Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

Inductie en scoren van transplantaat-versus-gastheer ziekte in een xenogene Murine model en kwantificering van menselijke T cellen in muizen weefsels met behulp van digitale PCR

doi: 10.3791/59107 Published: May 23, 2019

Summary

Hier presenteren we een protocol voor het opwekken en scoren van ziekten in een Xenogenic graft-versus-hostziekte (xenoGVHD) model. xenoGVHD biedt een in vivo model om immunosuppressie van menselijke T-cellen te bestuderen. Daarnaast beschrijven we hoe we menselijke T-cellen in weefsels met digitale PCR kunnen detecteren als een hulpmiddel om immunosuppressie te kwantificeren.

Abstract

Acute graft-versus-host ziekte (GVHD) is een significante beperking voor patiënten die hematopoietische stamceltransplantatie ondergaan als therapie voor Hematologische tekortkomingen en maligniteiten. Acute GVHD treedt op wanneer donor cellen gastheer weefsels als een vreemd antigeen herkennen en een immuunrespons op de host monteren. Huidige behandelingen omvatten toxische immunosuppressieve geneesmiddelen die patiënten vatbaar voor infectie en herhaling. Zo, er is lopend onderzoek naar een acute GVHD therapie die effectief kan richten op donor T cellen en het verminderen van bijwerkingen. Veel van dit pre-klinische werk maakt gebruik van de xenogene GVHD (xenoGVHD) Murine model dat het mogelijk maakt voor het testen van immunosuppressieve therapieën op menselijke cellen in plaats van murene cellen in een in vivo systeem. Dit protocol schetst hoe xenoGVHD te induceren en hoe te blind en standaardiseren klinische scoring om consistente resultaten te garanderen. Daarnaast wordt in dit protocol beschreven hoe u digitale PCR gebruikt om menselijke T-cellen in muizen weefsels te detecteren, die vervolgens kunnen worden gebruikt om de werkzaamheid van geteste therapieën te kwantificeren. Het xenoGVHD-model biedt niet alleen een model om GVHD-therapieën te testen, maar elke therapie die menselijke T-cellen kan onderdrukken, die vervolgens kan worden toegepast op veel ontstekingsziekten.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Allogene hematopoëtische stamceltransplantatie (HSCT) is een routine behandeling geworden voor patiënten die lijden aan hematologische maligniteiten zoals leukemie met een slechte prognose. Een significante complicatie van HSCT is acute graft-versus-hostziekte (GVHD). In een 2012-studie werd gemeld dat acute GVHD werd ontwikkeld in 39% van de HSCT-patiënten die transplantaties kregen van broer of zus en 59% van de patiënten die transplantaties ontvingen van niet-verbonden donoren1. Acute GVHD treedt op wanneer de donor afkomstige T-cellen de organen van de geadresseerde aanvallen. De enige succesvolle therapie voor GVHD is behandeling met zeer immunosuppressieve geneesmiddelen2, die zeer giftig en verhogen het risico van infectie en tumor herhaling. Zo, ondanks verbeteringen die zijn aangebracht in acute gvhd overleving in de afgelopen jaren3,4,5, er is nog steeds een kritische behoefte aan verbeterde gvhd therapieën met minimale toxiciteit die op lange termijn remissie bevorderen.

Het algemene doel van de volgende methoden is om te induceren en te scoren xenogene GVHD (xenoGVHD). De xenoGVHD model werd ontwikkeld als een instrument voor het opwekken van acute GVHD met menselijke cellen in plaats van Murine cellen waardoor meer directe vertaling van pre-klinisch GVHD onderzoek naar klinische proeven6. Dit model omvat het intraveneus injecteren van humane perifere bloed mononucleaire cellen (PBMC) in NOD-SCID IL-2Rγnull (NSG) muizen die sublethaal bestraald zijn. Geïnjecteerde humane t-cellen worden geactiveerd door humane antigeen-presentatie cellen (apc's) die muriene antigeen vertonen en de geactiveerde T-cellen migreren naar verre weefsels resulterend in systemische ontstekingen en uiteindelijk overlijden6,7, 8 , 9 , 10. ziekte pathologie en progressie in het xenogvhd model nabootsen van menselijke acute gvhd. In het bijzonder zijn de pathogene menselijke T-cellen reactief naar Murine Major histocompatibility complex (MHC) eiwitten, die vergelijkbaar is met de T-cel alloreactivity in humaan gvhd6,9. Het belangrijkste voordeel van de xenoGVHD model over de muis MHC-mismatch model, de andere veel gebruikte GVHD model, is het mogelijk voor het testen van therapieën op menselijke cellen in plaats van Murine cellen. Dit maakt het testen van producten die direct kunnen worden vertaald naar de kliniek zonder enige wijzigingen, omdat ze zijn gemaakt om menselijke cellen te richten. Onlangs is dit model gebruikt om een humaan anti-Il-2 antilichaam11, humane Thymus regulatoire T-cellen (tregs)12 en humane mesenchymale stamcellen13 te testen als mogelijke behandelingen voor acute gvhd. In een bredere context kan dit model worden gebruikt als een in-vivo-onderdrukkings test voor elk medicijn of celtype dat menselijke T-celactiviteit kan onderdrukken. Stockis et al.14 gebruikte bijvoorbeeld het xenoGVHD-model om het effect te bestuderen van het blokkeren van integrine αvβ8 op Treg suppressieve activiteit in vivo. Het xenoGVHD-model kan dus inzicht geven in het mechanisme van elke therapie gericht op T-cellen in een in vivo-instelling.

Een aanvullende methode die in dit protocol wordt beschreven, is het detecteren van menselijke T-cellen in muis weefsels met behulp van digitale polymerase kettingreactie (dPCR). Het doel van deze methode is om een instrument aan te bieden om migratie en proliferatie van T-cellen in doelweefsels te kwantificeren, die de werkzaamheid van immunosuppressieve therapieën meten die in dit model worden getest. dPCR is een relatief nieuwe methode voor de kwantificering van nucleïnezuren15. In het kort wordt het PCR-reactiemengsel onderverdeeld in partities die kleine aantallen van de doel volgorde of helemaal geen doel bevatten. De doel volgorde wordt vervolgens versterkt en gedetecteerd met behulp van DNA-intercalciserende kleurstoffen of fluorescerende doelspecifieke sondes. dpcr kwantificeert het aantal kopieën van de doel volgorde op basis van de Fractie van positieve partities en de statistieken van Poisson15,16. Het opsporen van T-cellen met dPCR vereist veel minder weefsel dan andere alternatieve methoden, waaronder Flowcytometrie en histologie, en kan worden uitgevoerd op bevroren of vast weefsel. dPCR vereist geen standaard curve om de Kopieer nummers te bepalen, noch zijn technische replicaten vereist. Dit vermindert de hoeveelheid reagens en het template-DNA die nodig zijn voor dPCR in vergelijking met traditionele kwantitatieve PCR (qPCR)16. Het partitioneren van de PCR-reactie in subreacties in dPCR concentreert zich doeltreffend op doelen17. Zo is dPCR in de eerste plaats een hulpmiddel voor het opsporen van zeldzame doelen in een grote hoeveelheid niet-doelwit DNA. Bijvoorbeeld, dPCR wordt gebruikt voor het opsporen van bacteriële besmetting in melk18, identificeren zeldzame mutaties in de oestrogeen receptor Gene19, en detecteren CIRCULEREND tumor-DNA in het bloed van patiënten20. In dit protocol fungeert dPCR als een efficiënt hulpmiddel voor het opsporen en kwantificeren van menselijke T-cellen in weefsels van muizen met xenoGVHD.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Alle muis experimenten werden uitgevoerd in overeenstemming, en met goedkeuring van, de Universiteit van Kansas Medical Center institutionele dierenverzorging en gebruik Comité. Alle gezonde menselijke bloedmonsters werden verkregen onder geïnformeerde toestemming en met goedkeuring van de institutionele Review Board aan de Universiteit van Kansas Medical Center.

1. bestraling van NSG-muizen

  1. Een dag voorafgaand aan PBMC injectie, bestralen 8 – 12 weken oude NSG muizen (beide geslacht kunnen worden gebruikt). Plaats in een steriele bioveiligheidskast muizen in een gesteriliseerde cirkel kooi of micro-isolator. Bestraleren van muizen in een CS137 -bron of een kleine dierlijke irradiator (BIJV. RS 2000) met een totale dosis van 150 cgy met langzame rotatie om zelfs bestraling te garanderen.
  2. Plaats muizen in schone kooien in een steriele bioveiligheidskast.

2. bereiding van de humane PBMC voor injectie

  1. Verzamelen genoeg gezonde menselijke bloed te isoleren 1,1 x 107 PBMC per muis. Verdun het gehepariniseerde bloed in een gelijk volume van 2% foetaal runderserum (FBS) in fosfaatgebufferde zoutoplossing (PBS).
    Let op: met dit protocol is de PMBC-opbrengst over het algemeen 0,5 – 1 x 107 per 10 ml volbloed. Elke muis krijgt 107 PBMC in 100 μL PBS. De extra 1 x 106 in 10 μL per muis zorgt ervoor dat elke muis de volledige dosering PBMC ontvangt, mochten er problemen zijn met het vullen van spuiten.
  2. Voeg 15 mL lymfocyten scheidings dichtheidsgradiënt medium (bv. Ficoll) toe aan een conische buis van 50 mL en breng vervolgens zorgvuldig tot 25 mL verdund bloed bovenop de dichtheidsgradiënt. Centrifugeer de buis met dichtheidsgradiënt en verdund bloed bij 400 x g voor 40 min bij kamertemperatuur zonder rem.
  3. Oogst de PBMC-interface in 10 mL PBS in een conische buis van 50 mL. Centrifugeer de cellen bij 400 x g gedurende 10 min. Verwijder het supernatant.
  4. Maak de pellet los door de buis te flikken en in 10 mL PBS te respenderen om de PBMC te wassen. Centrifugeer de cellen gedurende 5 minuten bij 400 x g .
  5. Optionele Gooi de supernatant-en lyse rode bloedcellen (Rbc's) in de celpellet weg door een volume ammonium-chloride-kalium (ACK) lysisbuffer toe te voegen dat gelijk is aan het korrel volume. Breng de pellet voorzichtig opnieuw aan en zwenk de tube 30 – 60 s. vulbuis met serum vrije RPMI-media en centrifugeer de buis bij 400 x g gedurende 5 minuten.
  6. Verwijder de supernatant en resuspendeer de celpellet in 5 mL PBS. Tel de cellen met behulp van trypan blauwe uitsluiting met een hemocytometer en een microscoop.
  7. Centrifugeer de cellen bij 400 x g gedurende 5 minuten. Verwijder de supernatant en respendeer cellen bij 1 x 108 cellen/ml in PBS.

3. retro-orbitale injectie van menselijke PBMC in muizen21

  1. Plaats een anesthesie kamer in een laminaire stroom kap om de steriliteit te behouden. Pre-Charge de anesthesie kamer met 5% Isofluraan en 1 L/min zuurstof debiet gedurende 5 minuten.
  2. Reduceer Isofluraan tot 2% en zet muizen uit dezelfde kooi in de anesthesie kamer. Zodra muizen de rechts verliezen, anesthetiseren muizen voor 5 minuten in de kamer. Gedurende deze tijd, Pre-Fill spuit met 100 μL (1 x 107 cellen) van celsuspensie.
  3. Plaats de muis op een verwarmingspad met zijn neus in een neuskegel om anesthesie te behouden. Controleer op bewustzijnsverlies door een voetpad te knijpen en te controleren op gebrek aan reflex.
  4. Restrain muis met duim en middelvinger. Plaats de 28 G 1/2 in de naald met de schuine kant omlaag aan de mediale Canthus, door het conjunctivale membraan totdat de achterkant van het oog is bereikt. Breng de naald lichtjes aan en Injecteer 100 μL cellen langzaam (1 x 107 cellen).
  5. Trek de naald volledig in en gooi de spuit en naald goed weg. Sluit het ooglid en breng milde druk aan op de injectieplaats met een gaas spons.
  6. Onderzoek de injectieplaats voor zwelling of ander zichtbaar trauma. Laat de muis het bewustzijn herwinnen in een steriele kooi bekleed met papieren handdoeken om te voorkomen dat het strooisel naar de huis kooi gaat. Nadat een bloeding is gestopt, breng een enkele druppel ooganestheticum aan op het oog voor analgesie.
    Opmerking: staart ader injectie is een alternatieve methode voor intraveneuze injectie van PBMC voor dit protocol zoals beschreven door Macholz et al.22.

4. klinische scoring van acute GVHD bij muizen (Figuur 1)23

  1. Meet de GVHD Score om de andere dag totdat muizen een Score van een 2 en vervolgens elke dag tot de dag van het opofferen bereiken.
    1. Plaats de kooi in een laminaire stroom afzuigkap, verwijder het voedsel en het water en zet het deksel weer op. Scoor activiteit door het observeren van muizen voor 5 min en toe te wijzen scores als volgt: 0 = muis begint te lopen binnen een paar minuten en houdt wandelen rond kooi, 1 = muis duurt een paar minuten om op te staan en loopt langzaam rond kooi, 2 = muis niet opstaan in 5 min en alleen wandelingen wanneer aangeraakt.
  2. Weeg elke muis in een glazen beker en geef een gewichtsverlies Score: 0 = < 10% verandering, 1 = 10 – 25% verandering en 2 = > 25% verandering.
  3. Terwijl de muis nog in het bekerglas zit, Inspecteer je op de houding: 0 = normaal, 1 = opjagende in rust, 2 = hunching schaadt beweging; bont textuur: 0 = normaal, 1 = milde tot matige ruffling, 2 = ernstige ruffling en huid integriteit : 0 = normaal, 1 = schalen van poten/staart, 2 = voor de hand liggende gebieden van een gedenudeerde huid (kijk naar oren, staart en poten voor het schalen).
  4. Met vijf categorieën en een Score van 0 – 2 voor elke categorie, kan een muis een maximale Score van 10 bereiken. Wanneer een muis een Score van 7 of hoger bereikt of 42 dagen na de injectie bereikt, euthanasie de muis via CO2 euthanasius of een andere methode goedgekeurd door de lokale instelling voor dierenverzorging en-gebruik.
    Opmerking: om de nauwkeurigheid van de resultaten te garanderen, wordt de scoring uitgevoerd door een onderzoeker die is geblindeerd tot de behandelgroepen24. Bovendien, hoewel > 20% van het verlies van het lichaamsgewicht is het aanbevolen humane eindpunt voor veel IACUC protocollen, met aanvullende rechtvaardiging IACUC goedkeuring van dit protocol kan worden verkregen.

5. oogst weefsels voor genomisch DNA van geëeuthaniseerde muizen en isolerende genomisch DNA

  1. Ontleden muizen met steriel chirurgisch gereedschap. Snijd een klein stukje weefsel over 3 mm x 0,5 mm in grootte van een orgaan van belang, bijvoorbeeld Long, lever, of milt. Weeg het weefselmonster af en plaats het weefsel stuk in een steriele 1,5 mL Tube. Als het verzamelen van meerdere weefsels, wassen gereedschappen met ethanol tussen het snijden van elk orgaan.
  2. Vries weefsels door de buisjes met het weefsel in vloeibare stikstof te subfuseren totdat het stopt met borrelen en bewaar in-80 °C 's nachts. Ontdooi de weefselmonsters en lyseer ze volgens een genomische DNA (gDNA) isolatie kit.
  3. Isoleer genomisch DNA volgens de instructies van de fabrikant zoals beschreven in de kit. Noteer de hoeveelheid weefsel die is verwerkt per microliter van de eluteerde gDNA (mg/μL).
    Let op: bevroren weefsels kunnen bij-80 °C worden bewaard voor verwerking op een later tijdstip.

6. kwantificering van menselijke T-cellen met behulp van digitale PCR (Figuur 2)

  1. Bereid digitale PCR-reacties volgens het protocol voor DNA-bindende kleurstoffen voor de gebruikte digitale PCR-machine. Gebruik de volgende primers specifiek voor humaan CD3 Epsilon genomisch DNA (NCBI-referentie sequentie: NG_ 007383.1); Voorwaartse primer: AGGCTGCCTTAACTCCCAAG, omgekeerde primer: GCCCTACCAGCTGTGGAAAC. Deze primers zullen een enkele band van 105 BP opleveren.
    Opmerking: Voeg 0,5 μL van een restrictie-enzym, zoals HindIII, toe aan elke reactie om het genomisch DNA te verteren. Zorg ervoor dat u verschillende gDNA verdunningen test om de scheiding van positieve en negatieve druppels te optimaliseren. Bovendien kan een subset van infiltrerende T-cellen niet-pathogene regulatoire T-cellen zijn. Deze cellen kunnen worden gekwantificeerd met behulp van extra primers voor regulatoire T-celmarkeringen.
  2. Voer de digitale PCR-reactie uit onder de volgende omstandigheden: deksel bij 105 °C, 95 °C gedurende 10 min (1 cyclus); 95 °C voor 30 s, helling 2 °C/s en 55 °C gedurende 1 minuut, helling 2 °C/s (40 cycli); 72 °C gedurende 10 min, 12 °C vasthouden.
    Opmerking: afhankelijk van de digitale PCR-apparatuur moeten deze parameters mogelijk worden aangepast.
  3. Verkrijg digitale PCR-gegevens met analyse software. Rapporteer gegevens als aantal kopieën per mg weefsel met behulp van de volgende vergelijking: (hoeveelheid kopieën/μL) x (μL gDNA in reactie) x (verdunningsfactor)/(mg weefsel/μL totaal gDNA)

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Sublethally bestraalde 8-12-week oude NSG-muizen van beide geslachten die menselijke PBMC ontvingen begonnen met het weergeven van klinische symptomen van GVHD rond dag 10 na injectie in vergelijking met negatieve controle muizen die alleen PBS ontvingen (Figuur 1a). XenoGVHD muizen hadden een mediane overleving van 23,5 dagen (Figuur 1b). Met digitale PCR kunnen CD3 Epsilon positieve menselijke T-cellen worden gedetecteerd in de longen en lever monsters van muizen die menselijke PBMC kregen. Weefselmonsters van muizen die met PBS zijn geïnjecteerd, werden als besturingselementen gebruikt (Figuur 2).

Figure 1
Figuur 1: ziekteprogressie van GVHD. Sublethally bestraalde 8-12-week-oude mannelijke en vrouwelijke NSG muizen waren retro-orbitaal geïnjecteerd met 1 x 107 menselijke PBMC (n = 6) of PBS (n = 4) als een negatieve controle. Getoonde gegevens zijn de gecombineerde resultaten van drie onafhankelijke experimenten. (A) de gvhd-score werd om de dag gemeten totdat muizen een score bereikten van 2 en daarna elke dag tot de dag van opoffering. De gegevens die op elk moment van de GVHD-Score worden gerapporteerd, zijn de gemiddelde ± SEM-Score van de levende muizen in combinatie met de laatste scores van alle overleden muizen in elke groep. * p < 0,05 zoals bepaald door Mann Whitney U test. B) Kaplan-Meier-curve van overleving. De dood werd gemarkeerd toen de GVHD-Score ≥ 7 was. * p < 0,05 zoals bepaald door de log-Rank test. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 2
Figuur 2: detectie van menselijke T-cellen met behulp van digitale PCR. Long-en lever monsters werden verzameld van muizen die retro-orbitaal werden geïnjecteerd met PBS (n = 3) of 1 x 107 humane PBMC (n = 3) wanneer muizen een gvhd-Score bereikten van ≥ 7 of 42 dagen na de injectie. Gegevens werden verzameld uit 3 onafhankelijke experimenten. gDNA werd geïsoleerd en de digitale PCR werd gebruikt om de kopieën van humane CD3 Epsilon per milligram weefsel te bepalen. A) representatief digitaal PCR-plot van Long-en lever monsters van een met PBS of PBMC geïnjecteerde muis. B) kwantificering van kopieën van humane CD3 Epsilon per millgram weefsel van muizen die met PBS of PBMC worden geïnjecteerd. * p ≤ 0,05 zoals bepaald door Mann Whitney U test. Klik hier om een grotere versie van dit cijfer te bekijken.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Ziekteprogressie is over het algemeen consistent in het xenoGVHD-model, zelfs met een injectie van PBMC van verschillende donoren, zodat meerdere experimenten kunnen worden gecombineerd. De belangrijkste stappen die nodig zijn om deze consistentie te behouden, zijn goede i.v.-injectietechniek, blindering en consistente scoring. Een studie van Nervi et al.25 toonde aan dat in vergelijking met intraveneuze staart ader injectie, retro-orbitale injecties van PBMC resulteerden in een consistentere engraftment en meer ernstige gvhd. Leon-Rico et al.26 toonde ook aan dat retro-orbitale injecties resulteerden in een consistentere hematopoietische stamcel engraftment bij muizen in vergelijking met een staart ader injectie. Echter, indien nodig, kunnen staart ader injecties worden gebruikt als een alternatieve methode in de xenogvhd model27,28,29.

Het probleem van de variabiliteit van de resultaten in verband met de injecties van de staart ader kan worden verminderd door het aantal proefpersonen te verhogen. Daarnaast is het belangrijk dat de persoon die de muizen scoorde geblindeerd is voor muis behandeling om bias te voorkomen bij het scoren van meer subjectieve criteria zoals activiteit of bont textuur. Het belang van geblindeerde GVHD-scores is ook aangetoond in de kliniek24. De persoon die de muizen injecteert, mag niet dezelfde persoon zijn als het scoren van de muizen. Als dit niet mogelijk is, controle-en behandelings buizen kunnen worden gerandomiseerd en gelabeld met nieuwe id's door een andere persoon (dat wil zeggen, controle is A, behandeling is B) zodat injecties kunnen worden geblindeerd. Muis scoren moet worden uitgevoerd rond dezelfde tijd elke dag en op dezelfde dagen na de injectie tussen verschillende experimenten.

Een potentieel obstakel in dit model is het gebrek aan GVHD-ontwikkeling. Dit kan te wijten zijn aan verminderde levensvatbaarheid van PBMC die kan worden aangepakt door het controleren van de levensvatbaarheid van PBMC door het tellen van cellen met trypan blauw. Als er problemen zijn met de levensvatbaarheid van de cel, kunnen de cellen in PBS worden gezet, aangevuld met 2% FBS om de overleving te verbeteren. Ook kunnen minder muizen tegelijk worden geïnjecteerd om de tijdcellen bij kamertemperatuur te verminderen. De werkzaamheid van de retro-orbitale injectie kan het probleem zijn. Muizen die worden geïnjecteerd met PBMC maar geen GVHD ontwikkelen, kunnen worden geëcaliseerd en immuuncellen die geïsoleerd zijn van hun milt kunnen worden geanalyseerd op aanwezigheid van menselijke cellen via dPCR of flow cytometrie. Als er een slechte engraftment is, dan is er waarschijnlijk een probleem met de injectietechniek. Als test voor de injectietechniek kunnen muizen retro-orbitaal worden geïnjecteerd met 200 μL Evans Blue Dye. Als de injectie succesvol is, zullen de oren, poten en staart van de muis blauw worden.

Het xenoGVHD-model bootst de menselijke acute GVHD-ziekte pathogenese en progressie30nauwgezet na. In tegenstelling tot de Murine MHC mismatch GVHD model, het xenoGVHD model testen van het effect van immunosuppressieve therapieën, met inbegrip van menselijke cel therapieën, op menselijke cellen in plaats van muriene cellen. Dit vermindert de variatie als gevolg van soorten verschillen bij het toepassen van onderzoeksresultaten op de kliniek. Het xenoGVHD-model kan ook dienen als een in-vivo-onderdrukkings test op andere gebieden van T-celonderzoek. Dus, resultaten van experimenten met behulp van het xenoGVHD model kan worden toegepast op elke menselijke T cel-gemedieerde ontstekingsziekte naast GVHD.

Er zijn beperkingen van het model xenoGVHD. Deze omvatten experimentele variabiliteit en mogelijke verschillen in behandeling met GVHD in vergelijking met de kliniek. Experimentele inconsistenties kunnen voortvloeien uit verschillen in muis stam, sites van PBMC injectie, stralingsdosis en microbiële omgeving30,31. Laboratoria die dit model gebruiken, moeten dus proberen deze parameters te standaardiseren om consistente uitkomsten te garanderen. In dit protocol beschrijven we scorings methoden die de variabiliteit in scores helpen verminderen. Factoren die de vergelijkbaarheid van xenoGVHD-gegevens tot klinische uitkomsten kunnen beperken, zijn onder meer het gebrek aan controlegroepen die behandeld worden met GVHD profylactische geneesmiddelen en het gebruik van bestraling als enige bron van conditionering in de xenoGVHD model31. Bovendien, het mechanisme van xenogvhd niet volledig even de onderliggende pathogenese in menselijke gvhd. Het is bijvoorbeeld Apc's van donoren in plaats van gastheer Apc's die menselijke T-cellen in het xenoGVHD-model activeren, terwijl host Apc's een belangrijke rol spelen in Human GVHD7. Zo zijn er, net als bij de meeste preklinische modellen, inconsistenties en onverenigbaarheden tussen xenoGVHD en menselijke GVHD die de toepassing van gegevens die van de xenoGVHD naar de kliniek worden gegenereerd, kunnen beperken.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Geen belangenconflicten gedeclareerd.

Acknowledgments

We willen graag het laboratorium van Lane Christenson erkennen voor het leveren van de digitale PCR-machine die wordt gebruikt in deze experimenten en voor de geleverde technische ondersteuning. Ook willen we Dr. Thomas Yankee bedanken voor zijn begeleiding en mentorschap. Deze studies werden ondersteund door de Tripp Family Foundation.

Materials

Name Company Catalog Number Comments
1.5 mL eppendorf tubes Fisher 05-408-129
10 mL serological pipet VWR International 89130-898
10mL BD Vacutainers - Green capped with Sodium Heparin Becton Dickinson 366480
250 µL Ranin pipette tips Rainin 17001118 Do not use other pipettes or pipet tips for droplet generation
50 mL conical tube VWR International 89039-656
96-Well ddPCR plate Bio-Rad 12001925
ACK (Ammonium-Chloride-Potassium) Lysing Buffer Lonza 10-548E Optional
Alcohol Wipes Fisher Scientific 6818
Anesthesia Chamber World Precision Instruments EZ-178 Provided by animal facility
Anesthesia Machine Parkland Scientific PM1002 Provided by animal facility
BD Vacutainer Safety-Lok Blood Collection Set Becton Dickinson 367281
DG8 Cartridges and Gaskets for QX100/QX200 Droplet Generator Bio-Rad 1864007
DNAse and RNAse free Molecular Grade H2O Life Technologies 1811318
Ethyl alcohol, Pure,200 proof, for molecular biology Sigma-Aldrich E7023-500ML
Fetal Bovine Serum Atlanta Biologicals S11150
Ficoll Fisher Scientific 45001750
Insulin Syringe Fisher Scientific 329424
Isoflurane Sigma-Aldrich CDS019936 Provided by animal facility
Liquid nitrogen N/A N/A
Mouse Irradiator Pie Cage Braintree Scientific, Inc. MPC 1 Holds up to 11 mice
Nexcare Gentle Paper Tape (a.k.a. 3M Micropore Surgical Tape / 3/4") Fisher Scientific 19-027-761
P1000 pipetman MidSci A-1000
P200 pipetman MidSci A-200
Pierceable Foil Heat Seal Bio-Rad 1814040
Pipetaid Gilson Macroman Fisher Scientific F110756
Pipet-Lite Multi Pipette L8-200XLS+ Rainin 17013805 Do not use other pipettes or pipet tips for droplet generation
Qiagen DNeasy Blood and Tissue Kit Qiagen 69506
qPCR plates VWR International 89218-292
QX200 Droplet Digital PCR System Bio-Rad 12001925 Includes droplet generator, droplet reader, laptop computer, software, associated component consumables, for EvaGreen or probe-based digital PCR applications
QX200 Droplet Generation Oil for EvaGreen Bio-Rad 1864006
QX200 ddPCR EvaGreen Supermix Bio-Rad 1864033
RNase and DNase-free plate seal Thermo Scientific 12565491
RPMI Advanced 1640 Life Technologies 12633012
Sterile Gauze Pads (2" x 2", 12-Ply) Fisher Scientific 67522
Sterile Phosphate Buffered Saline Fisher Scientific 21040CV
Sterile reservoir VWR International 89094-662
Surgial Scissors Kent Scientific INS600393-4
Surgical Forceps Kent Scientific INS650914-4

DOWNLOAD MATERIALS LIST

References

  1. Jagasia, M., et al. Risk factors for acute GVHD and survival after hematopoietic cell transplantation. Blood. 119, (1), 296-307 (2012).
  2. Bolanos-Meade, J., et al. Phase 3 clinical trial of steroids/mycophenolate mofetil vs steroids/placebo as therapy for acute GVHD: BMT CTN 0802. Blood. 124, (22), quiz 3335 3221-3227 (2014).
  3. Gooley, T. A., et al. Reduced mortality after allogeneic hematopoietic-cell transplantation. New England Journal of Medicine. 363, (22), 2091-2101 (2010).
  4. Hahn, T., et al. Significant improvement in survival after allogeneic hematopoietic cell transplantation during a period of significantly increased use, older recipient age, and use of unrelated donors. Journal of Clinical Oncology. 31, (19), 2437-2449 (2013).
  5. Khoury, H. J., et al. Improved survival after acute graft-versus-host disease diagnosis in the modern era. Haematologica. 102, (5), 958-966 (2017).
  6. King, M. A., et al. Human peripheral blood leucocyte non-obese diabetic-severe combined immunodeficiency interleukin-2 receptor gamma chain gene mouse model of xenogeneic graft-versus-host-like disease and the role of host major histocompatibility complex. Clinical & Experimental Immunology. 157, (1), 104-118 (2009).
  7. Lucas, P. J., Shearer, G. M., Neudorf, S., Gress, R. E. The human antimurine xenogeneic cytotoxic response. I. Dependence on responder antigen-presenting cells. Journal of Immunology. 144, (12), 4548-4554 (1990).
  8. Ito, R., et al. Highly sensitive model for xenogenic GVHD using severe immunodeficient NOG mice. Transplantation. 87, (11), 1654-1658 (2009).
  9. Kawasaki, Y., et al. Comprehensive Analysis of the Activation and Proliferation Kinetics and Effector Functions of Human Lymphocytes, and Antigen Presentation Capacity of Antigen-Presenting Cells in Xenogeneic Graft-Versus-Host Disease. Biology of Blood and Marrow Transplantation. 24, (8), 1563-1574 (2018).
  10. Ito, R., et al. A Novel Xenogeneic Graft-Versus-Host Disease Model for Investigating the Pathological Role of Human CD4(+) or CD8. T Cells Using Immunodeficient NOG Mice. American Journal of Transplantation. 17, (5), 1216-1228 (2017).
  11. Trotta, E., et al. A human anti-IL-2 antibody that potentiates regulatory T cells by a structure-based mechanism. Nature Medicine. 24, (7), 1005-1014 (2018).
  12. Dijke, I. E., et al. Discarded Human Thymus Is a Novel Source of Stable and Long-Lived Therapeutic Regulatory T Cells. American Journal of Transplantation. 16, (1), 58-71 (2016).
  13. Huang, F., et al. Human Gingiva-Derived Mesenchymal Stem Cells Inhibit Xeno-Graft-versus-Host Disease via CD39-CD73-Adenosine and IDO Signals. Frontiers in Immunology. 8, 68 (2017).
  14. Stockis, J., et al. Blocking immunosuppression by human Tregs in vivo with antibodies targeting integrin alphaVbeta8. Proceedings of the National Academy of Sciences of the United States of America. 114, (47), E10161-E10168 (2017).
  15. Vogelstein, B., Kinzler, K. W. Digital PCR. Proceedings of the National Academy of Sciences of the United States of America. 96, (16), 9236-9241 (1999).
  16. Quan, P. L., Sauzade, M., Brouzes, E. dPCR: A Technology Review. Sensors (Basel). 18, (4), (2018).
  17. Sykes, P. J., et al. Quantitation of targets for PCR by use of limiting dilution. Biotechniques. 13, (3), 444-449 (1992).
  18. Ma, H., et al. Evaluation of Bacterial Contamination in Goat Milk Powder Using PacBio Single Molecule Real-Time Sequencing and Droplet Digital PCR. Journal of Food Protection. 1791-1799 (2018).
  19. Vitale, S. R., et al. An optimized workflow to evaluate estrogen receptor gene mutations in small amounts of cell-free DNA. Journal of Molecular Diagnostics. (2018).
  20. Gorgannezhad, L., Umer, M., Islam, M. N., Nguyen, N. T., Shiddiky, M. J. A. Circulating tumor DNA and liquid biopsy: opportunities, challenges, and recent advances in detection technologies. Lab Chip. 18, (8), 1174-1196 (2018).
  21. Yardeni, T., Eckhaus, M., Morris, H. D., Huizing, M., Hoogstraten-Miller, S. Retro-orbital injections in mice. LabAnimal. 40, (5), 155-160 (2011).
  22. Machholz, E., Mulder, G., Ruiz, C., Corning, B. F., Pritchett-Corning, K. R. Manual restraint and common compound administration routes in mice and rats. Journal of Visualized Experiments. (67), (2012).
  23. Cooke, K. R., et al. An experimental model of idiopathic pneumonia syndrome after bone marrow transplantation: I. The roles of minor H antigens and endotoxin. Blood. 88, (8), 3230-3239 (1996).
  24. Weisdorf, D. J., et al. Prospective grading of graft-versus-host disease after unrelated donor marrow transplantation: a grading algorithm versus blinded expert panel review. Biology of Blood and Marrow Transplantation. 9, (8), 512-518 (2003).
  25. Nervi, B., et al. Factors affecting human T cell engraftment, trafficking, and associated xenogeneic graft-vs-host disease in NOD/SCID beta2mnull mice. Experimental Hematology. 35, (12), 1823-1838 (2007).
  26. Leon-Rico, D., et al. Comparison of haematopoietic stem cell engraftment through the retro-orbital venous sinus and the lateral vein: alternative routes for bone marrow transplantation in mice. LabAnimal. 49, (2), 132-141 (2015).
  27. Ali, N., et al. Xenogeneic graft-versus-host-disease in NOD-scid IL-2Rgammanull mice display a T-effector memory phenotype. PLoS One. 7, (8), e44219 (2012).
  28. van Rijn, R. S., et al. A new xenograft model for graft-versus-host disease by intravenous transfer of human peripheral blood mononuclear cells in RAG2-/- gammac-/- double-mutant mice. Blood. 102, (7), 2522-2531 (2003).
  29. Wunderlich, M., et al. OKT3 prevents xenogeneic GVHD and allows reliable xenograft initiation from unfractionated human hematopoietic tissues. Blood. 123, (24), e134-e144 (2014).
  30. Schroeder, M. A., DiPersio, J. F. Mouse models of graft-versus-host disease: advances and limitations. Disease Models & Mechanisms. 4, (3), 318-333 (2011).
  31. Zeiser, R., Blazar, B. R. Preclinical models of acute and chronic graft-versus-host disease: how predictive are they for a successful clinical translation? Blood. 127, (25), 3117-3126 (2016).
Inductie en scoren van transplantaat-versus-gastheer ziekte in een xenogene Murine model en kwantificering van menselijke T cellen in muizen weefsels met behulp van digitale PCR
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Seng, A., Markiewicz, M. A. Induction and Scoring of Graft-Versus-Host Disease in a Xenogeneic Murine Model and Quantification of Human T Cells in Mouse Tissues using Digital PCR. J. Vis. Exp. (147), e59107, doi:10.3791/59107 (2019).More

Seng, A., Markiewicz, M. A. Induction and Scoring of Graft-Versus-Host Disease in a Xenogeneic Murine Model and Quantification of Human T Cells in Mouse Tissues using Digital PCR. J. Vis. Exp. (147), e59107, doi:10.3791/59107 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter