Method Article

Induction and Scoring of Graft-Versus-Host Disease in a Xenogeneic Murine Model and Quantification of Human T Cells in Mouse Tissues using Digital PCR

7.1K views

DOI:

10.3791/59107

May 23rd, 2019

In This Article

Summary

Here, we present a protocol to induce and score disease in a xenogeneic graft-versus-host disease (xenoGVHD) model. xenoGVHD provides an in vivo model to study immunosuppression of human T cells. Additionally, we describe how to detect human T cells in tissues with digital PCR as a tool to quantify immunosuppression.

Abstract

Acute graft-versus-host disease (GVHD) is a significant limitation for patients receiving hematopoietic stem cell transplant as therapy for hematological deficiencies and malignancies. Acute GVHD occurs when donor T cells recognize host tissues as a foreign antigen and mount an immune response to the host. Current treatments involve toxic immunosuppressive drugs that render patients susceptible to infection and recurrence. Thus, there is ongoing research to provide an acute GVHD therapy that can effectively target donor T cells and reduce side effects. Much of this pre-clinical work uses the xenogenic GVHD (xenoGVHD) murine model that allows for testing of immunosuppressive therapies on human cells rather than murine cells in an in vivo system. This protocol outlines how to induce xenoGVHD and how to blind and standardize clinical scoring to ensure consistent results. Additionally, this protocol describes how to use digital PCR to detect human T cells in mouse tissues, which can subsequently be used to quantify efficacy of tested therapies. The xenoGVHD model not only provides a model to test GVHD therapies but any therapy that can suppress human T cells, which could then be applied to many inflammatory diseases.

Introduction

Allogeneic hematopoietic stem cell transplant (HSCT) has become routine treatment for patients suffering from hematological malignancies such as leukemia with poor prognosis. A significant complication of HSCT is acute graft-versus-host disease (GVHD). A 2012 study reported that acute GVHD developed in 39% of HSCT patients receiving transplants from sibling donors and 59% of patients receiving transplants from unrelated donors1. Acute GVHD occurs when donor-derived T cells attack recipient’s organs. The only successful therapy for GVHD is treatment with highly immunosuppressive drugs2, which are highly toxic and increase the risk of infection and tumor recurrence. Thus, despite improvements that have been made in acute GVHD survival in recent years3,4,5, there is still a critical need for improved GVHD therapies with minimal toxicity that promote long-term remission.

The overall goal of the following methods is to induce and score xenogeneic GVHD (xenoGVHD). The xenoGVHD model was developed as a tool to induce acute GVHD with human cells rather than murine cells allowing for more direct translation of pre-clinical GVHD research to clinical trials6. This model involves intravenously injecting human peripheral blood mononuclear cells (PBMC) into NOD-SCID IL-2Rγnull (NSG) mice that are sublethally irradiated. Injected human T cells are activated by human antigen presenting cells (APCs) presenting murine antigen and the activated T cells migrate to distant tissues resulting in systemic inflammation and ultimately death6,7,8,9,10. Disease pathology and progression in the xenoGVHD model closely mimic human acute GVHD. Specifically, the pathogenic human T cells are reactive to murine major histocompatibility complex (MHC) proteins, which is similar to the T cell alloreactivity in human GVHD6,9. The primary advantage of the xenoGVHD model over the mouse MHC-mismatch model, the other widely used GVHD model, is it allows for testing of therapies on human cells rather than murine cells. This allows for testing of products that can directly be translated to the clinic without any modifications because they are made to target human cells. Recently, this model has been used to test a human anti-IL-2 antibody11, human thymic regulatory T cells (Tregs)12 and human mesenchymal stem cells13 as potential treatments for acute GVHD. In a wider context, this model can be used as an in vivo suppression assay for any drug or cell type that can suppress human T cell activity. For example, Stockis et al.14 used the xenoGVHD model to study the effect of blocking integrin αVβ8 on Treg suppressive activity in vivo. Thus, the xenoGVHD model can provide insight into the mechanism of any therapy targeting T cells in an in vivo setting.

An additional method described in this protocol is how to detect human T cells in mouse tissues using digital polymerase chain reaction (dPCR). The goal of this method is to offer a tool to quantify migration and proliferation of T cells in target tissues, which measure efficacy of immunosuppressive therapies being tested in this model. dPCR is a relatively novel method for quantification of nucleic acids15. Briefly, the PCR reaction mixture is divided into partitions that contain small numbers of the target sequence or no target at all. The target sequence is then amplified and detected using DNA intercalating dyes or fluorescent target-specific probes. dPCR quantifies the number of copies of target sequence based on the fraction of positive partitions and Poisson’s statistics15,16. Detecting T cells with dPCR requires much less tissue compared with other alternative methods, including flow cytometry and histology, and can be performed on frozen or fixed tissue. dPCR does not require a standard curve to determine copy numbers, nor are technical replicates required. This reduces the amount of reagent and template DNA needed for dPCR compared to traditional quantitative PCR (qPCR)16. Partitioning the PCR reaction into sub-reactions in dPCR effectively concentrates targets17. Thus, dPCR is primarily a tool for detection of rare targets in a large amount of non-target DNA. For example, dPCR is being used to detect bacterial contamination in milk18, identify rare mutations in the estrogen receptor gene19, and detect circulating tumor DNA in the blood of patients20. In this protocol, dPCR serves as an efficient tool for detecting and quantifying human T cells in tissues of mice with xenoGVHD.

Access restricted. Please log in or start a trial to view this content.

Protocol

All mouse experiments were performed in compliance, and with approval from, the University of Kansas Medical Center Institutional Animal Care and Use Committee. All healthy human blood samples were obtained under informed consent and with approval from the Institutional Review Board at the University of Kansas Medical Center.

1. Irradiation of NSG Mice

  1. One day prior to PBMC injection, irradiate 8–12-week old NSG mice (either sex can be used). In a sterile biosafety cabinet, place mice in a sterilized pie cage or microisolator. Irradiate mice in a Cs137 source or small animal irradiator (e.g., RS 2000) with a total dose of 150 cGy with slow rotation to ensure even irradiation.
  2. Place mice into clean cages in a sterile biosafety cabinet.

2. Preparation of human PBMC for injection

  1. Collect enough healthy human blood to isolate 1.1 x 107 PBMC per mouse. Dilute the heparinized blood in an equal volume of 2% fetal bovine serum (FBS) in phosphate buffered saline (PBS).
    NOTE: With this protocol, the PMBC yield is generally 0.5–1 x 107 per 10 mL of whole blood. Each mouse will receive 107 PBMC in 100 µL of PBS. The extra 1 x 106 in 10 µL per mouse ensures that each mouse receives the full dosage of PBMC, should there be any issues with filling syringes.
  2. Add 15 mL lymphocyte separation density gradient medium (e.g., Ficoll) to a 50 mL conical tube and then carefully overlay up to 25 mL of diluted blood on top of the density gradient. Centrifuge the tube containing density gradient and diluted blood at 400 x g for 40 min at room temperature without brake.
  3. Harvest the PBMC interface into 10 mL of PBS in a 50 mL conical tube. Centrifuge the cells at 400 x g for 10 min. Remove the supernatant.
  4. Loosen pellet by flicking tube and resuspend in 10 mL PBS to wash the PBMC. Centrifuge the cells at 400 x g for 5 min.
  5. (Optional) Discard the supernatant and lyse red blood cells (RBCs) in the cell pellet by adding a volume of Ammonium-Chloride-Potassium (ACK) lysis buffer that is equal to the pellet volume. Gently resuspend the pellet and swirl the tube for 30–60 s. Fill tube with serum-free RPMI media and centrifuge the tube at 400 x g for 5 min.
  6. Remove the supernatant and re-suspend the cell pellet in 5 mL of PBS. Count the cells using trypan blue exclusion with a hemocytometer and a microscope.
  7. Centrifuge the cells at 400 x g for 5 min. Remove the supernatant and resuspend cells at 1 x 108 cells/mL in PBS.

3. Retro-orbital injection of human PBMC into mice21

  1. Place an anesthesia chamber in a laminar flow hood to maintain sterility. Pre-charge the anesthesia chamber with 5% isoflurane and 1 L/min oxygen flow rate for 5 min.
  2. Reduce isoflurane to 2% and put mice from the same cage into the anesthesia chamber. Once mice lose righting, anesthetize mice for 5 min in chamber. During this time, pre-fill syringe with 100 µL (1 x 107 cells) of cell suspension.
  3. Place mouse on a heating pad with its nose in a nose cone to maintain anesthesia. Check for loss of consciousness by pinching a foot pad and checking for lack of reflex.
  4. Restrain mouse with the thumb and middle finger. Insert the 28 G 1/2 in needle with the bevel down lateral to the medial canthus, through the conjunctival membrane until the back of the eye is reached. Slightly retract the needle and slowly inject 100 μL of cells (1 x 107 cells).
  5. Fully retract the needle and properly dispose of the syringe and needle. Close the eyelid and apply mild pressure to the injection site with a gauze sponge.
  6. Examine the injection site for swelling or other visible trauma. Allow the mouse to regain consciousness in a sterile cage lined with paper towels to prevent aspiration of bedding before moving to home cage. After any bleeding has stopped, apply a single drop of proparacaine to the eye for analgesia.
    NOTE: Tail vein injection is an alternative method of intravenous injection of PBMC for this protocol as described by Macholz et al.22.

4. Clinical Scoring of acute GVHD in Mice (Figure 1)23

  1. Measure GVHD score every other day until mice reach a score of a 2 and then every day until day of sacrifice.
    1. Place the cage in a laminar flow hood, remove the food and water and put the lid back on. Score activity by observing mice for 5 min and assign scores as follows: 0 = mouse starts walking within a couple minutes and keeps walking around cage, 1 = mouse takes a more than a couple minutes to get up and walks slowly around cage, 2 = mouse doesn’t get up in 5 min and only walks when touched.
  2. Weigh each mouse in a glass beaker and give a weight loss score: 0 = <10% change, 1 = 10–25% change and 2 = >25% change.
  3. While the mouse is still in the beaker, inspect for posture: 0 = normal, 1 = hunching at rest, 2 = hunching impairs movement; fur texture: 0 = normal, 1 = mild to moderate ruffling, 2 = severe ruffling, and skin integrity : 0 = normal, 1 = scaling of paws/tail, 2 = obvious areas of denuded skin (look at ears, tail and paws for scaling).
  4. With five categories and a score of 0–2 for each category, a mouse can reach a maximum score of 10. When a mouse reaches a score of 7 or greater or reaches 42 days post-injection, euthanize mouse via CO2 euthanasia or other method approved by the local Institutional Animal Care and Use Committee.
    NOTE: To ensure accuracy of results, the scoring is performed by a researcher who is blinded to the treatment groups24. Additionally, although >20% of body weight loss is the recommended humane endpoint for many IACUC protocols, with additional justification IACUC approval of this protocol can be obtained.

5. Harvesting tissues for genomic DNA from euthanized mice and isolating genomic DNA

  1. Dissect mice using sterile surgical tools. Cut a small piece of tissue about 3 mm x 0.5 mm in size from an organ of interest, e.g., lung, liver, or spleen. Weigh the tissue sample and place the tissue piece in a sterile 1.5 mL tube. If collecting multiple tissues, wash tools with ethanol between cutting each organ.
  2. Freeze tissues by submerging the tubes containing the tissue in liquid nitrogen until it stops bubbling and store in -80 °C overnight. Thaw the tissue samples and lyse them according to a genomic DNA (gDNA) isolation kit.
  3. Isolate genomic DNA according to manufacturer’s instructions as described in the kit. Be sure to note the amount of tissue that was processed per microliter of eluted gDNA (mg/μL).
    NOTE: Frozen tissues can be stored at -80 °C for processing at a later time.

6. Quantification of human T cells using digital PCR (Figure 2)

  1. Prepare digital PCR reactions according to the protocol for DNA binding dyes for the digital PCR machine being used. Use the following primers specific for human CD3 epsilon genomic DNA (NCBI Reference Sequence: NG_007383.1); Forward Primer: AGGCTGCCTTAACTCCCAAG, Reverse Primer: GCCCTACCAGCTGTGGAAAC. These primers will yield a single band of 105 bp.
    NOTE: Add 0.5 μL of a restriction enzyme, such as HindIII, to each reaction to digest the genomic DNA. Be sure to test out different gDNA dilutions to optimize separation of positive and negative droplets. Additionally, a subset of infiltrating T cells may be non-pathogenic regulatory T cells. These cells can be quantified using additional primers for regulatory T cell markers.
  2. Carry out the digital PCR reaction under the following conditions: Lid at 105 °C, 95 °C for 10 min (1 cycle); 95 °C for 30 s, ramp 2 °C/s and 55 °C for 1 min, ramp 2 °C/s (40 cycles); 72 °C for 10 min, 12 °C hold.
    NOTE: These parameters may need to be adjusted depending on digital PCR equipment.
  3. Acquire digital PCR data with analysis software. Report data as numbers of copies per mg of tissue using the following equation: (number of copies/μL) x (μL of gDNA in reaction) x (dilution factor)/(mg of tissue/μL of total gDNA )

Access restricted. Please log in or start a trial to view this content.

Results

Sublethally irradiated 8-12-week old NSG mice of both sexes that received human PBMC started displaying clinical signs of GVHD around day 10 post injection compared to negative control mice that received PBS only (Figure 1A). XenoGVHD mice had a median survival of 23.5 days (Figure 1B). With digital PCR, CD3 epsilon positive human T cells could be detected in the lung and liver samples of mice that received human PBMC. Tissue sam...

Access restricted. Please log in or start a trial to view this content.

Discussion

Disease progression is generally consistent in the xenoGVHD model, even with injection of PBMC from different donors, so multiple experiments can be combined. The key steps required to maintain this consistency are proper i.v. injection technique, blinding and consistent scoring. A study by Nervi et al.25 demonstrated that compared to intravenous tail vein injection, retro-orbital injections of PBMC resulted in more consistent engraftment and more severe GVHD. Leon-Rico et al.26<...

Access restricted. Please log in or start a trial to view this content.

Disclosures

No conflicts of interest declared.

Acknowledgements

We would like to acknowledge the laboratory of Lane Christenson for providing the digital PCR machine used in these experiments and for the technical support provided. We would also like to thank Dr. Thomas Yankee for his guidance and mentorship. These studies were supported by the Tripp Family Foundation.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
1.5 mL eppendorf tubesFisher05-408-129
10 mL serological pipetVWR International89130-898
10mL BD Vacutainers - Green capped with Sodium HeparinBecton Dickinson366480
250 µL Ranin pipette tipsRainin17001118Do not use other pipettes or pipet tips for droplet generation
50 mL conical tubeVWR International89039-656
96-Well ddPCR plateBio-Rad12001925
ACK (Ammonium-Chloride-Potassium) Lysing BufferLonza10-548EOptional
Alcohol WipesFisher Scientific6818
Anesthesia ChamberWorld Precision InstrumentsEZ-178Provided by animal facility
Anesthesia MachineParkland ScientificPM1002Provided by animal facility
BD Vacutainer Safety-Lok Blood Collection SetBecton Dickinson367281
DG8 Cartridges and Gaskets for QX100/QX200 Droplet GeneratorBio-Rad1864007
DNAse and RNAse free Molecular Grade H2OLife Technologies1811318
Ethyl alcohol, Pure,200 proof, for molecular biologySigma-AldrichE7023-500ML
Fetal Bovine SerumAtlanta BiologicalsS11150
FicollFisher Scientific45001750
Insulin SyringeFisher Scientific329424
IsofluraneSigma-AldrichCDS019936Provided by animal facility
Liquid nitrogenN/AN/A
Mouse Irradiator Pie CageBraintree Scientific, Inc.MPC 1Holds up to 11 mice
Nexcare Gentle Paper Tape (a.k.a. 3M Micropore Surgical Tape / 3/4")Fisher Scientific19-027-761
P1000 pipetmanMidSciA-1000
P200 pipetmanMidSciA-200
Pierceable Foil Heat SealBio-Rad1814040
Pipetaid Gilson MacromanFisher ScientificF110756
Pipet-Lite Multi Pipette L8-200XLS+Rainin17013805Do not use other pipettes or pipet tips for droplet generation
Qiagen DNeasy Blood and Tissue KitQiagen69506
qPCR platesVWR International89218-292
QX200 Droplet Digital PCR SystemBio-Rad12001925Includes droplet generator, droplet reader, laptop computer, software, associated component consumables, for EvaGreen or probe-based digital PCR applications
QX200 Droplet Generation Oil for EvaGreenBio-Rad1864006
QX200 ddPCR EvaGreen SupermixBio-Rad1864033
RNase and DNase-free plate sealThermo Scientific12565491
RPMI Advanced 1640Life Technologies12633012
Sterile Gauze Pads (2" x 2", 12-Ply)Fisher Scientific67522
Sterile Phosphate Buffered SalineFisher Scientific21040CV
Sterile reservoirVWR International89094-662
Surgial ScissorsKent ScientificINS600393-4
Surgical ForcepsKent ScientificINS650914-4

References

  1. Jagasia, M., et al. Risk factors for acute GVHD and survival after hematopoietic cell transplantation. Blood. 119 (1), 296-307 (2012).
  2. Bolanos-Meade, J., et al. Phase 3 clinical trial of steroids/mycophenolate mofetil vs steroids/placebo as therapy for acute GVHD: BMT CTN 0802. Blood. 124 (22), quiz 3335 3221-3227 (2014).
  3. Gooley, T. A., et al. Reduced mortality after allogeneic hematopoietic-cell transplantation. New England Journal of Medicine. 363 (22), 2091-2101 (2010).
  4. Hahn, T., et al. Significant improvement in survival after allogeneic hematopoietic cell transplantation during a period of significantly increased use, older recipient age, and use of unrelated donors. Journal of Clinical Oncology. 31 (19), 2437-2449 (2013).
  5. Khoury, H. J., et al. Improved survival after acute graft-versus-host disease diagnosis in the modern era. Haematologica. 102 (5), 958-966 (2017).
  6. King, M. A., et al. Human peripheral blood leucocyte non-obese diabetic-severe combined immunodeficiency interleukin-2 receptor gamma chain gene mouse model of xenogeneic graft-versus-host-like disease and the role of host major histocompatibility complex. Clinical & Experimental Immunology. 157 (1), 104-118 (2009).
  7. Lucas, P. J., Shearer, G. M., Neudorf, S., Gress, R. E. The human antimurine xenogeneic cytotoxic response. I. Dependence on responder antigen-presenting cells. Journal of Immunology. 144 (12), 4548-4554 (1990).
  8. Ito, R., et al. Highly sensitive model for xenogenic GVHD using severe immunodeficient NOG mice. Transplantation. 87 (11), 1654-1658 (2009).
  9. Kawasaki, Y., et al. Comprehensive Analysis of the Activation and Proliferation Kinetics and Effector Functions of Human Lymphocytes, and Antigen Presentation Capacity of Antigen-Presenting Cells in Xenogeneic Graft-Versus-Host Disease. Biology of Blood and Marrow Transplantation. 24 (8), 1563-1574 (2018).
  10. Ito, R., et al. A Novel Xenogeneic Graft-Versus-Host Disease Model for Investigating the Pathological Role of Human CD4(+) or CD8. T Cells Using Immunodeficient NOG Mice. American Journal of Transplantation. 17 (5), 1216-1228 (2017).
  11. Trotta, E., et al. A human anti-IL-2 antibody that potentiates regulatory T cells by a structure-based mechanism. Nature Medicine. 24 (7), 1005-1014 (2018).
  12. Dijke, I. E., et al. Discarded Human Thymus Is a Novel Source of Stable and Long-Lived Therapeutic Regulatory T Cells. American Journal of Transplantation. 16 (1), 58-71 (2016).
  13. Huang, F., et al. Human Gingiva-Derived Mesenchymal Stem Cells Inhibit Xeno-Graft-versus-Host Disease via CD39-CD73-Adenosine and IDO Signals. Frontiers in Immunology. 8, 68(2017).
  14. Stockis, J., et al. Blocking immunosuppression by human Tregs in vivo with antibodies targeting integrin alphaVbeta8. Proceedings of the National Academy of Sciences of the United States of America. 114 (47), E10161-E10168 (2017).
  15. Vogelstein, B., Kinzler, K. W. Digital PCR. Proceedings of the National Academy of Sciences of the United States of America. 96 (16), 9236-9241 (1999).
  16. Quan, P. L., Sauzade, M., Brouzes, E. dPCR: A Technology Review. Sensors (Basel). 18 (4), (2018).
  17. Sykes, P. J., et al. Quantitation of targets for PCR by use of limiting dilution. Biotechniques. 13 (3), 444-449 (1992).
  18. Ma, H., et al. Evaluation of Bacterial Contamination in Goat Milk Powder Using PacBio Single Molecule Real-Time Sequencing and Droplet Digital PCR. Journal of Food Protection. , 1791-1799 (2018).
  19. Vitale, S. R., et al. An optimized workflow to evaluate estrogen receptor gene mutations in small amounts of cell-free DNA. Journal of Molecular Diagnostics. , (2018).
  20. Gorgannezhad, L., Umer, M., Islam, M. N., Nguyen, N. T., Shiddiky, M. J. A. Circulating tumor DNA and liquid biopsy: opportunities, challenges, and recent advances in detection technologies. Lab Chip. 18 (8), 1174-1196 (2018).
  21. Yardeni, T., Eckhaus, M., Morris, H. D., Huizing, M., Hoogstraten-Miller, S. Retro-orbital injections in mice. LabAnimal. 40 (5), 155-160 (2011).
  22. Machholz, E., Mulder, G., Ruiz, C., Corning, B. F., Pritchett-Corning, K. R. Manual restraint and common compound administration routes in mice and rats. Journal of Visualized Experiments. (67), (2012).
  23. Cooke, K. R., et al. An experimental model of idiopathic pneumonia syndrome after bone marrow transplantation: I. The roles of minor H antigens and endotoxin. Blood. 88 (8), 3230-3239 (1996).
  24. Weisdorf, D. J., et al. Prospective grading of graft-versus-host disease after unrelated donor marrow transplantation: a grading algorithm versus blinded expert panel review. Biology of Blood and Marrow Transplantation. 9 (8), 512-518 (2003).
  25. Nervi, B., et al. Factors affecting human T cell engraftment, trafficking, and associated xenogeneic graft-vs-host disease in NOD/SCID beta2mnull mice. Experimental Hematology. 35 (12), 1823-1838 (2007).
  26. Leon-Rico, D., et al. Comparison of haematopoietic stem cell engraftment through the retro-orbital venous sinus and the lateral vein: alternative routes for bone marrow transplantation in mice. LabAnimal. 49 (2), 132-141 (2015).
  27. Ali, N., et al. Xenogeneic graft-versus-host-disease in NOD-scid IL-2Rgammanull mice display a T-effector memory phenotype. PLoS One. 7 (8), e44219(2012).
  28. van Rijn, R. S., et al. A new xenograft model for graft-versus-host disease by intravenous transfer of human peripheral blood mononuclear cells in RAG2-/- gammac-/- double-mutant mice. Blood. 102 (7), 2522-2531 (2003).
  29. Wunderlich, M., et al. OKT3 prevents xenogeneic GVHD and allows reliable xenograft initiation from unfractionated human hematopoietic tissues. Blood. 123 (24), e134-e144 (2014).
  30. Schroeder, M. A., DiPersio, J. F. Mouse models of graft-versus-host disease: advances and limitations. Disease Models & Mechanisms. 4 (3), 318-333 (2011).
  31. Zeiser, R., Blazar, B. R. Preclinical models of acute and chronic graft-versus-host disease: how predictive are they for a successful clinical translation? Blood. 127 (25), 3117-3126 (2016).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

Human T Cell QuantificationPeripheral Blood Mononuclear CellsStromal Vascular FractionFlow CytometryClinical ScoringTissue DigestionCell Isolation

Related Articles