau's lösning och fenolrött (10% av den slutliga volymen). För ett exempel, se tabell 4.
    2. Injicera 1 nL per embryo.
  6. CRISPR injektioner
    1. Förbereda RNA så att 25 pg av gärna och 300 pg Cas9 mRNA totala kommer att injiceras per embryo. För ett prov CRISPR/Cas9 injektion blandning, se tabell 5.
    2. Injicera 2 nL av gärna/Cas9 mRNA per embryo direkt i embryot.
  7. Injektion av Tol2 transposase och Tol2-flankerad plasmid för genmodifiering
    1. Tina transposase mRNA och Tol2 plasmid på is. Kombinera Cas9 mRNA (på 25 ng/µL), önskad Tol2 konstruktion (25 ng /μL), och fenolrött (10% av den slutliga volymen) i RNase-gratis vatten. För ett prov Tol2 genmodifiering injektion blandning, se tabell 6.
    2. Håll injektionslösningen och nålar på is för att undvika nedbrytning av mRNA. Injicera 1 nL i volym per embryo.

6. uppfödning och screening injiceras fisk

  1. Injicerade fisk djurhållning
    1. Efter äggen injiceras, omedelbart överföra dem till glasskålar (10 x 5 cm) fylld med ~ 200 mL fisk systemet vatten. Ägg sköljs enkelt genom att doppa injektion plattorna i skålar fylld med fisk vatten och skölja ägg med en pipett.
    2. Placera ~ 5080 injicerade embryon per skål och föda upp dem vid 2224 °C.
    3. Rengör skålarna med injicerade fisk 2 x per dag för att ta bort döda embryon och ändra ~ 20% av vattnet på en daglig basis.
    4. Ytterligare uppfödning utförs i enlighet med tidigare publicerade protokoll39.
  2. Screening av morpholino-insprutning individer
    1. Visualisera djur under ett stereomikroskop till skärmen för fenotyper. Effekten av morpholinos kan kvarstå upp till ~ 5 dagar postinjection21.
    2. Mäta beteendemässiga fenotyper på 4 dagar postinjection.
  3. Screening för CRISPR indels
    1. Design grundfärger att förstärka genomiskt DNA runt målplatsen. Utforma primers så att target PCR-produkten är cirka 100125 bp.
      Obs: till exempel för det oca2 -locus, den region som omger gärna målwebbplatsen förstärktes med forward primer 5'-CTCCTCTGTCAGGCTGTGC-3' och reverse primer 5'-GAAGGGGATGTTGTCTATGAGC-3' för en PCR produkt längd av 105 bp.
    2. Offra embryon eller fin klipp vuxen fisk enligt protokollet institutionella djur.
    3. Samla in embryon eller dissekerade fenor i PCR-rören och extrahera DNA och utföra primärvården. prov PCR-protokoll för gen-specifika primers kan hittas i Ma et al.35.
    4. Att bedöma för mutagenes, köra 5 resulterar µL av PCR-produkten på en 3% agarosgel på 70 V för 3 h. (nonmutagenized) Wild-type-DNA i en PCR-produkt som ett distinkt band. Muterat DNA kommer att resultera i en smetig band på gelen.
    5. För att avgöra sekvensen av muterade alleler, TA klona PCR-produkten enligt tillverkaren'anvisningar, plocka kolonier och miniprep kulturer. Skicka den resulterande DNA för sekvensering.
    6. För att upprätta och upprätthålla linjer av fisk överföra muterade alleler, korsa vuxen injiceras fisk till vildtyp fisk och skärm 510 embryon att avgöra om någon av avkomman bärare av en muterad allel av genen efter steg 6.3.1-6.3.6.
      Obs: Olika F1 individer från samma F0 grundare fisk kan bära olika mutationer. Säkerställa mutant linjerna är sekvenserade Erhåll mutationer förutspådde för att producera alleler som är ur ram.
    7. Identifiera fisk bärare av en muterad allel med PCR med smetig band-analys (steg 6.3.1-6.3.6) eller genom att utforma allel-specifika PCR primers som kommer att förstärka mutant och vildtyps-band (figur 2 c).
    8. När en linje av fisk är etablerad, homozygose muterade alleler att testa för recessiv fenotyper.
  4. Screening för transgena positiva individer
    Obs: Rekommenderas använda konstruktioner som innehåller en fluorescerande maker att effektivisera screening för transgena positiva individer. Dock standard PCR screeningmetoder kan användas till skärmen för överföring.
    1. Visualisera vävnadsspecifika fluorescerande proteiner i F0 fisk så tidigt som 2 dagar postinjection, med en epifluorescence dissekera omfattning.
      Anmärkning: Uttrycket i F0 larver är mosaik och positiva individer kan ha en rad uttryck fenotyper.
    2. Hålla positiva individer som F0 grundare fisk.
    3. När F0s når mognad, backcross grundande fisk till nontransgenic individer som härrör från samma befolkning/lab bestånd. Skärmen F1 avkomma med samma protokoll som beskrivs i steg 6,2.
      Anmärkning: Uttrycket i F1 larver är enhetlig och säkerställer enhetlighet bland F1 syskon.
    4. Eftersom Tol2 integration är inte plats-medierad och integration kan variera bland grundarna, Välj F1 syskon härrör en enda F0 grundare och korsas positiva-uttryckande F1 syskon för att generera F2s. Denna avkomma kommer att ligga till grund för en stabil linje.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Flera populationer av grottboende A. mexicanus visar reducerad sömn och ökad vakenhet/aktivitet i förhållande till sin yta-bostad artfränder14. Hypokretin/orexin (HCRT) är en mycket neuropeptid, som agerar för att öka vakenhet, och avvikelser i HCRT väg orsaka narkolepsi hos människor och andra däggdjur47,48. Vi har tidigare visat att grottan A. mexicanus har ökat uttryck av HCRT peptid, vilket tyder på att ett ökat uttryck av denna peptid kan ligga bakom förlusten av sömn i släktet38. Den MO knockdown hcrt uttryck ger en kraftfull metod för att direkt pröva effekten av ökad hcrt uttryck medla förlust av sömn i släktet.

För att undersöka sambandet mellan hcrt uttryck och sömn, utformade vi en översättning-blockerande morpholino. MO mål de första 25 bp av exon, inklusive ATG startar webbplats (figur 1A,B). Som en kontroll utnyttjade vi en kommersiellt tillgänglig kodade MO kontroll (figur 1B). Med BLAST algoritm på NCBI, bekräftat vi att det finns inga off-target effekter för antingen MO i hela genomet (inga data anges). A. mexicanus yta fisk och Pachón släktet var bred och deras ägg samlades in och sedan injiceras med 400 pg av MO i en 1 nL-volym i en-cellstadie (figur 1 c,D). Fisken var upphöjt till 4 dpf och sedan mätt för aktivitet och sömn beteende.

Cave A. mexicanus injiceras med kontrollen MO uppvisade betydligt mer rörelseaktivitet och minskad sömn under en 24 h period jämfört med surface fisk också injiceras med kodade MO (figur 1E,F), vilket tyder på ingen effekt av den Kontrollera morpholino injektioner som resultaten överensstämmer med tidigare publicerade aktivitet och sömn mönster i varje morphotype (t = 5.021, df = 88, p < 0,0001). Injektion av HCRT-MO hade liten effekt på sömnen i ytan fisk jämfört med kontroll-injiceras fisken (t = 0,17, df = 88, p > 0,99). Däremot hade hcrt knockdown via MO injektion en betydande inverkan på sömn i grottboende fisk. Pachón släktet larver visade mindre än en fyrfaldig minskning i rörelseaktivitet, och sover nästan två gånger mer än styra Pachón larver (figur 1E,F; t = 2.694, df = 88, p < 0,05). En jämförelse av rörelseaktivitet och sova i MO-knockdown yta - och grotta-bostad fisk visade jämförbar locomotion och sömn belopp (figur 1E, F). Dessa data ger en direkt koppling mellan hcrt uttryck och sömnbrist och tillhandahålla en metod för att förhöra de biologiska mekanismerna för förlust av sömn i de evolutionärt härledda grottboende morphs.

Pigmentering förlust är ett kännetecken för grottan organismer, och flera grottboende Astyanax populationer visar förlust av pigmentering. Albinism hos Molino och Pachón släktet har mappats använder QTL mappning till en genomisk region som innehåller genen, okulär albinism 2 (oca2), vilket tyder på mutationer i oca2 ligger bakom albinism i släktet6.

För att validera oca2 som den orsakande locus för albinism i Pachón cave morphs, utnyttjade vi CRISPR/Cas9 gen redigering för att mutera denna region i ytan fiskpopulationer. Eftersom exon 21 raderas i Molino fisk6, utformade vi en gärna att rikta denna region av genen (figur 2A). Den genomiska sekvensen, inklusive gärna mål sekvensen och PAM (fetstil), är 5'-GGTCATGTGGGTCTCAGCTTTGG-3 '. Detta mål sekvens (utan sekvensen PAM) användes för att generera en gärna för riktad mutagenes. Yta uppfödare blev att mate och resulterande embryona insamlades i en-cellstadie. En-cellstadie embryon injicerades med Cas9 mRNA och gärna-targeting oca2och injicerade djuren togs upp till vuxen ålder43. De injicerade vuxna blev att para till vildtyp yta fisk och embryon från dessa korsningar var genotypbestämts att bestämma könsceller överföring, med hjälp av primers från steg 6.3.1. Vi sekvenserade en mutant oca2 -allelen och identifierade germ line-överförbara 2 bp borttagning i oca2 (figur 2B,C). För att underlätta genotypning utformat vi allel-specifika primers att identifiera vildtyp och muterade alleler (figur 2D) och genotypbestämts fisk, med PCR följt av gelelektrofores (figur 2E). Vi incrossed yta fisk som är heterozygota för denna oca2 mutant allel. Den resulterande avkomman var pigmenterad eller albino (figur 2F-jag). Pigmenterade individer var vildtyp eller heterozygot på det oca2-locus, medan albino individer var homozygot mutant (figur 2E). Dessa data ger en direkt koppling mellan oca2 -genen locus och albinism hos A. mexicanus släktet.

Otaliga beteenden såsom sömn, utfodring och stress skiljer sig i A. mexicanus släktet i förhållande till ytan artfränder, men de underliggande neuronala bestämningsfaktorerna mellan morphs förblir oklart. Hela-hjärnan kalcium imaging erbjuder en kraftfull förutsättningslös metod för att undersöka sambanden mellan förändrad neural aktivitet och ändrade beteende. Genererade vi ytan fisk och släktet med en nära-allmänt utbredda neuronala uttryck för indikatorn genetiskt kodade kalcium, GCaMP6s, med reagens används allmänt i Zebrafiskar forskning. ELAV-liknande neuron-specifika RNA-bindande protein 3 (elavl3) uttrycks endogent i nyligen differentierade nervceller i hela centrala nervsystemet49 och har använts i Zebrafiskar för att köra uttrycket av proteiner i hela majoriteten av nervsystemet50. Vi fick en Tol2 konstruktion som innehåller ~2.8 kb Zebrafiskar elavl3 Promotorn transkription uppströms genetiskt kodade kalcium indikatorn GCaMP6s (en blandning av grönt fluorescerande protein [GFP], calmodulin och M13, en peptid sekvens från myosin ljus-chain kinase), flankerad på 5' och 3' avslutar med Tol2 webbplatser (Tol2 -elavl3:GCaMP6s-Tol2)51.

A. mexicanus yta fisk och Molino släktet var bred, och de resulterande embryona var coinjected i singel-cellstadie med 25 ng/μl av den Tol2 -elavl3:GCaMP6s-Tol2 konstruera och 25 ng/μl Tol2 transposase mRNA (figur 3A). Vid 24 – 48 dpf, som larver screenades för en övergående neuronala uttryck för GCaMP6s. De injicerade (F0)-embryon med ett uttryck av GCaMP6s var upp till vuxen ålder och backcrossed med vildtyp vuxna härrör från samma härstamning av surface fisk eller släktet. De resulterande F1 vuxna screenades för ett stabilt uttryck av GCaMP6s uttryck, och dessa larver kvarstod för att generera stabila linjer (figur 3B,C). Eftersom varje F1 vuxen med ett stabilt uttryck har sannolikt integrerat Tol2 -elavl3: GCaMP6s-Tol2 på olika genomisk platser, varje F1 designeras en olika allel. Med denna metod har vi genererat stabil F1s för surface fisk och Molino släktet populationer (figur 3B,C), således möjliggöra levande kalcium imaging för att avslöja skillnader i neuronal aktivitet medla beteendeförändringar i grottan miljö (figur 3 C,D). Ytterligare, denna metod lägger grunden för uttrycket av många ytterligare transgener att karakterisera och manipulera funktionen genen i A. mexicanus.

Figure 1
Figur 1: Morpholino Nedslagning av Hcrt minskar aktivitet och ökar sömn i släktet. (A) översättning-blockerande morpholino mål de första 25 bp av den Hcrt kodande sekvens, inklusive webbplatsen för ATG-start. (B) Hcrt morpholino oligo (MO) och kontroll sekvenser. (C) justering av ~ 200 encelliga ägg på agaros ägg formar för injektion. (D) Mikroskop 1.0 nL injektion blandning med fenolrött indikator för visualisering. Skalstapeln = 0,5 mm. (E) Morpholino Nedslagning av Hcrt minskar aktiviteten (totala körsträcka) av Pachón släktet (t = 5.021, df = 88, p < 0,0001) men inte av surface fisk (t = 1.318, df = 88, p > 0,72). (F) Knockdown ökar sömn i Pachón släktet (t = 2.694, df = 88, p < 0,05) men har ingen effekt på ytan fisk (t = 0,17, df = 88, p > 0,99). Skalstapeln = 1 mm. Felstaplar i paneler E och F betecknar medelvärdet standardfel. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2: CRISPR genredigering av oca2 introducerar albinism i ytan-bostad A. mexicanus. (A) Schematisk bild av oca2 kodande regioner och guide RNA (gärna) inriktning exon 21 för CRISPR-medierad gen redigering. (B) sekvensering kromatogram av vildtyp Oca2 + och (C) mutant Oca2 - alleler. Den röda rutan i panelen B anger 2 bp sekvensen, som saknas i den muterade Oca2 - allelen skildras i panel C. (D) riktade CRISPR introducerar 2 bp borttagning, hormonstörande Oca2 funktion. Grundfärger är utformade för genotypisk screening av 2 bp borttagning i F0 avkomma. (E) PCR och gel elektrofores av Oca2 i vildtyp yta fisk (bandet storlek = 134 bp) och F0 CRISPR-injiceras avkomma (bandet storlek = 133 bp). Individer homozygota eller heterozygot för vildtyp varianten av Oca2 (Oca2 +) är pigmenterade, medan F0s homozygot för 2 bp radering (Oca2 -) harbor albinism. (F) hela kroppen bilder av vildtyp surface fisk och (G) yta fisk med CRISPR-medierad albinism. Skalstapeln = 5 mm. (H och jag) förstorad vy av huvuden av individer som skildras i paneler F och G, respektive. Skalstapeln = 2 mm. vänligen klicka här för att visa en större version av denna siffra.

Figure 3
Figur 3: Tol2 genmodifiering av pan-neuronal GCAMP6s möjliggör den levande avbildning av hjärnans aktivitet i A. mexicanus. (A) Tol2-medierad genmodifiering i A. mexicanus. Coinjection Tol2 mRNA och Tol2 -elav3l: GCAMP6s-Tol2 plasmid integrerar GCAMP6s transgenens i F0 grundarna. Återkorsning till det ursprungliga beståndet av vild typ fisk ger F1 individer med en stabil pan-neuronala uttryck för GCAMP6s. (B och C) resulterande avkomman screenas för ett stabilt uttryck med dissektion och konfokalmikroskopi. Stabil TgAsty(elav3l: GCaMP6s) F1 individer har fastställts för både yt-(avbildad i panelen B) och grottboende morphotypes (avbildad i panel C). Skalstapeln = 200 μm.  Klicka här för att se en större version av denna siffra.

Reagens Volym eller belopp
10,0 μg av St-zT2TP plasmid DNA X μl
NEB CutSmart buffert 10,0 µl
NotI-HF enzym 2.0 μl
Nuclease-fri H2O X μl
BSA 1,0 μl
Totalt 100 μl

Tabell 1: Begränsning sammandrag av Tol2 plasmid.

Reagens Volym eller belopp
1,0 μg av linearized pCS-zT2TP plasmid DNA X μl
10 x reaktion buffert 2.0 μl
2 x NTP/CAP 10,0 µl
SP6 enzym mix 2.0 μl
RNase-fri H2O X μl
Totalt ≤20 μl

Tabell 2: In vitro-syntesen av Tol2 mRNA.

Inställningens namn Inställningsvärde
Värme 510
Dra 55
Hastighet 100
Tid 40
Tryck 500
Ramp 534

Tabell 3: Prov pipett-pulling protokoll. 

Reagens Volym eller belopp
Morpholino (frys lager @ 4mM) 1,0 μl
Nuclease-fri H2O eller Danieaus lösning 17,0 μl
Phenol röd 2.0 μl
Totalt 20 μl

Tabell 4: Morpholino injektion blandning.

Reagens Volym av belopp
Gärna (arbetande slutkoncentration @ 100ng/μl) 1 μl
Cas9 mRNA (arbetande slutkoncentration @ 1200ng/μl) 1 μl
RNase-fri H2O 2 μl
Totalt 4 μl

Tabell 5: Prov CRISPR/Cas9 injektion blandning.

Reagens Volym av belopp
Tol2 plasmid (arbetande slutkoncentration @ 25ng/μl) X μl
Tol2 mRNA (arbetande slutkoncentration @ 25ng/μl) X μl
Phenol röd 1,0 μl
RNase-fri H2O X μl
Totalt 15 μl

Tabell 6: Prov Tol2 genmodifiering injektion blandning

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Här, gav vi en metodik för att manipulera geners funktion med morpholinos, CRISPR/Cas9 gen redigering och genmodifiering metodik. Rikedomen av genteknik och optimering av dessa system i Zebrafiskar sannolikt möjliggör överföring av dessa verktyg till A. mexicanus med lätthet52. Nya rön har använt dessa metoder i A. mexicanus, men de förblir underutnyttjade i utredningen av olika morfologiska, utvecklingsmässiga och beteendemässiga egenskaper i detta system30,36,42 , 53.

Morpholinos har använts i Zebrafiskar forskning till knockdown uttrycket av gener. Metoden är lättköpt och resulterar i en robust knockdown uttryck. Off-target effekter har dock allmänt dokumenterade22,53; Således, djur där morpholinos injicerats att övervakas noggrant för eventuella oväntade fenotyper22,55. När det är möjligt bör resultat från morpholino knockdown valideras med hjälp av andra metoder, såsom CRISPR/Cas9-medierad knockout metoder. Medan morpholinos möjliggör den robusta Nedslagning av genuttryck, är morpholino-medierad knockdown övergående. Således, analysera vuxen fenotyper är inte möjligt när du använder denna metod.

CRISPR/Cas9-medierad mutagenes erbjuder direkt manipulation av specifika gener. Vidare, till skillnad från morpholino-medierad knockdown, CRISPR/Cas9 mutagenes möjliggör analys av muterade fenotyper i vuxenlivet. För att förhindra off-target effekter av CRISPR/Cas9, mutant linjer bör vara outcrossed flera generationer, och om möjligt, mer än en allel bör erhållas och testade. CRISPR/Cas9 systemet ger också möjligheter för att utnyttja genredigering metoder att slå-i alleler eller att producera specifika genetiska förändringar. CRISPR/Cas9 systemet har använts i Zebrafiskar att producera exakt integrationer av exogent DNA och generera exakt punktmutationer19,20,56,57,58, 59. med sekvensering av släktet genomet, är det nu möjligt att identifiera enda nukleotid polymorfismer (SNP) eller andra subtila genetiska förändringar mellan surface fisk och släktet populationer33. Tillämpningen av CRISPR/Cas9 gen redigering ger tillfälle att utbyta alleler mellan surface fisk och släktet, eller mellan olika populationer av släktet, att undersöka rollen som dessa genetiska förändringar i olika utvecklingsprocesser.

De metoder för genmodifiering som beskrivs i detta protokoll ger en enkel och kraftfull metod för gain-of-function studier och för att generera verktyg att förändra biologiska processer genetiskt. Tol2 systemet används flitigt i Zebrafiskar forskning, och vi har visat att det är likaså kraftfull i A. mexicanus. Dessutom visade vi en transgena konstruktion som genereras i Zebrafiskar som använder Zebrafiskar främjare och recapitulates endogena uttryck i A. mexicanus. Vi har hittat fyra andra initiativtagare isolerade från zebrafisk bilresa vävnadsspecifika uttrycket som förväntat i A. mexicanus (inga data anges). Eftersom Zebrafiskar initiativtagare sammanfatta deras bevarade uttrycksmönster i A. mexicanus, tyder detta på att många av de genetiska verktyg kan överföras direkt från zebrafisk till A. mexicanus utan behov av modifiering med A. mexicanus promotorer. Dessutom med förskottet i sekvensering teknik i A. mexicanus33tillåter de transgena metoder som beskrivs här en kraftfull framtid för utredning av förstärkare och initiativtagare som kan spela en roll i variationen mellan ytan och grottan former. Slutligen, de kraftfulla verktyg för genmanipulation av biologiska processer som har gjort Zebrafiskar värdefulla är lika viktiga i A. mexicanus60,61,62,63. Skillnader i olika beteendemässiga egenskaper, såsom sömn, utfodring, stress och aggression, mellan A. mexicanus yta - och grotta-bostad bildar har varit utförligt dokumenterade12,14,15 ,38,64, men den underliggande neurala korrelat inte är väl förstått. Verktyg såsom Tg(elavl3:GCaMP6s) kommer tillåta en dissekering av hur skillnader i neuronal aktivitet hjärnan-wide korrelerar med skillnader i beteende och erbjuda en unik inblick i hur hjärnan har ändras evolutionärt.

Sammantaget är A. mexicanus redo för att bli en ledande modell för att undersöka utvecklingen av en mängd olika morfologiska och beteendemässiga drag. Olika skillnader i komplexa biologiska processer i A. mexicanus utgöra en plattform för att utreda genetiska mekanismer av drag evolution. Tillämpningen av verktyg för att manipulera geners funktion kan bidra till att utveckla denna organism i en modell som kan användas för att undersöka biologiska sjukdomar relaterade till ögat degeneration, neurologiska avvikelser och sömnlöshet.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har något att avslöja.

Acknowledgments

Författarna vill tacka Sunishka Thakur för hennes hjälp i genotypning och imaging oca2 mutant fisk avbildas i figur 2. Detta arbete stöddes av National Science Foundation (NSF) award 1656574 till A.C.K., NSF award 1754321 till J.K. och A.C.K., och National Institutes of Health (NIH) award R21NS105071 A.C.K. och E.R.D.

Materials

Name Company Catalog Number Comments
Fish breeding & egg supplies
Fine mesh fish net Penn Plax BN4
Fish tank heater Aqueon 100106108
Egg traps Custom made NA Design and create plastic grate to place at bottom of tank to protect eggs
Glass pipettes Fisher Scientific 13-678-20C
Pipette bulbs Fisher Scientific 03-448-21
Agarose Fisher Scientific BP160-500
Egg molds Adaptive Science Tools TU-1
Morpholino supplies
Control Morpholino Gene Tools, LLC Standard control olio
Custom Morpholino Gene Tools, LLC NA
Phenol Red Sigma Aldrich P0290-100ML
CRISPR supplies
Cas9 Plasmid AddGene 46757
GoTaq DNA Polymerase Promega M3001
KOD Hot Start Taq EMD Millipore 71-842-3
Primers Integrated DNA Technologies Custom
T7 Megascript Kit Ambion/Thermofisher AM1333
miRNeasy Kit Qiagen 217004
mMessage mMachine T3 kit Ambion/Thermofisher AM1348
MinElute Kit Qiagen 28204
Tol2 transgenesis supplies
pCS-zT2TP plasmid Kawakami et al., 2004 Request from senior author
CutSmart Buffer New England Biolabs B7204
NotI-HF Restriction Enzyme New England Biolabs R3189
PCR purification Kit Qiagen 28104
SP6 mMessenger Kit Ambion/Thermofisher AM1340
Microinjection supplies
Glass Capillary Tubes Sutter Instruments BF100-58-10
Pipette puller Sutter Instruments P-97
Picoinjector Warner Instruments PLI-100A
Micromanipulator World Precision Instruments M3301R
Micromanipulator Stand World Precision Instruments M10
Micmanipulator Base World Precision Instruments Steel Plate Base, 10 lbs

DOWNLOAD MATERIALS LIST

References

  1. Darwin, C. On the Origin of Species by Means of Natural Selection. D. Appleton and Company. (1859).
  2. Culver, D. C., Pipan, T. The Biology of Caves and Other Subterranean Habitats. Oxford University Press. New York, NY. (2009).
  3. Mitchell, R. W., Russell, W. H., Elliott, W. R. Mexican Eyeless Characin Fishes, Genus Astyanax: Environment, Distribution, and Evolution. (1977).
  4. Huppop, K. Oxygen consumption of Astyanax fasciatus (Characidae, Pisces): A comparison of epigean and hypogean populations. Environmental Biology of Fishes. 17, 299-308 (1986).
  5. Moran, D., Softley, R., Warrant, E. J. Eyeless Mexican Cavefish Save Energy by Eliminating the Circadian Rhythm in Metabolism. PLoS ONE. 9, (9), e107877 (2014).
  6. Protas, M. E., et al. Genetic analysis of cavefish reveals molecular convergence in the evolution of albinism. Nature genetics. 38, 107-111 (2006).
  7. Wall, A., Volkoff, H. Effects of fasting and feeding on the brain mRNA expressions of orexin tyrosine hydroxylase (TH), PYY and CCK in the Mexican blind cavefish (Astyanax fasciatus mexicanus). General and Comparative Endocrinology. 183, 44-52 (2013).
  8. Aspiras, A., Rohner, N., Marineau, B., Borowsky, R., Tabin, J. Melanocortin 4 receptor mutations contribute to the adaptation of cavefish to nutrient-poor conditions. Proceedings of the National Academy of Sciences. 112, (31), 9668-9673 (2015).
  9. Yoshizawa, M., Gorički, Š, Soares, D., Jeffery, W. R. Evolution of a behavioral shift mediated by superficial neuromasts helps cavefish find food in darkness. Current Biology. 20, (18), 1631-1636 (2010).
  10. Jeffery, W. R. Regressive Evolution in Astyanax Cavefish. Annual Review of Genetics. 43, 25-47 (2009).
  11. Gross, J. B. The complex origin of Astyanax cavefish. BMC Evolutionary Biology. 12, 105 (2012).
  12. Elipot, Y., Hinaux, H., Callebert, J., Rétaux, S. Evolutionary shift from fighting to foraging in blind cavefish through changes in the serotonin network. Current Biology. 23, (1), 1-10 (2013).
  13. Kowalko, J. E. J., et al. Loss of schooling behavior in cavefish through sight-dependent and sight-independent mechanisms. Current Biology. 23, (19), 1874-1883 (2013).
  14. Duboué, E. R. E. R., Keene, A. C. A. C., Borowsky, R. L. R. L. Evolutionary convergence on sleep loss in cavefish populations. Current Biology. 21, (8), 671-676 (2011).
  15. Chin, J. S., et al. Convergence on reduced stress behavior in the Mexican blind cavefish. Developmental Biology. (2018).
  16. Scheer, N., Campos-Ortega, J. A. Use of the Gal4-UAS technique for targeted gene expression in the zebrafish. Mechanisms of Development. 80, (2), 153-158 (1999).
  17. Kawakami, K., Shima, A., Kawakami, N. Identification of a functional transposase of the Tol2 element, an Ac-like element from the Japanese medaka fish, and its transposition in the zebrafish germ lineage. Proceedings of the National Academy of Sciences. 97, (21), 11403-11408 (2000).
  18. Balciunas, D., et al. Enhancer trapping in zebrafish using the Sleeping Beauty transposon. BMC Genomics. (2004).
  19. Auer, T. O., Duroure, K., De Cian, A., Concordet, J. P., Del Bene, F. Highly efficient CRISPR/Cas9-mediated knock-in in zebrafish by homology-independent DNA repair. Genome Research. 24, (1), 142-153 (2014).
  20. Kimura, Y., Hisano, Y., Kawahara, A., Higashijima, S. I. Efficient generation of knock-in transgenic zebrafish carrying reporter/driver genes by CRISPR/Cas9-mediated genome engineering. Scientific Reports. 4, (2014).
  21. Bill, B. R., Petzold, A. M., Clark, K. J., Schimmenti, L. A., Ekker, S. C. A Primer for Morpholino Use in Zebrafish. Zebrafish. 6, (1), 69-77 (2009).
  22. Nasevicius, A., Ekker, S. C. Effective targeted gene “knockdown” in zebrafish. Nature Genetics. (2000).
  23. Sander, J. D., et al. Targeted gene disruption in somatic zebrafish cells using engineered TALENs. Nature Biotechnology. (2011).
  24. Huang, P., et al. Heritable gene targeting in zebrafish using customized TALENs. Nature Biotechnology. (2011).
  25. Kawakami, K. Transposon tools and methods in zebrafish. Developmental Dynamics. 234, (2), 244-254 (2005).
  26. Urasaki, A., Morvan, G., Kawakami, K. Functional dissection of the Tol2 transposable element identified the minimal cis-sequence and a highly repetitive sequence in the subterminal region essential for transposition. Genetics. 174, (2), 639-649 (2006).
  27. Juntti, S. A., Hu, C. K., Fernald, R. D. Tol2-Mediated Generation of a Transgenic Haplochromine Cichlid, Astatotilapia burtoni. PLoS ONE. 8, (10), (2013).
  28. Harel, I., Valenzano, D. R., Brunet, A. Efficient genome engineering approaches for the short-lived African turquoise killifish. Nature Protocols. 11, (10), 2010-2028 (2016).
  29. Erickson, P. A., Ellis, N. A., Miller, C. T. Microinjection for Transgenesis and Genome Editing in Threespine Sticklebacks. Journal of Visualized Experiments. (111), e54055 (2016).
  30. Elipot, Y., Legendre, L., Père, S., Sohm, F., Rétaux, S. Astyanax transgenesis and husbandry: how cavefish enters the laboratory. Zebrafish. 11, (4), 291-299 (2014).
  31. Keene, A., Yoshizawa, M., McGaugh, S. Biology and Evolution of the Mexican Cavefish. Academic Press. New York, NY. (2015).
  32. Casane, D., Rétaux, S. Evolutionary Genetics of the Cavefish Astyanax mexicanus. Advances in Genetics. 95, 117-159 (2016).
  33. Mcgaugh, S., et al. The cavefish genome reveals candidate genes for eye loss. Nature Communications. 5, 5307 (2014).
  34. Yoshizawa, M., et al. Distinct genetic architecture underlies the emergence of sleep loss and prey-seeking behavior in the Mexican cavefish. BMC Biology. 13, (1), (2015).
  35. Ma, L., Jeffery, W. R., Essner, J. J., Kowalko, J. E. Genome editing using TALENs in blind Mexican cavefish, Astyanax mexicanus. PLoS ONE. 10, (3), (2015).
  36. Bilandzija, H., Ma, L., Parkhurst, A., Jeffery, W. A potential benefit of albinism in Astyanax cavefish: downregulation of the oca2 gene increases tyrosine and catecholamine levels as an alternative to melanin synthesis. PLoS ONE. 8, (11), e80823 (2013).
  37. Alie, A., et al. Developmental evolution of the forebrain in cavefish: from natural variations in neuropeptides to behavior. eLife. 7, e32808 (2018).
  38. Jaggard, J. B., et al. Hypocretin underlies the evolution of sleep loss in the Mexican cavefish. eLife. 7, e32637 (2018).
  39. Borowsky, R. Handling Astyanax mexicanus eggs and fry. Cold Spring Harbor Protocols. 3, (11), (2008).
  40. Varshney, G. K., Sood, R., Burgess, S. M. Understanding and Editing the Zebrafish Genome. Advances in Genetics. 92, 1-52 (2015).
  41. Wierson, W. A., et al. GeneWeld: a method for efficient targeted integration directed by short homology. BioRxiv. (2018).
  42. Klaassen, H., Wang, Y., Adamski, K., Rohner, N., Kowalko, J. E. CRISPR mutagenesis confirms the role of oca2 in melanin pigmentation in Astyanax mexicanus. Developmental Biology. (2018).
  43. Jao, L. E., Wente, S. R., Chen, W. Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proceedings of the National Academy of Sciences of the United States of America. 110, (34), 13904-13909 (2013).
  44. Kwan, K. M., et al. The Tol2kit: A multisite gateway-based construction Kit for Tol2 transposon transgenesis constructs. Developmental Dynamics. 236, (11), 3088-3099 (2007).
  45. Kawakami, K., et al. A transposon-mediated gene trap approach identifies developmentally regulated genes in zebrafish. Developmental Cell. 7, (1), 133-144 (2004).
  46. Kowalko, J., Ma, L., Jeffery, W. Genome Editing in Astyanax mexicanus Using Transcription Activator-like Effector Nucleases (TALENs). Journal of Visualized Experiments. (112), e54113 (2016).
  47. Nishino, S., Ripley, B., Overeem, S., Lammers, G. J., Mignot, E. Hypocretin (orexin) deficiency in human narcolepsy. Lancet. (2000).
  48. Lin, L., et al. The sleep disorder canine narcolepsy is caused by a mutation in the hypocretin (orexin) receptor 2. Cell. (1999).
  49. Park, H. C., et al. Analysis of upstream elements in the HuC promoter leads to the establishment of transgenic Zebrafish with fluorescent neurons. Developmental Biology. 227, (2), 279-293 (2000).
  50. Higashijima, S., Masino, M. A., Mandel, G., Fetcho, J. R. Imaging Neuronal Activity During Zebrafish Behavior With a Genetically Encoded Calcium Indicator. Journal of Neurophysiology. (2003).
  51. Vladimirov, N., et al. Light-sheet functional imaging in fictively behaving zebrafish. Nature Methods. 11, (9), 883-884 (2014).
  52. Halpern, M. E., et al. Gal4/UAS transgenic tools and their application to zebrafish. Zebrafish. 5, (2), 97-110 (2008).
  53. Jaggard, J. B., Stahl, B. A., Lloyd, E., Prober, D. A., Duboue, E. R., Keene, A. C. Hypocretin underlies the evolution of sleep loss in the Mexican cavefish. bioRxiv. 7, e32637 (2018).
  54. Bedell, V. M., Westcot, S. E., Ekker, S. C. Lessons from morpholino-based screening in zebrafish. Briefings in Functional Genomics. (2011).
  55. Robu, M. E., et al. p53 activation by knockdown technologies. PLoS Genetics. (2007).
  56. Hisano, Y., et al. Precise in-frame integration of exogenous DNA mediated by CRISPR/Cas9 system in zebrafish. Scientific reports. 5, 8841 (2015).
  57. Prykhozhij, S., et al. Optimized knock-in of point mutations in zebrafish using CRISPR/Cas9. Nucleic Acids Res. 46, (17), (2018).
  58. Tessadori, F., et al. Effective CRISPR/Cas9-based nucleotide editing in zebrafish to model human genetic cardiovascular disorders. Disease Model Mechanisms. 11, (10), (2018).
  59. Armstrong, G., Liao, M., You, Z., Lissouba, A., Chen, B., Drapeau, P. Homology Directed Knockin of Point Mutations in the Zebrafish tardbp and fus Genes in ALS Using the CRISPR/Cas9 System. PLoS ONE. 11, (3), (2016).
  60. Friedrich, R. W., Jacobson, G. A., Zhu, P. Circuit Neuroscience in Zebrafish. Current Biology. 20, (8), (2010).
  61. Friedrich, R. W., Genoud, C., Wanner, A. A. Analyzing the structure and function of neuronal circuits in zebrafish. Frontiers in Neural Circuits. 7, (2013).
  62. Scott, E. K., et al. Targeting neural circuitry in zebrafish using GAL4 enhancer trapping. Nature Methods. 4, (4), 323-326 (2007).
  63. Asakawa, K., Kawakami, K. Targeted gene expression by the Gal4-UAS system in zebrafish. Development Growth and Differentiation. (2008).
  64. Lloyd, E., et al. Evolutionary shift towards lateral line dependent prey capture behavior in the blind Mexican cavefish. Developmental Biology. (2018).
Manipulation av geners funktion i mexikanska släktet
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Stahl, B. A., Jaggard, J. B., Chin, J. S. R., Kowalko, J. E., Keene, A. C., Duboué, E. R. Manipulation of Gene Function in Mexican Cavefish. J. Vis. Exp. (146), e59093, doi:10.3791/59093 (2019).More

Stahl, B. A., Jaggard, J. B., Chin, J. S. R., Kowalko, J. E., Keene, A. C., Duboué, E. R. Manipulation of Gene Function in Mexican Cavefish. J. Vis. Exp. (146), e59093, doi:10.3791/59093 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter