Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Neuroscience

בתוך Vivo ישיר של תאים Glial תושב לתוך Interneurons על ידי הזרקת גרם של וקטורים ויראלי

doi: 10.3791/59465 Published: June 17, 2019

Summary

פרוטוקול זה מתכוון לייצר האינטרנוירונים מתוכנת באופן ישיר ב-vivo, באמצעות מערכת ויראלי מבוססי AAV במוח וכתבת ה-GFP FLEX סינפסין, המאפשרת זיהוי תאים וניתוח נוסף בvivo.

Abstract

המרת התושב גליה במוח לתוך הנוירונים פונקציונלי מסוג אחד ספציפי ב vivo מספק צעד קדימה לקראת התפתחות של טיפולים חלופיים החלפת תאים תוך יצירת כלים גם לחקור את גורל התא באתרו. עד כה, ניתן היה להשיג נוירונים באמצעות vivo תכנות מדויק, אבל הפנוטיפ המדויק של נוירונים אלה או איך הם בוגרים לא נותחו בפרוטרוט. בפרוטוקול זה, אנו מתארים המרה יעילה יותר הזיהוי הספציפי לתא של vivo מתוכנת נוירונים, באמצעות מערכת וקטורים מבוססי AAV ויראלי. אנו מספקים גם פרוטוקול להערכה תפקודית של ההבשלה העצבית של התאים שתיכנתו. על-ידי הזרקת וקטורים מסוג ' היפוך כריתה ' (FLEX), המכיל את גנים הכתב המתיכנות מראש והסינפסין לסוגי תאים ספציפיים במוח המשמשים כיעד לתיכנות מדויק של התא. טכניקה זו מאפשרת זיהוי קל של הנוירונים החדשים שעוצבו מחדש. התוצאות מראות כי הנוירונים שהתקבלו מתוכנת מחדש פונקציונלית בוגרת לאורך זמן, לקבל אנשי קשר סינפטית ולהציג מאפיינים אלקטרולוגיים של סוגים שונים של האינטרנוירונים. באמצעות שעתוק הגורמים Ascl1, Lmx1a ו Nurr1, רוב התאים התיכנתו יש מאפיינים של מהיר העולה, parvalbumin המכיל באינטרנוירונים.

Introduction

המטרה הכוללת של שיטה זו היא להמיר ביעילות את המוח תושב glia ב vivo לתוך הנוירונים פונקציונלי מסוג אחד ספציפיים כגון parvalbumin-הביע interneurons. זה מספק צעד קדימה לקראת הפיתוח של טיפול חלופי החלפת התא עבור מחלות המוח ללא צורך מקור תא אקסוסוגני. זה גם יוצר כלי לחקור את מתגי הגורל התא באתרו.

המוח יש רק קיבולת מוגבלת ליצירת נוירונים חדשים. לכן, במחלות נוירולוגיות, יש צורך של מקורות תא אקסוגני לתיקון המוח. בשביל זה, מקורות שונים של תאים נחשפו למחקר אינטנסיבי במהלך השנים, כולל תאים מרקמות ראשוני, תאי גזע הנגזרים תאים ותאים מתוכנת מחדש1,2,3. מחדש ישירות של תאי המוח תושב לתוך הנוירונים היא גישה האחרונות שיכול לספק שיטה אטרקטיבית לתיקון המוח כפי שהוא משתמש בתאים של החולה ליצירת נוירונים הרומן בתוך המוח. עד היום, מספר דיווחים הראו vivo תכנות מחדש באמצעות משלוח וקטורי ויראלי במוח4,5,6,78,9 באזורי מוח שונים כגון הקליפה, חוט השדרה, סטריאטום והמוח המאמצע5,10,11, כמו גם במוח השלם ולגירסה5,8,11,12. הן נוירונים מעכבות ומרגש הושגו4,8, אבל הפנוטיפ מדויק או פונקציונליות של תאים אלה עדיין לא נותחו בפרוטרוט.

בפרוטוקול זה, אנו מתארים התכנות יעיל יותר וזיהוי תא ספציפי של vivo נוירונים מתוכנת. אנו מספקים פרוטוקול להערכה תפקודית של ההבשלה העצבית והאפיון הפנוטיפ המבוסס על פונקציונליות ותכונות אימונוהיסטוכימיה.

השתמשנו inducible וקטור AAV של היצורים וכתבת GFP כדי לזהות את הנוירונים vivo מתוכנת. בחירה זו של וקטורים ויראלי יש את היתרון של הדבקה הן חלוקת תאים בלתי מפרידים של המוח, הגדלת מספר תאים ייעודיים, כחלופה לשימוש של רטרו וירוס7,8. כתבת FLEX (GFP) ספציפית לעצב-מסינפסין, אפשרה לנו לזהות במיוחד את הנוירונים שנוצרו לאחרונה. מחקרים קודמים השתמשו היזמים ספציפיים למשנה עבור ב vivo תכנות7,9, כי גם לאפשר את הביטוי של גנים התיכנות מראש וכתבים בסוגי תאים ספציפיים. עם זאת, שיטה זו מחייבת זיהוי נוסף של נוירונים מתוכנת על ידי ניתוח לאחר המוות של הביטוי המשותף של כתב וסמנים עצביים. השימוש בכתב מסוים בעצב, כגון האחד המתואר לעיל, מאפשר זיהוי ישיר. זה מספק הוכחה ישירה של המרה מוצלחת ומאפשר זיהוי תא חי הנדרש עבור מהדק-מלחציים הפיזיולוגיה.

Protocol

כל ההליכים הניסיוניים בוצעו תחת הוראת האיחוד האירופי (2010/63/האיחוד האירופי) ואושרה על-ידי הוועדה האתית לשימוש בעלי חיים במעבדה באוניברסיטת לונד והמחלקה השבדית לחקלאות (Jordbruksקט). עכברים ממוקמים במחזור של 12 שעות ובאור כהה עם גישה מודעת למים למזון ומים.

