Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Neuroscience

바이러스 벡터의 intracerebral 주입에 의해 인터뉴런으로 상주 신경교 세포의 생체 내 직접 재프로그래밍

doi: 10.3791/59465 Published: June 17, 2019

Summary

이 프로토콜은 생체 내에서 직접 다시 프로그래밍 된 인터뉴런을 생성하는 것을 목표로, 뇌의 AAV 기반 바이러스 시스템과 생체 내에서 세포 식별 및 추가 분석을 허용하는 FLEX 시냅신 구동 GFP 리포터를 사용하여.

Abstract

생체 내에서 뇌의 상주 신경교를 기능및 아류형 특이적 뉴런으로 변환하는 것은 대체 세포 대체 요법의 개발을 향한 한 걸음을 내딛는 동시에 구내에서 세포 운명을 연구하는 도구를 만듭니다. 현재까지 생체 내 재프로그래밍을 통해 뉴런을 얻을 수 있었지만, 이러한 뉴런의 정확한 표현형이나 성숙 하는 방법은 자세히 분석되지 않았습니다. 이 프로토콜에서, 우리는 AAV 기반 바이러스 벡터 시스템을 사용하여 생체 내 재프로그래밍 된 뉴런의 보다 효율적인 변환 및 세포 별 식별을 설명합니다. 우리는 또한 재프로그래밍된 세포의 신경 성숙에 대한 기능적 평가를 위한 프로토콜을 제공한다. 플립-절제(FLEX) 벡터를 주입함으로써, 세포 리프로그래밍의 표적역할을 하는 뇌의 특정 세포 유형에 리프로그래밍 및 시냅신 구동 리포터 유전자를 함유한다. 이 기술은 새로 프로그래밍 된 뉴런의 쉬운 식별을 할 수 있습니다. 결과는 수득된 재프로그래밍된 뉴런이 시간이 지남에 따라 기능적으로 성숙하고, 시냅스 접촉을 받고, 다른 유형의 인터뉴런의 전기 생리학적 특성을 보여준다는 것을 보여준다. 전사 인자 Ascl1, Lmx1a 및 Nurr1을 사용하여, 재프로그래밍된 세포의 대다수는 빠른 스파이크, 파르브알부민 함유 인터뉴런의 특성을 갖는다.

Introduction

이 방법의 전반적인 목표는 효율적으로 parvalbumin 발현 인터뉴런과 같은 기능및 아류형 특정 뉴런으로 생체 내 뇌 상주 glia를 변환하는 것입니다. 이것은 외인성 세포 공급원에 대한 필요 없이 뇌 질환에 대한 대체 세포 대체 요법의 개발을 향한 한 걸음을 제공합니다. 또한 세포 운명 스위치를 연구하는 도구를 만듭니다.

뇌는 새로운 뉴런을 생성하기위한 제한된 용량을 가지고. 따라서, 신경 질환에서, 뇌 수리를 위한 외인성 세포 소스의 필요성이 있다. 이를 위해, 세포의 상이한 공급원은 1차 조직, 줄기세포 유래 세포 및 재프로그래밍된 세포로부터의 세포를 포함하여 수년에 걸쳐 강렬한 연구를 거쳤으며 1,2,3. 뉴런으로 상주 하는 뇌 세포의 직접 리프로그래밍은 뇌 내부의 새로운 뉴런을 생성 하기 위한 환자의 자신의 세포를 사용 하 여 뇌 수리에 대 한 매력적인 방법을 제공할 수 있는 최근 접근. 현재까지, 몇몇 보고는 두뇌에 있는 바이러스성 벡터 납품을통해 생체 내 재프로그래밍에서 보여주었습니다 4, 5,6,78,9 와 같은 다른 두뇌 지구에서 피질, 척수, 줄무늬 및 중뇌 5,10,11뿐만아니라 손상되지 않은 병변 뇌 5,8,11,12. 억제 및 흥분성 뉴런 모두4,8,그러나 이들 세포의 정확한 표현형 또는 기능은 아직 상세히 분석되지 않았다.

이 프로토콜에서, 우리는 생체 내 재프로그래밍 된 뉴런의 보다 효율적인 재프로그래밍 및 세포 별 식별을 설명합니다. 우리는 기능성 및 면역 조직 화학적 특성에 기초한 신경 성숙 및 표현형 특성의 기능 평가를 위한 프로토콜을 제공합니다.

우리는 생체 내 재프로그래밍 된 뉴런을 확인하기 위해 Cre-유도성 AAV 벡터와 GFP 리포터를 사용했습니다. 이러한 바이러스 벡터의 선택은 레트로바이러스7,8의사용에 대한 대안으로서 뇌의 분할 및 비분할 세포 모두를 감염시키고, 표적 세포의 수를 증가시키는 장점이 있다. 뉴런 특이적 시냅신 구동 FLEX 리포터(GFP)를 통해 새로 생성된 뉴런을 구체적으로 검출할 수 있었습니다. 이전 연구는 생체 내 재프로그래밍7,9에 대한 아류형 특이적 프로모터를 사용했으며, 이는 또한 특정 세포 유형에서 유전자 및 리포터의 재프로그래밍을 허용한다. 그러나, 그 방법은 리포터 및 뉴런 마커의 공동 발현의 사후 분석에 의해 재프로그래밍된 뉴런의 추가 식별을 요구한다. 본 명세서에 기재된 것과 같은 뉴런 특이적 리포터의 사용은, 직접적인 식별을 허용한다. 이는 성공적인 변환에 대한 직접적인 증거를 제공하며 패치 클램프 전기 생리학에 필요한 라이브 세포 식별을 허용합니다.

Protocol

모든 실험 절차는 유럽 연합 지침 (2010/63/ EU)에 따라 수행되었으며 룬드 대학과 스웨덴 농무부 (Jordbruksverket)의 실험실 동물 사용에 대한 윤리위원회의 승인을 받았습니다. 마우스는 음식과 물에 광고 리비텀 액세스와 12 시간 빛 / 어두운 주기에 보관됩니다.

1. 바이러스 벡터

  1. AAV 벡터의 복제
    1. Cre-유도성 AAV5 벡터를 생성하려면 GFP, Ascl1, Lmx1a 및 NR4A2(Nurr1)에 대한 cDNA를 이종형, 반평행 LoxP 플립 절제(FLEX) 서열(재료 표)의 두 쌍으로 측면에 있는 역방향으로 삽입합니다. cDNA 삽입을 위해, pAAV-Cba-FLEX와 같은 백본또는 FLEX 서열과 닭 베타 액틴(CBA) 프로모터를 포함하는 유사한 구조를 가진 백본을 사용한다.
    2. 중합효소 연쇄반응(PCR) 및 제한 효소에 의해 백본에 각각의 단일 cDNA(예를 들어, Ascl1)를 삽입한다. 시냅신 프로모터 및 Ascl1, Lmx1a, Nurr1의 제어하에 유비쿼터스로 발현된 CBA 프로모터의 제어하에 GFP를 익스프레스.
      참고: 특정 내독소가 없는 플라스미드 DNA 분리 키트를 사용하여 내독소가 없는 DNA를 가지고 있는지 확인하십시오.
    3. 복제 단계의 성공 여부를 확인하기 위해 사용하기 전에 구문에 대한 시퀀싱 및 제한 분석을 수행합니다.
  2. AAV5 바이러스 벡터 생산
    주의 사항: 아데노 관련 바이러스(AAV)를 취급할 때 현지 생물 안전 지침을 참조하십시오. 스웨덴에서는 이 프로토콜에 사용되는 AAV가 생체 안전 수준 2(BSL-2)를 요구합니다.
    1. 표준 배양 배지가 있는 종자 HEK293T 세포(DMEM+글루타맥스 + 10% FBS + 페니실린 (100 U/ml) 스트렙토마이신(100 μg/mL), T175 플라스크의 플라스크는 플라스크당 3 x 10 6셀의 밀도로 확인한다. AAV 일괄 처리당 5개의 플라스크를 고려하고 한 번에 6개의 배치를 계획합니다.
    2. 세포가 50-70 % 합류에 도달하면, 형질 감염 (175cm2 플라스크 당)에 대한 다음 혼합을 준비하십시오.
      1. 50 mL 원심 분리튜브에서, 175 cm2 플라스크 당 총 72 μg의 양으로 벡터 플라스미드 및 pDG 시리즈 도우미 플라스미드(pDP5, pDP6)의 등음부를 첨가한다.
      2. Tris-EDTA 버퍼(TE 버퍼, 10mM Tris-HCl, 1mM EDTA)를 최종 부피 144mL에 추가합니다.
      3. 총 부피가 1296 mL가 되도록 초순수를 첨가하고 혼합합니다.
      4. 2.5 M CaCl2의 144 μL을 넣고 섞습니다. 1.92 μL의 HEPES 완충식염수(HBS)(1.5 mM Na2HPO4, 140 mM NaCl, 50 mM HEPES)를 DNA 용액에 넣고 소용돌이에 의해 즉시 혼합합니다.
      5. 정확히 60s에 대한 실온 (RT)에서 배양. 28 mL 신선한 세포 배양 매체에 용액을 전송하고 혼합.
    3. 플라스크 내의 배지를 형질감염 혼합을 함유하는 세포 배양 배지로 대체한다.
    4. 형질전환 3일 후, 플라스크에서 나오는 thr 배지를 폐기물용 일회용 용기에 부어 세포를 수확하고 5 mL의 수확 버퍼를 추가합니다(EDTA는 인산완충식염수에 첨가, 재료표, DPBS를 최종 농도로 참조) 5 mM)을 각 플라스크에서 5 mMM의 농도로 하여 세포 분리를 허용한다.
    5. 50 mL 원심 분리튜브에 셀 용액을 붓습니다. 각 플라스크에 DPBS 4mL를 추가하여 나머지 세포를 헹구고 첫 번째 셀 용액으로 풀을 합니다. 4°C에서 5분 동안 1,000 x g에서 수확된 세포를 원심분리기.
    6. 원심분리 후, 상층부를 제거하고 15 mL의 용해 완충액(50 mM Tris-HCl pH 8.5, 150 mM NaCl, 1 mM MgCl 2)에 펠릿을 소용돌이에 의해 용해한다.
    7. CO2-얼음/에탄올 욕조에서 15분 동안 얼린 후 -20°C 냉동고에 보관하십시오. 사용 전에 37°C 수조에서 수확된 세포를 용해시켰다.
  3. AAV5 바이러스 벡터 정제
    1. Iodixanol 그라데이션 울트라 원심 분리13에 의해 AAV 정화를 수행하고 RT에서 1 시간 및 45 분 동안 350,000 x g에서 원심 분리가있는 초원심분리 튜브를 사용합니다.
    2. 18G 바늘이 있는 10 mL 주사기를 사용하고 AAV 함유 상을 추출하기 위해 경사를 위쪽으로 향하게 하는 40/60% 위상 테두리 아래에 약 2mm를 삽입합니다. 5-6 mL이 추출된 후 단백질 밴드에 도달하기 전에 중지하십시오.
    3. 그라데이션 추출물을 오토클레이브 유리 병에 4°C로 보관합니다. 하룻밤 이상 보관하지 마십시오.
    4. 이오디산놀 그라데이션 추출물을 소용돌이치면서 12 mL의 이오디산올 용해(IE) 완충액(20 mM Tris-HCl pH 8.0, 15 mM NaCl)에서 천천히 파이펫팅하여 3배 희석한다.
    5. 희석된 이오디산놀 그라데이션을 항이온 교환 필터를 통해 정제하고 농축한다. 1 방울 / s보다 빠른 속도로 천천히 밀어 넣으면 필터를 통해 천천히 IE 버퍼 3 mL을 밀어 씻어 내립니다.
    6. 용출 완충액 의 1-2 mL와 원심 필터 장치에 용해 (20 mM 트리스-HCl pH 8.0;250 mM NaCl). 장치에 DPBS를 4mL의 최종 볼륨에 추가합니다. 0.5 mL 미만이 필터에 남을 때까지 RT에서 2,000 x g의 원심분리기. 튜브 바닥에서 액체를 제거하고 4 mL의 DPBS로 리필하고 원심 분리기를 다시 제거하십시오. 이 단계를 두 번 더 반복합니다. 필터에 집중된 벡터의 부피가 마지막 원심분리 단계 후 약 200 μL인지 확인합니다.
    7. 파이펫을 사용하여 200 μL농축 벡터를 제거하고 0.22 mm 필터를 통해 농축액을 밀어 살균합니다. Aliquot 200 μLinto 9mm 유리 병과연동 된 인서트 (재료 표).
      참고: AAV5 벡터 스톡은 2주 이내에 사용하는 경우 -80°C 냉동고에 저장될 수 있으며, 4°C에서 보관할 수 있다.
  4. AAV5 바이러스 벡터 적시자 측정
    1. 역단말 반복(ITR) 시퀀스 및 ITR 시퀀스를 위한 5́FAM/3 ́BHQ1 프로브(재료표)를위한 프라이머가 있는 표준 정량적 폴리머라제 연쇄 반응(qPCR)을 사용하여 AAV5 역가를 결정합니다. 플라스미드를 포함하는 알려진 양의 ITR로 달성된 표준 곡선을 사용합니다. ITR 서열이 적시자 판정에 사용되는 경우 각 AAV 벡터는 밀리리터당 1E+14 – 1E+15 게놈 사본의 범위를 가져야 합니다.
      참고: 성공적인 AAV5 바이러스 생산은 3E+13 – 7E+13 단위/mL의 최소 범위에서 적시재와 주식을 제공합니다.

2. 뇌에 재프로그래밍 요인의 주입

  1. 동물 설정, 입체 배치 및 드릴링
    참고:이 프로토콜은 NG2 glia의 재프로그래밍을 위한 Ascl1, Lmx1a 및 Nurr1 (ALN)의 사용에 초점을 맞추고 인터뉴런으로. 우리의 경험에서, 유사한 표현형의 interneurons는 그밖 요인 조합을 사용하여 장악될 수 있습니다11세.
    1. 수술 전에, Cba-FLEX-Ascl1 벡터, Cba-FLEX-Lmx1a, Cba-FLEX-Nurr1 및 리포터 벡터 Syn-FLEX-GFP를 포함하는 바이러스 성 혼합물을 준비한다. 최종 바이러스 성 솔루션이 리프로그래밍 요인 (Ascl1, Lmx1a 및 Nurr1)의 각각 5 %와 리포터 구조의 10 %(5 % A, 5 % L, 5 % N 및 10 % GFP)를 가지도록 섹션 1에서 준비된 각 주식을 최종 믹스에 추가하십시오.
      참고: AAV5 벡터 믹스는 4°C에서 저장될 수 있고 향후 생체 내에서 사용하기 위해 보관될 수 있다.
    2. 공기와 아산화질소(N2O)를 4:1 비율로 혼합하여 2% 이소플루란을 사용하여 마우스를 마취시하였다. 다이어프램의 움직임을 관찰하여 동물의 호흡을 모니터링합니다. 수술 중, 1-1.5 % 이소플루란을 사용하여 마취를 유지하십시오.
      참고: 본원에 기재된 마우스 모델은 NG2 글리아에서 Cre를 구체적으로 표현하는 마우스 스트레인으로 구성된다. 생체 내 재프로그래밍은 신경교 세포의 다른 집단에서 Cre를 발현하는 상이한 마우스 균주를사용하여 달성될 수 있다(예를 들어, 성상세포 14).
    3. 동물이 완전히 마취되면 (예 : 완전한 근육 이완 및 발 패드의 핀치에 대한 반응 없음), 절개 부위 주변부위를 면도하고 동물을 입체 프레임으로 가져옵니다.
    4. 수술 중 동물의 체온을 유지하려면 스테레오택시 프레임의 베이스에 가열 패드를 부착하십시오. 깨끗하고 건조한 종이 타월에 마우스를 놓습니다.
    5. 마우스의 머리를 귀바에 조심스럽게 놓습니다. 올바르게 배치하면 머리의 측면 움직임을 관찰하지 않아야합니다. 마우스를 스테레오택시 프레임에 놓기 전에 왼쪽 이어 바를 4mm로 설정합니다.
    6. 치아 바를 제자리에 고정한 다음 코 바를 조입니다. 머리가 어떤 차원에서도 움직이지 않고 앞을 똑바로 가리키지 않도록 하십시오(중간선은 이어바의 평면에 수직임). 눈 보호를 위해 안과 연고를 바르고 있습니다.
    7. 수술이 시작되기 전에 적절한 진통을 투여하십시오 (예 : Buprenorphine 의 0.05 mg / kg, 하위 종하).
    8. 눈가에 접근하지 않고 면 거즈 또는 70 % EtOH로 적신 물티슈로 절개 부위를 청소하십시오.
      참고: 내뇌 바이러스 주사의 경우, 당겨진 유리 모세관에 적응된 5 또는 10 mL 주사기가 사용된다. 유리 모세 혈관은 마이크로 파이펫 풀러를 사용하여 당겨져 매우 미세한 팁이있는 모세관이 생성되어 절차의 침략을 최소화합니다. 주사기에 모세관을 적응하려면 주사기의 바늘과 유리 모세관 사이의 연결 위에 고무 튜브 조각을 사용하고 열원 (예 : 라이터)을 사용하여 녹입니다. 두 조각 사이의 긴밀한 연결은 주입 중에 유체 누출이 없는지 확인합니다. 수술을 시작하기 전에 주사기를 식염수로 채우고 액체를 주사기에서 밀어 내림으로써 테스트하십시오.
    9. 머리의 중간선을 따라 약 0.5-0.8 cm의 절개를 합니다. 메스로 두 피와 하위 절단 층을 모두 잘라.
    10. 절개의 각 측면에 피부 플랩을 넓히. 혈액의 절개를 청소하고 면봉으로 피하 층을 긁어 냅니다.
    11. 스테레오택 프레임의 M/L-D/V 암을 제자리에(동물 위)으로 이동하여 고정합니다.
      참고: 스테레오탁틱 프레임을 사용하면 전방/후방(A/P, Y축), 내측/측면(M/L, X축) 및 등쪽/배회(D/V, Z축) 축을 따라 주사기를 조정할 수 있습니다.
    12. 스테레오택 프레임의 다른 축을 따라 주사기를 이동하여 유리 모세관의 끝을 bregma(다른 두개골 판이 만나는 접합점) 바로 위에 가져옵니다.
    13. 모세관 팁이 A/P 및 M/L 평면 모두에서 완벽하게 직선인지 확인합니다. 모호한 bregma의 경우 측면 및 중간 선 봉합사의 평균을 취하십시오.
    14. 모세관 의 끝이 bregma 위에 올바르게 배치되면 디지털 좌표 카운터에서 M/L 및 A/P 값을 모두 0.0으로 재설정합니다.
    15. 동물의 머리가 완벽하게 평평한 위치에 있는지 확인하려면 디지털 좌표 카운터를 사용하여 A/P 암이 +2.0 및 -2.0(M/L = 0.0)인 경우, M/L 암이 +2.0 및 -2.0(A/P = 0.0)인 경우 디지털 좌표 카운터를 사용하여 D/V 좌표 값을 측정합니다. 그에 따라 치아 바 및 이어 바의 높이를 조정합니다.
    16. 줄무늬에서 바이러스 벡터를 주입하기 위해 주사기를 원하는 좌표로 이동합니다(A/P = +1.0; M/L = -2.0, 브레그마에 상대).
    17. 주사기를 약간 올리고 현미경을 통해 주사 부위를 보면서 주사 좌표에서 치과 드릴을 사용하여 구멍을 뚫습니다. 원형의 부드러운 방식으로 작업, 현장에서 드릴을 시작합니다.
      참고: 드릴 비트는 추가 힘없이 뼈를 통과 할 만큼 날카롭기 때문에 너무 많은 하향 압력을 가하지 마십시오. 열을 발생하므로 길고 지속적인 드릴링을 피하십시오.
    18. 드릴링이 끝나면 경막미가 그대로 유지되고 주입을 위해 노출되어 있는지 확인합니다.
  2. 주사기 설정 준비
    1. 면 거즈 조각을 절개 개각 위에 놓고 주사기를 식염수로 씻어 내보소입니다.
    2. 플러싱 후, 1-2 μL의 기포를 취하고, 바이러스 벡터를 포함하는 용액의 1 μL을 취하고, 의도하지 않은 기포를 피한다. 바이러스 성 용액이 주입되는 동안 기포 아래에 쉽게 시각화 될 수 있는지 확인하십시오.
  3. 바이러스 성 주사
    1. 절개 부위 에서 면 거즈를 제거하고 스테레오 택시틱 프레임의 D / V 암을 사용하여 주사기를 낮춥시됩니다. 두개골의 표면이 접근할 때, 현미경을 주의 깊게 살펴보고 경막미의 D/V 수준을 측정하십시오 - 그것은 온화한 압력하에서 약간 부풀어 오르게 됩니다.
    2. 모세관 끝으로 경막미를 터치하는 동안 D/V 좌표를 0.0으로 설정합니다.
    3. 주사기를 내리고 원하는 깊이로 천천히 진행합니다(D/V = -2.7, dura mater에 상대). 바늘/모세관의 구부러짐이 관찰되지 않도록 궤적에 뼈 조각이 없는지 확인합니다.
      참고: 제시된 좌표는 NG2-Cre 마우스의 줄무늬로 재프로그래밍 요인의 주입을 지칭한다. 다른 뇌 영역에 대응하는 좌표가 사용될 수 있다. 항상 염료 (예를 들어, Trypan Blue), 착색 된 비드 주입 또는 새로운 마우스 변형의 뇌로 재프로그래밍 요인을 주입하기 전에 리포터 바이러스 벡터를 사용하여 먼저 주입좌표를 테스트하십시오. Trypan 블루를 주입 하는 경우, 동물 수술 후 즉시 희생 될 필요가 있고 뇌 밖으로 해부. 신선한 뇌는 동결된 상태에서 마이크로토메를 사용하여 절단할 수 있으며, 주사 부위는 뇌의 염료 위치의 시각화에 의해 결정된다. 색깔된 구슬을 사용하여 좌표를 시험하는 경우에, 주입에 주입의 사이트를 결정하고 주입 후에 두뇌를 잘라내는 것이 가능합니다. 대안적으로, 리포터 유전자를 운반하는 바이러스 벡터를 이용한 주사가 사용될 수 있고, 주입 부위는 공류 절단 뇌에서 결정된다.
    4. 0.4 μL/min의 속도로 바이러스 용액 1 μL을 주입하십시오. 전체 부피가 주입되면 주사기 가 꺼지기 전에 2 분의 확산 기간을 허용하십시오.
    5. 확산 후 모세관 끝이 완전히 뇌에서 나올 때까지 주사기를 천천히 철회하십시오.
    6. 상처 위에 면 거즈 조각을 놓고 식염수로 주사기를 씻어 내보소입니다.
    7. 스테레오택 프레임의 M/L-D/V 암을 작업 영역 밖으로 이동합니다.
  4. 상처 폐쇄 및 수술 후 절차
    1. 봉합사 를 사용하여 절개를 조심스럽게 봉합하십시오.
      참고: 주입된 동물에 사용되는 모든 봉합사 실은 항 바이러스 성 세제 용액이 함유 된 컵 / 바이알에 폐기해야합니다. 동일한 용액은 수술 재료와 접촉된 수술 부위를 둘러싼 모든 표면을 청소하는 데 사용됩니다. 모든 수술 도구는 철저하게 세척하고 각 수술 하루의 끝에 오토 클레이브된다.
    2. 동물을 입체 프레임에서 제거하고 깨끗하고 가열된 케이지, 음식과 물에 대한 접근, 동물이 완전히 깨어날 때까지 머무르는 곳을 포함하는 수술 후 스테이션에 놓습니다. 이 기간 동안 의식이 회복 될 때까지 동물을 면밀히 모니터링하십시오.
    3. 수술후 완전히 회복될 때까지 는 수술이 없는 동물을 보관하지 마십시오.
    4. 매일 동물을 감독하십시오. 사용되는 봉합사에 따라 필요한 경우 제거해야 합니다. 모든 동물은 수술 후 치료로 피하 부페노르피눔 (1ml / kg에서 Temgesic)을 받았다.
      참고: 이틀 연속 동일한 주사기를 사용하여 작동하는 경우, 물로 세척한 다음 에탄올 70%를 다시 물로 씻어내십시오. 가능한 잔류물을 용해할 수 있도록 주사기를 밤새 물로 가득 채운 상태로 두십시오.

3. 전기 생리학 기록

  1. 전기 생리학을 위한 조직 슬라이스 준비
    주의 사항: 좋은 전기 생리학적 기록을 달성하기 위해서는 잘 실행된 조직 준비가 필요합니다. 조심스럽게 방을 준비하고 얼음에 관류 및 해부를위한 도구를 배치합니다.
    1. 얼음 추위와 산소화 (95 % O2 및 5 % CO2) 관류, 해부 및 절단을위한 Krebs 용액을 준비하십시오 (초순수에 스톡 용액을 희석하고 NaHCO3 및 포도당을 추가하여 10 x 재고에서 같은 날에 준비하십시오). MM의 크렙스 용액의 구성 요소는 (1x로 희석 한 후) 다음과 같습니다 : 126 NaCl, 2.5 KCl, 1.2 NaH2PO4· H2O, 1.3 MgCl2·6H2O, 및 2.4 CaCl2·6H2O, 22 NaHCO3,10 포도당. 용액의 pH를 7.4로 조정합니다.
    2. 새로운 면도날로 진동에 대한 교정(Vibracheck)을 수행합니다.
    3. 진동의 냉각 블록을 시작 (또는 얼음으로 주변 챔버를 채우기), 사용하기 전에 95 % O2 및 5 % CO2 적어도 30 분 산소에 대한 Krebs 솔루션으로 절단 챔버를 채웁니다.
    4. 얼음에 페트리 접시를 넣고 산소 크렙스 용액으로 채웁니다. 블레이드, 가위 및 장착 판을 얼음 위에 놓습니다.
      주의 사항: 적응 절차를 시작하기 전에 적어도 1 시간 동안 마우스가 들어있는 케이지를 방으로 가져 오십시오. 스트레스는 뇌 조직 섹션의 상태에 부정적인 영향을 미칩니다.
    5. 말단은 Pentobarbital의 과다 복용을 주입하여 마우스를 마취하고 동물이 잠들 수 있도록.  깜박임 반사가 꺼지고 동물이 통증 자극에 반응하지 않을 때, 2-3 분 동안 얼음 차가운 크렙스 용액으로 동물을 심낭으로 정중시 (10-20 mL / min의 속도로).
    6. 급속하지만 신중하게 뇌를 해부하고 얼음에 놓인 페트리 접시에 거꾸로 놓습니다 (크렙스 용액 포함).
      참고: 재프로그래밍된 뉴런의 기능적 성숙을 비교하기 위해, 바이러스 주사 후 다른 시점에서 기록을 위해 동물을 희생한다. 기존 문헌15에 기초하여 뉴런의 뚜렷한 아류형의 발사 특성을 평가한다.
    7. 중간 소뇌를 따라 관상 컷을 확인하고 진동 절단을위한 장착 플레이트 (또한 얼음 차가운)에이 측면을 접착제.
    8. 붙은 뇌를 진동의 완충실에 조심스럽게 담급강.
      주의 사항: 자신의 안전을 위해 면도날을 만지지 않도록 주의하고 칼날이 보정된 상태를 유지하도록 하십시오.
    9. 고속으로 줄무늬 수준으로 뇌의 가장 로스트랄 부분에서 잘라. 그런 다음 느린 속도(0.10mm/s)에서 275mm로 관상으로 줄입니다.
    10. 각 절단 후, 조심스럽게 주입되지 않은 줄무늬 측 (예를 들어, 구부러진 바늘)을 제거하고 수조에 삽입 된 바닥 그물 (RT에서 산소화 된 Krebs)을 포함하는 수조에서 주입 된 면을 다른 유리병으로 옮긴다. 모든 섹션이 잘릴 때까지 RT에 보관하십시오.
    11. 수조의 온도를 37°C로 천천히 올리고 30분 동안 그대로 둡니다. 그런 다음 히터를 끄고 RT가 될 때까지 식힙니다.
      참고: 이 시점에서 녹화를 시작할 때까지 일시 중지할 수 있습니다. 섹션은 4-6 시간 동안 지속됩니다.
  2. 전체 셀 패치 클램프 기록
    1. 크렙스 용액의 연속흐름에 잠긴 제1 조직 절을 기록 챔버로 옮겼다. 경량을 사용하여 단면을 장착하고 목표를 잠급합니다.
    2. 현미경에서 줄무늬 영역을 식별하고 GFP 양성 (재 프로그래밍 된) 뉴런을 검색합니다. 형태학에 광범위하고 섬유 번들 또는 혈관에 포함되지 않는 뉴런을 선택하십시오.
    3. 패칭을 위해 보로실리케이트 유리 파이펫(3-7 MΩ)을 준비하고 다음 세포 내 용액(mM)으로 채웁니다: 122.5 칼륨 글루코네이트, 12.5 KCl, 0.2 EGTA, 10 HEPES, 2 MgATP, 0.3 Na3GTP 및 8 NaCl, KOH 7.3으로 조정.
    4. 바이오시틴 충진의 경우, 1 mL의 내부 용액과 소용돌이에 1 mg의 바이오시틴 소금을 넣으세요.
      주의 사항: 그렇지 않으면 전극을 막을 수 있기 때문에 바이오 시틴으로 내부 용액을 필터링해야합니다.
    5. 유리 파이펫을 기록 전극에 부착하고 용액에 담급강합니다. 전극의 저항을 다시 확인합니다. 그런 다음 팁이 막히지 않도록 전극에 약간의 양압을 유지하면서 파이펫으로 셀에 천천히 접근하십시오.
      주의 사항: 전극을 하강하는 동안 세포를 추적하고 세포의 형광을 표백하지 않도록주의하십시오 (즉, 필요하지 않을 때 형광 램프를 끕니다).
    6. 전극의 양압을 사용하여 주변 조직을 조심스럽게 헹구고 전극으로 셀에 접근하십시오. 전극을 전극 바로 위에 배치하고 전극이 멤브레인에 닿을 때까지 하강합니다. 전극과 세포막 사이에 기가-Ω 씰을 만들고 음압 펄스를 사용하여 멤브레인을 파열시켜 전체 세포 패치를 만듭니다.
      주의 사항: 다시 프로그래밍된 뉴런은 민감합니다. 패치 할 때주의하고 기가 Ω 씰에 도달하거나 세포막을 열 때 너무 많은 부정적인 압력을 두지 마십시오. 또한, 더 오래된 동물에 패치는 그들의 결합 조직이 두껍고 뉴런을 시각화하기 어렵기 때문에 연습과 인내가 필요합니다.
    7. 전류 클램프 모드에서 침입 한 직후 휴식 멤브레인 전위를 확인하고 분석을 위해 적어 둡니다.
    8. 현재 클램프에서 -60 mV에서 -80 mV 사이의 셀을 유지하고 -20 pA에서 +90 pA까지 500 ms 전류를 주입하고 10 pA 증분으로 작용 전위를 유도합니다.
    9. 전압 클램프로 전달하고 10 mV의 탈분극 단계에서 내부 나트륨 및 지연 정류 칼륨 전류를 측정합니다.
      참고: 전압 클램프 기록은 멤브레인을 보다 효율적으로 클램프하는 화학 물질로 구성된 다른 내부 솔루션을 사용하여 더 잘 평가됩니다. 그러나, 다시 프로그래밍 된 뉴런에 대 한, 에서 기록할 수 있는 세포의 수는 몇 가지 이며 이러한 뉴런조직 섹션의 수는 제한. 따라서 동일한 셀의 전류 클램프및 전압 클램프를 모두 기록하는 것이 유리합니다.
    10. 전압 클램프 모드에서는 -70 mV에서 자발적인 후발 활동을 기록합니다. -70 mV에서 흥분성 이벤트에서 0 mV의 막 전위에서 억제 성 후세포 이벤트를 구별하십시오.
    11. 안정적인 기준선에 도달 한 후, Picrotoxin을 추가, GABA수용체 길항제, 기록 챔버로 흐르는 크렙스 솔루션에, 흥분성 이벤트를 추출 (별도의 50 mM의 최종 농도에 Picrotoxin의 재고 용액을 추가 챔버 관류에 연결된 버퍼 주사기. 안전한 폐기를 위해 챔버에서 진공 백에 버퍼의 유출을 연결하십시오).
    12. 20 분 후, CNQX를 추가 (20 mM), AMPA 길항제, 기록 챔버로 흐르는 크렙스 솔루션에, 억제 이벤트를 차단하려면 (Picrotoxin와 동일한 절차를 사용하여). 또 다른 20 분 동안 두고 크렙스 용액으로 씻어 내십시오. 챔버에서 조직 섹션을 제거합니다.
    13. 기록을 마친 후, 분석 프로그램에서 임계값-이벤트 검출(>5 pA)을 사용하여 자발적인 흥분성 시냅스 후 전류(EPSC) 및 시냅스 후 전류(IPSC)의 억제를 오프라인으로 분석합니다.
    14. 전체 기록 동안, 세포는 천천히 바이오시틴 함유 내부 용액으로 채워질 것이다. 전극을 천천히 제거하기 전에 적어도 20 분 동안 패치를 유지하여 셀을 완전히 충진하십시오.
      주의 사항: 나중에 세포의 연속적인 형태 학적 분석을 파괴 할 수있는 전극에 양압이 없는지 주의하십시오.
    15. 바이오시틴 시각화의 경우, 조직 절편을 4°C에서 밤새 4% 파라포름알데히드(PFA)에 넣습니다. 0.02 M 칼륨 인산 완충액 (KPBS)에서 0.1 % 트리톤으로 섹션을 헹구다. 이어서, 스트렙타비딘-Cy3(KPBS-T에서 1: 600, 2h)에 대한 얼룩, 재프로그래밍된 뉴런의 생체시틴 충전 세포 및 형태학적 시각화의 식별을 위한.
      참고: 바이오시틴 충전재는 패치된 뉴런의 형태학적 분석 및 삽화에 사용될 수 있다.

4. 면역화학, 입체학 및 정량화

참고: 전기 생리학에 사용되는 조직 섹션이 면역 조직 화학에 최적이 아니기 때문에 면역 조직 화학을 위한 마우스의 특정 단을 헌납하십시오.

  1. 펜토바르비탈의 과다 복용으로 마우스를 마취시키고 관류를 위해 동물을 장착합니다.
  2. 먼저 식염수용액으로 혈액을 제거한 다음 얼음으로 차가운 4% PFA로 마우스를 심혈합니다.
  3. 4% PFA에서 적어도 12 시간 동안 뇌와 사후 수정을 해부하십시오.
  4. 약 12 시간 동안 25 % 자당 용액 (냉동 보호용)에 뇌를 넣습니다.
    참고: 뇌는 25 % 자당 용액에 가라 앉을 때 절단 할 준비가되어 있으며, 자당이 전체 마우스 뇌에 침투했음을 나타냅니다.
  5. 소뇌를 가로 질러 관상 절단을 확인, 마이크로 톤에 뇌를 배치하고 최적의 절삭 온도 화합물 (OCT)를 사용하여 장소에 고정하는 뇌의 평면, 대부분의 꼬리 부분을 사용합니다.
  6. 35mm의 두께로 뇌를 관상 조각으로 자르고 0.02 M KPBS를 포함하는 유리병 이나 우물에 배치 된 연속 시리즈로 뇌를 나눕니다.
  7. 표준 프로토콜16, 17에따라 GFP 및 GAD65/67, PV, Chat(콜린 아세틸트랜스파제) 및 NPY(Neuropeptide Y)와 같은 상호 뉴런 마커에 대한 항체를 사용하여 면역운동 화학을 위한 섹션을 처리한다.
    참고: 뇌 슬라이스는 부동결 용액에서 4°C 또는 -20°C에서 장기간 보관할 수 있다.
  8. 염색이 완료된 후, 유리 슬라이드에 섹션을 장착하고 장착 용액을 사용하여 유리 커버 슬립으로 덮어 제자리에 고정시십시오. 커버슬라이드를 밤새 말리도록 그대로 두십시오.
    참고: 우리의 연구를 위해, 전체 뇌는 1:8 시리즈로 절단된다 (즉, 섹션을 포함하는 각 유리병은 마우스 뇌의 1/8을 보유할 것이다11).
  9. 반전형광 및/또는 공초점 현미경을 사용하여 단면을 분석합니다.
    주의 사항: 형광 현미경 검사법은 결과의 일반적인 개요및 재프로그래밍 효율성을 계산하기 위한 이미지를 캡처하는 데 유용합니다. 이중 양성 세포의 관찰에 의한 자형질 정체성의 보다 상세한 분석을 위해, 공초점 화상 진찰은 이용되어야 합니다.
  10. 줄무늬에서 GFP+ 뉴런으로 발현된 상이한 마커의 정량화를 위해, GFP+ 세포의 총 수(즉, 재프로그래밍된 뉴런)와 관련하여 이중 양성 세포의 수를 각각의 적어도 2개의 필드에서 계산합니다. 줄무늬 섹션.
  11. 뇌당 재프로그래밍된 뉴런의 대략적인 추정 총 수를 결정하기 위해, 이전에 잘라낸 뇌 시리즈 중 하나의 줄무늬에 존재하는 GFP+ 뉴런을 계산한 다음 총 계열 수를 곱합니다.
    참고: 정량화의 다른 방법은 재프로그래밍 효율성, 동물 당 재 프로그래밍 된 뉴런의 수 및 특정 표현형 마커를 발현하는 뉴런의 백분율을 표현하는 데 사용될 수 있습니다. 자세한 내용은 이전 발행물11을참조하십시오.
  12. 그래프 패드 프리즘 또는 이와 유사한 조건을 사용하여 조건 간의 차이를 분석합니다.
    참고: 효율성 계산을 위해, 우리는 CRE 의존적 ALN 변환 벡터 및 GFP 리포터와 NG2-Cre 마우스를 주입하였다. 변환 효율을 추정하기 위해, 우리는 또한 유비쿼터스 cba 프로모터하에 Cre 의존적 GFP를 가진 동물을 주입하여 모든 표적 세포를 GFP+로렌더링하였다. 이 비교를 사용하여, 우리는 표적으로 한 세포의 66.81% ± 38.38%가 뉴런으로 변환되었다는 것을 추정했습니다. 각 유전자의 발현의 유효성을 검사하기 위해, GFP/Ascl1, GFP/Lmx1a 및 GFP/Nurr1에 대해 상보적인 이중 면역형 화-염색을 수행할 수 있다. 추가적으로, 단세포 RNA 시퀀싱과 같은 게놈 시퀀싱은 재프로그래밍된 세포에 있는 유전자의 각각의 존재를 밝힐 수 있다.

Representative Results

AAV 벡터의 주사는 NG2-Cre 마우스 줄무늬(도1A)에서뉴런으로 상주하는 NG2 글리아 세포를 성공적으로 재프로그래밍하는 데 사용된다. 구체적으로 NG2 glia를 표적으로 하기 위해, 리프로그래밍/리포터 유전자를 가진 FLEX 벡터는 안티센스 방향으로 삽입되고 두 쌍의 안티병렬,이종 성 loxP 부위에 의해 측면에 삽입된다(그림 1B). 3개의 재프로그래밍 유전자(Ascl1, Lmx1a 및 Nurr1)는 각각 의 개별 벡터에 대한 유비쿼터스 cba 프로모터의 제어 하에 배치된다. GFP 발현이 Cre 발현 세포로부터 유래된 재프로그래밍된 뉴런으로 제한되도록 하기 위해, GFP는 뉴런 특이적 시냅신 프로모터의 제어하에 배치된다(또한 FLEX 벡터에서).

리프로그래밍 및 리포터 구문의 조합의 사용은 마우스 줄무늬에서 GFP 양성 뉴런의 생성을 허용한다(도1C,C'). 재프로그래밍 유전자의 존재 없이 리포터 구조의 사용은 GFP 양성 뉴런을 생성하지 않는다(도1D).

바이오시틴이 채워진 재프로그래밍된 뉴런은 사후 면역 염색 후 볼 수있다(도 2A). 변환이 성공하면 광범위한 신경 형태가 있어야합니다. 재프로그래밍된 뉴런의 전기생리학적 기록은 자발적인 활성 측정을 가진 후발성 기능적 연결의 존재를 보여준다(도2B,C). 이 ionotropic GABAergic 또는 글루타마테르지 차단제와 함께 차단 될 수 있습니다 (Picrotoxin 또는 CNQX), 다시 프로그래밍 된 뉴런에 흥분 성 및 억제 시 냅 스 입력을 제안. 자발적인 활동의 발생은 시간 후바이러스 주사 (그림 2D)와 함께 증가하여 점진적 인 성숙을 나타냅니다.

전류 유도된 활동 전위는 기능적인 뉴런에서 존재합니다. 변환 후 시간이 지남에 따라 작업전위가 증가합니다(그림 2E). 이것은 또한 신경 기능의 성숙을 나타냅니다. 미성숙한 뉴런에서, 전류는 없음 또는 극소수의작용 전위를 유도한다(도 2F).

뉴런의 발사 패턴은 세포의 형태와 채널 발현(15)과 같은인자에 의존하기 때문에 세포 유형별이다. 생체 내 재프로그래밍된 뉴런에서 기록된 패턴은 내인성 뉴런 아류형과 비교하여, 예를 들어 빠른 스파이크 인터뉴런(Cell Type B, 도 3B)또는 다른 세포 유형(그림3A,C, D) ). 관찰된 전기생리학적 차이는 GFP와의 특정 아류형 마커 및 공동 발현의 존재에 의해 확인될 수 있다(도 3E-H). 전부, 이 데이터는 줄무늬에 존재하는 재프로그래밍된 뉴런이 Parvalbumin-, ChAt- 및 NPY-발현과 같은 다른 유형의 인터뉴런의 특성을 가지고 있음을 나타내며, 줄무늬 배지 가시 뉴런 정체성(DARPP32+) 그림 3E -H)를참조하십시오.

Figure 1
그림 1: 상주 NG2 글리아의 생체 내 재프로그래밍을 뉴런으로. (A) AAV 바이러스-줄무늬 NG2 글리아의 생체 내 재프로그래밍에서 매개된 회로도 표현. (b) 생체 내 재프로그래밍에 사용되는 AAV5 FLEX 구조체의 개략적 표현은 표적 세포에서 의 유전자 발현에 의해 유전자 발현이 조절된다. (CC')생체 내에서 신경세포를 다시 프로그래밍하여, 신-GFP + ALN 주사를 줄무늬로 주입하였다. (D) 바이러스 성 칵테일에 재프로그래밍 요인이 첨가되지 않은 경우 재프로그래밍 된 뉴런의 부재, 오직 리포터 구성만이 생체 내에서 주입된다. 축척 막대 = 100mm(C), 25mm(C'), 25mm(D). 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 2
그림 2: 생체 내 재프로그래밍된 뉴런은 기능적이며 시간이 지남에 따라 성숙을 보여준다. (A) 바이오시틴이 채워진 재프로그래밍 된 뉴런은 수지상 척추를 포함하는 성숙한 신경 형태를 나타낸다. 트레이스는 (B) 억제 (GABAergic) 활성은 PICrotoxin으로 차단되는 활성, GABAA 수용체 길항제 및 (C) CNQX, AMPA 수용체 길항제로 차단되는 흥분성 활성. (D) 후시냅스 활동이 있는 뉴런의 수는 시간이 지남에 따라 증가합니다. (E) 패치 된 뉴런은 이미 5 주 후 주입 후 (w.p.i.)에서 반복적 인 발사를 보여주고 8 및 12 w.p.i. (F) 미성숙 뉴런의 현재 유도 된 행동 전위 및 후발성 활성을 보여 줄 수 있으며, 시냅스 (saptic)는 거의 시냅스를 보이지 않습니다. 이벤트 및 B 및 D. 규모 막대 = 25mm에 비해 몇 가지 작업 잠재력이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 3
그림 3: 생체 내 재프로그래밍된 뉴런은 줄무성 인터뉴런의 면역조직화학적 및 전기생리학적 특성을 보여준다. (A-D) 생체 내 재프로그래밍 된 뉴런의 발사 패턴은 뚜렷한 유형일 수 있습니다: (A) 유형 A는 내인성 배지 가시 뉴런 (DARPP32+)과 유사합니다; (B) 빠른 스파이크와 유사 (PV +) 인터 뉴런; (C) 눈에 띄는 처짐 (NPY+)와 낮은 임계 값 스파이크 뉴런과 유사; (D) 큰 과분극 (채팅 +)로 발사 뉴런. (E-H) GFP 및 인터뉴런 마커 PV(E), ChAT(F), NPY(G), 및프로젝션 뉴런 마커 DARPP32(H)의 공동 국소화를 나타내는 공초점 이미지. 모든 축척 막대 = 50mm. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Discussion

생체 내 직접 재프로그래밍은 Cre-발현 마우스 균주에서 AAV FLEX 벡터를 사용하여 달성될 수 있다. 재프로그래밍 효능에 관해서는 마우스 균주 간의 차이가 관찰되었다는 점에 유의하는 것이 중요합니다. 줄무늬에서 생체 내 재프로그래밍의 경우, NG2-Cre 마우스 라인은 다른 균주와 비교할 때 더 효율적인 것으로 입증되었습니다. 새로운 동물 균주를 사용하기 전에, 동물의 나이가 종종이 단백질 발현의 특이성에 영향을 미치기 때문에 시간이 지남에 따라 Cre 발현에 관한 마우스 제공 자 지침을 확인하는 것이 중요합니다. 우리의 연구에서, 12주 이상 된 동물은 NG2 glia 이외의 세포에서 Cre 발현에 대한 위험이 있었기 때문에 생체 내 재프로그래밍에 사용되지 않았다. 시냅신-FLEX-GFP 시제만주입된 대조군 동물의 지속적인 존재 및 모니터링이 권장된다. 이것은 더 재프로그래밍 유전자 (ALN)가 사용되지 않는 경우에 나타나서는 안 되는 GFP 양성 세포를 위한 동물의 감시를 허용합니다.

새로 프로그래밍된 뉴런을 식별하기 위해 이 프로토콜에 설명된 뉴런과 같은 뉴런 특이적 식별 방법이 가장 중요합니다. 이는 동성애자 영역에서 재프로그래밍할 때 특히 관련성이 있는 내인성 주변 세포로부터 재프로그래밍된 뉴런을 적절히 식별하고 구별할 수 있게 한다.

그것은 또한 바이러스 성 주입에 대 한 올바른 구조를 대상으로 하는 것이 중요 하다. 따라서, 바이러스 성 주입을 위한 입체 외과는 중요하고 두뇌의 더 작은 구조물을 표적으로 할 때 특히 정확하게 접근할 필요가 있습니다.

우리는 이전에동일한 재프로그래밍 인자를 사용하여 생체 외 재프로그래밍 실험을 기반으로 생체 내 재프로그래밍의 결과를 예측하는 것이 신뢰할 수 없다는 것을 11을 보여주었습니다. 따라서 관심있는 모든 요소는 생체 내에서 테스트해야합니다. 우리의 손에, 많은 다른 요인 조합은 뉴런의 동일한 아류형을 제공 (즉, 생체 내에서 interneurons11) 이러한 유전자는 다른 뉴런의 개발에 연루 된 사실에도 불구하고.

재프로그래밍된 뉴런에 대한 전세포 패치 클램프는 섬세한 기술이며 조직 처리는 좋은 결과를 위해 중요하다. 얼음 차가운 Krebs 용액을 가진 관류는 조직 질을 향상시킵니다. 또한 패치 된 뉴런은 신중하게 치료해야합니다. 재프로그래밍된 뉴런의 성숙 및 표현형 정체성이 전체 세포 패치 클램프를 사용하여 다소 평가될 수 있더라도, 이들 세포는 그들의 내인성 대조물과 완전히 비교할 수 없다. 게놈 시퀀싱(예를 들어, RNA 시퀀싱)과 같은 추가유형의 분석은 다시 프로그래밍된 세포 정체성을 추가로 확인하기 위해 사용되어야 한다.

본 명세서에 기재된 기술은 뇌에서 신경 대체가 필요한 미래 치료법의 개발을 위해 고려될 수 있다. 생체 내 재프로그래밍은 아직 초기 단계에 있으며 인간으로의 번역은 아직 예측되지 않았지만,이 기술은 뇌의 외인성 유전자 기능을 평가하고 생체 내에서 세포 성숙을 연구하는 방법을 제공 할 수 있습니다.

Disclosures

저자는 공개 할 것이 없다.

Acknowledgments

마르첼라 비르텔레는 마리 스크와도우스카-퀴리 혁신 교육 네트워크 및 보조금 협정 제676408호하에 유럽 연합 호라이즌 2020 프로그램(H2020-MSCA-ITN-2015)의 자금을 지원받았습니다. 다니엘라 릴란더 오토슨은 스웨덴 연구위원회 (2017-01234)의 지원을 받았습니다.

Materials

Name Company Catalog Number Comments
REAGENTS FOR AAV5 CLONING AND VIRAL VECTOR PREPARATION
pAAV-CA-FLEX AddGene 38042
Ascl1 AddGene 67291 NM_008553.4
Lmx1a AddGene 33013 NM_0033652.5
Nurr1 AddGene 35000 NM_013613.2
GFP-syn AddGene 30456
LoxP (FLEX) sequence 1 GATCTccataacttcgtataaagtatcctatac
gaagttatatcaaaataggaagaccaatgcttc
accatcgacccgaattgccaagcatcaccatcg
acccataacttcgtataatgtatgctatacgaa
gttatactagtcccgggaaggcgaagacgcgga
agaggctctaga
LoxP (FLEX) sequences 2 tactagtataacttcgtataggatactttatac
gaagttatcattgggattcttcctattttgatc
caagcatcaccatcgaccctctagtccacatct
caccatcgacccataacttcgtatagcatacat
tatacgaagttatgtccctcgaagaggttcgaa
ttcgtttaaacGGTACCCTCGAC
pDP5 Plasmid Factory PF435
pDP6 Plasmid Factory PF436
Phosphate-Buffered Saline (PBS) Thermo Fisher Scientific 10010023
FBS (Fetal bovine serum) Thermo Fisher Scientific 10500064
Penicillin streptomycin Thermo Fisher Scientific 15140122
DMEM (Dulbecco's Modified Eagle Medium)+ Glutamax Thermo Fisher Scientific 61965026
DPBS (Dulbecco's Phosphate Buffer Saline) Thermo Fisher Scientific 14190094
HEK293 cells Thermo Fisher Scientific 85120602-1VL
Flasks BD Falcon 10078780 175 cm2
Tris H-CL Sigma Aldrich 10812846001 For TE buffer use 10 mM, pH 8.0; for lysis buffer use 50mM, pH 8.5; for IE buffer use 20 mM, pH 8.0; for elution buffer use 20 mM, pH 8.0
EDTA EDTA: Invitrogen EDTA: AM9260G For TE buffer use 1 mM EDTA
Ultrapure water see Ultrapure water system
CaCl2 SigmaAldrich C5080 2.5 M
Dulbecco´s phosphate-buffered saline (DPBS) Thermo Fisher Scientific 14190136
NaCl Sigma-Aldrich S3014 FOR HBS use 140 mM; for Lysis Buffer use 150 mM; for IE buffer use 15 mM; for elution buffer use 250 mM
MgCl2 Sigma-Aldrich M8266-100G For lysis Buffer: 1 mM
Ultracentrifuge sealing tubes Beckman Coulter Quick-Seal® Polypropylene Tube
OptiPrep™ Density Gradient Medium Sigma Aldrich D1556-250ML
10-mL syringe-18G needle BD 305064
Laboratory glass bottles VWR ?
Anion exchange filter PALL laboratory MSTG25Q6 Acrodisc unit with Mustang Q membrane
Centrifugal filter unit Merck Z740210-24EA Amicon Ultra-4 device
Endotoxin-Free Plasmid DNA Isolation Kits Thermo Fisher Scientific A33073
Na2PO4 Sigma-Aldrich S7907
HEPES Sigma-Aldrich H7523 15 mL
Falcon tube Thermo Fisher Scientific Corning 352196
Falcon tube Thermo Fisher Scientific Corning 352070
Glass Vials Novatech 30209-1232 CGGCCTCAGFGAGCGA
Forward Primer for Inverted Terminal Repeat (ITR) sequence GGAACCCCTAGTGATGGAGTT
Reverse Primer for Inverted Terminal Repeat (ITR) sequence CACTCCCTCTCTGCGCGCTCG
5´FAM / 3´BHQ1 probe Jena Bioscience
0.22 mm filter Merck SLGV004SL Millex-GV filter
EQUIPMENT AAV5 VIRAL VECTOR PREPARATION
Freezer -20 °C
Freezer -80 °C
Fridge +4 °C
AAV viral room
Ultrapure Water system Merck Milli-Q® IQ 7000
Vortex mixer VWR 444-0004
Ultracentrifuge Beckman Coulter Beckman Optima LE-80K Ultracentrifuge
Autoclave Tuttnauer 2540 EL
Polymerase Chain Reaction (PCR) BioRad C1000 Touch Thermal Cycler
Quantitative PCR (qPCR) Roche LightCycler® 480 System
Centrifuge Thermo Fisher Scientific Sorvall ST16
Water Bath Thermo Fisher Scientific TSGP02
ANIMAL MODEL
NG2-Cre mice Jackson NG2-CrexB6129, Stock #008533
REAGENTS FOR INJECTION OF REPROGRAMMING FACTORS INTO THE BRAIN
Water
Saline Apoteket AB 70%
Ethanol Solveco
Isolfurane Apoteket AB Dilute to 1% solution with warm water.
Virkon Viroderm 7511 
Pentobarbital Apoteket AB P0500000 i.p. for terminal procedure at the dose of 60 mg/ml.
Sucrose Merck S0389-500G
Trypan Blu Thermo Fisher Scientific 15250061
Retrobeads Lumafluor R170
Buprenorphine Apoteket AB
EQUIPMENT FOR INJECTION OF REPROGRAMMING FACTORS INTO THE BRAIN From RSG Solingen.
Scissors VWR 233-1552 From Biochem.
Tweezers VWR 232-0007
Forcep VWR 232-0120
Scalpel holder VWR RSGA106.621 Number 20.
Scalpel VWR RSGA106.200
Stereotaxic frame Stoelting Europe 51500D
Mouse ear bars Stoelting Europe 51648 5 ul
Syringe with Removable needle Hamilton Company 65 0,75 inner diameter and 1.5 outer diameter.
Glass capilaries Stoelting 50811
Glass capillary puller Sutter company P-1000
Dental drill Agnthos AB 1464
Shaver Agnthos AB GT420
Isoflurane Chamber and pump Agnthos AB 8323101 2 mL
Syringes Merck Z118400-30EA 25G
Needles Merck Z192414 Aldrich
Mouse and neonatal rat adaptor for stereotaxic fram Stoelting 51625
Heating pad Braintree scientific, inc 53800M From Covidien 2187.
Cotton gauze Fisher Scientific 22-037-902
Rubber tube Elfa Distrelec HFT-A-9.5/4.8 PO-X BK 150
Cotton swabs Fisher Scientific 18-366-473
REAGENTS FOR WHOLE-CELL PATCH CLAMP RECORDINGS
NaCl Sigma-Aldrich S3014
KCl Sigma-Aldrich P9333
NaH2PO4-H2O Sigma-Aldrich S9638
MgCl2-6 H2O Sigma-Aldrich M2670
CaCl2-6 H2O Sigma-Aldrich C8106
MgSO4-7 H2O Sigma-Aldrich 230391
NaHCO3 Sigma-Aldrich S5761
Glucose Sigma-Aldrich G7021 see Ultrapure Water system
Ultrapure Water Prepare 1 or 2M.
KOH Sigma-Aldrich P5958-500G
K-D-gluconate Sigma-Aldrich G4500 Sigma
KCl Sigma-Aldrich P9541
KOH-EGTA (Etilene glycol-bis-N-tetracetic acid) Sigma-Aldrich E3889 Sigma
KOH- Hepes acid (N-2-hydroxyethylpiperazine-N’-2-ethanesulfonic acid) Sigma-Aldrich H7523
NaCl Sigma-Aldrich S3014
Mg2ATP Sigma-Aldrich A9187
Na3GTP Sigma-Aldrich G8877
Biocytin Sigma-Aldrich B4261
Picrotoxin Merck P1675 Sigma
CNQX Merck C239 Sigma
Ice
EQUIPMENT FOR WHOLE-CELL PATCH CLAMP RECORDINGS
Borosilicate glass pipette Sutter Company B150-86-10
Glass capillary puller Sutter company P-1000
Vibratome Leica Leica VT1000 S
WaterBath Thermo Fisher Scientific TSGP02
Clampfit software Molecular Devices
Multiclamp software Molecular Devices
REAGENTS FOR IMMUNOHISTOCHEMISTRY Use at a concentration of 4%. CAUTION: PFA is a potent fixative. Avoid ingestion and contact with skin.
Paraformaldehyde (PFA) Merck Millipore 1040051000 Use at a concentration of 0.1%.
Triton X-100 Fisher Scientific 10254640 Donkey.Use at a concentration of 1 : 400.
Serum Merck Millipore S30-100ML Reconstitute the powder in Milli-Q water to 1 mg/mL. Aliquot and store at -20°C, light sensitive. Use at a concentration of 1 : 500.
4′,6-Diamidino-2′-phenylindole dihydrochloride (DAPI) Sigma Aldrich D9542 1: 600 in KPBS-T.
streptavidin- Cy3 Thermo Fisher Scientific 434315 1:5000, rabbit.
Anti-GAD65/67 Abcam 1:2000, mouse.
Anti-PV Sigma P3088 1:200, goat.
Anti-Chat Merk AB143 1:5000, rabbit.
Anti-NPY Immunostar 22940
K2HPO4 Sigma-Aldrich P3786
NaCl Sigma-Aldrich S3014
KH2PO4 Sigma-Aldrich NIST200B 1:1000, chicken.
Anti-GFP Abcam ab13970
Mounting solution Merck 10981 Polyvinyl alcohol mounting medium with DABCO®, antifading
OCT Agar Scientific
Glycerol Sigma-Aldrich G9012-100ML
Distilled water
Anti-freeze solution Tissue Pro Technology AFS05-1000N, 1000 mL/ea.
EQUIPMENT FOR IMMUNOHISTOCHEMISTRY
Inverted fluorescence microscope Leica DMI6000 B
Confocal microscope Leica TCS SP8 laser scanning confocal microscope.
Prism GraphPad
Microtome Leica SM2010R

DOWNLOAD MATERIALS LIST

References

  1. Barker, R. A., Parmar, M., Studer, L., Takahashi, J. Human Trials of Stem Cell-Derived Dopamine Neurons for Parkinson's Disease: Dawn of a New Era. Cell Stem Cell. 21, (5), 569-573 (2017).
  2. Southwell, D. G., et al. Interneurons from embryonic development to cell-based therapy. Science. 344, (6180), 1240622 (2014).
  3. Parmar, M., Torper, O., Drouin-Ouellet, J. Cell-based therapy for Parkinson's disease: A journey through decades toward the light side of the Force. European Journal of Neuroscience. (2018).
  4. Torper, O., et al. In Vivo Reprogramming of Striatal NG2 Glia into Functional Neurons that Integrate into Local Host Circuitry. Cell Reports. 12, (3), 474-481 (2015).
  5. Su, Z., Niu, W., Liu, M. L., Zou, Y., Zhang, C. L. In vivo conversion of astrocytes to neurons in the injured adult spinal cord. Nature Communication. 5, 3338 (2014).
  6. Liu, Y., et al. Ascl1 Converts Dorsal Midbrain Astrocytes into Functional Neurons In Vivo. Journal of Neuroscience. 35, (25), 9336-9355 (2015).
  7. Guo, Z., et al. In vivo direct reprogramming of reactive glial cells into functional neurons after brain injury and in an Alzheimer's disease model. Cell Stem Cell. 14, (2), 188-202 (2014).
  8. Grande, A., et al. Environmental impact on direct neuronal reprogramming in vivo in the adult brain. Nature Communication. 4, 2373 (2013).
  9. Niu, W., et al. In vivo reprogramming of astrocytes to neuroblasts in the adult brain. Nature Cell Biology. 15, (10), 1164-1175 (2013).
  10. Weinberg, M. S., Criswell, H. E., Powell, S. K., Bhatt, A. P., McCown, T. J. Viral Vector Reprogramming of Adult Resident Striatal Oligodendrocytes into Functional Neurons. Molecular Therapy. 25, (4), 928-934 (2017).
  11. Pereira, M., et al. Direct Reprogramming of Resident NG2 Glia into Neurons with Properties of Fast-Spiking Parvalbumin-Containing Interneurons. Stem Cell Reports. 9, (3), 742-751 (2017).
  12. Rivetti di Val Cervo, P., et al. Induction of functional dopamine neurons from human astrocytes in vitro and mouse astrocytes in a Parkinson's disease model. Nature Biotechnology. 35, (5), 444-452 (2017).
  13. Crosson, S. M., Dib, P., Smith, J. K., Zolotukhin, S. Helper-free Production of Laboratory Grade AAV and Purification by Iodixanol Density Gradient Centrifugation. Molecular Therapy Methods & Clinial Development. 10, 1-7 (2018).
  14. Torper, O., et al. Generation of induced neurons via direct conversion in vivo. Proceedings of the National Academy of Sciences of the United States of America. 110, (17), 7038-7043 (2013).
  15. Kawaguchi, Y., Kubota, Y. Correlation of physiological subgroupings of nonpyramidal cells with parvalbumin- and calbindinD28k-immunoreactive neurons in layer V of rat frontal cortex. Journal of Neurophysiology. 70, (1), 387-396 (1993).
  16. Grealish, S., et al. The A9 dopamine neuron component in grafts of ventral mesencephalon is an important determinant for recovery of motor function in a rat model of Parkinson's disease. Brain. 133, (Pt 2), 482-495 (2010).
  17. Thompson, L., Barraud, P., Andersson, E., Kirik, D., Bjorklund, A. Identification of dopaminergic neurons of nigral and ventral tegmental area subtypes in grafts of fetal ventral mesencephalon based on cell morphology, protein expression, and efferent projections. Journal of Neuroscience. 25, (27), 6467-6477 (2005).
바이러스 벡터의 intracerebral 주입에 의해 인터뉴런으로 상주 신경교 세포의 생체 내 직접 재프로그래밍
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Pereira, M., Birtele, M., Rylander Ottosson, D. In Vivo Direct Reprogramming of Resident Glial Cells into Interneurons by Intracerebral Injection of Viral Vectors. J. Vis. Exp. (148), e59465, doi:10.3791/59465 (2019).More

Pereira, M., Birtele, M., Rylander Ottosson, D. In Vivo Direct Reprogramming of Resident Glial Cells into Interneurons by Intracerebral Injection of Viral Vectors. J. Vis. Exp. (148), e59465, doi:10.3791/59465 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter