Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Neuroscience

In Vivo Direkte Reprogrammierung von Resident Glial Cells in Interneurons durch Intracerebral Injection of Viral Vectors

doi: 10.3791/59465 Published: June 17, 2019

Summary

Dieses Protokoll zielt darauf ab, direkt umprogrammierte Interneuronen in vivo zu erzeugen, indem ein AAV-basiertes Virussystem im Gehirn und ein FLEX synapsingesteuerter GFP-Reporter verwendet werden, der die Zellidentifikation und weitere Analyse in vivo ermöglicht.

Abstract

Die Umwandlung von Resident Glia im Gehirn in funktionelle und subtypspezifische Neuronen in vivo ist ein Schritt in Richtung der Entwicklung alternativer Zellersatztherapien und schafft gleichzeitig Werkzeuge, um das Zellschicksal vor Ort zu untersuchen. Bis heute war es möglich, Neuronen durch In-vivo-Reprogrammierung zu erhalten, aber der genaue Phänotyp dieser Neuronen oder wie sie reifen, wurde nicht im Detail analysiert. In diesem Protokoll beschreiben wir eine effizientere Konvertierung und zellspezifische Identifizierung der in vivo reprogrammierten Neuronen mit Hilfe eines AAV-basierten viralen Vektorsystems. Wir bieten auch ein Protokoll zur funktionellen Bewertung der neuronalen Reifung der umprogrammierten Zellen. Durch Injektion von Flip-Excision(FLEX)-Vektoren, die die Reprogrammierung und synapsingesteuerte Reportergene in bestimmte Zelltypen im Gehirn enthalten, die als Ziel für die Zellreprogrammierung dienen. Diese Technik ermöglicht die einfache Identifizierung neu neu programmierter Neuronen. Die Ergebnisse zeigen, dass die erhaltenen neu programmierten Neuronen funktionell im Laufe der Zeit reifen, synaptische Kontakte erhalten und elektrophysiologische Eigenschaften verschiedener Arten von Interneuronen zeigen. Mit den Transkriptionsfaktoren Ascl1, Lmx1a und Nurr1 haben die meisten umprogrammierten Zellen Eigenschaften von schnell speichelnden, parvalbuminhaltigen Interneuronen.

Introduction

Das übergeordnete Ziel dieser Methode ist es, hirnresidente Glia in vivo effizient in funktionelle und subtypspezifische Neuronen wie Parvalbumin-extierende Interneurons umzuwandeln. Dies ist ein Schritt nach vorn in Richtung der Entwicklung einer alternativen Zellersatztherapie für Hirnerkrankungen ohne die Notwendigkeit einer exogenen Zellquelle. Es schafft auch ein Werkzeug, um Zellschicksalsschalter vor Ort zu untersuchen.

Das Gehirn hat nur eine begrenzte Kapazität für die Erzeugung neuer Neuronen. Daher, bei neurologischen Erkrankungen, gibt es einen Bedarf an exogenen Zellquellen für die Reparatur des Gehirns. Dazu wurden im Laufe der Jahre verschiedene Zellquellen intensiv erforscht, darunter Zellen aus Primärgewebe, Stammzellen-abgeleitete Zellen und umprogrammierte Zellen1,2,3. Direkte Reprogrammierung von ansässigen Gehirnzellen in Neuronen ist ein neuer Ansatz, der eine attraktive Methode für die Reparatur des Gehirns bieten könnte, da es die eigenen Zellen des Patienten für die Erzeugung neuer Neuronen im Gehirn verwendet. Bis heute haben mehrere Berichte gezeigt, in vivo Reprogrammierung durch virale Vektor-Bereitstellung im Gehirn4,5,6,78,9 in verschiedenen Hirnregionen wie der Kortex, Rückenmark, Striatum und das Mittelhirn5,10,11, sowie in intakten und läsioned Gehirn5,8,11,12. Sowohl hemmende als auch exzitatorische Neuronen wurdenerhalten 4,8, aber der genaue Phänotyp oder die Funktionalität dieser Zellen wurde noch nicht im Detail analysiert.

In diesem Protokoll beschreiben wir eine effizientere Reprogrammierung und zellspezifische Identifizierung von in vivo reprogrammierten Neuronen. Wir bieten ein Protokoll zur funktionellen Beurteilung der neuronalen Reifung und Phänotypcharakterisierung basierend auf Funktionalität und immunhistochemischen Merkmalen.

Wir verwendeten einen creinduzierbaren AAV-Vektor und einen GFP-Reporter, um die in vivo reprogrammierten Neuronen zu identifizieren. Diese Wahl der viralen Vektoren hat den Vorteil, sowohl teilende als auch nicht trennende Zellen des Gehirns zu infizieren, wodurch die Anzahl der Zielzellen erhöht wird, als Alternative zur Verwendung des Retrovirus7,8. Ein neuronspezifischer synapsingesteuerter FLEX-Reporter (GFP) ermöglichte es uns, die neu generierten Neuronen gezielt zu erkennen. Frühere Studien haben subtypspezifische Promotoren für die In-vivo-Reprogrammierung7,9verwendet, die auch die Expression von Reprogrammierungsgen und Reportern in bestimmten Zelltypen ermöglichen. Diese Methode erfordert jedoch eine weitere Identifizierung umprogrammierter Neuronen durch postmortale Analyse der Koexpression von Reportern und neuronalen Markern. Die Verwendung eines neuronspezifischen Reporters, wie er hier beschrieben wird, ermöglicht eine direkte Identifizierung. Dies ist ein direkter Beweis für eine erfolgreiche Umwandlung und ermöglicht eine Live-Zell-Identifikation, die für die Patch-Clamp-Elektrophysiologie erforderlich ist.

Protocol

Alle Experimentellen Verfahren wurden gemäß der Richtlinie der Europäischen Union (2010/63/EU) durchgeführt und vom Ethikausschuss für die Verwendung von Labortieren an der Universität Lund und dem schwedischen Landwirtschaftsministerium (Jordbruksverket) genehmigt. Mäuse sind in einem 12 h Licht/Dunkel-Zyklus mit ad libitum Zugang zu Nahrung und Wasser untergebracht.

1. Virale Vektoren

  1. Klonen von AAV-Vektoren
    1. Um creinduzierbare AAV5-Vektoren zu erstellen, fügen Sie cDNA für GFP, Ascl1, Lmx1a und NR4A2 (Nurr1) in einer umgekehrten Ausrichtung ein, flankiert von zwei Paaren heterotypischer, antiparalleler LoxP-Flip-Excision (FLEX)-Sequenzen (Materialtabelle). Verwenden Sie für die cDNA-Einfügung ein Backbone wie pAAV-Cba-FLEX oder eines mit einer ähnlichen Struktur, das FLEX-Sequenzen und einen Hähnchen-Beta-Aktin (CBA)-Promotor enthält.
    2. Fügen Sie jede einzelne cDNA (z. B. Ascl1) durch Polymerase-Kettenreaktion (PCR) und Restriktionsenzyme in das Rückgrat ein. Express GFP unter der Kontrolle eines Synapsin-Promotors und Ascl1, Lmx1a, Nurr1 unter der Kontrolle eines allgegenwärtig ausgedrückten CBA-Promoters.
      HINWEIS: Stellen Sie sicher, dass Endotoxin freie DNA mit spezifischen Endotoxin-Free Plasmid DNA Isolation Kits.
    3. Führen Sie vor der Verwendung eine Sequenzierungs- und Einschränkungsanalyse für die Konstrukte durch, um den Erfolg des Klonschritts zu überprüfen.
  2. AAV5 virale Vektorproduktion
    ACHTUNG: Beziehen Sie sich auf lokale Biosicherheitsrichtlinien beim Umgang mit Adeno-assoziierten Viren (AAV). In Schweden erfordert die in diesem Protokoll verwendete AAV Biosafety Level 2 (BSL-2).
    1. Saat HEK293T-Zellen mit Standardkulturmedien (DMEM+Glutamax + 10% FBS + Penicillin (100 U/ml) Streptomycin (100 g/ml), siehe Materialtabelle) in T175-Kolben mit einer Dichte von 3 x 106 Zellen pro Kolben. Machen Sie 5 Kolben pro Charge AAV und planen Sie 6 Chargen gleichzeitig.
    2. Wenn die Zellen 50-70% Koninfluenza erreichen, bereiten Sie die folgende Mischung für die Transfektion vor (pro 175 cm2 Kolben).
      1. In einem 50 ml Zentrifugenrohr fügen Sie äquimolare Mengen an Vektorplasmid und PDG-Serie Hilfsplasmid (pDP5, pDP6), mit einer Gesamtmenge von 72 g pro 175 cm2 Kolben hinzu.
      2. Fügen Sie Tris-EDTA-Puffer (TE-Puffer, 10 mM Tris-HCl, 1 mM EDTA) zu einem Endvolumen von 144 ml hinzu.
      3. Fügen Sie Reinstwasser hinzu, so dass das Gesamtvolumen 1296 ml wird und mischen.
      4. 144 L von 2,5 M CaCl2 hinzufügen und mischen. Fügen Sie der DNA-Lösung 1,92 L HEPES Gepufferte Saline (HBS) (1,5 mM Na2HPO4 ,140 mM NaCl, 50 mM HEPES) hinzu und mischen Sie sie sofort durch Wirbeln.
      5. Inkubieren bei Raumtemperatur (RT) für genau 60 s. Übertragen Sie die Lösung auf 28 ml Frischzellenkulturmedien und mischen Sie sie.
    3. Ersetzen Sie das Medium in den Kolben durch ein Zellkulturmedium, das einen Transfektionsmix enthält.
    4. Drei Tage nach der Transfektion die Zellen ernten, indem Sie das Medium aus den Kolben in einen Einwegbehälter für Abfälle gießen und 5 ml Erntepuffer hinzufügen (EDTA zu Phosphat-gepufferter Saline hinzugefügt, siehe Tabelle derMaterialien, DPBS zu einer endgültigen Konzentration von 5 mM) auf eine Konzentration von 5 mM) in jedem Kolben, um eine Zellablösung zu ermöglichen.
    5. Gießen Sie die Zelllösung in ein 50 ml Zentrifugenrohr. Fügen Sie jedem Kolben weitere 4 ml DPBS hinzu, um die verbleibenden Zellen zu spülen und mit der ersten Zelllösung zu poolen. Zentrifugieren Sie die geernteten Zellen bei 1.000 x g für 5 min bei 4 °C.
    6. Nach der Zentrifugation den Überstand entfernen und die Pellets in 15 ml Lysepuffer (50 mM Tris-HCl pH 8,5, 150 mM NaCl, 1 mM MgCl2) durch Wirbeln auflösen.
    7. Einfrieren imCO2-Eis/Ethanol-Bad für 15 min und in einem Gefrierschrank von -20 °C lagern. Die geerntete Zelle lysieren vor Gebrauch in einem 37 °C-Wasserbad.
  3. AAV5 virale Vektorreinigung
    1. Führen Sie die AAV-Reinigung durch Iodixanol Gradient Ultrazentrifugation13 durch und verwenden Sie Ultrazentrifugen-Dichtungsrohre mit Zentrifugation bei 350.000 x g für 1 h und 45 min bei RT.
    2. Verwenden Sie eine 10 ml Spritze mit einer 18G-Nadel und legen Sie etwa 2 mm unter den 40/60%-Phasenrahmen mit der Abschrägung nach oben, um die AAV-haltige Phase zu extrahieren. Achten Sie darauf, vor Erreichen des Proteinbandes zu stoppen, nachdem 5-6 ml extrahiert wurde.
    3. Bewahren Sie die Gradientenextrakte in autoklavierten Glasflaschen bei 4 °C auf. Vermeiden Sie die Lagerung von Zeiten länger als über Nacht.
    4. Verdünnen Sie den Iodixanol Gradientenextrakt 3-fach durch langsames Pipettieren in 12 ml Iodixanol-Elution (IE)-Puffer (20 mM Tris-HCl pH 8.0, 15 mM NaCl) beim Wirbeln.
    5. Reinigen und konzentrieren Sie den verdünnten Iodixanol-Gradienten durch einen Anionenaustauschfilter. Drücken Sie es langsam mit einer Geschwindigkeit nicht schneller als 1 Tropfen / s. Drücken Sie 3 ml IE Puffer langsam durch den Filter, um es zu waschen.
    6. In eine Zentrifugalfiltereinheit mit 1-2 ml Elutionspuffer (20 mM Tris-HCl pH 8.0;250 mM NaCl) Fügen Sie dem Gerät DPBS zu einem Endvolumen von 4 ml hinzu. Zentrifuge bei 2.000 x g bei RT, bis weniger als 0,5 ml im Filter verbleiben. Entfernen Sie die Flüssigkeit von der Unterseite des Rohres, nachfüllen mit 4 ml DPBS und Zentrifuge wieder. Wiederholen Sie diesen Schritt noch zwei Weitere Male. Stellen Sie sicher, dass das Volumen des konzentrierten Vektors auf dem Filter nach dem letzten Zentrifugationsschritt etwa 200 l beträgt.
    7. Entfernen Sie den 200-L-Konzentrationsvektor mit einer Pipette und drücken Sie das Konzentrat durch einen 0,22 mm Filter, um es zu sterilisieren. Aliquot 200 lin eine 9 mm Glasdurchstechflasche mit verriegelten Einsatz(Materialtabelle).
      HINWEIS: Die AAV5-Vektorbestände können in -80 °C-Gefrierschränken für lange Lagerung oder bei 4 °C gelagert werden, wenn sie innerhalb von 2 Wochen verwendet werden.
  4. AAV5 virale Vektortiterbestimmung
    1. Bestimmen Sie den AAV5-Titer mit der standardmäßigen quantitativen Polymerase-Kettenreaktion (qPCR) mit Primern für die invertierte Terminal-Wiederholungssequenz (ITR) und einer 5-FAM-/3-BHQ1-Sonde für ITR-Sequenz (Materialtabelle). Verwenden Sie eine Standardkurve, die mit bekannten MENGEN an ITR-haltigem Plasmid erreicht wird. Jeder AAV-Vektor sollte einen Bereich von 1E+14 – 1E+15 Genomkopien pro Milliliter haben, wenn die ITR-Sequenz zur Titerbestimmung verwendet wird.
      HINWEIS: Eine erfolgreiche AAV5-Virusproduktion liefert Bestände mit Titfern im Mindestbereich von 3E+13 – 7E+13 Einheiten/ml.

2. Injektion von Reprogramming-Faktoren in das Gehirn

  1. Tieraufbau, stereotaxic Platzierung und Bohren
    notiz:Dieses Protokoll konzentriert sich auf die Verwendung von Ascl1, Lmx1a und Nurr1 (ALN) für die Umprogrammierung von NG2 glia in interneurons. Nach unserer Erfahrung können Interneuronen eines ähnlichen Phänotyps mit anderen Faktorkombinationen11.
    1. Bereiten Sie vor der Operation den viralen Mix mit den Vektoren Cba-FLEX-Ascl1, Cba-FLEX-Lmx1a, Cba-FLEX-Nurr1 und dem Reportervektor Syn-FLEX-GFP vor. Fügen Sie jeden der in Abschnitt 1 vorbereiteten Bestände zum endgültigen Mix hinzu, so dass die endgültige virale Lösung 5 % der Reprogrammierungsfaktoren (Ascl1, Lmx1a und Nurr1) und 10 % des Reporterkonstrukts (5 % A, 5 % L, 5 % N und 10 % GFP) enthält.
      HINWEIS: Die AAV5-Vektormischungen können bei 4 °C gelagert und für die zukünftige Verwendung in vivo aufbewahrt werden.
    2. Anästhesisieren Sie die Maus mit 2% Isofluran in einer Mischung aus Luft und Lachgas (N2O) im Verhältnis 4:1. Überwachen Sie die Atmung des Tieres, indem Sie die Bewegungen des Zwerchfells beobachten. Während der Operation die Anästhesie mit 1–1,5 % Isofluran aufrecht erhalten.
      HINWEIS: Das hierbeschriebene Mausmodell besteht aus einer Mausdehnung, die Cre in NG2-Glia spezifisch ausdrückt. In vivo Reprogrammierung kann mit verschiedenen Mausstämmen erreicht werden, die Cre in anderen Populationen von Gliazellen ausdrücken (z.B. Astrozyten14).
    3. Sobald das Tier vollständig anästhesisiert ist (z.B. komplette Muskelentspannung und keine Reaktion auf eine Prise im Fußpolster), rasieren Sie den Bereich um die Einschnittstelle und bringen Sie das Tier zum stereotaxic Rahmen.
    4. Um die Körpertemperatur des Tieres während der Operation zu erhalten, befestigen Sie ein Heizkissen an der Basis des stereotaxic Rahmens. Legen Sie die Maus auf ein sauberes, trockenes Papiertuch.
    5. Legen Sie den Mauskopf vorsichtig in die Ohrstangen. Bei richtiger Platzierten ist keine seitliche Bewegung des Kopfes zu beobachten. Stellen Sie die linke Ohrleiste auf 4 mm ein, bevor Sie mit der Platzierung der Maus im stereotaxic-Rahmen beginnen.
    6. Sichern Sie die Zahnstange an Ort und Stelle, und ziehen Sie dann die Nasenstange. Stellen Sie sicher, dass sich der Kopf in keiner Dimension bewegt und geradeaus punktiert (die Mittellinie ist senkrecht zur Ebene der Ohrbügel). Ophthalmologische Salbe für den Augenschutz auftragen.
    7. Vor Beginn der Operation die entsprechende Analgesie (z. B. 0,05 mg/kg Buprenorphin, subkutan) verabreichen.
    8. Reinigen Sie den Schnittbereich mit einer Watte oder einem mit 70% EtOH getränkten Wisch, ohne sich der Augenpartie zu nähern.
      HINWEIS: Für die intrazerebrale Virusinjektion wird eine 5- oder 10-ml-Spritze verwendet, die mit einer gezogenen Glaskapillare angepasst ist. Glaskapillaren werden mit einem Mikropipette-Puller gezogen, was zu einer Kapillare mit einer sehr feinen Spitze führt, die die Invasivität des Verfahrens minimiert. Um die Kapillare in die Spritze einzustellen, verwenden Sie ein Stück Gummischläuche über die Verbindung zwischen der Nadel der Spritze und der Glaskapillare und schmelzen Sie sie mit einer Wärmequelle (z. B. einem Feuerzeug). Eine enge Verbindung zwischen den beiden Teilen stellt sicher, dass während der Injektion keine Flüssigkeitslecks vorhanden sind. Vor Beginn der Operation testen Sie dies, indem Sie die Spritze mit Einer Linie füllen und die Flüssigkeit aus der Spritze schieben.
    9. Machen Sie einen Schnitt von etwa 0,5-0,8 cm entlang der Mittellinie des Kopfes. Schneiden Sie sowohl kutane als auch subkutane Schichten mit einem Skalpell durch.
    10. Erweitern Sie die Hautklappen auf jeder Seite des Einschnitts. Reinigen Sie den Schnitt von Blut und kratzen Sie die subkutanen Schichten mit einer Baumwollknospe zurück.
    11. Bewegen Sie den M/L-D/V-Arm des stereotaxic Rahmens an Ort und Stelle (über dem Tier) und sichern Sie ihn.
      HINWEIS: Der stereotaxic Rahmen ermöglicht die Einstellung der Spritze entlang der Vorderen/Hintern (A/P, Y-Achse), Medial/Lateral (M/L, X-Achse) und Dorsal/Ventral (D/V, Z-Achse).
    12. Bewegen Sie die Spritze entlang der verschiedenen Achse des stereotaxic Rahmens, um die Spitze der Glaskapillare knapp über Bregma zu bringen (der Knotenpunkt, an dem sich die verschiedenen Schädelplatten treffen).
    13. Stellen Sie sicher, dass die Kapillarspitze sowohl in A/P- als auch in M/L-Ebenen perfekt gerade ist. Im Falle eines mehrdeutigen Bregma, nehmen Sie den Durchschnitt der seitlichen und Mittellinie Nähte.
    14. Wenn die Spitze der Kapillare korrekt über Bregma platziert ist, setzen Sie sowohl die M/L- als auch die A/P-Werte auf 0,0 auf dem digitalen Koordinatenzähler zurück.
    15. Um sicherzustellen, dass sich der Kopf des Tieres in einer vollkommen flachen Position befindet, verwenden Sie den digitalen Koordinatenzähler, um den D/V-Koordinatenwert zu messen, wenn der A/P-Arm bei +2,0 und -2,0 (M/L = 0,0) liegt, sowie wenn der M/L-Arm bei +2,0 und -2,0 (A/P = 0,0) liegt. Passen Sie die Höhe der Zahnstange und der Ohrstangen entsprechend an.
    16. Bewegen Sie die Spritze auf die gewünschten Koordinaten für die Injektion von viralen Vektoren in das Striatum (A/P = +1,0; M/L = -2,0, relativ zu Bregma).
    17. Heben Sie die Spritze leicht an und bohren Sie durch den Blick auf die Injektionsstelle durch das Mikroskop ein Loch mit einem Zahnbohrer an den Injektionskoordinaten. Beginnen Sie, auf der Website zu bohren, arbeiten in kreisförmiger und sanfter Weise.
      HINWEIS: Setzen Sie nicht zu viel Abwärtsdruck, da das Bohrer scharf genug sein sollte, um ohne zusätzliche Kraft durch den Knochen zu gehen. Vermeiden Sie langes, nachhaltiges Bohren, da dies Wärme erzeugt.
    18. Überprüfen Sie am Ende der Bohrung, ob die Dura mater intakt und zur Injektion ausgesetzt bleiben.
  2. Spritzenaufbauvorbereitung
    1. Legen Sie ein Stück Watte über den offenen Einschnitt und spülen Sie die Spritze mit einer Salinelösung.
    2. Nach dem Spülen nehmen Sie eine Luftblase von 1–2 l auf, gefolgt von einer Lösung von 1 L, die die viralen Vektoren enthält, wodurch unbeabsichtigte Blasen vermieden werden. Stellen Sie sicher, dass die virale Lösung leicht unter der Luftblase visualisiert werden kann, während sie injiziert wird.
  3. Virale Injektion
    1. Entfernen Sie die Baumwollgaze über der Einschnittstelle, und senken Sie die Spritze mit dem D/V-Arm des stereotaxic Rahmens. Wenn sich die Oberfläche des Schädels nähert, schauen Sie sorgfältig durch das Mikroskop und messen Sie den D/V-Gehalt von Dura mater – es sollte leicht unter sanftem Druck wölben.
    2. Wenn Sie die Dura mater mit der Spitze der Kapillare berühren, stellen Sie die D/V-Koordinate auf 0,0 ein.
    3. Senken Sie die Spritze und bewegen Sie sich langsam auf die gewünschte Tiefe (D/V = -2,7, relativ zu dura mater). Stellen Sie sicher, dass die Flugbahn frei von Knochenfragmenten ist, so dass keine Biegung der Nadel/Kapillare beobachtet wird.
      HINWEIS: Die vorgestellten Koordinaten beziehen sich auf eine Injektion der Reprogrammierungsfaktoren in das Striatum von NG2-Cre-Mäusen. Es können Koordinaten verwendet werden, die anderen Hirnregionen entsprechen. Testen Sie die Koordinaten für die Injektion immer zuerst mit einem Farbstoff (z.B. Trypan Blue), farbiger Perleninjektion oder einem Reporter-Virusvektor vor der Injektion von Reprogrammierungsfaktoren in das Gehirn eines neuen Mausstamms. Wenn Trypan Blue injiziert wird, müssen die Tiere sofort nach der Operation geopfert und das Gehirn seziert werden. Frische Gehirne können mit einem Mikrotom geschnitten werden, während eingefroren, und die Injektionsstelle durch Visualisierung der Farbstoffposition im Gehirn bestimmt. Wenn Sie Koordinaten mit farbigen Perlen testen, ist es möglich, die Injektionsstelle auf perfundierte und schneiden Gehirne eine Woche nach der Injektion zu bestimmen. Alternativ kann eine Injektion mit einem viralen Vektor verwendet werden, der ein Reportergen trägt, und die Injektionsstelle wird in durchfundierten Schnittgehirnen bestimmt.
    4. Injizieren Sie 1 l der virusviralen Lösung mit einer Rate von 0,4 l/min. Wenn das gesamte Volumen injiziert wird, lassen Sie eine Diffusionsperiode von 2 min vor spritzenentzug.
    5. Nach der Diffusion die Spritze langsam zurückziehen, bis die Spitze der Kapillare vollständig aus dem Gehirn ist.
    6. Legen Sie ein Stück Watte über die Wunde und spülen Sie die Spritze mit einer Salinelösung.
    7. Bewegen Sie den M/L-D/V-Arm des stereotaxic-Rahmens aus dem Arbeitsbereich.
  4. Wundschließungundsarbeiten und postoperative Eingriffe
    1. Den Schnitt vorsichtig mit Nahtgewinde benähen.
      HINWEIS: Alle Nahtfäden, die bei injizierten Tieren verwendet werden, sollten in einer Tasse/Durchstechflasche entsorgt werden, die eine antivirale Waschmittellösung enthält. Die gleiche Lösung wird verwendet, um alle Oberflächen rund um den Operationsbereich zu reinigen, die mit chirurgischen Materialien in Berührung gekommen sind. Alle chirurgischen Werkzeuge werden am Ende jedes Operationstages gründlich gewaschen und autoklaviert.
    2. Entfernen Sie das Tier aus dem stereotaxic Rahmen und legen Sie es in eine postoperative Station, die einen sauberen, beheizten Käfig, Zugang zu Nahrung und Wasser enthält, und wo das Tier bleibt, bis es vollständig wach ist. Während dieser Zeit, überwachen Sie das Tier genau, bis das Bewusstsein wiedererlangt ist.
    3. Beherbergen Sie keine operierten Tiere mit nicht operierten Tieren, bis sich erstere vollständig von der Operation erholt haben.
    4. Beaufsichtigen Sie täglich operierte Tiere. Je nach verwendeter Naht stellen Sie sicher, dass sie bei Bedarf entfernt werden. Alle Tiere erhielten Bupenorphinum (Temgesic bei 1ml/kg) subkutan als postoperative Versorgung.
      HINWEIS: Wenn Sie mit der gleichen Spritze an zwei aufeinanderfolgenden Tagen arbeiten, spülen Sie sie mit Wasser, gefolgt von Ethanol 70% und Wasser wieder. Lassen Sie die Spritze über Nacht mit Wasser gefüllt, um die Auflösung möglicher Rückstände zu ermöglichen.

3. Elektrophysiologische Aufnahmen

  1. Gewebescheibenpräparat für die Elektrophysiologie
    ACHTUNG: Eine gut ausgeführte Gewebepräparation ist notwendig, um gute elektrophysiologische Aufnahmen zu erzielen. Bereiten Sie den Raum sorgfältig vor und legen Sie Werkzeuge für die Perfusion und Sezieren auf Eis.
    1. Bereiten Sie eiskalt und sauerstoffisiert (95% O2 und 5% CO2 ) Krebs-Lösung für Perfusion, Sezieren und Schneiden (bereiten Sie dies am selben Tag aus dem 10-fachen Vorrat durch Verdünnen der Stammlösung in Reinstwasser und Zugabe von NaHCO3 und Glukose). Die Komponenten in der Krebs-Lösung in mM (nach Verdünnung auf 1x) sind: 126 NaCl, 2.5 KCl, 1.2 NaH2PO4 H2O, 1,3 MgCl26H2O und 2,4 CaCl 2,6H2O, 22 NaHCO3,10 Glukose. Stellen Sie den pH-Wert der Lösung auf 7.4 ein.
    2. Führen Sie eine Kalibrierung (Vibracheck) für das Vibratom mit einer neuen Rasierklinge durch.
    3. Starten Sie den Kühlblock des Vibratoms (oder füllen Sie die umgebende Kammer mit Eis), füllen Sie die Schneidkammer vor Gebrauch mit einer Krebs-Lösung für die Sauerstoffversorgung mit 95 % O2 und 5 % CO2 mindestens 30 min.
    4. Eine Petrischale auf Eis legen und mit sauerstoffhaltiger Krebslösung füllen. Die Klinge, die Schere und die Montageplatte auf Eis legen.
      ACHTUNG: Bringen Sie den Käfig mit der Maus mindestens 1 h in den Raum, bevor Sie mit dem Eingewöhnungsverfahren beginnen. Stress hat einen negativen Einfluss auf den Zustand der Hirngewebeabschnitte.
    5. Endly beästhesieren Sie die Maus durch Injektion einer Überdosis Pentobarbital und lassen Sie das Tier einschlafen.  Wenn der Blinkreflex aus ist und die Tiere nicht auf Schmerzreize reagieren, durchdringen Sie das Tier transkardial mit eiskalter Krebslösung für 2-3 min (bei einer Rate von 10-20 ml/min).
    6. Sezieren Sie das Gehirn schnell, aber sorgfältig aus und stellen Sie es auf den Kopf in die Petrischale, die auf Eis gelegt wird (mit Krebs-Lösung).
      HINWEIS: Um die funktionelle Reifung der neu programmierten Neuronen zu vergleichen, opfern Sie die Tiere für Aufnahmen an verschiedenen Zeitpunkten nach der viralen Injektion. Bewerten Sie die Brenneigenschaften verschiedener Subtypen von Neuronen basierend auf vorhandener Literatur15 .
    7. Machen Sie einen koronalen Schnitt entlang der Mitte Kleinhirn und kleben Sie diese Seite auf die Montageplatte (auch eiskalt) für Vibratome Schneiden.
    8. Tauchen Sie das geklebte Gehirn vorsichtig in die Pufferkammer im Vibratome.
      ACHTUNG: Achten Sie darauf, die Rasierklinge nicht zu Ihrer eigenen Sicherheit zu berühren, und damit die Klinge kalibriert bleibt.
    9. Schneiden Sie vom rostralsten Teil des Gehirns bis zum striatalen Niveau mit hoher Geschwindigkeit. Dann schneiden Sie das Striatum koronal bei 275 mm bei langsamer Geschwindigkeit (0,10 mm/s).
    10. Nach jedem Schnitt die nicht injizierte Ststrichleiste (z. B. mit einer gebogenen Nadel) vorsichtig entfernen und die injizierte Seite in eine andere Durchstechflasche in einem Wasserbad geben, das ein in ein Wasserbad gelegtes Grundnetz (sauerstoffisiertkrebs bei RT) enthält. Bewahren Sie dies bei RT auf, bis alle Abschnitte geschnitten sind.
    11. Erhöhen Sie die Temperatur des Wasserbades langsam auf 37 °C und lassen Sie es 30 min. Dann schalten Sie die Heizung aus und lassen Sie abkühlen, bis RT.
      HINWEIS: An diesem Punkt können Sie anhalten, bis Sie mit der Aufnahme beginnen. Die Abschnitte dauern für 4-6 h.
  2. Ganzzellen-Patch-Clamp-Aufnahmen
    1. Übertragen Sie den ersten Gewebeabschnitt in die Aufnahmekammer, die in einem kontinuierlichen Fluss der Krebslösung untergetaucht ist. Montieren Sie den Abschnitt mit leichten Gewichten und tauchen Sie das Objektiv unter.
    2. Identifizieren Sie die striatale Region im Mikroskop und suchen Sie nach GFP-positiven (reprogrammierten) Neuronen. Wählen Sie ein Neuron, das in der Morphologie umfangreich ist und nicht von Faserbündeln oder Blutgefäßen bedeckt ist.
    3. Bereiten Sie Borosilikatglaspipetten (3–7 Mio.) zum Patchen vor und füllen Sie sie mit der folgenden intrazellulären Lösung (in mM): 122,5 Kaliumgluconat, 12,5 KCl, 0,2 EGTA, 10 HEPES, 2 MgATP, 0,3 Na3GTP und 8 NaCl, angepasst an pH 7,3 mit KOH.
    4. Für die Biocytinfüllung 1 mg Biocytinsalz zu 1 ml interner Lösung und Wirbel hinzufügen.
      ACHTUNG: Achten Sie darauf, die interne Lösung mit Biocytin zu filtern, da dies sonst die Elektrode verstopfen kann.
    5. Befestigen Sie die Glaspipette an der Aufnahmeelektrode und tauchen Sie in die Lösung ein. Überprüfen Sie den Widerstand der Elektrode. Dann nähern Sie sich langsam der Zelle mit der Pipette, halten einen leichten positiven Druck in der Elektrode, um zu vermeiden, die Spitze zu verstopfen.
      ACHTUNG: Achten Sie darauf, Ihre Zelle beim Absteigen der Elektrode zu verfolgen und die Fluoreszenz in der Zelle nicht zu bleichen (d. h. schalten Sie die Fluoreszenzlampe aus, wenn Sie sie nicht benötigen).
    6. Spülen Sie das umgebende Gewebe vorsichtig mit positivem Druck der Elektrode und nähern Sie sich der Zelle mit der Elektrode. Suchen Sie die Elektrode direkt auf der Oberseite der Zelle und steigen Sie ab, bis die Elektrode die Membran berührt. Machen Sie eine Giga-A-Dichtung zwischen der Elektrode und der Zellmembran und brechen Sie mit Unterdruckimpulsen die Membran, um ein Ganzzellpflaster zu erstellen.
      ACHTUNG: Umprogrammierte Neuronen sind empfindlich. Seien Sie vorsichtig beim Patchen und setzen Sie nicht zu viel Unterdruck, wenn Sie eine Giga-Siegel erreichen oder die Zellmembran öffnen. Auch, Patching auf Tiere, die älter sind erfordert Praxis und Geduld, da ihr Bindegewebe dicker ist und es schwieriger ist, die Neuronen zu visualisieren.
    7. Überprüfen Sie die ruhenden Membranpotentiale unmittelbar nach dem Einbrechen im Stromklemmenmodus und notieren Sie sich zur Analyse.
    8. Halten Sie die Zelle in der stromaktuellen Klemme zwischen -60 mV und -80 mV und injizieren Sie 500 ms Ströme von -20 pA bis +90 pA, mit 10 pA-Schritten, um Aktionspotentiale zu induzieren.
    9. Transfer in Spannungsklemme und Messen des nach innen gerichteten Natriums und verzögerte Rektifizieren von Kaliumströmen bei Depolarisationsschritten von 10 mV.
      HINWEIS: Spannungs-Klemmen-Aufnahmen werden besser mit einer anderen internen Lösung bewertet, die aus Chemikalien besteht, die die Membran effizienter klemmen. Bei neu programmierten Neuronen ist die Anzahl der Zellen, von denen Sie aufzeichnen können, jedoch gering und die Anzahl der Gewebeabschnitte mit diesen Neuronen ist begrenzt. Daher ist es von Vorteil, sowohl in Stromklemme als auch spannungsklemme aus derselben Zelle aufzunehmen.
    10. Zeichnen Sie im Spannungsklemmenmodus die spontane postsynaptische Aktivität bei -70 mV auf. Unterscheiden Sie hemmende postsynaptische Ereignisse bei einem Membranpotential von 0 mV von erregenden Ereignissen bei -70 mV.
    11. Nach Erreichen einer stabilen Ausgangsbasis fügen Sie Picrotoxin, den GABA-A-Rezeptor-Antagonisten, in die Krebs-Lösung ein, die in die Aufnahmekammer fließt, um exzitatorische Ereignisse zu extrahieren (eine Stammlösung von Picrotoxin zu einer Endkonzentration von 50 mM in Pufferspritze, die mit der Kammerperfusion verbunden ist. Schließen Sie den Pufferabfluss aus der Kammer an einen Vakuumbeutel an, um sie sicher zu entsorgen).
    12. Nach 20 min cNQX (20 mM), einem AMPA-Antagonisten, in die Krebs-Lösung geben, die in die Aufnahmekammer fließt, um die hemmenden Ereignisse zu blockieren (mit dem gleichen Verfahren wie bei Picrotoxin). Weitere 20 min einlassen und dann mit Krebslösung auswaschen. Entfernen Sie den Gewebeabschnitt aus der Kammer.
    13. Nach Abschluss der Aufnahmen können Sie eine Offline-Analyse spontaner exzitatorischer postsynaptischer Ströme (EPSC) und hemmender postsynaptischer Ströme (IPSC) mit einer Schwellenwert-Ereignis-Erkennung (>5 pA) im Analyseprogramm durchführen.
    14. Während der gesamten Aufnahme wird die Zelle langsam mit der biocytinhaltigen inneren Lösung gefüllt. Halten Sie das Pflaster mindestens 20 min, bevor Sie die Elektrode langsam entfernen, um eine vollständige Befüllung der Zelle zu erreichen.
      ACHTUNG: Achten Sie darauf, keinen positiven Druck in der Elektrode zu haben, der die konsekutive morphologische Analyse der Zellen danach zerstören könnte.
    15. Zur Biocytin-Visualisierung den Gewebeabschnitt in 4 % Paraformaldehyd (PFA) über Nacht bei 4 °C. Spülen Sie den Abschnitt in 0,02 M Kaliumphosphatpuffer (KPBS) mit 0,1 % Triton. Dann Fleck für Streptavidin- Cy3 (1: 600 in KPBS-T, 2 h), zur Identifizierung der biocytingefüllten Zelle und morphologische Visualisierung des umprogrammierten Neurons.
      HINWEIS: Biocytinfüllung kann für morphologische Analysen und Illustrationen der geflickten Neuronen verwendet werden.

4. Immunhistochemie, Stereologie und Quantifizierung

HINWEIS: Widmen Sie eine bestimmte Gruppe von Mäusen für die Immunhistochemie, da Gewebeabschnitte, die für die Elektrophysiologie verwendet werden, für die Immunhistochemie nicht optimal sind.

  1. Anästhesisieren Sie Mäuse mit einer i.p. Injektion einer Überdosierung von Pentobarbital und montieren Sie das Tier zur Perfusion.
  2. Transkardisch durchdringen die Mäuse, zuerst mit einer Saline-Lösung, um Blut zu entfernen, und dann mit eiskaltem 4% PFA.
  3. Sezieren Sie die Gehirne und Post-Fix für mindestens 12 h in 4% PFA.
  4. Setzen Sie die Gehirne in 25% Saccharoselösung (für Kryoschutz) für etwa 12 h.
    HINWEIS: Die Gehirne sind bereit, geschnitten zu werden, wenn sie in der 25% Saccharose-Lösung sinken, was darauf hindeutet, dass die Saccharose das gesamte Maushirn durchdrungen hat.
  5. Machen Sie einen koronaren Schnitt über das Kleinhirn, verwenden Sie den flachen, kaudalsten Teil des Gehirns, um das Gehirn auf ein Mikrotome zu legen und es mit optimaler Schnitttemperaturverbindung (OCT) an Ort und Stelle zu fixieren.
  6. Schneiden Sie das Gehirn in koronare Scheiben mit einer Dicke von 35 mm und teilen Sie das Gehirn in aufeinander folgende Reihen in Fläschchen oder Brunnen mit 0,02 M KPBS platziert.
  7. Verarbeiten Sie die Abschnitte für die Immunhistochemie mit Antikörpern gegen GFP- und Interneuron-Marker wie GAD65/67, PV, Chat (Cholin-Acetyltransferase) und NPY (Neuropeptid Y), gemäß den Standardprotokollen16, 17.
    HINWEIS: Gehirnscheiben können bei 4 °C oder -20 °C in Frostschutzlösung für längere Zeit aufbewahrt werden.
  8. Nachdem die Färbung abgeschlossen ist, montieren Sie die Abschnitte auf einem Glasschlitten und decken Sie mit einem Glasdeckel, mit einer Montagelösung, um es an Ort und Stelle zu befestigen. Lassen Sie die Abdeckungenrutschen über Nacht trocknen.
    HINWEIS: Für unsere Studien werden ganze Gehirne in 1:8-Serie geschnitten (d.h. jede Durchstechflasche mit Abschnitten hält ein Achtel des Maushirns11).
  9. Analysieren Sie die Abschnitte mit einem invertierten Fluoreszenz- und/oder konfokalen Mikroskop.
    ACHTUNG: Die Fluoreszierende Mikroskopie ist nützlich für einen allgemeinen Überblick über die Ergebnisse und die Aufnahme von Bildern zur Berechnung der Effizienz der Neuprogrammierung. Für eine detailliertere Analyse der phänotypchen Identität durch Beobachtung von doppelpositiven Zellen sollte eine konfokale Bildgebung verwendet werden.
  10. Für die Quantifizierung verschiedener Marker, die in GFP+ Neuronen im Striatum exprimiert werden, zählen Sie die Anzahl der doppelpositiven Zellen im Verhältnis zur Gesamtzahl der GFP+ Zellen (d. h. der umprogrammierten Neuronen) in mindestens zwei sttriatalen Abschnitt.
  11. Um die ungefähre extrapolierte Gesamtzahl der umprogrammierten Neuronen pro Gehirn zu bestimmen, zählen Sie das GFP+ Neuronen, die im Striatum einer der zuvor geschnittenen Gehirnreihen vorhanden sind, und multiplizieren Sie dann mit der Gesamtzahl der Reihen.
    HINWEIS: Verschiedene Methoden der Quantifizierung können verwendet werden, um die Effizienz der Neuprogrammierung auszudrücken, die Anzahl der umprogrammierten Neuronen pro Tier und den Prozentsatz der Neuronen, die bestimmte phänotypische Marker exprimieren. Weitere Informationen finden Sie in der vorherigen Publikation11.
  12. Analysieren Sie die Unterschiede zwischen den Bedingungen mit Graph Pad Prism oder ähnlichem.
    HINWEIS: Zur Effizienzberechnung haben wir NG2-Cre-Mäuse mit den CRE-abhängigen ALN-Umwandlungsvektoren und dem GFP-Reporter injiziert. Um die Umwandlungseffizienz abzuschätzen, injizierten wir auch Tieren ein cre-abhängiges GFP unter dem allgegenwärtigen cba-Promotor, wodurch alle Zielzellen GFP+. Bei diesem Vergleich schätzten wir, dass 66,81 % bis 38,38 % der Zielzellen in Neuronen umgewandelt wurden. Zur Validierung der Expression jedes der Gene kann für GFP/Ascl1, GFP/Lmx1a und GFP/Nurr1 eine komplementäre Doppelimmunfluoreszenzfärbung durchgeführt werden. Darüber hinaus kann die Genomsequenzierung wie die sequenzielle RNA-Sequenzierung einzelner Zellen das Vorhandensein jedes einzelnen Gens in den neu programmierten Zellen offenbaren.

Representative Results

Die Injektion von AAV-Vektoren wird verwendet, um ansässige NG2-Gliazellen erfolgreich in Neuronen im NG2-Cre-Maus-Striatum umzuprogrammieren (Abbildung 1A). Um NG2 glia gezielt anzusprechen, werden FLEX-Vektoren mit Reprogramming-/Reportergenen in antisense-Richtung eingefügt und von zwei Paaren antiparalleler, heterotypischer LoxP-Sites flankiert (Abbildung 1B). Jedes der drei Reprogrammierungsgene (Ascl1, Lmx1a und Nurr1) wird unter die Kontrolle des allgegenwärtigen cba-Promotors auf einzelnen Vektoren gestellt. Um sicherzustellen, dass die GFP-Expression auf neu programmierte Neuronen beschränkt ist, die aus einer Cre-exemittierten Zelle stammen, wird GFP unter die Kontrolle des neuronspezifischen Synapsin-Promotors (auch in einem FLEX-Vektor) gestellt.

Die Verwendung der Kombination von Reprogramming und Reporterkonstrukten ermöglicht die Erzeugung von GFP-positiven Neuronen im Mausstriatum (Abbildung 1C,C'). Die Verwendung des Reporterkonstrukts ohne das Vorhandensein von Reprogrammierungsgen ergibt keine GFP-positiven Neuronen (Abbildung 1D).

Die neu programmierten Neuronen, die mit Biocytin gefüllt sind, sind nach der post-mortem-Immunfärbung sichtbar (Abbildung 2A). Wenn die Konvertierung erfolgreich ist, sollte es eine umfassende neuronale Morphologie geben. Die elektrophysiologischen Aufnahmen von umprogrammierten Neuronen zeigen das Vorhandensein postsynaptischer funktioneller Verbindungen mit spontanen Aktivitätsmaßnahmen (Abbildung 2B, C). Dies kann entweder mit ionotropen GABAergic oder Glutamaterge Blocker blockiert werden (Picrotoxin oder CNQX), was sowohl erregende und hemmende synaptische Input in die neu programmierten Neuronen. Das Auftreten spontaner Aktivität nimmt mit der Zeit nach der Viralinjektion zu (Abbildung 2D), was auf eine allmähliche Reifung hindeutet.

Strominduzierte Wirkungspotentiale sind in funktionellen Neuronen vorhanden. Die Aktionspotentiale nehmen im Laufe der Zeit nach der Umstellung zu (Abbildung 2E). Dies deutet weiter auf eine Reifung in der neuronalen Funktion hin. In einem unreifen Neuron wird Strom entweder keine oder sehr wenige Aktionspotentiale induzieren (Abbildung 2F).

Die Brennmuster eines Neurons sind zelltypspezifisch, da sie von Faktoren wie der Morphologie der Zellen und der Kanalexpression15abhängen. Die aufgezeichneten Muster in den in vivo reprogrammierten Neuronen können in Gruppen unterschieden und mit denen endogener neuronaler Subtypen verglichen werden, z. B. schnell sprudelnde Interneuronen (Zelltyp B, Abbildung 3B) oder andere Zelltypen ( Abbildung 3A,C,D ). Die beobachteten elektrophysiologischen Unterschiede können durch das Vorhandensein spezifischer Subtype-Marker und die Ko-Expression mit GFP bestätigt werden (Abbildung 3E-H). Insgesamt deuten diese Daten darauf hin, dass die im Striatum vorhandenen umprogrammierten Neuronen Eigenschaften verschiedener Arten von Interneuronen wie Parvalbumin-, ChAt- und NPY-exzessierende Interneuronen sowie striatale mittelspiny neuron identity (DARPP32+) ( Abbildung 3E -H).

Figure 1
Abbildung 1: In-vivo-Umprogrammierung der ansässigen NG2-Glia in Neuronen. (A) Schematische Darstellung der aAV-virusvermittelten In-vivo-Reprogrammierung der striatalen NG2-Glia. (B) Schematische Darstellung von AAV5 FLEX-Konstrukten, die für die In-vivo-Reprogrammierung verwendet werden, bei denen die Genexpression durch Cre-Expression in den Zielzellen reguliert wird. (C und C') In vivo reprogrammierte Neuronen, die durch Syn-GFP + ALN-Injektion in das Striatum entstehen. (D) Fehlen von umprogrammierten Neuronen, wenn dem viralen Cocktail keine Umprogrammierungsfaktoren hinzugefügt werden und nur das Reporterkonstrukt in vivo injiziert wird. Skalenstäbe = 100 mm (C), 25 mm (C'), 25 mm (D). Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 2
Abbildung 2: In vivo umprogrammierte Neuronen sind funktional und zeigen eine Reife im Laufe der Zeit. (A) Biocytin-gefülltes neu programmiertes Neuron, zeigt eine reife neuronale Morphologie, einschließlich dendritischer Stacheln. Spuren zeigt (B) hemmende (GABAerge) Aktivität, die mit Picrotoxin blockiert ist, ein GABA-A-Rezeptor-Antagonist und (C) erregende Aktivität, die mit CNQX blockiert ist, ein AMPA-Rezeptor-Antagonist. (D) Die Anzahl der Neuronen mit postsynaptischer Aktivität nimmt im Laufe der Zeit zu. (E) Gepatchte Neuronen zeigen bereits nach 5 Wochen nach der Injektion (w.p.i.) repetitives Abfeuern und zeigen weiterhin, dass bei 8 und 12 w.p.i. (F) Das strominduzierte Wirkungspotenzial und die postsynaptische Aktivität eines unreifen Neurons, die nur wenige synaptische Ereignisse und wenige Aktionspotenziale im Vergleich zu B und D. Scale bar = 25 mm Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 3
Abbildung 3: In vivo umprogrammierte Neuronen zeigen immunhistochemische und elektrophysiologische Eigenschaften von striatalen Interneuronen. (A-D) Die Brennmuster von in vivo reprogrammierten Neuronen können von unterschiedlichen Typen sein: (A) Typ A ähnelt dem endogenen mittleren Stachelneuron (DARPP32+); (B) ähnlich wie fast-spiking (PV+) interneurons; (C) ähnlich wie niedrigschwellige spiking Neuronen mit prominentem Sag (NPY+); (D) Neuronen, die mit großer Nachhyperpolarisation (Chat+) feuern. (E-H) Konfokale Bilder, die die Kolokalisierung von GFP und den interneuron Markern PV (E), ChAT (F), NPY (G) und Projektionsneuronenmarker DARPP32 (H) zeigen. Alle Skalenleisten = 50 mm. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Discussion

Die direkte In-vivo-Reprogrammierung kann mit AAV FLEX-Vektoren in Cre-expressing-Mausstämmen erreicht werden. Es ist wichtig zu beachten, dass Unterschiede zwischen Denspezien in Bezug auf die Reprogrammierung der Wirksamkeit beobachtet wurden. Bei der In-vivo-Reprogrammierung im Striatum hat sich die NG2-Cre-Mauslinie im Vergleich zu anderen Stämmen als die effizientere erwiesen. Bevor Sie mit der Verwendung eines neuen tierischen Stammes beginnen, ist es wichtig, die Richtlinien des Mausanbieters bezüglich der Cre-Expression im Laufe der Zeit zu überprüfen, da das Alter der Tiere oft die Spezifität dieser Proteinexpression beeinflusst. In unseren Studien wurden Tiere, die älter als 12 Wochen waren, nicht für die In-vivo-Reprogrammierung verwendet, da ein Risiko für die Cre-Expression in anderen Zellen als NG2-Glia bestand. Die ständige Anwesenheit und Überwachung von Kontrolltieren, die nur mit Synapsin-FLEX-GFP-Konstrukt injiziert werden, wird empfohlen. Dies ermöglicht die Überwachung der Tiere auf GFP-positive Zellen, die nicht vorhanden sein sollten, wenn keine Reprogrammierungsgene (ALN) verwendet werden.

Um die neu neu programmierten Neuronen zu identifizieren, ist eine neuronspezifische Identifizierungsmethode, wie sie in diesem Protokoll beschrieben wird, von größter Bedeutung. Dies ermöglicht eine korrekte Identifizierung und Unterscheidung der umprogrammierten Neuronen von den endogenen umgebenden Zellen, die bei der Umprogrammierung in einer homotopischen Region von besonderer Bedeutung ist.

Es ist auch wichtig, die richtige Struktur für die virale Injektion zu zielen. Daher ist die stereotaxic Chirurgie für die virale Injektion wichtig und muss mit Genauigkeit angegangen werden, vor allem, wenn kleinere Strukturen des Gehirns gezielt.

Wir haben11 zuvor gezeigt, dass es nicht zuverlässig ist, das Ergebnis einer In-vivo-Reprogrammierung auf der Grundlage von In-vitro-Reprogrammierungsexperimenten unter Verwendung der gleichen Reprogrammierungsfaktoren vorherzusagen. Alle Faktoren von Interesse müssen daher in vivo getestet werden. In unseren Händen geben viele verschiedene Faktorkombinationen den gleichen Subtyp von Neuronen (d.h. Interneurons11 in vivo) trotz der Tatsache, dass diese Gene in die Entwicklung anderer Neuronen involviert sind.

Ganzzellige Patchklemme für neu programmierte Neuronen ist eine delikate Technik und Gewebeverarbeitung ist wichtig für ein gutes Ergebnis. Perfusion mit eiskalter Krebslösung verbessert die Gewebequalität. Auch geflickte Neuronen müssen sorgfältig behandelt werden. Auch wenn die Reifung und die phänotypische Identität von neu programmierten Neuronen mit einer ganzzelligen Pflasterklemme etwas beurteilt werden können, sind diese Zellen nicht vollständig mit ihren endogenen Gegenstücken vergleichbar. Zusätzliche Arten der Analyse, wie z. B. genomische Sequenzierung (z. B. RNA-Sequenzierung), sollten verwendet werden, um die neu programmierte Zellidentität weiter zu bestätigen.

Die hier beschriebene Technik könnte für die Entwicklung zukünftiger Therapien in Betracht gezogen werden, bei denen neuronaler Ersatz im Gehirn benötigt wird. Obwohl sich die In-vivo-Reprogrammierung noch in den Anfängen befindet und die Übersetzung in den Menschen noch nicht absehbar ist, könnte diese Technik eine Methode zur Bewertung der exogenen Genfunktion im Gehirn und zur Untersuchung der Zellreifung in vivo bieten.

Disclosures

Die Autoren haben nichts zu verraten.

Acknowledgments

Marcella Birtele wurde durch das Horizont 2020-Programm der Europäischen Union (H2020-MSCA-ITN-2015) im Rahmen der Innovativen Ausbildungsnetze von Marie Skodowska-Curie und der Finanzhilfevereinbarung Nr. 676408 finanziert. Daniella Rylander Ottosson wurde vom Schwedischen Forschungsrat (2017-01234) finanziert.

Materials

Name Company Catalog Number Comments
REAGENTS FOR AAV5 CLONING AND VIRAL VECTOR PREPARATION
pAAV-CA-FLEX AddGene 38042
Ascl1 AddGene 67291 NM_008553.4
Lmx1a AddGene 33013 NM_0033652.5
Nurr1 AddGene 35000 NM_013613.2
GFP-syn AddGene 30456
LoxP (FLEX) sequence 1 GATCTccataacttcgtataaagtatcctatac
gaagttatatcaaaataggaagaccaatgcttc
accatcgacccgaattgccaagcatcaccatcg
acccataacttcgtataatgtatgctatacgaa
gttatactagtcccgggaaggcgaagacgcgga
agaggctctaga
LoxP (FLEX) sequences 2 tactagtataacttcgtataggatactttatac
gaagttatcattgggattcttcctattttgatc
caagcatcaccatcgaccctctagtccacatct
caccatcgacccataacttcgtatagcatacat
tatacgaagttatgtccctcgaagaggttcgaa
ttcgtttaaacGGTACCCTCGAC
pDP5 Plasmid Factory PF435
pDP6 Plasmid Factory PF436
Phosphate-Buffered Saline (PBS) Thermo Fisher Scientific 10010023
FBS (Fetal bovine serum) Thermo Fisher Scientific 10500064
Penicillin streptomycin Thermo Fisher Scientific 15140122
DMEM (Dulbecco's Modified Eagle Medium)+ Glutamax Thermo Fisher Scientific 61965026
DPBS (Dulbecco's Phosphate Buffer Saline) Thermo Fisher Scientific 14190094
HEK293 cells Thermo Fisher Scientific 85120602-1VL
Flasks BD Falcon 10078780 175 cm2
Tris H-CL Sigma Aldrich 10812846001 For TE buffer use 10 mM, pH 8.0; for lysis buffer use 50mM, pH 8.5; for IE buffer use 20 mM, pH 8.0; for elution buffer use 20 mM, pH 8.0
EDTA EDTA: Invitrogen EDTA: AM9260G For TE buffer use 1 mM EDTA
Ultrapure water see Ultrapure water system
CaCl2 SigmaAldrich C5080 2.5 M
Dulbecco´s phosphate-buffered saline (DPBS) Thermo Fisher Scientific 14190136
NaCl Sigma-Aldrich S3014 FOR HBS use 140 mM; for Lysis Buffer use 150 mM; for IE buffer use 15 mM; for elution buffer use 250 mM
MgCl2 Sigma-Aldrich M8266-100G For lysis Buffer: 1 mM
Ultracentrifuge sealing tubes Beckman Coulter Quick-Seal® Polypropylene Tube
OptiPrep™ Density Gradient Medium Sigma Aldrich D1556-250ML
10-mL syringe-18G needle BD 305064
Laboratory glass bottles VWR ?
Anion exchange filter PALL laboratory MSTG25Q6 Acrodisc unit with Mustang Q membrane
Centrifugal filter unit Merck Z740210-24EA Amicon Ultra-4 device
Endotoxin-Free Plasmid DNA Isolation Kits Thermo Fisher Scientific A33073
Na2PO4 Sigma-Aldrich S7907
HEPES Sigma-Aldrich H7523 15 mL
Falcon tube Thermo Fisher Scientific Corning 352196
Falcon tube Thermo Fisher Scientific Corning 352070
Glass Vials Novatech 30209-1232 CGGCCTCAGFGAGCGA
Forward Primer for Inverted Terminal Repeat (ITR) sequence GGAACCCCTAGTGATGGAGTT
Reverse Primer for Inverted Terminal Repeat (ITR) sequence CACTCCCTCTCTGCGCGCTCG
5´FAM / 3´BHQ1 probe Jena Bioscience
0.22 mm filter Merck SLGV004SL Millex-GV filter
EQUIPMENT AAV5 VIRAL VECTOR PREPARATION
Freezer -20 °C
Freezer -80 °C
Fridge +4 °C
AAV viral room
Ultrapure Water system Merck Milli-Q® IQ 7000
Vortex mixer VWR 444-0004
Ultracentrifuge Beckman Coulter Beckman Optima LE-80K Ultracentrifuge
Autoclave Tuttnauer 2540 EL
Polymerase Chain Reaction (PCR) BioRad C1000 Touch Thermal Cycler
Quantitative PCR (qPCR) Roche LightCycler® 480 System
Centrifuge Thermo Fisher Scientific Sorvall ST16
Water Bath Thermo Fisher Scientific TSGP02
ANIMAL MODEL
NG2-Cre mice Jackson NG2-CrexB6129, Stock #008533
REAGENTS FOR INJECTION OF REPROGRAMMING FACTORS INTO THE BRAIN
Water
Saline Apoteket AB 70%
Ethanol Solveco
Isolfurane Apoteket AB Dilute to 1% solution with warm water.
Virkon Viroderm 7511 
Pentobarbital Apoteket AB P0500000 i.p. for terminal procedure at the dose of 60 mg/ml.
Sucrose Merck S0389-500G
Trypan Blu Thermo Fisher Scientific 15250061
Retrobeads Lumafluor R170
Buprenorphine Apoteket AB
EQUIPMENT FOR INJECTION OF REPROGRAMMING FACTORS INTO THE BRAIN From RSG Solingen.
Scissors VWR 233-1552 From Biochem.
Tweezers VWR 232-0007
Forcep VWR 232-0120
Scalpel holder VWR RSGA106.621 Number 20.
Scalpel VWR RSGA106.200
Stereotaxic frame Stoelting Europe 51500D
Mouse ear bars Stoelting Europe 51648 5 ul
Syringe with Removable needle Hamilton Company 65 0,75 inner diameter and 1.5 outer diameter.
Glass capilaries Stoelting 50811
Glass capillary puller Sutter company P-1000
Dental drill Agnthos AB 1464
Shaver Agnthos AB GT420
Isoflurane Chamber and pump Agnthos AB 8323101 2 mL
Syringes Merck Z118400-30EA 25G
Needles Merck Z192414 Aldrich
Mouse and neonatal rat adaptor for stereotaxic fram Stoelting 51625
Heating pad Braintree scientific, inc 53800M From Covidien 2187.
Cotton gauze Fisher Scientific 22-037-902
Rubber tube Elfa Distrelec HFT-A-9.5/4.8 PO-X BK 150
Cotton swabs Fisher Scientific 18-366-473
REAGENTS FOR WHOLE-CELL PATCH CLAMP RECORDINGS
NaCl Sigma-Aldrich S3014
KCl Sigma-Aldrich P9333
NaH2PO4-H2O Sigma-Aldrich S9638
MgCl2-6 H2O Sigma-Aldrich M2670
CaCl2-6 H2O Sigma-Aldrich C8106
MgSO4-7 H2O Sigma-Aldrich 230391
NaHCO3 Sigma-Aldrich S5761
Glucose Sigma-Aldrich G7021 see Ultrapure Water system
Ultrapure Water Prepare 1 or 2M.
KOH Sigma-Aldrich P5958-500G
K-D-gluconate Sigma-Aldrich G4500 Sigma
KCl Sigma-Aldrich P9541
KOH-EGTA (Etilene glycol-bis-N-tetracetic acid) Sigma-Aldrich E3889 Sigma
KOH- Hepes acid (N-2-hydroxyethylpiperazine-N’-2-ethanesulfonic acid) Sigma-Aldrich H7523
NaCl Sigma-Aldrich S3014
Mg2ATP Sigma-Aldrich A9187
Na3GTP Sigma-Aldrich G8877
Biocytin Sigma-Aldrich B4261
Picrotoxin Merck P1675 Sigma
CNQX Merck C239 Sigma
Ice
EQUIPMENT FOR WHOLE-CELL PATCH CLAMP RECORDINGS
Borosilicate glass pipette Sutter Company B150-86-10
Glass capillary puller Sutter company P-1000
Vibratome Leica Leica VT1000 S
WaterBath Thermo Fisher Scientific TSGP02
Clampfit software Molecular Devices
Multiclamp software Molecular Devices
REAGENTS FOR IMMUNOHISTOCHEMISTRY Use at a concentration of 4%. CAUTION: PFA is a potent fixative. Avoid ingestion and contact with skin.
Paraformaldehyde (PFA) Merck Millipore 1040051000 Use at a concentration of 0.1%.
Triton X-100 Fisher Scientific 10254640 Donkey.Use at a concentration of 1 : 400.
Serum Merck Millipore S30-100ML Reconstitute the powder in Milli-Q water to 1 mg/mL. Aliquot and store at -20°C, light sensitive. Use at a concentration of 1 : 500.
4′,6-Diamidino-2′-phenylindole dihydrochloride (DAPI) Sigma Aldrich D9542 1: 600 in KPBS-T.
streptavidin- Cy3 Thermo Fisher Scientific 434315 1:5000, rabbit.
Anti-GAD65/67 Abcam 1:2000, mouse.
Anti-PV Sigma P3088 1:200, goat.
Anti-Chat Merk AB143 1:5000, rabbit.
Anti-NPY Immunostar 22940
K2HPO4 Sigma-Aldrich P3786
NaCl Sigma-Aldrich S3014
KH2PO4 Sigma-Aldrich NIST200B 1:1000, chicken.
Anti-GFP Abcam ab13970
Mounting solution Merck 10981 Polyvinyl alcohol mounting medium with DABCO®, antifading
OCT Agar Scientific
Glycerol Sigma-Aldrich G9012-100ML
Distilled water
Anti-freeze solution Tissue Pro Technology AFS05-1000N, 1000 mL/ea.
EQUIPMENT FOR IMMUNOHISTOCHEMISTRY
Inverted fluorescence microscope Leica DMI6000 B
Confocal microscope Leica TCS SP8 laser scanning confocal microscope.
Prism GraphPad
Microtome Leica SM2010R

DOWNLOAD MATERIALS LIST

References

  1. Barker, R. A., Parmar, M., Studer, L., Takahashi, J. Human Trials of Stem Cell-Derived Dopamine Neurons for Parkinson's Disease: Dawn of a New Era. Cell Stem Cell. 21, (5), 569-573 (2017).
  2. Southwell, D. G., et al. Interneurons from embryonic development to cell-based therapy. Science. 344, (6180), 1240622 (2014).
  3. Parmar, M., Torper, O., Drouin-Ouellet, J. Cell-based therapy for Parkinson's disease: A journey through decades toward the light side of the Force. European Journal of Neuroscience. (2018).
  4. Torper, O., et al. In Vivo Reprogramming of Striatal NG2 Glia into Functional Neurons that Integrate into Local Host Circuitry. Cell Reports. 12, (3), 474-481 (2015).
  5. Su, Z., Niu, W., Liu, M. L., Zou, Y., Zhang, C. L. In vivo conversion of astrocytes to neurons in the injured adult spinal cord. Nature Communication. 5, 3338 (2014).
  6. Liu, Y., et al. Ascl1 Converts Dorsal Midbrain Astrocytes into Functional Neurons In Vivo. Journal of Neuroscience. 35, (25), 9336-9355 (2015).
  7. Guo, Z., et al. In vivo direct reprogramming of reactive glial cells into functional neurons after brain injury and in an Alzheimer's disease model. Cell Stem Cell. 14, (2), 188-202 (2014).
  8. Grande, A., et al. Environmental impact on direct neuronal reprogramming in vivo in the adult brain. Nature Communication. 4, 2373 (2013).
  9. Niu, W., et al. In vivo reprogramming of astrocytes to neuroblasts in the adult brain. Nature Cell Biology. 15, (10), 1164-1175 (2013).
  10. Weinberg, M. S., Criswell, H. E., Powell, S. K., Bhatt, A. P., McCown, T. J. Viral Vector Reprogramming of Adult Resident Striatal Oligodendrocytes into Functional Neurons. Molecular Therapy. 25, (4), 928-934 (2017).
  11. Pereira, M., et al. Direct Reprogramming of Resident NG2 Glia into Neurons with Properties of Fast-Spiking Parvalbumin-Containing Interneurons. Stem Cell Reports. 9, (3), 742-751 (2017).
  12. Rivetti di Val Cervo, P., et al. Induction of functional dopamine neurons from human astrocytes in vitro and mouse astrocytes in a Parkinson's disease model. Nature Biotechnology. 35, (5), 444-452 (2017).
  13. Crosson, S. M., Dib, P., Smith, J. K., Zolotukhin, S. Helper-free Production of Laboratory Grade AAV and Purification by Iodixanol Density Gradient Centrifugation. Molecular Therapy Methods & Clinial Development. 10, 1-7 (2018).
  14. Torper, O., et al. Generation of induced neurons via direct conversion in vivo. Proceedings of the National Academy of Sciences of the United States of America. 110, (17), 7038-7043 (2013).
  15. Kawaguchi, Y., Kubota, Y. Correlation of physiological subgroupings of nonpyramidal cells with parvalbumin- and calbindinD28k-immunoreactive neurons in layer V of rat frontal cortex. Journal of Neurophysiology. 70, (1), 387-396 (1993).
  16. Grealish, S., et al. The A9 dopamine neuron component in grafts of ventral mesencephalon is an important determinant for recovery of motor function in a rat model of Parkinson's disease. Brain. 133, (Pt 2), 482-495 (2010).
  17. Thompson, L., Barraud, P., Andersson, E., Kirik, D., Bjorklund, A. Identification of dopaminergic neurons of nigral and ventral tegmental area subtypes in grafts of fetal ventral mesencephalon based on cell morphology, protein expression, and efferent projections. Journal of Neuroscience. 25, (27), 6467-6477 (2005).
In Vivo Direkte Reprogrammierung von Resident Glial Cells in Interneurons durch Intracerebral Injection of Viral Vectors
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Pereira, M., Birtele, M., Rylander Ottosson, D. In Vivo Direct Reprogramming of Resident Glial Cells into Interneurons by Intracerebral Injection of Viral Vectors. J. Vis. Exp. (148), e59465, doi:10.3791/59465 (2019).More

Pereira, M., Birtele, M., Rylander Ottosson, D. In Vivo Direct Reprogramming of Resident Glial Cells into Interneurons by Intracerebral Injection of Viral Vectors. J. Vis. Exp. (148), e59465, doi:10.3791/59465 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter