Summary

Isolering, förökning och Prion proteinuttryck under Neuronal differentiering av mänskliga Tandpulpan stamceller

Published: March 18, 2019
doi:

Summary

Här presenterar vi ett protokoll för mänskliga Dental massa stamceller isolering och förökning för att utvärdera uttrycket prion protein under neuronal differentiering process.

Abstract

Bioetiska frågor som rör manipulering av embryonala stamceller har hindrat framsteg inom området för medicinsk forskning. Därför är det mycket viktigt att få stamceller från olika vävnader såsom adipose, navelsträng, benmärg och blod. Bland de möjliga källorna är tandpulpan särskilt intressant eftersom det är lätt att få när det gäller bioetiska överväganden. Faktiskt mänskliga Dental massa stamceller (hDPSCs) är en typ av adulta stamceller kan skilja i neuronala-liknande celler och kan erhållas från den tredje molar av friska patienter (13-19 åldrar). I synnerhet var tandpulpan bort med en grävmaskin, skuren i små skivor, behandlas med kollagenas IV och odlade i en kolv. För att framkalla den neuronal differentieringen, stimuleras hDPSCs med EGF/bFGF i 2 veckor. Vi har tidigare visat att under processen differentiering innehållet i cellulära prion Protein (PrPC) i hDPSCs ökade. Den cytofluorimetric analysen visade ett tidigt uttryck för PrPC som ökade efter neuronal differentiering processen. Ablation av PrPC av siRNA PrP hindrade neuronal differentiering induceras av EGF/bFGF. I detta papper illustrera vi att som vi förstärkt isolering, separation och in vitro- odlingsmetoder för hDPSCs med flera enkla procedurer, effektivare cell kloner var införskaffad och storskalig utbyggnad av de mesenkymala stamcellerna (MSC) observerades. Vi visar också hur de hDPSCs, erhålls med metoder som beskrivs i protokollet, är en utmärkt experimentell modell att studera processen neuronal differentiering av MSCs och efterföljande cellulära och molekylära processer.

Introduction

Bindvävsstamceller har isolerats från flera vävnader, inklusive benmärg, navelsträngsblod, mänskliga tandpulpan, fettvävnad och blod1,2,3,4,5 , 6. som rapporterats av flera författare, hDPSCs Visa plast följsamhet, en typisk fibroblast-morfologi. Dessa representerar en ytterst heterogen befolkning med distinkta kloner och skillnader i proliferativ och särskiljande kapacitet7,8. hDPSCs express specifika markörer för mesenkymala stamceller (dvs CD44, CD90, CD73, CD105, STRO-1), de är negativa för vissa hematopoetiska markörer (såsom CD14 och CD19) och klarar av in vitro-multilinjärt differentiering9, 10,11.

Flera författare har visat att dessa celler kan differentieras till neuron-liknande celler använder olika protokoll, som inkluderar tillägg av NGF, bFGF, EGF i kombination med den särskilda medier och kosttillskott7,12. Också, många proteiner är involverade under neuronal differentiering och bland dessa flera papper Visa en relevant roll och betydande uttryck av cellulära prionproteinet PrP (C), både i embryonala och vuxna stamceller13, 14. PrPC representerar en pleiotropiska molekyl som kan utföra olika funktioner inuti cellerna som koppar metabolism, apoptos, och motstånd mot oxidativ stress15,16,17 , 18 , 19 , 20 , 21 , 22.

I vår tidigare papper23undersökte vi rollen av PrPC i processen hDPSCs neuronal differentiering. I själva verket hDPSCs express precociously PrPC och efter neuronal differentiering, det var möjligt att observera en ytterligare ökning. Andra författare hypotes om en möjlig roll för PrPC i neuronal differentiering processer av stamceller. Faktiskt, PrPC kör differentiering av mänskliga embryonala stamceller in i nervceller, oligodendrocyter och astrocyter24. Syftet med denna studie var att betona metoden för att erhålla stamceller från tandpulpan, sin differentiering process och rollen av PrPC under neuronal differentiering.

Protocol

Tredje molarer som användes i studien var censurerade från patienter (13-19 år gamla) med ingen tidigare historia av drog eller alkoholkonsumtion, samtliga rökfria och med lämpliga munhygien. På dagen för förklaring, vid institutionen för naturvetenskap odontologi och Maxillofacial av ”Sapienza”-universitetet i Rom, erhölls informerat samtycke från patienten eller föräldrarna. Informerat samtycke erhölls utifrån etiska överväganden och godkännande av etikkommittén. 1. tand…

Representative Results

Isolering och separation förfarandena av hDPSCs från tandpulpan, erhålls från den tredje molar, är komplexa processer där små förändringar kan leda ett förödande resultat. I detta papper använder vi protokollet av Arthur et al. 12 med flera förbättringar. Ett representativt system av procedurer visas i figur 1. hDPSCs representerar en heterogen populati…

Discussion

I detta arbete fokuserade vi på metodik för isolering och neuronal differentiering av hDPSCs; Dessutom utvärderade vi rollen av PrPC i denna process. I området i närheten finns det flera metoder att isolera och differentiera hDPSCs i neuron-liknande celler och kritiska steg under processen. hDPSCs kan skilja i flera härstamningar som chondroblasts, adipocyter, osteoblaster och nervceller. I våra papper undersökte vi mekanismerna för neuronal differentiering och förekomsten av PrPC. Som dis…

Disclosures

The authors have nothing to disclose.

Acknowledgements

Detta arbete stöds av ”Fondazione Varrone” och Rieti universitet Hub ”Sabina Universitas” till Vincenzo Mattei.

Figur 5 (A, B) omtryckt med tillåtelse av utgivaren Taylor & Francis Ltd från: rollen av Prion protein-EGFR multimolecular komplexet under neuronal differentiering av mänskliga dental massa-derived stamceller. Martellucci, S., Manganelli V., Santacroce C., Santilli F., Piccoli L., Sorice M. Mattei V. Prion. 2018 Mar 4. Taylor & Francis Ltd.

Materials

Amphotericin B solution Sigma-Aldrich A2942 It is use to supplement cell culture media, it is a polyene antifungal antibiotic from Streptomyce
Anti-B3tubulin Cell Signaling Technology  #4466 One of six B-tubulin isoform, it is expressed highly during fetal and postnatal development, remaining high in the peripheral nervous system
Anti-CD105  BD Biosciences 611314 Endoglin (CD105), a major glycoprotein of human vascular endothelium, is a type I integral membrane protein with a large extracellular region, a hydrophobic transmembrane region, and a short cytoplasmic tail
Anti-CD44 Millipore CBL154-20ul Positive cell markers antibodies directed against mesenchymal stem cells
Anti-CD73  Cell Signaling Technology  13160 CD73 is a 70 kDa glycosyl phosphatidylinositol-anchored, membrane-bound glycoprotein that catalyzes the hydrolysis of extracellular nucleoside monophosphates into bioactive nucleosides
Anti-CD90 Millipore CBL415-20ul Positive cell markers antibodies directed against mesenchymal stem cells
Anti-GAP43  Cell Signaling Technology  #8945 Is a nervous system specific, growth-associated protein in growth cones and areas of high plasticity
Anti-mouse PE  Abcam ab7003 Is an antibody used in in flow cytometry or FACS analysis
Anti-NFH  Cell Signaling Technology  #2836 Is an antibody that detects endogenous levels of total Neurofilament-H protein
Anti-PrP mAb EP1802Y  Abcam ab52604 Rabbit monoclonal [EP 1802Y] to Prion protein PrP
Anti-rabbit CY5  Abcam ab6564 Is an antibody used in in flow cytometry or FACS analysis
Anti-STRO 1 Millipore MAB4315-20ul Positive cell markers antibodies directed against mesenchymal stem cells
B27 Supp XF CTS Gibco by life technologies A14867-01 B-27  can be used to support induction of human neural stem cells (hNSCs) from pluripotent stem cells (PSCs), expansion of hNSCs, differentiation of hNSCs, and maintenance of mature differentiated neurons in culture
BD Accuri C6 flow cytometer  BD Biosciences AC6531180187 Flow cytometer equipped with a blue laser (488 nm) and a red laser (640 nm)
BD Accuri C6 Software  BD Biosciences Controls the BD Accuri C6 flow cytometer system in order to acquire data, generate statistics, and analyze results
bFGF PeproThec, DBA 100-18B basic Fibroblast Growth Factor 
Centrifuge CL30R Termo fisher Scientific 11210908 it is a device that is used for the separation of fluids,gas or liquid, based on density
CO2 Incubator 3541 Termo fisher Scientific 317527-185 it ensures optimal and reproducible growth conditions for cell cultures
Collagenase, type IV  Life Technologies 17104019 Collagenase is a protease that cleaves the bond between a neutral amino acid (X) and glycine in the sequence Pro-X-Glyc-Pro, which is found with high frequency in collagen
Disposable scalpel  Swann-Morton 501 It is use to cut tissues
DMEM-L Euroclone ECM0060L Dulbecco's Modified Eagle's Medium Low Glucose with L-Glutamine with Sodium Pyruvate
EGF PeproThec, DBA AF-100-15 Epidermal Growth Factor 
Fetal Bovine Serum Gibco by life technologies 10270-106 FBS is a popular media supplement because it provides a wide array of functions in cell culture. FBS delivers nutrients, growth and attachment factors and protects cells from oxidative damage and apoptosis by mechanisms that are difficult to reproduce in serum-free media (SFM) systems
Filtropur BT50 0.2,500ml Bottle top filter Sarstedt 831,823,101 it is a device that is used for filtration of solutions
Flexitube GeneSolution for PRNP Qiagen GS5621 4 siRNAs for Entrez gene 5621. Target sequence N.1 TAGAGATTTCATAGCTATTTA  N.2 CAGCAAATAACCATTGGTTAA  N.3. CTGAATCGTTTCATGTAAGAA  N.4  CAGTGACTATGAGGACCGTTA
Hank's solution 1x Gibco by life technologies 240200083 The essential function of Hanks′ Balanced Salt solution is to maintain pH as well as osmotic balance. It also provides water and essential inorganic ions to cells
HiPerFect Transfection Reagent  Qiagen 301705 HiPerFect Transfection Reagent is a unique blend of cationic and neutral lipids that enables effective siRNA uptake and efficient release of siRNA inside cells, resulting in high gene knockdown even when using low siRNA concentrations
Neurobasal A  Gibco by life technologies 10888022 Neurobasal-A Medium is a basal medium designed for long-term maintenance and maturation of pure post-natal and adult brain neurons 
Paraformaldehyde Sigma-Aldrich 30525-89-4 Paraformaldehyde has been used for fixing of cells and tissue sections during staining procedures
penicillin/streptomycin  Euroclone ECB3001D  It is use to supplement cell culture media to control bacterial contamination
Phosphate buffered saline  (PBS) Euroclone ECB4004LX10  PBS is a balanced salt solution used for the handling and culturing of mammalian cells. PBS is used to to irrigate, wash, and dilute mammalian cells. Phosphate buffering maintains the pH in the physiological range
TC-Platte 6 well, Cell+,F Sarstedt 833,920,300 It is a growth surface for adherent cells
Tissue culture flask T-25,Cell+,Vented Cap Sarstedt 833,910,302 Tissue culture flask T-25, polystyrene, Cell+ growth surface for sensitive adherent cells, e.g. primary cells, canted neck, ventilation cap, yellow, sterile, Pyrogen-free, non-cytotoxic, 10 pcs./bag
Triton X-100  Sigma-Aldrich 9002-93-1 Widely used non-ionic surfactant for recovery of membrane components under mild non-denaturing conditions
Trypsin-EDTA  Euroclone ECB3052D  Trypsin will cleave peptides on the C-terminal side of lysine and arginine amino acid residues. Trypsin is used to remove adherent cells from a culture surface
Tube Sarstedt 62,554,502 Tube 15ml, 120x17mm, PP
VBH 36 C2 Compact Steril ST-003009000 Offers totally protection for the enviroment and worker
ZEISS Axio Vert.A1 – Inverted Microscope Zeiss 3849000962 ZEISS Axio Vert.A1 provides a unique entry level price and can provide all contrasting techniques, including brightfield, phase contrast, PlasDIC, VAREL, improved Hoffman Modulation Contrast (iHMC), DIC and fluorescence. Incorporate LED illumination for gentle imaging for fluorescently-labeled cells. Axio Vert.A1 is ergonomically designed for routine work and compact enough to sit inside tissue culture hoods.

References

  1. Robey, P. G., Kuznetsov, S. A., Riminucci, M., Bianco, P. Bone marrow stromal cell assays: in vitro and in vivo. Methods in Molecular Biology. 1130, 279-293 (2014).
  2. Jiang, Y., et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature. 418, 1-49 (2002).
  3. Kern, S., Eichler, H., Stoeve, J., Kluter, H., Bieback, K. Comparative analysis of mesenchymal stem cells from bone marrow, umbilical cord blood, or adipose tissue. Stem Cells. 24, 1294-1301 (2006).
  4. Zannettino, A. C. W., et al. Multi-potential Human adipose-derived stromal stem cells exhibit a perivascular phenotype in vitro and in vivo. Journal of Cellular Physiology. 214, 413-421 (2008).
  5. Mattei, V., et al. Role of lipid rafts in neuronal differentiation of dental pulp-derived stem cells. Experimental Cell Research. 339, 231-240 (2015).
  6. Jansen, J., Hanks, S., Thompson, J. M., Dugan, M. J., Akard, L. P. Transplantation of hematopoietic stem cells from the peripheral blood. Journal of Cellular and Molecular Medicine. 9 (1), 37-50 (2005).
  7. Young, F. I., et al. Clonal heterogeneity in the neuronal and glial differentiation of dental pulp stem/progenitor cells. Stem Cells International. 2016, 1290561 (2016).
  8. Pisciotta, A., et al. Human dental pulp stem cells (hDPSCs): isolation, enrichment and comparative differentiation of two sub-populations. BMC Developmental Biology. 15, 14 (2015).
  9. Atari, M., et al. Dental pulp of the third molar: a new source of pluripotent-like stem cells. Journal of Cell Science. 125, 3343-3356 (2012).
  10. Koyama, N., Okubo, Y., Nakao, K., Bessho, K. Evaluation of pluripotency in human dental pulp cells. Journal of oral and maxillofacial surgery: official journal of the American Association of Oral and Maxillofacial Surgeons. 67, 501-506 (2009).
  11. Gronthos, S., et al. Stem cell properties of human dental pulp stem cells. Journal of Dental Research. 81, 531-535 (2002).
  12. Arthur, A., Rychkov, G., Shi, S., Koblar, S. A., Gronthos, S. Adult human dental pulp stem cells differentiate toward functionally active neurons under appropriate environmental cues. Stem Cells. 7, 1787-1795 (2008).
  13. Lee, Y. J., Baskakov, I. V. The cellular form of the prion protein is involved in controlling cell cycle dynamics, self-renewal, and the fate of human embryonic stem cell differentiation. Journal of Neurochemistry. 124, 310-322 (2013).
  14. Steele, A. D., Emsley, J. G., Ozdinler, P. H., Lindquist, S., Macklis, J. D. Prion protein (PrPc) positively regulates neural precursor proliferation during developmental and adult mammalian neurogenesis. Proceedings of the National Academy of Sciences of the United States of America. 103, 3416-3421 (2006).
  15. Wulf, M. A., Senatore, A., Aguzzi, A. The biological function of the cellular prion protein: an update. BMC Biology. 15, 34 (2017).
  16. Mattei, V., et al. Recruitment of cellular prion protein to mitochondrial raft-like microdomains contributes to apoptosis execution. Molecular Biology of the Cell. 22, 4842-4853 (2011).
  17. Linden, R. The Biological Function of the Prion Protein: A Cell Surface Scaffold of Signaling Modules. Frontiers in Molecular Neuroscience. 10, 77 (2017).
  18. Garofalo, T., et al. Role of mitochondrial raft-like microdomains in the regulation of cell apoptosis. Apoptosis. , 621-634 (2015).
  19. Watt, N. T., et al. Reactive oxygen species-mediated beta-cleavage of the prion protein in the cellular response to oxidative stress. The Journal of Biological Chemistry. 280, 35914-35921 (2005).
  20. Mattei, V., et al. Morphine Withdrawal Modifies Prion Protein Expression in Rat Hippocampus. PLoS One. 12, 0169571 (2017).
  21. Hu, W., et al. Prion proteins: physiological functions and role in neurological disorders. Journal of the Neurological Sciences. 264, 1-8 (2008).
  22. Sorice, M., et al. Trafficking of PrPC to mitochondrial raft-like microdomains during cell apoptosis. Prion. 6, 354-358 (2012).
  23. Martellucci, S., et al. Role of Prion protein-EGFR multimolecular complex during neuronal differentiation of human dental pulp-derived stem cells. Prion. 12 (2), 117-126 (2018).
  24. Lee, Y. J., Baskokov, I. V. The cellular form of the prion protein guides the differentiation of human embryonic stem cell into neuron-, oligodendrocyte- and astrocyte-committed lineages. Prion. 8, 266-275 (2014).
  25. Huang, G. T., Sonoyama, W., Chen, J., Park, S. H. In vitro characterization of human dental pulp cells: various isolation methods and culturing environments. Cell and Tissue Research. 324, 225-236 (2006).
  26. Suchanek, J., et al. Dental pulp stem cells and their characterization. Biomedical papers of the Medical Faculty of the University Palacký. 153, 31-35 (2009).
  27. Bressan, E., et al. Donor age-related biological properties of human dental pulp stem cells change in nanostructured scaffolds. PLoS One. 7 (11), 49146 (2012).

Play Video

Cite This Article
Martellucci, S., Santacroce, C., Manganelli, V., Santilli, F., Piccoli, L., Cassetta, M., Misasi, R., Sorice, M., Mattei, V. Isolation, Propagation, and Prion Protein Expression During Neuronal Differentiation of Human Dental Pulp Stem Cells. J. Vis. Exp. (145), e59282, doi:10.3791/59282 (2019).

View Video