1. נגיפי וקטורים

  1. שיבוט של וקטורים AAV
    1. כדי ליצור מinducible AAV5 וקטורים, הכנס cDNA עבור GFP, Ascl1, Lmx1a ו NR4A2 (Nurr1) בכיוון הפוך מוקף על ידי שני זוגות של הטרוסקסואלים, אנטי מקבילי LoxP להעיף-כריתה (FLEX) רצפים (טבלת חומרים). עבור ההכנסה cdna, להשתמש בעמוד השדרה כמו paav-cdna-FLEX או אחד עם מבנה דומה, המכיל רצפי FLEX ו ביתא התרנגול אקטין (cdna) מקדם.
    2. הוסף כל cDNA בודד (למשל, Ascl1) בעמוד השדרה על ידי תגובת שרשרת פולימראז (PCR) ואנזימים הגבלה. אקספרס GFP תחת שליטה של מקדם סינפסין ו Ascl1, Lmx1a, Nurr1 תחת שליטה של מקדם ביטא באופן אוביקטאני.
      הערה: ודא שיש דנ א חינם אנדוטוקסין באמצעות ערכות DNA ספציפיות של אנדוטוקסין ללא מערכת בידוד.
    3. ביצוע ניתוח ברצף והגבלה על המבנה לפני השימוש, כדי לבדוק את הצלחת שלב השכפול.
  2. AAV5 הפקת וקטורים ויראליות
    זהירות: עיין בהנחיות הביו-בטיחות המקומיות בעת טיפול בווירוס משויך adeno (AAV). בשוודיה, ה-AAV המשמש בפרוטוקול זה דורש ברמת Biosafety טיחות 2 (BSL-2).
    1. זרע HEK293T תאים עם מדיה תרבותית סטנדרטית (DMCFXMAX + 10% FBS + פניצילין (100 U/ml) סטרפטומיצין (100 μg/mL), ראה טבלת חומרים) ב T175 מבחנות בצפיפות של 3 x 106 תאים לכל בקבוקון. חשבון עבור 5 מבחנות לכל אצווה של AAV ותוכנית 6 אצוות בכל פעם.
    2. כאשר התאים מגיעים 50-70% שליטה, להכין את התערובת הבאה עבור העברה (לכל 175 ס מ2 בקבוקון).
      1. ב שפופרת צנטריפוגה 50 mL, להוסיף כמויות equimolar של וקטור באמצע ו-pDG סדרת המסייע פלמיד (pDP5, pDP6), עם כמות כוללת של 72 μg לכל 175 ס מ2 בקבוקון.
      2. הוספת מאגר טריס-EDTA (מאגר TE, 10 מ"מ Tris-HCl, 1 מ"מ EDTA) לנפח הסופי של 144 mL.
      3. הוסיפו מים באולטרה-טהורים כך שעוצמת הקול הכוללת תהיה 1296 mL ותערבב.
      4. הוסף 144 μL של 2.5 M CaCl2 ו לערבב. הוסף 1.92 μL של מלוחים באגירה של HEPES (HBS) (1.5 mM Na2hbs4 , 140 mm הנאפס, 50 mm hepes) לפתרון ה-DNA ולערבב מיד על ידי vortexing.
      5. דגירה בטמפרטורת החדר (RT) עבור בדיוק 60 s. העבר את הפתרון ל 28 מדיה חדשה של תרבות התא ומערבבים.
    3. להחליף את המדיום בתוך מבחנות עם מדיום תרבות התא המכיל תערובת הגלגול.
    4. שלושה ימים לאחר החצייה, הקציר את התאים על ידי שפיכת את המדיום מן צלוחיות לתוך מיכל חד פעמי עבור פסולת ולהוסיף 5 מ ל של מאגר הקציר (EDTA הוסיף מלוחים באגירה פוספט, ראה טבלת חומרים, dpbs לריכוז סופי של 5 מ"מ) לריכוז של 5 מ"מ) בכל בקבוקון כדי לאפשר ניתוק תאים.
    5. שופכים את פתרון התאים בשפופרת צנטריפוגה 50 mL. הוסף עוד 4 מ ל של DPBS לכל בקבוקון כדי לשטוף את התאים הנותרים בריכה עם פתרון התא הראשון. צנטריפוגה את התאים שנקטפו ב 1,000 x g עבור 5 דקות ב 4 ° c.
    6. לאחר צנטריפוגה, להסיר את supernatant ולפזר את כדורי ב 15 מ ל של מאגר הליזה (50 mM טריס-HCl pH 8.5, 150 mM הנאקל, 1 מ"מ MgCl2) על ידי vortexing.
    7. להקפיא אותם באמבט2-ice/אתנול למשך 15 דקות ולחנות ב-20 ° c מקפיא. הפשרת התאים הנקצרו באמבט מים ב37 ° c לפני השימוש.
  3. טיהור וקטורי AAV5 ויראלי
    1. לבצע טיהור AAV על ידי יודיקסנול מעבר הדרגתי13 ולהשתמש ultracentrifuge איטום צינורות עם צנטריפוגה ב 350,000 x g עבור 1 h ו 45 דקות ב RT.
    2. השתמש מזרק 10 מ ל עם מחט 18G ו להוסיף על 2 מ"מ מתחת 40/60% הגבול שלב עם השיקוע פונה כלפי מעלה על מנת לחלץ את השלב המכיל AAV. הקפד להפסיק לפני שהגיע להקת החלבון אחרי 5-6 mL הופק.
    3. אחסן את תמציות מעבר הצבע בבקבוקי זכוכית אוטוקליים ב-4 ° c. הימנע משמירת שעות ארוכות יותר מלילה.
    4. לדלל את תמצית יודיקסנול מעבר 3-קיפול על ידי ליטוף לאט ב 12 מ ל של מאגר יודיאקרול (IE) (20 מ"מ טריס-HCl pH 8.0, 15 מ"מ הנאל) בזמן מתערבל.
    5. לטהר ולרכז את מעבר הדרגתי מדולל באמצעות מסנן החליפין אניון. לדחוף אותו באיטיות עם מהירות לא מהירה יותר מ 1 טיפה/s. לדחוף 3 מ ל של IE מאגר לאט דרך המסנן כדי לשטוף אותו.
    6. אליוט לתוך יחידת מסנן צנטריפוגלי עם 1-2 מ ל של מאגר הימנעות (20 מ"מ טריס-HCl pH 8.0; 250 מ"מ הנאל). הוסף DPBS למכשיר נפח סופי של 4 mL. צנטריפוגה ב 2,000 x g ב RT עד פחות מ 0.5 mL נשאר במסנן. הסר את הנוזל מהחלק התחתון של הצינור, מילוי מחדש עם 4 מ ל של DPBS ו צנטריפוגה שוב. חזור על שלב זה פעמיים נוספות. ודא שעוצמת הקול של הווקטור המרוכז במסנן היא כ-200 μL לאחר השלב האחרון צנטריפוגה.
    7. להסיר את הווקטור 200 Μlמרוכז באמצעות פיפטה ולדחוף את הריכוז באמצעות מסנן 0.22 מ"מ כדי לעקר אותו. Aliquot 200 Μlto a 9 בקבוקון זכוכית עם הוספה משולבת (טבלה של חומרים).
      הערה: מניות AAV5 וקטורים ניתן לאחסן ב-80 ° c מקפיאים לאחסון ארוך, או ב 4 ° c אם נעשה שימוש בתוך 2 שבועות.
  4. הגדרה וקטורית של AAV5 ויראלית
    1. קביעת AAV5 סיכוייו באמצעות שרשרת התגובה הכמותית כמותית (qpcr) עם התחל של רצף חוזר מסוף הפוך (itr) ו 5 ́FAM/3 ́BHQ1 הבדיקה עבור רצף itr (טבלת חומרים). השתמש בעקומה רגילה שהושגה עם כמויות ידועות של ITR המכילות פלסמיד. כל וקטור aav צריך להיות מגוון של 1e+ 14 – 1e+ 15 עותקי הגנום עבור מיליליטר אם רצף itr משמש לקביעת סיכוייו.
      הערה: ייצור וירוס מוצלח AAV5 נותן מניות עם מגדל בטווח המינימלי של 3e+ 13 -7e+ 13 יחידות/mL.

2. הזרקת גורמי תיכנות מראש למוח

  1. הגדרת בעלי חיים, השמה וקידוח סטריאוטקאית
    הערהפרוטוקול זה מתמקד בשימוש ב-Ascl1, Lmx1a ו-Nurr1 (מו) עבור התיכנות מראש של NG2 glia לתוך האינטרנוירונים. בניסיון שלנו, האינטרנוירונים של פנוטיפ דומה ניתן להשיג באמצעות שילובים גורמים אחרים11.
    1. לפני הניתוח, להכין את התמהיל הנגיפי המכיל את וקטורים Cba-FLEX-Ascl1, Cba-FLEX-Lmx1a, Cba-FLEX-Nurr1 ואת העיתונאי וקטור Syn-FLEX-GFP. הוסף כל אחד המניות שהוכנו בסעיף 1 לתמהיל הסופי, כך הפתרון הנגיפי הסופי יש 5% של כל אחד הגורמים מתכנות משנה (Ascl1, Lmx1a ו Nurr1) ו-10% של העיתונאי לבנות (5% A, 5% L, 5% N ו 10% GFP).
      הערה: התערובות AAV5 וקטוריות ניתן לאחסן ב 4 ° צ' ונשמר לשימוש עתידי בvivo.
    2. הרדים העכבר באמצעות 2% isofלוריאן בתערובת של תחמוצת האוויר והחנקן (N2O) ביחס 4:1. עקוב אחר נשימתו של בעל החיים על ידי התבוננות בתנועות הסרעפת. במהלך הניתוח, לשמור על הרדמה באמצעות 1 – 1.5% isofלוריאן.
      הערה: מודל העכבר המתואר בזאת מורכב מאמץ העכבר כי במיוחד מבטאת את היצור ב NG2 glia. ב vivo מחדש ניתן להשיג באמצעות זנים עכבר שונים המבטאים את היצורים באוכלוסיות אחרות של התאים גליה (למשל, אסטרוציטים14).
    3. לאחר שהחיה מורדם לחלוטין (למשל, הרפיה שרירים מלאה ואין תגובה לצביטה במשטח הרגל), לגלח את האזור סביב האתר החתך ולהביא את החיה למסגרת סטריאוטקאית.
    4. כדי לשמור על טמפרטורת הגוף של החיה במהלך הניתוח, הצמד משטח חימום לבסיס המסגרת הסטריאוטקאית. הניחו את העכבר על מגבת נייר נקיה ויבשה.
    5. הניחו את ראשו של העכבר בזהירות על פסי האוזן. אם מניחים נכון, אין להקפיד על תנועה לרוחב של הראש. הגדר את פס האוזן השמאלי ל-4 מ"מ, לפני תחילת הצבת העכבר במסגרת הסטריאוטקאית.
    6. אבטח את פס השן במקומו ולאחר מכן הדק את סרגל האף. ודא שהראש אינו זז בממד כלשהו ומצביע ישר קדימה (קו האמצע מאונך למישור פסי האוזן). החלת משחה אופטלמולוגית להגנה על העיניים.
    7. לפני תחילת הניתוח, לנהל את כאבים המתאים (למשל, 0.05 mg/ק"ג של בופרינורפין, תת עורית).
    8. נקו את אזור החתך עם גזה כותנה או ניגוב ספוגה עם 70% אטוח, מבלי להתקרב לאזור העין.
      הערה: עבור הזרקה גרם נגיפית, מזרק 5 או 10 מ"ל מותאם עם נימי זכוכית משכה משמש. נימים זכוכית משכו באמצעות פולר מיקרופיפטה, והתוצאה היא נימי עם טיפ דק מאוד, אשר יצמצם את התהליך הפולשני של ההליך. כדי להתאים את הנימים לתוך המזרק, השתמש בחתיכת אבובים גומי על הקשר שבין מחט המזרק לנימי הזכוכית וממיסים אותו באמצעות מקור חום (למשל, מצית). חיבור הדוק בין שני החלקים יוודא שאין דליפות נוזלים במהלך ההזרקה. לפני תחילת הניתוח, לבדוק את זה על ידי מילוי המזרק עם תמיסת מלח ודוחף את הנוזל מתוך המזרק.
    9. לעשות חתך של כ 0.5-0.8 ס מ לאורך קו האמצע של הראש. חותכים את שתי השכבות העורית. והתת עורית עם אזמל
    10. הרחב את מדפים העור בכל צד של החתך. לנקות את החתך של דם ולגרד בחזרה את השכבות התת עורית עם ניצן כותנה.
    11. הזז את הזרוע M/L-D/V של המסגרת הסטריאוטקאית למקומה (מעל לבעל החיים) ואבטח אותה.
      הערה: המסגרת הסטריאוטקאית מאפשרת התאמת המזרק לאורך הקדמי/האחורי (A/P, ציר Y), המדיאלי/לרוחב (M/L, X) וציר מתקדם (D/V, ציר Z).
    12. הזיזו את המזרק לאורך הציר האחר של מסגרת הסטריאוטקאית, כדי להביא את קצהו של נימי הזכוכית שמעל לברגמה (נקודת המפגש שבה נפגשים לוחיות הגולגולת השונות).
    13. ודא שעצת הקפילר ישרה באופן מושלם הן במטוסי A/P והן במטוסים של M/L. במקרה של בלימה רב-משמעית, קחו את הממוצע של התפרים לרוחב ולקו האמצע.
    14. כאשר קצה הקפילר ממוקם כראוי מעל לברגמה, יש לאפס את ערכי M/L ו-A/P ל-0.0 במונה הקואורדינטות הדיגיטליות.
    15. כדי לוודא שראשו של בעל החיים נמצא במצב שטוח לחלוטין, השתמש במונה הקואורדינטות הדיגיטליות כדי למדוד את ערך הקואורדינטות D/V, כאשר הזרוע A/P היא ב + 2.0 ו-2.0 (M/L = 0.0), כמו גם כאשר הזרוע M/L היא ב + 2.0 ו-2.0 (A/P = 0.0 התאימו את הגובה של סרגל השן ופסי האוזן בהתאם.
    16. הזיזו את המזרק לנקודות הציון הרצויות להזרקה של וקטורים ויראליות בסטריאטום (A/P = + 1.0; M/L =-2.0, ביחס לברגמה).
    17. הרם את המזרק מעט, על ידי התבוננות באתר ההזרקה דרך המיקרוסקופ, קדוח חור באמצעות מקדחה שיניים בקואורדינטות ההזרקה. התחל לקדוח באתר, עבודה באופן מעגלי ועדין.
      הערה: לא לשים יותר מדי לחץ כלפי מטה, כמו המקדחה צריך להיות חד מספיק כדי לעבור את העצם ללא כוח נוסף. להימנע ארוך, קידוח מתמשך כמו זה יוצר חום.
    18. בסוף הקידוח, בדוק כי מאטר הדורא נשאר שלם ונחשף להזרקה.
  2. הכנת מזרק
    1. מניחים פיסת כותנה על החתך הפתוח לשטוף את המזרק עם תמיסת מלח.
    2. לאחר השטיפה, לקחת את בועת האוויר של 1 – 2 μL, ואחריו 1 μL של פתרון המכיל את וקטורים ויראלי, הימנעות כל בועות בשוגג. ודא כי הפתרון הנגיפי יכול בקלות להיות דמיינו מתחת לבועה האוויר, תוך הזרקת.
  3. זריקה נגיפית
    1. הסר את גזה כותנה מעבר לאתר החתך, והנמך את המזרק באמצעות הזרוע D/V של מסגרת סטריאוטקאית. כאשר המשטח של הגולגולת הוא ניגש, בזהירות להסתכל דרך המיקרוסקופ ולמדוד את הרמה D/V של דורא מאטר-זה צריך לבליטה מעט תחת לחץ עדין.
    2. בעת נגיעה בקרום הדורא עם קצה הקפילר, קבעו את קואורדינטת ה-D/V ל-0.0.
    3. הנמך את המזרק, מתקדם לאט לעומק הרצוי (D/V =-2.7, ביחס לדורא מאטר). ודא כי המסלול הוא ברור של שברי העצם, כך לא כיפוף של המחט/נימי הוא נצפתה.
      הערה: הקואורדינטות המוצגות מתייחסות להזרקה של הגורמים המשתנים מראש לתוך הסטריאטום של עכברים NG2-יצורים. ניתן להשתמש בקואורדינטות המתאימות לאזורי מוח אחרים. תמיד לבדוק את נקודות הציון עבור הזרקה תחילה באמצעות צבע (למשל טריבין כחול), הזרקת חרוז צבעוני או כתבת וקטור נגיפי לפני הזרקה של גורמים מחדש למוח של זן העכבר החדש. במקרה של הזרקת טרילון כחול, יש להקריב את החיות מיד לאחר הניתוח ולגזור את המוח. מוחות טריים ניתן לגזור באמצעות מיקרוטומה, בעוד קפוא, ואת האתר של הזרקה נקבע על ידי ויזואליזציה של מיקום הצבע במוח. אם בדיקת קואורדינטות באמצעות חרוזים צבעוניים, ניתן לקבוע את האתר של הזרקה על מעשה ולחתוך את המוח שבוע לאחר ההזרקה. לחילופין, זריקה עם וקטור ויראלי נושאת גן עיתונאי ניתן להשתמש, ואת האתר של הזרקה נקבע במוח חתך מוכן.
    4. הכנס 1 μL של הפתרון הנגיפי בקצב של 0.4 μL/min. כאשר אמצעי האחסון כולו מוזרק, אפשר תקופת דיפוזיה של 2 דקות לפני נסיגת המזרק.
    5. לאחר הדיפוזיה, הורידו לאט את המזרק עד שקצה הקפילר מחוץ למוח.
    6. מניחים פיסת כותנה על הפצע ומרוקן את המזרק בתמיסה מלוחים.
    7. הזז את הזרוע M/L-D/V של המסגרת הסטריאוטקלית מתוך אזור העבודה.
  4. סגירת פצעים והליכים שלאחר הניתוח
    1. תפר בזהירות את החתך באמצעות חוט תפר.
      הערה: כל הליכי תפר המשמשים בעלי חיים מוזרק צריך להיות מושלך בספל/בקבוקון המכיל תמיסת כביסה אנטי ויראלית. אותו פתרון משמש כדי לנקות את כל המשטחים המקיפים את אזור הניתוח כי היו במגע עם חומרים כירורגיים. כל כלי הניתוח נשטפים ביסודיות ובאופן אוטומטי בתום כל יום ניתוח.
    2. הסירו את בעל החיים מהמסגרת הסטריאוטקאית והניחו אותו בתחנה שלאחר הניתוח, הכוללת כלוב נקי ומחומם, גישה למזון ולמים, והיכן שהחיה נשארת עד הערה מלאה. במהלך תקופה זו, נטר את בעל החיים מקרוב עד שתודעה תוחזר.
    3. אין לבית בעלי חיים מופעלים עם בעלי חיים לא מופעלים עד שהראשון התאושש מהניתוח.
    4. מפקחים על בעלי חיים מופעלים מדי יום. בהתאם לתפרים בשימוש, לוודא שהם יוסרו במידת הצורך. כל בעלי החיים ניתנו בבופנאורנום (טמגסיק ב-1ml/ק"ג) תת-עורי כטיפול מבצעי.
      הערה: אם ההפעלה באמצעות אותו מזרק בשני ימים רצופים, לשטוף אותו עם מים, ואחריו אתנול 70% ומים שוב. השאירו את המזרק מלא מים ללילה, כדי לאפשר פירוק של שאריות אפשריים.

3. הקלטות אלקטרופיזיולוגיות

  1. הכנה לרקמות אלקטרופיזיולוגיה של הרקמה
    זהירות: כדי להשיג הקלטות. אלקטרופיזיולוגיות טובות הכינו את החדר בזהירות והניחו כלים לפרזיה ולניתוח על הקרח.
    1. הכינו קרח קר, חמצן (95% O2 ו 5% CO2) פתרון krebs עבור perfusion, חיתוך וגזירה (להכין את זה באותו יום מהמלאי 10x ידי דילול הפתרון במניה במים באולטרטהורים והוספת נחקו3 ו גלוקוז). הרכיבים בתמיסה Krebs ב mM (לאחר דילול ל -1 x) הם: 126 היום, 2.5 KCl, 1.2 נה2PO4· H2o, 1.3 MgCl2· 6h2o, ו 2.4 cacl2· 6h2o, 22 נחקו3, 10 גלוקוז. כוונן את ה-pH של הפתרון ל-7.4.
    2. ביצוע כיול (ויברצ) לקבלת הרטט עם להב תער חדש.
    3. להתחיל את בלוק הקירור של הרטט (או למלא את החדר המקיף עם קרח), למלא את חדר החיתוך עם פתרון Krebs עבור חמצון עם 95% O2 ו 5% CO2 לפחות 30 דקות לפני השימוש.
    4. הניחו צלחת פטרי על הקרח ומלאו אותו בתמיסת קרבס מחמצן. הניחו את הלהב, המספריים והצלחת ההרכבה על הקרח.
      זהירות: הביאו את הכלוב המכיל את העכבר לחדר לפחות 1 שעות לפני תחילת הליך ההסתגלות. למתח יש השפעה שלילית על מצבם של רקמות המוח.
    5. באמצעות הזרקת מנת יתר של פנטוברביטל. ותן לחיה להירדם  כאשר רפלקס המצמוץ הוא מחוץ ובעלי חיים לא מגיבים לגירויים כאבים, מבשם החיה עם פתרון קרבס קר הקרח עבור 2-3 דקות (בקצב של 10-20 mL/min).
    6. במהירות, אבל בזהירות, לנתח את המוח ולשים אותו הפוך בצלוחית פטרי כי הוא ממוקם על הקרח (המכיל פתרון Krebs).
      הערה: על מנת להשוות את ההבשלה התפקודית של הנוירונים המתוכנת מחדש, להקריב את החיות עבור הקלטות בזמן שונה הזרקה שלאחר ויראלי. להעריך את מאפייני הירי של סוגי הנוירונים ברורים בהתבסס על הספרות הקיימת15 .
    7. להפוך לחתוך ילתית לאורך המוח החלק האמצע ודבק בצד זה על הצלחת ההרכבה (גם קרח קר) עבור חיתוך הרטט.
    8. טבול את המוח מודבק בזהירות לתוך התא מאגר ב הרטט.
      זהירות: היזהרו לא לגעת להב תער למען ביטחונכם, כך הלהב יישאר מכויל.
    9. חותכים מהחלק הrostral ביותר של המוח עד לרמת הסטריאטאל במהירות גבוהה. ואז לחתוך את הסטריאטום ב 275 מ"מ במהירות איטית (0.10 מ"מ/s).
    10. לאחר כל חתך, הסירו בזהירות את הרקמה שאינה מוזרקת בצד (למשל, עם מחט מודגש) ולהעביר את הצד המוזרק לתוך בקבוקון אחר באמבט מים, המכיל רשת תחתונה (קרבס מחמצן ב RT) ממוקם באמבט מים. שמור את זה ב-RT עד שכל המקטעים יחתכו.
    11. מגבירים באיטיות את טמפרטורת המים עד 37 ° c ומשאירים אותה למשך 30 דקות. ואז לכבות את החימום ולתת להתקרר עד RT.
      הערה: בשלב זה, תוכל להשהות את ההשהיה עד שתתחיל בהקלטה. הסעיפים האחרונים עבור 4-6 h.
  2. הקלטות קלאמפ לתאים שלמים
    1. העבר את חתך הרקמה הראשון לתא ההקלטה שקוע בזרימה רציפה של פתרון קרבס. הר את המקטע באמצעות משקולות אור להטביע את המטרה.
    2. לזהות את האזור סטריאטאטאל במיקרוסקופ ולחפש הנוירונים GFP-חיוביים (מתוכנת העצב). בחר תא עצב נרחב במבנה מורפולוגיה ולא מכוסה על ידי צרורות סיבים או כלי דם.
    3. הכנת פיפטות זכוכית בורוסיליקט (3 – 7 MΩ) עבור תיקון ומילוי עם הפתרון הבאים תאיים (ב mM): 122.5 האשלגן, 12.5 KCl, 0.2 EGTA, 10 HEPES, 2 MgATP, 0.3 Na3gtp ו-8 הנאל, מותאם ל-pH 7.3 עם KOH.
    4. למילוי ביוציטוטין, הוסיפו 1 מ ג של מלח ביוציטוטין ל-1 מ ל של פתרון פנימי ומערבולת.
      זהירות: הקפד לסנן את הפתרון הפנימי עם biocytin כמו זה יכול אחרת לסתום את האלקטרודה.
    5. חברו את הצנרת זכוכית לאלקטרודות ההקלטה וטבול לתוך הפתרון. . בדקו פעמיים את ההתנגדות של האלקטרודה ואז לאט להתקרב לתא עם הפיפטה, שמירה על לחץ חיובי קל באלקטרודה כדי להימנע מחיבור הקצה.
      זהירות: היזהרו לעקוב אחר התא שלך תוך ירידה האלקטרודה ולא להלבין את הזריחה בתא (כלומר, לכבות את מנורת הזריחה כאשר אתה לא צריך את זה).
    6. לשטוף את הרקמה המקיפה בזהירות באמצעות לחץ חיובי של האלקטרודה וגישה לתא עם האלקטרודה. לאתר את האלקטרודה ימינה על גבי התא ולרדת עד האלקטרודה touchd הקרום. הפוך Giga-Ω חותם בין האלקטרודה ואת קרום התא, עם פולסים בלחץ שלילי, קרע את הקרום כדי ליצור תיקון של תא שלם.
      זהירות: . הנוירונים מתכנתו הם רגישים להיזהר כאשר תיקון לא לשים לחץ שלילי יותר מדי בעת הגעה Giga-Ω חותם או לפתוח את קרום התא. כמו כן, תיקון על בעלי חיים מבוגרים דורש תרגול וסבלנות כמו רקמת החיבור שלהם הוא עבה יותר, קשה יותר לדמיין את הנוירונים.
    7. בדוק את הפוטנציאל ממברנה מנוחה מיד לאחר פריצה במצב הצבת הנוכחי ולכתוב למטה לניתוח.
    8. ב מהדק הנוכחי, לשמור על התא בין-60 mV ל-80 mV ו להזריק 500 ms הזרמים מ-20 pA כדי + 90 pA, עם 10 במרווחים של הרשות לגרום לפוטנציאל פעולה.
    9. העברה לתוך מתח מהדק ולמדוד את הנתרן פנימה מתעכב זרמים אשלגן לתקן בשלבים של 10 mV.
      הערה: מתח הקלטות מהדק מוערך טוב יותר באמצעות פתרון פנימי שונה, מורכב של כימיקלים ביעילות רבה יותר להדק את קרום. עם זאת, עבור נוירונים מתוכנת משנה, מספר התאים שאתה יכול להקליט הוא כמה ומספר מקטעי רקמות עם הנוירונים האלה הוא מוגבל. מכאן, זה יתרון להקליט הן מלחציים הנוכחי, מהדק מתח מאותו תא.
    10. במצב מהדק מתח, הקלטת פעילות הפוסטסינפטית ספונטנית ב-70 mV. הבחנה בין אירועי הפוסטסינפטיות מעכבות בפוטנציאל ממברנה של 0 mV מאירועים מסוימים ב-70 mV.
    11. לאחר שהגיע לקו הבסיס היציב, להוסיף Picrotoxin, אתהאדם האחרון היריב הקולטן, לפתרון krebs הזורם לתוך חדר ההקלטה, כדי לחלץ אירועים מרגש (להוסיף פתרון מניות של picrotoxin לריכוז הסופי של 50 mM בנפרד מזרק מאגר המחובר לפרזיה קאמרית. חבר את הזרימה החוצץ מהתא לשקית ואקום לסילוק בטוח).
    12. לאחר 20 דקות, להוסיף CNQX (20 מ"מ), היריב אמפא, אל הפתרון Krebs הזורם לתוך חדר ההקלטה, כדי לחסום את אירועי העכבות (באמצעות אותו הליך כמו Picrotoxin). להשאיר בתוך 20 דקות נוספות ולאחר מכן לשטוף עם פתרון Krebs. . תסיר את מחלק הרקמה מהתא
    13. לאחר לסיים את ההקלטות, לעשות ניתוח מקוון של זרמים בלתי מקוונים התגובה ספונטנית (EPSC) ו מעכבות זרמים פוסט סינפטית (IPSC) באמצעות זיהוי האירוע סף (> 5 הרשות) בתוכנית הניתוח.
    14. במהלך כל ההקלטה, התא יתמלא באיטיות בתמיסה הפנימית המכילה את הביולוציטין. שמור את התיקון לפחות 20 דקות לפני הסרת האלקטרודות באיטיות כדי להשיג מילוי מלא של התא.
      זהירות: להיזהר לא לקבל כל לחץ חיובי באלקטרודה שיכול להרוס את הניתוח מורפולוגית עוקבים של התאים לאחר מכן.
    15. עבור ביוציטוטין-ויזואליזציה, הניחו את מקטע הרקמה ב-4% פאראפורמלדהיד (כדור בסיס) ב -4 ° c. לשטוף את המקטע 0.02 M אשלגן פוספט מאגר (KPBS) עם 0.1% טריטון. לאחר מכן, כתם עבור streptavidin-Cy3 (1:600 ב KPBS-T, 2 h), לזיהוי של התא ממולא בביוציטוטין והדמיה מורפולוגית של תא העצב מתוכנת.
      הערה: ניתן להשתמש במילוי ביולוציטין לניתוח מורפולוגי ואיורים של הנוירונים הטלוציטים.

4. אימונוהיסטוכימיה, סטריאולוגיה וקוונפיקציה

הערה: להקדיש קבוצה מסוימת של עכברים עבור אימונוהיסטוכימיה, כמו מקטעי רקמות המשמשות אלקטרופיזיולוגיה אינם אופטימליים עבור אימונוהיסטוכימיה.

  1. עכברים הרדים עם הזרקת כיתה של מנת יתר של פנטוברביטל ו הר החיה עבור perfusion.
  2. מבשם העכברים, תחילה עם פתרון תמיסת מלח כדי להסיר דם, ולאחר מכן עם קרח קר 4% בארה.
  3. לנתח את המוח ולאחר תיקון עבור לפחות 12 h ב 4% בכיוון הכלייתי.
  4. שים את המוח בתוך 25% בתמיסה (לקריוציט) במשך כ -12 שעות.
    הערה: המוח מוכן להיות חתוך כאשר הם לשקוע ב 25% הפתרון סוכרוז, המציין כי הסוכות חדרה למוח העכבר כולו.
  5. לעשות חתך הפוך על פני המוח הזעירה, להשתמש שטוח, החלק השכיח ביותר של המוח כדי למקם את המוח על מיקרוטומה ולתקן אותו במקום באמצעות מתחם בטמפרטורת חיתוך אופטימלית (OCT).
  6. חותכים את המוח לפרוסות ילתית עם עובי של 35 מ"מ ולחלק את המוח לסדרה עוקבת ממוקם בבקבוקונים או בארות המכילים 0.02 M kpbs.
  7. לעבד את הסעיפים עבור אימונוהיסטוכימיה באמצעות נוגדנים נגד gfp סמנים הביננוירונים כגון GAD65/67, PV, צ'אט (כולין acetyltransferase) ו npy (נוירופפטיד Y), על פי פרוטוקולים סטנדרטיים16, 17.
    הערה: ניתן לשמור פרוסות מוח ב-4 ° c או 20 ° c בפתרון אנטי-הקפאה לתקופות ארוכות.
  8. לאחר הצביעת הושלמה, הר את הסעיפים על שקופית זכוכית ולכסות עם שמיכות זכוכית, באמצעות פתרון הרכבה כדי לתקן את זה במקום. תשאיר את הכיסויים מחליק. כדי להתייבש הלילה
    הערה: ללימודים שלנו, שכל המוחות חותכים ב 1:8 סדרות (כלומר, כל בקבוקון המכיל סעיפים יחזיק שמינית של מוח העכבר11).
  9. לנתח את הסעיפים באמצעות זריחה הפוכה ו/או מיקרוסקופ קונפוקלית וקד.
    זהירות: מיקרוסקופ פלורסנט שימושי עבור סקירה כללית של תוצאות ולכידת תמונות לחישוב יעילות תכנות מחודש. לניתוח מפורט יותר של זהות פנוטימית על-ידי התבוננות בתאים כפולים חיוביים, יש להשתמש בדימות ממוקד.
  10. עבור כימות של סמנים שונים ביטא GFP+ נוירונים בסטריאטום, לספור את מספר התאים החיוביים כפול ביחס למספר הכולל של התאים gfp (כלומר, הנוירונים מתוכנת מחדש), לפחות שני שדות של כל . מחלקת הסטריאטאל
  11. לקביעת המספר הכולל משוער של נוירונים מתוכנת מתכנתו למוח, לספור את gfp בנוירונים בהווה בסטריאטום של אחת סדרת המוח לחתוך מוקדם יותר, ולאחר מכן להכפיל על ידי המספר הכולל של סדרה.
    הערה: שיטות שונות של כימות ניתן להשתמש כדי לבטא יעילות מחדש, מספר נוירונים מתוכנת לבעלי חיים ואחוז של נוירונים כי לבטא סמנים פנוטימית מסוימים. לקבלת מידע נוסף, עיין בפרסום הקודם11.
  12. לנתח את ההבדלים בין התנאים באמצעות גרף Pad מנסרה או דומה.
    הערה: לחישוב יעילות, הזרקנו עכברים NG2-יצור עם הוקטורים תלויי-המרה בעלי הקשר וכתבת ה-gfp. כדי להעריך את יעילות ההמרה, אנחנו גם מזריקים בעלי חיים עם GFP תלויי-יצור מתחת לכל מקום, עיבוד כל התאים המיועדים GFP+. באמצעות השוואה זו, הערכנו כי 66.81% ± 38.38% של תאים ייעודיים הומרו לנוירונים. עבור אימות של ביטוי של כל אחד הגנים, משלימים כפולים המשלים כתמים מכתים ניתן לבצע עבור GFP/Ascl1, GFP/Lmx1a ו-GFP/Nurr1. בנוסף, רצף הגנום כגון רצפי RNA תא בודד יכול לחשוף את נוכחותו של כל אחד הגנים בתאים שניתן לתיכנתו.

Representative Results

ההזרקה של וקטורים AAV משמש בהצלחה תכנות מחודש NG2 glia התאים לתוך נוירונים בתוך NG2-העכבר סטריאטום (איור 1A). כדי במיוחד היעד NG2 glia, FLEX וקטורים עם התכנות מתיכנות/כתבת גנים, מוכנסים לכיוון antisense ומוקף על ידי שני זוגות של מקבילים, הטרוטיפקס אתרים loxP (איור 1B). כל אחד משלושת הגנים מתיכנות מראש (Ascl1, Lmx1a ו Nurr1) ממוקם תחת השליטה של היזם לונים בכל מקום על וקטורים בודדים. על מנת להבטיח ביטוי GFP מוגבל הנוירונים מתוכנת מראש ממקור התא ביטוי, GFP הוא ממוקם תחת השליטה של תא העצב-סינפסין יזם ספציפי, (גם וקטור FLEX).

השימוש בשילוב של התכנות מראש ובנייה עיתונאי מאפשר את הדור של נוירונים GFP-חיוביים בסטריאטום העכבר (איור 1C, C '). השימוש של העיתונאי לבנות ללא נוכחות של גנים מתיכנות מראש לא להניב נוירונים GFP-חיוביים (איור 1D).

הנוירונים שאינם מתוכנת על-ידי הביוציטוטין מתמלאים לאחר שלאחר המוות מכתימה (איור 2 א). אם ההמרה תצליח, צריכה להיות. מורפולוגיה נרחבת במבנה העצבי ההקלטות האלקטרופיזיולוגיות של הנוירונים מתוכנת להראות נוכחות של קשרים פונקציונליים פוסט-סינפטית עם צעדי פעילות ספונטנית (איור 2B, C). זה יכול להיות חסום עם GABAergic גאבה או glutamatergic חוסם (Picrotoxin או CNQX), מציע הן מרגש ומעכבות קלט סינפטית לנוירונים מתוכנת. התרחשות של פעילות ספונטנית עולה עם הזרקת הזמן ויראלי הזרקה (איור 2D), המציין התבגרות הדרגתית.

פוטנציאל הפעולה המושרה קיים בנוירונים פונקציונליים. פוטנציאל הפעולה יגדל במספר לאורך זמן לאחר ההמרה (איור 2E). זה מעיד על התבגרות. בתפקוד עצבי בתוך תא עצב בלתי מפותח, הזרם יגרום ליותר או לא מעט מאוד פוטנציאל פעולה (איור 2F).

דפוסי הירי של תא העצב הוא סוג תא ספציפי כפי שהוא תלוי בגורמים כגון המבנה של התאים וביטוי הערוץ15. את דפוסי מוקלט ב vivo הנוירונים הניתנים לדפוס ניתן להבדיל לקבוצות ולעומת זה של תת-סוגי נוירוגניים עצביים, למשל מהיר המבהנוירונים (תא סוג B, איור 3B) או סוגי תאים אחרים (איור 3b, C, D ). הבדלים אלקטרופיסיולוגיים שנצפו ניתן לאשר על ידי נוכחות של סמנים ספציפיים לסוג וביטוי משותף עם GFP (איור 3E-H). בסך הכל, מידע זה מציין כי הנוירונים המתוכנת מחדש המצויים בסטריאטום יש תכונות של סוגים שונים של אינטרנוירונים, כגון Parvalbumin-, צ'אט-ו-NPY-ביטוי interneurons, כמו גם שלאטאת זהות תא העצב המדיום קוצני (DARPP32 +) ( איור 3E -H).

Figure 1
איור 1: ב vivo תכנות של תושב NG2 glia לתוך נוירונים. (A) ייצוג סכמטי של וירוס aav בתיווך בvivo תכנות מחודש של סטריאטNG2 glia. (ב) ייצוג סכימטי של AAV5 FLEX בנייה המשמשים בvivo תכנות, שבו ביטוי הגנים מוסדר על ידי ביטוי היצור בתאי ממוקדות. (C ו- c) בvivo הנוירונים שעברו תוכנת העצב, כתוצאה מ-Syn-gfp + הזרקה לתוך הסטריאטום. (ד) העדר נוירונים מתוכנת תכנות כאשר לא מוסיפים לתוך הקוקטייל הנגיפי, ורק מבנה העיתונאי מוזרק בvivo. סולם ברים = 100 מ"מ (C), 25 מ"מ (ג), 25 מ"מ (ד). אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 2
איור 2: ב vivo מתוכנת נוירונים הם פונקציונליים ולהראות התבגרות לאורך זמן. (א) מראה מורפולוגיה עצבית בוגרת, כולל שיוט דנדריטי. רשמים מראה (ב) פעילות מעכבות (GABAergic) כי הוא נחסם עם PICROTOXIN, נגבההיריב קולטן (ג) פעילות מרגש נחסם עם CNQX, היריב קולטן אמפא. (ד) מספר הנוירונים עם הפעילות הפוסט-סינפטית גדל לאורך זמן. (ה) נוירונים שתוקנו להראות ירי חוזרות כבר ב 5 שבועות לאחר ההזרקה (w.p.i.) ולהמשיך להראות כי ב 8 ו 12 W.p.i. (F) המושרה התוצאה פעולה פוטנציאל ו-postsynaptic של תא עצב בוגר, מראה מעטים הסינפטיות אירועים ובעלי פוטנציאל פעולה מועטים בהשוואה ל-B ו-D בסרגל קנה מידה = 25 מ"מ לחץ כאן כדי לצפות בגירסה גדולה יותר של איור זה.

Figure 3
איור 3: ב Vivo הנוירונים מתוכנת להראות אימונוהיסטוכימיה ו אלקטרופיזיולוגיה תכונות של סטריאטאל interneurons. (A-D) דפוסי ירי של vivo מתוכנת הנוירונים יכול להיות מסוגים שונים: (א) סוג דומה לעצב בינוני אנסוגני קוצני (DARPP32 +); (ב) דומה מהיר העולה (PV +) interneurons; (ג) בדומה להנוירונים בולטים בעלי הסף הנמוך (npy +); (ד) נוירונים יורים עם היפרפולריזציה גדולה (צ'אט +). (E-ח) תמונות confocal וקד מראה שיתוף לוקליזציה של GFP ו-סמנים הביננוירונים PV (E), צ'אט (F), npy (G), ו תא ההקרנה סמן DARPP32 (H). כל ברים בקנה מידה = 50 מ"מ. לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Discussion

ב vivo ישיר מתיכנות ניתן להשיג באמצעות וקטורים FLEX AAV ביצור-המבטא זנים של העכבר. חשוב לציין כי הבדלים בין זני העכבר לגבי יעילות תכנות משנה נצפו. עבור ב vivo מתיכנות משני בסטריאטום, קו העכבר NG2-יצורים הוכיחה להיות יעיל יותר בהשוואה זנים אחרים. לפני שמתחילים להשתמש זן חדש של בעלי חיים, חשוב לבדוק את הקווים המנחים של ספק העכבר לגבי ביטוי היצור לאורך זמן, כמו גיל של בעלי חיים לעיתים קרובות משפיע על הספציפיות של הביטוי הזה חלבון. במחקרים שלנו, בעלי חיים שגילם עולה על 12 שבועות לא שימשו בvivo תכנות כפי שהיה סיכון לביטוי היצור בתאים שאינם NG2 glia. הנוכחות הקבועה וניטור של בעלי חיים בקרה מוזרק רק עם סינפסין-FLEX-GFP המבנה מומלץ. זה מאפשר ניטור של בעלי החיים עבור תאים GFP-חיוביים כי לא צריך להיות נוכח אם אין גנים מתיכנות מראש (מאשר) משמשים.

כדי לזהות את הנוירונים החדשים שעוצבו מחדש, שיטת זיהוי ספציפית לנוירונים, כמו זו המתוארת בפרוטוקול זה, היא בעלת חשיבות עליונה. זה מאפשר זיהוי והבחנה נכונה של הנוירונים מתוכנת התכנות מתוך התאים האנדוגניים המקיפים כי הוא מאוד רלוונטיות כאשר תכנות מחודש באזור הומונושא.

חשוב גם למקד את המבנה הנכון עבור הזרקה ויראלי. לכן, הניתוח הסטרטקאני להזרקה ויראלי חשוב וצריך להתקרב אליו בדיוק, במיוחד כאשר מסמנים את המבנים הקטנים יותר של המוח.

בעבר הצגנו11 כי זה לא אמין כדי לחזות את התוצאה של vivo תכנות מבוסס על ניסויים באמצעות התכנות מחוץ גופית באמצעות אותם גורמים תכנות משנה. לכן יש לבחון את כל גורמי העניין בvivo. בידינו, שילובים רבים גורמים שונים לתת את אותו סוג של נוירונים (כלומר, interneurons11 ב vivo) למרות העובדה כי גנים אלה היו מעורבים בפיתוח של נוירונים אחרים.

כל תא מהדק תיקון עבור נוירונים מתוכנת מתכנתו היא טכניקה עדינה עיבוד רקמות חשוב לתוצאה טובה. Perfusion עם פתרון קרבס קר משפר את איכות הרקמה. גם, נוירונים שתוקנה צריך להיות מטופלים בזהירות. גם אם התבגרות וזהות פנוטימית של נוירונים מתוכנת שניתן להעריך במידת מה באמצעות מהדק טלאי תא שלם, תאים אלה אינם מקבילים באופן מלא לעמיתיהם האנדוגניים שלהם. סוגים נוספים של ניתוח, כגון רצף הגנום (למשל, רצפי RNA) יש להשתמש כדי לאשר עוד זהות תא מתוכנת.

הטכניקה המתוארת במסמך זה יכולה להיחשב לפיתוח טיפולים עתידיים שבהם נדרש תחליף עצבי במוח. למרות שvivo תכנות עדיין בשלבים המוקדמים שלה ואת התרגום לבני אדם עדיין לא מראש, טכניקה זו יכולה לספק שיטה כדי להעריך את התפקוד הגנטי האקסוגני במוח וללמוד תא התבגרות בvivo.

Disclosures

. למחברים אין מה לגלות

Acknowledgments

מרקלה בירטלה ממומנת על ידי האיחוד האירופי אופק 2020 תוכנית (H2020-MSCA-ITN-2015) תחת מארי Skłodowska-קירי רשתות הדרכה חדשנית וגרנט הסכם מס ' 676408. דניאלה רילנדר אוטקסון ממומנת על ידי מועצת המחקר השבדית (2017-01234).

Materials

Name Company Catalog Number Comments
REAGENTS FOR AAV5 CLONING AND VIRAL VECTOR PREPARATION
pAAV-CA-FLEX AddGene 38042
Ascl1 AddGene 67291 NM_008553.4
Lmx1a AddGene 33013 NM_0033652.5
Nurr1 AddGene 35000 NM_013613.2
GFP-syn AddGene 30456
LoxP (FLEX) sequence 1 GATCTccataacttcgtataaagtatcctatac
gaagttatatcaaaataggaagaccaatgcttc
accatcgacccgaattgccaagcatcaccatcg
acccataacttcgtataatgtatgctatacgaa
gttatactagtcccgggaaggcgaagacgcgga
agaggctctaga
LoxP (FLEX) sequences 2 tactagtataacttcgtataggatactttatac
gaagttatcattgggattcttcctattttgatc
caagcatcaccatcgaccctctagtccacatct
caccatcgacccataacttcgtatagcatacat
tatacgaagttatgtccctcgaagaggttcgaa
ttcgtttaaacGGTACCCTCGAC
pDP5 Plasmid Factory PF435
pDP6 Plasmid Factory PF436
Phosphate-Buffered Saline (PBS) Thermo Fisher Scientific 10010023
FBS (Fetal bovine serum) Thermo Fisher Scientific 10500064
Penicillin streptomycin Thermo Fisher Scientific 15140122
DMEM (Dulbecco's Modified Eagle Medium)+ Glutamax Thermo Fisher Scientific 61965026
DPBS (Dulbecco's Phosphate Buffer Saline) Thermo Fisher Scientific 14190094
HEK293 cells Thermo Fisher Scientific 85120602-1VL
Flasks BD Falcon 10078780 175 cm2
Tris H-CL Sigma Aldrich 10812846001 For TE buffer use 10 mM, pH 8.0; for lysis buffer use 50mM, pH 8.5; for IE buffer use 20 mM, pH 8.0; for elution buffer use 20 mM, pH 8.0
EDTA EDTA: Invitrogen EDTA: AM9260G For TE buffer use 1 mM EDTA
Ultrapure water see Ultrapure water system
CaCl2 SigmaAldrich C5080 2.5 M
Dulbecco´s phosphate-buffered saline (DPBS) Thermo Fisher Scientific 14190136
NaCl Sigma-Aldrich S3014 FOR HBS use 140 mM; for Lysis Buffer use 150 mM; for IE buffer use 15 mM; for elution buffer use 250 mM
MgCl2 Sigma-Aldrich M8266-100G For lysis Buffer: 1 mM
Ultracentrifuge sealing tubes Beckman Coulter Quick-Seal® Polypropylene Tube
OptiPrep™ Density Gradient Medium Sigma Aldrich D1556-250ML
10-mL syringe-18G needle BD 305064
Laboratory glass bottles VWR ?
Anion exchange filter PALL laboratory MSTG25Q6 Acrodisc unit with Mustang Q membrane
Centrifugal filter unit Merck Z740210-24EA Amicon Ultra-4 device
Endotoxin-Free Plasmid DNA Isolation Kits Thermo Fisher Scientific A33073
Na2PO4 Sigma-Aldrich S7907
HEPES Sigma-Aldrich H7523 15 mL
Falcon tube Thermo Fisher Scientific Corning 352196
Falcon tube Thermo Fisher Scientific Corning 352070
Glass Vials Novatech 30209-1232 CGGCCTCAGFGAGCGA
Forward Primer for Inverted Terminal Repeat (ITR) sequence GGAACCCCTAGTGATGGAGTT
Reverse Primer for Inverted Terminal Repeat (ITR) sequence CACTCCCTCTCTGCGCGCTCG
5´FAM / 3´BHQ1 probe Jena Bioscience
0.22 mm filter Merck SLGV004SL Millex-GV filter
EQUIPMENT AAV5 VIRAL VECTOR PREPARATION
Freezer -20 °C
Freezer -80 °C
Fridge +4 °C
AAV viral room
Ultrapure Water system Merck Milli-Q® IQ 7000
Vortex mixer VWR 444-0004
Ultracentrifuge Beckman Coulter Beckman Optima LE-80K Ultracentrifuge
Autoclave Tuttnauer 2540 EL
Polymerase Chain Reaction (PCR) BioRad C1000 Touch Thermal Cycler
Quantitative PCR (qPCR) Roche LightCycler® 480 System
Centrifuge Thermo Fisher Scientific Sorvall ST16
Water Bath Thermo Fisher Scientific TSGP02
ANIMAL MODEL
NG2-Cre mice Jackson NG2-CrexB6129, Stock #008533
REAGENTS FOR INJECTION OF REPROGRAMMING FACTORS INTO THE BRAIN
Water
Saline Apoteket AB 70%
Ethanol Solveco
Isolfurane Apoteket AB Dilute to 1% solution with warm water.
Virkon Viroderm 7511 
Pentobarbital Apoteket AB P0500000 i.p. for terminal procedure at the dose of 60 mg/ml.
Sucrose Merck S0389-500G
Trypan Blu Thermo Fisher Scientific 15250061
Retrobeads Lumafluor R170
Buprenorphine Apoteket AB
EQUIPMENT FOR INJECTION OF REPROGRAMMING FACTORS INTO THE BRAIN From RSG Solingen.
Scissors VWR 233-1552 From Biochem.
Tweezers VWR 232-0007
Forcep VWR 232-0120
Scalpel holder VWR RSGA106.621 Number 20.
Scalpel VWR RSGA106.200
Stereotaxic frame Stoelting Europe 51500D
Mouse ear bars Stoelting Europe 51648 5 ul
Syringe with Removable needle Hamilton Company 65 0,75 inner diameter and 1.5 outer diameter.
Glass capilaries Stoelting 50811
Glass capillary puller Sutter company P-1000
Dental drill Agnthos AB 1464
Shaver Agnthos AB GT420
Isoflurane Chamber and pump Agnthos AB 8323101 2 mL
Syringes Merck Z118400-30EA 25G
Needles Merck Z192414 Aldrich
Mouse and neonatal rat adaptor for stereotaxic fram Stoelting 51625
Heating pad Braintree scientific, inc 53800M From Covidien 2187.
Cotton gauze Fisher Scientific 22-037-902
Rubber tube Elfa Distrelec HFT-A-9.5/4.8 PO-X BK 150
Cotton swabs Fisher Scientific 18-366-473
REAGENTS FOR WHOLE-CELL PATCH CLAMP RECORDINGS
NaCl Sigma-Aldrich S3014
KCl Sigma-Aldrich P9333
NaH2PO4-H2O Sigma-Aldrich S9638
MgCl2-6 H2O Sigma-Aldrich M2670
CaCl2-6 H2O Sigma-Aldrich C8106
MgSO4-7 H2O Sigma-Aldrich 230391
NaHCO3 Sigma-Aldrich S5761
Glucose Sigma-Aldrich G7021 see Ultrapure Water system
Ultrapure Water Prepare 1 or 2M.
KOH Sigma-Aldrich P5958-500G
K-D-gluconate Sigma-Aldrich G4500 Sigma
KCl Sigma-Aldrich P9541
KOH-EGTA (Etilene glycol-bis-N-tetracetic acid) Sigma-Aldrich E3889 Sigma
KOH- Hepes acid (N-2-hydroxyethylpiperazine-N’-2-ethanesulfonic acid) Sigma-Aldrich H7523
NaCl Sigma-Aldrich S3014
Mg2ATP Sigma-Aldrich A9187
Na3GTP Sigma-Aldrich G8877
Biocytin Sigma-Aldrich B4261
Picrotoxin Merck P1675 Sigma
CNQX Merck C239 Sigma
Ice
EQUIPMENT FOR WHOLE-CELL PATCH CLAMP RECORDINGS
Borosilicate glass pipette Sutter Company B150-86-10
Glass capillary puller Sutter company P-1000
Vibratome Leica Leica VT1000 S
WaterBath Thermo Fisher Scientific TSGP02
Clampfit software Molecular Devices
Multiclamp software Molecular Devices
REAGENTS FOR IMMUNOHISTOCHEMISTRY Use at a concentration of 4%. CAUTION: PFA is a potent fixative. Avoid ingestion and contact with skin.
Paraformaldehyde (PFA) Merck Millipore 1040051000 Use at a concentration of 0.1%.
Triton X-100 Fisher Scientific 10254640 Donkey.Use at a concentration of 1 : 400.
Serum Merck Millipore S30-100ML Reconstitute the powder in Milli-Q water to 1 mg/mL. Aliquot and store at -20°C, light sensitive. Use at a concentration of 1 : 500.
4′,6-Diamidino-2′-phenylindole dihydrochloride (DAPI) Sigma Aldrich D9542 1: 600 in KPBS-T.
streptavidin- Cy3 Thermo Fisher Scientific 434315 1:5000, rabbit.
Anti-GAD65/67 Abcam 1:2000, mouse.
Anti-PV Sigma P3088 1:200, goat.
Anti-Chat Merk AB143 1:5000, rabbit.
Anti-NPY Immunostar 22940
K2HPO4 Sigma-Aldrich P3786
NaCl Sigma-Aldrich S3014
KH2PO4 Sigma-Aldrich NIST200B 1:1000, chicken.
Anti-GFP Abcam ab13970
Mounting solution Merck 10981 Polyvinyl alcohol mounting medium with DABCO®, antifading
OCT Agar Scientific
Glycerol Sigma-Aldrich G9012-100ML
Distilled water
Anti-freeze solution Tissue Pro Technology AFS05-1000N, 1000 mL/ea.
EQUIPMENT FOR IMMUNOHISTOCHEMISTRY
Inverted fluorescence microscope Leica DMI6000 B
Confocal microscope Leica TCS SP8 laser scanning confocal microscope.
Prism GraphPad
Microtome Leica SM2010R

DOWNLOAD MATERIALS LIST

References

  1. Barker, R. A., Parmar, M., Studer, L., Takahashi, J. Human Trials of Stem Cell-Derived Dopamine Neurons for Parkinson's Disease: Dawn of a New Era. Cell Stem Cell. 21, (5), 569-573 (2017).
  2. Southwell, D. G., et al. Interneurons from embryonic development to cell-based therapy. Science. 344, (6180), 1240622 (2014).
  3. Parmar, M., Torper, O., Drouin-Ouellet, J. Cell-based therapy for Parkinson's disease: A journey through decades toward the light side of the Force. European Journal of Neuroscience. (2018).
  4. Torper, O., et al. In Vivo Reprogramming of Striatal NG2 Glia into Functional Neurons that Integrate into Local Host Circuitry. Cell Reports. 12, (3), 474-481 (2015).
  5. Su, Z., Niu, W., Liu, M. L., Zou, Y., Zhang, C. L. In vivo conversion of astrocytes to neurons in the injured adult spinal cord. Nature Communication. 5, 3338 (2014).
  6. Liu, Y., et al. Ascl1 Converts Dorsal Midbrain Astrocytes into Functional Neurons In Vivo. Journal of Neuroscience. 35, (25), 9336-9355 (2015).
  7. Guo, Z., et al. In vivo direct reprogramming of reactive glial cells into functional neurons after brain injury and in an Alzheimer's disease model. Cell Stem Cell. 14, (2), 188-202 (2014).
  8. Grande, A., et al. Environmental impact on direct neuronal reprogramming in vivo in the adult brain. Nature Communication. 4, 2373 (2013).
  9. Niu, W., et al. In vivo reprogramming of astrocytes to neuroblasts in the adult brain. Nature Cell Biology. 15, (10), 1164-1175 (2013).
  10. Weinberg, M. S., Criswell, H. E., Powell, S. K., Bhatt, A. P., McCown, T. J. Viral Vector Reprogramming of Adult Resident Striatal Oligodendrocytes into Functional Neurons. Molecular Therapy. 25, (4), 928-934 (2017).
  11. Pereira, M., et al. Direct Reprogramming of Resident NG2 Glia into Neurons with Properties of Fast-Spiking Parvalbumin-Containing Interneurons. Stem Cell Reports. 9, (3), 742-751 (2017).
  12. Rivetti di Val Cervo, P., et al. Induction of functional dopamine neurons from human astrocytes in vitro and mouse astrocytes in a Parkinson's disease model. Nature Biotechnology. 35, (5), 444-452 (2017).
  13. Crosson, S. M., Dib, P., Smith, J. K., Zolotukhin, S. Helper-free Production of Laboratory Grade AAV and Purification by Iodixanol Density Gradient Centrifugation. Molecular Therapy Methods & Clinial Development. 10, 1-7 (2018).
  14. Torper, O., et al. Generation of induced neurons via direct conversion in vivo. Proceedings of the National Academy of Sciences of the United States of America. 110, (17), 7038-7043 (2013).
  15. Kawaguchi, Y., Kubota, Y. Correlation of physiological subgroupings of nonpyramidal cells with parvalbumin- and calbindinD28k-immunoreactive neurons in layer V of rat frontal cortex. Journal of Neurophysiology. 70, (1), 387-396 (1993).
  16. Grealish, S., et al. The A9 dopamine neuron component in grafts of ventral mesencephalon is an important determinant for recovery of motor function in a rat model of Parkinson's disease. Brain. 133, (Pt 2), 482-495 (2010).
  17. Thompson, L., Barraud, P., Andersson, E., Kirik, D., Bjorklund, A. Identification of dopaminergic neurons of nigral and ventral tegmental area subtypes in grafts of fetal ventral mesencephalon based on cell morphology, protein expression, and efferent projections. Journal of Neuroscience. 25, (27), 6467-6477 (2005).
בתוך Vivo ישיר של תאים Glial תושב לתוך Interneurons על ידי הזרקת גרם של וקטורים ויראלי
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Pereira, M., Birtele, M., Rylander Ottosson, D. In Vivo Direct Reprogramming of Resident Glial Cells into Interneurons by Intracerebral Injection of Viral Vectors. J. Vis. Exp. (148), e59465, doi:10.3791/59465 (2019).More

Pereira, M., Birtele, M., Rylander Ottosson, D. In Vivo Direct Reprogramming of Resident Glial Cells into Interneurons by Intracerebral Injection of Viral Vectors. J. Vis. Exp. (148), e59465, doi:10.3791/59465 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter