Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Neuroscience

In vivo Direct omprogrammering av Resident gliacellene Cells til Interneurons av Intracerebrale injeksjon av viral vektorer

doi: 10.3791/59465 Published: June 17, 2019

Summary

Denne protokollen tar sikte på å generere direkte omprogrammeres interneurons in vivo, ved hjelp av et AAV-basert virus system i hjernen og en FLEX synapsin-drevet GFP reporter, som gjør det mulig for celle identifisering og videre analyse in vivo.

Abstract

Konvertering bosatt glia i hjernen til funksjonelle og under type-spesifikke neurons in vivo gir et skritt fremover mot utvikling av alternative celle erstatning terapier samtidig skape verktøy for å studere celle skjebne in situ. Hittil har det vært mulig å få neurons via in vivo omprogrammering, men den presise fenotype av disse neurons eller hvordan de modne ikke har blitt analysert i detalj. I denne protokollen, beskriver vi en mer effektiv konvertering og celle-spesifikk identifisering av in vivo omprogrammeres neurons, ved hjelp av en AAV-basert viral vektor system. Vi tilbyr også en protokoll for funksjonell vurdering av omprogrammeres cellenes neuronal modning. Ved å injisere flip-forbruker (FLEX) vektorer, som inneholder omprogrammering og synapsin-drevet reporter gener til bestemte celletyper i hjernen som fungerer som mål for celle omprogrammering. Denne teknikken gjør det mulig for enkel identifisering av nylig omprogrammeres neurons. Resultatene viser at de oppnådde omprogrammeres neurons funksjonelt modne over tid, motta Synaptic kontakter og vise elektrofysiologisk egenskaper av ulike typer interneurons. Ved hjelp av transkripsjon faktorer Ascl1, Lmx1a og Nurr1, de fleste av de omprogrammeres cellene har egenskaper av fast-skyter, parvalbumin-inneholdende interneurons.

Introduction

Det overordnede målet med denne metoden er å effektivt konvertere hjernen bosatt glia in vivo i funksjonell og under type-spesifikke neurons som parvalbumin-uttrykker interneurons. Dette gir et skritt fremover mot utviklingen av en alternativ celle erstatning terapi for hjernesykdommer uten behov for en eksogene celle kilde. Det skaper også et verktøy for å studere celle skjebne brytere in situ.

Hjernen har bare en begrenset kapasitet for å generere nye neurons. Derfor, i nevrologiske sykdommer, er det behov for eksogene celle kilder for hjernen reparasjon. For dette har ulike kilder til celler blitt utsatt for intens forskning gjennom årene, inkludert celler fra primær vev, stilk cellen-avledet celler og omprogrammeres celler1,2,3. Direkte omprogrammering av fastboende hjerneceller i neurons er en nylig tilnærming som kan gi en attraktiv metode for hjernen reparasjon som den bruker pasientens egne celler for å generere romanen neurons inne i hjernen. Hittil har flere rapporter vist i vivo omprogrammering gjennom viral vektor levering i hjernen4,5,6,78,9 i ulike hjerneregioner som cortex, ryggmargen, striatum og mellomhjernen5,10,11, så vel som i intakt og lesioned Brain5,8,11,12. Både hemmende og eksitatoriske neurons har blitt oppnådd4,8, men den presise fenotype eller funksjonaliteten til disse cellene har ennå ikke blitt analysert i detalj.

I denne protokollen beskriver vi en mer effektiv omprogrammering og celle spesifikk identifisering av in vivo omprogrammeres neurons. Vi tilbyr en protokoll for funksjonell vurdering av neuronal modning og fenotype karakterisering basert på funksjonalitet og immunhistokjemiske egenskaper.

Vi brukte en grobunn-induserbart AAV vektor og en GFP reporter å identifisere in vivo omprogrammeres neurons. Dette valget av viral vektorer har fordelen av å infisere både dele og ikke-splitte celler i hjernen, øke antall målrettede celler, som et alternativ til bruk av retrovirus. En Nevron-spesifikk synapsin-drevet FLEX reporter (GFP), gjorde oss i stand til å spesifikt oppdage den nylig genererte neurons. Tidligere studier har brukt under type-spesifikke arrangører for in vivoomprogrammering, som også tillater uttrykk for omprogrammering gener og journalister i bestemte celletyper. Imidlertid krever at metoden ytterligere identifisering av omprogrammeres neurons av postmortem analyse av co-uttrykk for reporter og neuronal markører. Bruken av en Nevron-spesifikk reporter, slik som den som er beskrevet her, åpner for en direkte identifisering. Dette gir en direkte bevis på en vellykket konvertering og tillater en live celle identifikasjon som er nødvendig for patch-Clamp elektrofysiologi.

Protocol

Alle eksperimentelle prosedyrer ble utført i henhold til EU-direktivet (2010/63/EU) og godkjent av etisk komité for bruk av forsøksdyr ved Lunds universitet og det svenske Landbruksdepartementet (Jordbruksverket). Mus er plassert i en 12 h lys/mørk syklus med ad lib tilgang til mat og vann.

1. viral vektorer

  1. Kloning av AAV-vektorer
    1. For å opprette grobunn-induserbart AAV5 vektorer, sett inn cDNA for GFP, Ascl1, Lmx1a og NR4A2 (Nurr1) i en omvendt retning flankert av to par heterotypical, antiparallel LoxP flip-fjerning (FLEX) sekvenser (tabell av materialer). For cDNA innsetting, bruk en ryggrad som pAAV-CBA-FLEX eller en med en lignende struktur, som inneholder FLEX-sekvenser og en kylling beta utgangen (CBA) promoter.
    2. Sett inn hver enkelt cDNA (f.eks. Ascl1) i ryggraden ved polymerase kjedere reaksjon (PCR) og Begrensnings enzymer. Express GFP under kontroll av en synapsin promoter og Ascl1, Lmx1a, Nurr1 under kontroll av en overalt uttrykt CBA promoter.
      Merk: Sørg for å ha endotoksin gratis DNA ved hjelp av spesifikke Endotoksin-Free plasmider DNA Isolation kits.
    3. Utføre sekvensering og Begrensnings analyse på konstruksjoner før bruk, for å kontrollere suksessen til kloning trinnet.
  2. AAV5 viral vektor produksjon
    Forsiktig: Se lokale retningslinjer for biosafety ved håndtering av adeno virus (AAV). I Sverige krever AAV som brukes i denne protokollen, biosafety nivå 2 (BSL-2).
    1. Seed HEK293T celler med standard kultur medier (DMEM + Glutamax + 10% FBS + penicillin (100 U/ml) Streptomycin (100 μg/mL), se tabell av materialer) i T175 flasker med en tetthet på 3 x 106 celler per kolbe. Konto for 5 flasker per batch av AAV og plan for 6 grupper om gangen.
    2. Når cellene når 50-70% confluency, klargjør du følgende blanding for transfeksjoner (per 175 cm2 flaske).
      1. I en 50 mL sentrifugerør, tilsett ekvimolare mengder vektor plasmider og pDG serie hjelper plasmider (pDP5, pDP6), med en total mengde 72 μg per 175 cm2 kolbe.
      2. Legg til Tris-EDTA-buffer (TE-buffer, 10 mM Tris-HCl, 1 mM EDTA) til et endelig volum på 144 mL.
      3. Legg ultrarent vann slik at det totale volumet blir 1296 mL og bland.
      4. Tilsett 144 μL av 2,5 M CaCl2 og bland. Tilsett 1,92 μL av HEPES bufret Saline (HBS) (1,5 mM na2HPO4 , 140 mM NACL, 50 mm HEPES) til DNA-løsningen og bland umiddelbart ved virvlingen.
      5. Ruge ved romtemperatur (RT) for nøyaktig 60 s. Overfør løsningen til 28 mL frisk cellekultur medier og bland.
    3. Bytt medium i flaskene med cellekultur medium som inneholder transfeksjoner mix.
    4. Tre dager etter transfeksjoner, høste cellene ved å helle av THR medium fra flaskene til en disponibel beholder for avfall og tilsett 5 mL av innhøstingen buffer (EDTA lagt til fosfat-bufret Saline, se tabell over materialer, DPBS til en endelig konsentrasjon 5 mM) til en konsentrasjon på 5 mM) i hver kolbe for å tillate celle avløsning.
    5. Hell celle oppløsningen i et 50 mL sentrifugerør. Legg til en annen 4 mL DPBS til hver kolbe for å skylle de resterende cellene og bassenget med første celle løsning. Sentrifuger høstes cellene ved 1 000 x g i 5 min ved 4 ° c.
    6. Etter sentrifugering, Fjern supernatanten og oppløse pellets i 15 mL av lyseringsbuffer (50 mM Tris-HCl pH 8,5, 150 mM NaCl, 1 mM MgCl2) av virvlingen.
    7. Frys dem i CO2-Ice/etanol bad i 15 min og lagre i en-20 ° c fryser. Tin høstes celle lysat i et vannbad på 37 ° c før bruk.
  3. AAV5 viral vektor rensing
    1. Utfør AAV rensing av Iodixanol gradient Ultracentrifugation13 og bruk ultracentrifuge tetnings rør med sentrifugering på 350 000 x g for 1 t og 45 min ved RT.
    2. Bruk en 10 mL sprøyte med en 18G nål og sett inn ca 2 mm under 40/60% fasegrensen med den skråkanten vendt oppover for å trekke ut den AAV-inneholdende fasen. Sørg for å stoppe før du når proteinet bandet etter 5-6 mL er trukket ut.
    3. Oppbevar graderings ekstrakter i autoklaveres glass flasker ved 4 ° c. Unngå å lagre ganger lengre enn over natten.
    4. Fortynne Iodixanol gradient ekstrakt 3-fold ved langsomt pipettering i 12 mL Iodixanol eluering (IE) buffer (20 mM Tris-HCl pH 8,0, 15 mM NaCl) mens virvlende.
    5. Rens og Konsentrer fortynnet Iodixanol gradient gjennom et anion utvekslings filter. Skyv den gjennom sakte med en hastighet ikke raskere enn 1 dråpe/s. Skyv 3 mL IE buffer langsomt gjennom filteret for å vaske den.
    6. Eluere til en sentrifugal Filterenhet med 1-2 mL eluering buffer (20 mM Tris-HCl pH 8.0; 250 mM NaCl). Legg DPBS til enheten til et endelig volum på 4 mL. Sentrifuger på 2 000 x g ved RT til mindre enn 0,5 ml er igjen i filteret. Fjern væsken fra bunnen av røret, fyll på med 4 mL DPBS og sentrifuger igjen. Gjenta dette trinnet to ganger til. Kontroller at volumet av konsentrert vektor på filteret er omtrent 200 μL etter siste sentrifugering trinn.
    7. Fjern 200 μLconcentrated vektor ved hjelp av en pipette og skyv konsentrat gjennom et 0,22 mm filter for å sterilisere det. Alikvot 200 μLinto et 9 mm hetteglass med interlocked innlegg (tabell med materialer).
      Merk: AAV5 vektorer kan oppbevares i-80 ° c frysere for lang lagring, eller ved 4 ° c hvis brukt innen 2 uker.
  4. AAV5 viral vektor titer bestemmelse
    1. Bestem AAV5 titer ved hjelp av standard kvantitativ polymerase kjede reaksjon (qPCR) med grunning for invertert Terminal REPEAT (ITR) sekvens og en 5 ́fam/3 ́BHQ1 SONDE for ITR sekvens (tabell av materialer). Bruk en standard kurve oppnådd med kjente mengder ITR som inneholder plasmider. Hver AAV vektor bør ha en rekke 1E+ 14 -1e+ 15 Genova eksemplarer per milliliter hvis ITR sekvensen brukes til titer besluttsomhet.
      Merk: En vellykket AAV5 virus produksjon gir aksjer med titers i minimum utvalg av 3E+ 13 -7e+ 13 enheter/ml.

2. injeksjon av omprogrammering faktorer inn i hjernen

  1. Animal oppsett, stereotaxic plassering og boring
    Merk:Denne protokollen fokuserer på bruk av Ascl1, Lmx1a og Nurr1 (ALN) for omprogrammering av NG2 glia i interneurons. I vår erfaring, interneurons av en lignende fenotype kan fås ved hjelp av andre faktor kombinasjoner11.
    1. Før kirurgi, forberede viral Mix inneholder vektorer CBA-FLEX-Ascl1, CBA-FLEX-Lmx1a, CBA-FLEX-Nurr1 og reporter vektor syn-FLEX-GFP. Legg hver enkelt av aksjene utarbeidet i § 1 til den endelige blandingen, slik at den endelige viral løsning har 5% av hver og en av de omprogrammering faktorene (Ascl1, Lmx1a og Nurr1) og 10% av reporteren konstruere (5% A, 5% L, 5% N og 10% GFP).
      Merk: AAV5 vektor mikser kan oppbevares ved 4 ° c og oppbevares for fremtidig bruk in vivo.
    2. Dop musa med 2% isoflurane i en blanding av luft og lystgass (N2O) ved en 4:1 ratio. Overvåk dyrets pust ved å observere bevegelsene til membranen. Under operasjonen, opprettholde anestesi med 1-1.5% isoflurane.
      Merk: Muse modellen er herved beskrevet består av en mus stamme som spesifikt uttrykker grobunn i NG2 glia. In vivo omprogrammering kan oppnås ved hjelp av ulike mus stammer som uttrykker grobunn i andre populasjoner av gliacellene celler (f. eks astrocytter14).
    3. Når Dyret er helt anesthetized (f. eks, komplett muskel avslapping og ingen respons på en klype i foten pad), barbere området rundt snittet området og bringe dyret til stereotaxic rammen.
    4. For å opprettholde dyrets kroppstemperatur under operasjonen, fest en varmepute til bunnen av stereotaxic rammen. Plasser musen på et rent, tørt papir håndkle.
    5. Plasser muse hodet forsiktig inn i øre linjene. Hvis riktig plassert, bør ingen sideveis bevegelse av hodet observeres. Sett venstre øre linjen til 4 mm, før du begynner å plassere musen i stereotaxic rammen.
    6. Fest tann stangen på plass, og stram deretter nese linjen. Pass på at hodet ikke beveger seg i noen dimensjon og peker rett fram (midtlinjen blir vinkelrett på flyet av øret barer). Påfør øyen-salve for øyebeskyttelse.
    7. Før begynnelsen av operasjonen, administrere den aktuelle analgesi (f. eks, 0,05 mg/kg buprenorfin, sub-hud).
    8. Rengjør snittområdet med en bomull gasbind eller en tørk fuktet med 70% EtOH, uten nærmer øyet området.
      Merk: For intracerebrale viral injeksjon brukes en 5 eller 10 mL sprøyte som er tilpasset med en trukket glass kapillær. Glass blodkar trekkes ved hjelp av en micropipette avtrekker, noe som resulterer i en kapillær med en veldig fin spiss, som vil minimere invasiveness av prosedyren. For å tilpasse kapillær inn i sprøyten, bruk et stykke gummi rør over sammenhengen mellom nålen på sprøyten og glass kapillær og smelte den ved hjelp av en varmekilde (f. eks, en lighter). En stram forbindelse mellom de to brikkene vil sørge for at det ikke er noen væske lekkasjer under injeksjonen. Før du starter operasjonen, test dette ved å fylle sprøyten med saltvann og skyve væsken ut av sprøyten.
    9. Lag et snitt på ca 0,5-0,8 cm langs midtlinjen av hodet. Skjær gjennom både hud og sub-hud lag, med en skalpell.
    10. Utvide hud klaffene på hver side av snittet. Rengjør snittet av noe blod og skrape tilbake subkutan lag med en bomulls knopp.
    11. Beveg M/L-D/V-armen på stereotaxic ammen på plass (over dyret) og fest den.
      Merk: Den stereotaxic rammen gjør det mulig å justere sprøyten langs aksen for fremre/bakre (A/P, Y-akse), midtre/laterale (M/L, X-akse) og rygg/ventrale (D/V, Z-akse).
    12. Beveg sprøyten langs den andre aksen i den stereotaxic rammen, for å bringe tuppen av glass kapillær like over bregma (knutepunktet der de forskjellige hodeskallen møtes).
    13. Sørg for at kapillær spissen er helt rett i både A/P og M/L-flyene. I tilfelle av en tvetydig bregma, ta gjennomsnittet av lateral og midtlinjen sting.
    14. Når spissen av kapillær er riktig plassert over bregma, tilbakestille både M/L og A/P-verdier til 0,0 på den digitale koordinat telleren.
    15. For å være sikker på at dyrets hode er i en helt flat posisjon, bruk den digitale koordinat telleren til å måle D/V-koordinat verdien, når A/P-armen er på + 2,0 og-2,0 (M/L = 0,0), så vel som når M/L-armen er på + 2,0 og-2,0 (A/P = 0,0). Juster høyden på tann bar og øre linjer tilsvarende.
    16. Flytt sprøyten til ønsket koordinater for injeksjon av virale vektorer i striatum (A/P = + 1,0; M/L =-2,0, i forhold til bregma).
    17. Hev sprøyten litt og, ved å se på injeksjonsstedet gjennom mikroskopet, bore et hull ved hjelp av en tannlege Drill på injeksjons koordinatene. Begynn å bore på stedet, arbeider i sirkulær og skånsom måte.
      Merk: Ikke Legg for mye press, da borekronen skal være skarp nok til å gå gjennom benet uten ekstra kraft. Unngå lang, vedvarende boring da dette skaper varme.
    18. På slutten av boringen, sjekk at Dura mater forblir intakt og utsatt for injeksjon.
  2. Tilberedning av sprøyte oppsett
    1. Legg et stykke bomulls gasbind over det åpne snittet og skyll sprøyten med saltoppløsning.
    2. Etter spyling tar du opp en luftboble på 1 – 2 μL, etterfulgt av 1 μL oppløsning som inneholder virus vektorene, og unngår utilsiktede bobler. Sørg for at viral løsning kan lett bli vist under luftboble, mens blir injisert.
  3. Viral injeksjon
    1. Fjern bomulls gasbind fra over snittet området, og senk sprøyten ved hjelp av D/V arm av stereotaxic rammen. Som overflaten av skallen er nærmet seg, nøye se gjennom mikroskopet og måle D/V nivå Dura mater-det bør bule litt under mildt trykk.
    2. Mens berøre Dura mater med spissen av kapillær, sette D/V koordinat til 0,0.
    3. Senk sprøyten, progresjon langsomt til ønsket dybde (D/V =-2,7, i forhold til Dura mater). Pass på at banen er klar av bein fragmenter, slik at ingen bøying av nålen/kapillær er observert.
      Merk: De presenterte koordinatene viser til en injeksjon av omprogrammering faktorer i striatum hos NG2-grobunn-mus. Koordinater som tilsvarer andre hjerneregioner, kan brukes. Alltid teste koordinatene for injeksjon først ved hjelp av et fargestoff (f. eks Trypan Blue), farget perle injeksjon eller en reporter viral vektor før injeksjon av omprogrammering faktorer inn i hjernen av en ny mus belastning. Hvis sprøytebruk Trypan Blue, dyrene trenger å bli ofret umiddelbart etter operasjonen og hjernen dissekert ut. Friske hjerner kan kuttes ved hjelp av en mikrotomen, mens frosset, og injeksjonsstedet bestemmes av visualisering av fargestoff posisjon i hjernen. Hvis testing koordinater ved hjelp av fargede perler, er det mulig å bestemme injeksjonsstedet på perfusert og kutte hjernen en uke etter injeksjon. Alternativt kan en injeksjon med en viral vektor bærer en reporter genet brukes, og injeksjonsstedet bestemmes i perfusert kuttet hjernen.
    4. Injiser 1 μL av viral oppløsning med en hastighet på 0,4 μL/min. Når hele volumet injiseres, tillate en diffusjon periode på 2 min før sprøyte uttak.
    5. Etter diffusjon, langsomt trekke sprøyten til spissen av kapillær er helt ut av hjernen.
    6. Legg et stykke bomulls gasbind over såret og skyll sprøyten med saltoppløsning.
    7. Flytt M/L-D/V-armen på den stereotaxic rammen ut av arbeidsområdet.
  4. Sår lukking og postoperativ prosedyrer
    1. Nøye Sutur snittet ved hjelp av Sutur tråden.
      Merk: Alle Sutur tråder brukt i injisert dyr skal kastes i en kopp/hetteglass med anti-viral vaskemiddel løsning. Den samme løsningen brukes til å rense alle overflater rundt operasjonsområdet som har vært i kontakt med kirurgiske materialer. Alle kirurgiske verktøy er grundig vasket og autoklaveres på slutten av hver kirurgi dag.
    2. Fjern dyret fra stereotaxic ramme og plasser den i en post-operative stasjon, som inkluderer en ren, oppvarmet bur, tilgang til mat og vann, og hvor dyret forblir til helt våken. I løpet av denne perioden, overvåke dyret tett inntil bevisstheten er gjenvunnet.
    3. Ikke huset opererte dyr med ikke-opererte dyr før det tidligere har helt utvinnes fra kirurgi.
    4. Tilsyn operert dyr daglig. Avhengig av sting som brukes, sørg for at de er fjernet om nødvendig. Alle dyrene fikk Bupenorphinum (Temgesic for 1ml/kilos) subkutan idet stolpe operative bekymre.
      Merk: Hvis drift ved hjelp av den samme sprøyten i to påfølgende dager, skyll den med vann, etterfulgt av etanol 70% og vann igjen. La sprøyten fylles med vann over natten, slik at det blir mulig å oppløse eventuelle rester.

3. elektrofysiologisk innspillinger

  1. Vev skive forberedelse for elektrofysiologi
    Forsiktig: En godt utført vevs forberedelser er nødvendig for å oppnå gode elektrofysiologisk innspillinger. Forbered rommet forsiktig og plasser verktøy for å disseksjon på is.
    1. Forbered iskald og oxygenized (95% O2 og 5% co2) Krebs løsning for disseksjon og skjæring (Forbered dette på samme dag fra 10x lager ved å fortynne aksjen løsning i Ultrarent vann og legge NaHCO3 og glukose). Komponentene i Krebs-løsningen i mM (etter fortynning til 1x) er: 126 NaCl, 2,5 KCl, 1,2 NaH2PO4· H2O, 1,3 MgCl2· 6h2o og 2,4 CaCl2· 6h2o, 22 NaHCO3, 10 glukose. Juster pH-verdien i løsningen til 7,4.
    2. Utfør en kalibrering (Vibracheck) for vibratome med et nytt barberblad.
    3. Start kjøle blokken på vibratome (eller fyll det omgivende kammeret med is), fyll skjære kammeret med Krebs løsning for oksygenering med 95% O2 og 5% co2 minst 30 min før bruk.
    4. Sett en Petri parabolen på isen og fyll den med oxygenized Krebs løsning. Plasser blad, saks og monteringsplate på isen.
      Forsiktig: Ta med buret som inneholder musen til rommet minst 1 time før du starter prosedyren for Akklimatisering. Stress har en negativ effekt på tilstanden til hjernevevet seksjoner.
    5. Uhelbredelig bedøve musen ved å injisere en overdose av pentobarbital og la dyret sovner.  Når glimtet refleks er ute og dyr ikke reagerer på smerte stimuli, transcardially perfuse dyret med iskald Krebs løsning for 2-3 min (med en hastighet på 10-20 mL/min).
    6. Raskt, men nøye, analysere ut hjernen og putte den opp ned i Petri-parabolen som er plassert på is (som inneholder Krebs løsning).
      Merk: For å sammenligne funksjonell modning av omprogrammeres neurons, ofre dyrene for opptak på ulike tidspunkt-poeng etter viral injeksjon. Vurdere avfyring egenskaper av forskjellige under typer av neurons basert på eksisterende litteratur15 .
    7. Lag en koronale kuttet langs midten av lillehjernen og lim denne siden på monteringsplaten (også iskald) for vibratome skjæring.
    8. Dypp limt hjernen forsiktig inn i buffer kammeret i vibratome.
      Forsiktig: Vær forsiktig så du ikke berører barberbladet for din egen sikkerhet, og slik at bladet vil forbli kalibrert.
    9. Skjær fra den mest rostral delen av hjernen ned til stria tale nivå i høy hastighet. Deretter klippes striatum-koronalt ved 275 mm ved lav hastighet (0,10 mm/s).
    10. Etter hvert kutt, forsiktig fjerne ikke-injisert stria tale side (f. eks, med en bøyde nål) og overføre injisert side i et annet hetteglass i et vannbad, som inneholder en bunn netto (oxygenized Krebs på RT) plassert i et vannbad. Oppbevar dette på RT til alle seksjoner er kuttet.
    11. Sakte øke temperaturen i vannbad til 37 ° c og la den i 30 min. Deretter slår av ovnen og la avkjøles til RT.
      Merk: på dette tidspunktet kan du ta en pause til du starter opptaket. Seksjonene vare for 4-6 h.
  2. Hel celle patch-klemme innspillinger
    1. Overfør den første vevs delen til opptaks kammeret nedsenket i en kontinuerlig strøm av Krebs løsning. Monter seksjonen med lette vekter og senk målet.
    2. Identifiser stria tale regionen i mikroskopet og søk etter GFP-positive (omprogrammeres) neurons. Velg en Nevron som er omfattende i morfologi og ikke dekkes av fiber bunter eller blodkar.
    3. Klargjør Borosilikatglass glass Pipetter (3 – 7 MΩ) for patching og fyll med følgende intracellulære oppløsning (i mM): 122,5 kalium gluconate, 12,5 KCl, 0,2 EGTA, 10 HEPES, 2 MgATP, 0,3 na3GTP og 8 NaCl, justert til pH 7,3 med Koh.
    4. For biocytin fylling, tilsett 1 mg biocytin salt til 1 mL intern oppløsning og Vortex.
      Forsiktig: Sørg for å filtrere den interne løsningen med biocytin, da dette ellers kan tette elektroden.
    5. Fest glass pipette til opptaks elektroden og dypp den i løsningen. Dobbeltsjekk motstanden til elektroden. Så sakte nærme cellen med pipette, holde et svakt positivt trykk i elektroden for å unngå å plugge spissen.
      Forsiktig: Vær nøye med å holde styr på cellen mens du synkende elektroden og ikke bleke fluorescens i cellen (dvs. slå av fluorescens lampen når du ikke trenger det).
    6. Skyll det omgivende vevet nøye ved hjelp av positivt trykk på elektroden og nærme seg cellen med elektroden. Finn elektroden rett på toppen av cellen og ned til elektroden touchd membranen. Lag en Giga-Ω Seal mellom elektroden og cellemembranen, og med negativt trykkpulser, brudd membranen for å skape en hel celle patch.
      Forsiktig: Omprogrammeres neurons er følsomme. Vær forsiktig når patching og ikke legge for mye negativt trykk når du når en Giga-Ω Seal eller åpne cellemembranen. Også, patching på dyr som er eldre krever praksis og tålmodighet som deres bindevev er tykkere og det er vanskeligere å visualisere neurons.
    7. Sjekk hvile membranen potensialer umiddelbart etter innbrudd i gjeldende-klemme modus og skrive ned for analyse.
    8. I gjeldende klemme, opprettholde cellen mellom-60 mV til-80 mV og injisere 500 MS strømninger fra-20 pA til + 90 pA, med 10 pA trinn for å indusere handling potensialer.
    9. Overfør til spennings-klemme og måle innover natrium og forsinket rectifying kalium strømmer ved depolariserende trinn på 10 mV.
      Merk: Spennings-klemme innspillinger er bedre vurdert ved hjelp av en annen intern løsning, sammensatt av kjemikalier som mer effektivt klemme membranen. Men for omprogrammeres neurons, antall celler som du kan ta opp fra er få og antall vev seksjoner med disse neurons er begrenset. Derfor er det en fordel å ta opp både i gjeldende-klemme og spenning-klemme fra samme celle.
    10. I spennings klemme modus, ta opp spontan postsynaptic aktivitet ved-70 mV. Skill hemmende postsynaptic hendelser ved et membran potensial på 0 mV fra eksitatoriske hendelser på-70 mV.
    11. Etter å ha nådd en stabil Baseline, legge Pikrotoksin, den GABAen reseptor motstander, til Krebs løsning som renner inn i innspillingen kammer, for å trekke ut eksitatoriske hendelser (legge til en lagerløsning av pikrotoksin til en endelig konsentrasjon av 50 mm i separate buffer sprøyten som er koblet til kammeret. Koble strøm av buffer fra kammeret til en vakuum pose for sikker avhending).
    12. Etter 20 min, legge CNQX (20 mM), en AMPA motstander, til Krebs løsning som renner inn i opptaket kammeret, for å blokkere hemmende hendelser (ved hjelp av samme prosedyre som for Pikrotoksin). La i for en annen 20 min og deretter vaske ut med Krebs løsning. Fjern vevs delen fra kammeret.
    13. Etter å ha fullført opptakene, gjør en offline analyse av spontane eksitatoriske post-Synaptic strømninger (EPSC) og hemmende post-Synaptic strømninger (IPSC) ved hjelp av en terskel-hendelse deteksjon (> 5 pA) i analysen programmet.
    14. Under hele opptaket blir cellen langsomt fylt med den biocytin interne løsningen. Oppbevar plasteret i minst 20 minutter før du langsomt fjerner elektroden for å oppnå fullstendig fylling av cellen.
      Forsiktig: Vær forsiktig så du ikke har noe positivt trykk i elektroden som kan ødelegge påfølgende morfologiske analyse av cellene etterpå.
    15. For biocytin-visualisering, Legg vevs delen i 4% paraformaldehyde (PFA) over natten ved 4 ° c. Skyll seksjonen i 0,02 M kalium fosfat buffer (KPBS) med 0,1% Triton. Deretter beis for streptavidin-Cy3 (1:600 i KPBS-T, 2 h), for identifisering av den biocytin celle og morfologiske visualisering av omprogrammeres Nevron.
      Merk: Biocytin fylling kan brukes til morfologiske analyse og illustrasjoner av lappet neurons.

4. immunhistokjemi, Stereology og kvantifisering

Merk: Dedikere en bestemt gruppe mus for immunhistokjemi, siden vevs deler som brukes til elektrofysiologi ikke er optimale for immunhistokjemi.

  1. Dop mus med en IP injeksjon av en overdose av pentobarbital og montere dyret for.
  2. Transcardially perfuse musene, først med en saltløsning for å fjerne blod, og deretter med iskald 4% PFA.
  3. Analysere hjernen og post-Fix i minst 12 timer i 4% PFA.
  4. Sett hjernen i 25% sukrose løsning (for cryoprotection) for ca 12 h.
    Merk: Hjernen er klar til å bli kuttet når de synker i 25% sukrose løsning, noe som indikerer at sukrose har trengt hele musen hjernen.
  5. Lag en koronale kutt over lillehjernen, bruk den flate, mest caudal delen av hjernen til å plassere hjernen på en mikrotomen og fikse den på plass ved hjelp av optimal skjæring temperatur sammensatte (OCT).
  6. Skjær hjernen i koronale skiver med en tykkelse på 35 mm og dele hjernen i påfølgende serie plassert i ampuller eller brønner som inneholder 0,02 M KPBS.
  7. Behandle seksjonene for immunhistokjemi ved hjelp av antistoffer mot GFP og interneuron markører som GAD65/67, PV, chat (kolin acetyltransferase) og NPY (Neuropeptide Y), ifølge standardprotokoller16, 17.
    Merk: Hjerne skiver kan oppbevares ved 4 ° c eller-20 ° c i frostvæske i lange perioder.
  8. Etter farging er fullført, montere seksjonene på et glass lysbilde og dekk med et glass dekkglass, ved hjelp av en monteringsløsning for å fikse det på plass. La de påsatt dekkglass lysbildene tørke over natten.
    Merk: For våre studier, er hele hjernen kuttet i 1:8-serien (dvs. hvert hetteglass som inneholder seksjoner vil holde en åttende av musen hjernen11).
  9. Analyser avsnittene ved hjelp av et invertert fluorescens og/eller konfokalmikroskopi mikroskop.
    Forsiktig: Fluorescerende mikroskopi er nyttig for en generell oversikt over resultater og opptak av bilder for å beregne omprogrammering effektivitet. For en mer detaljert analyse av fenotypiske identitet ved observasjon av dobbelt-positive celler, bør konfokalmikroskopi Imaging brukes.
  10. For kvantifisering av forskjellige markører uttrykt i GFP+ neurons i striatum, telle antall dobbelt-positive celler i forhold til det totale antall GFP+ celler (dvs. omprogrammeres neurons), i minst to felt av hver stria tale-delen.
  11. For å bestemme omtrentlig ekstrapolert totalt antall omprogrammeres neurons per hjerne, telle GFP+ neurons stede i striatum av en av hjernen serien kuttet tidligere, og deretter multiplisere med det totale antall serier.
    Merk: Ulike metoder for kvantifisering kan brukes til å uttrykke omprogrammering effektivitet, antall omprogrammeres neurons per dyr og prosent av neurons som uttrykker visse fenotypiske markører. Hvis du vil ha mer informasjon, se forrige publikasjon11.
  12. Analyser forskjellene mellom forholdene ved hjelp av Graph pad Prism eller lignende.
    Merk: For effektivitets beregning, injisert vi NG2-grobunn mus med den grobunn-avhengige ALN konvertering VEKTORER og GFP reporter. For å estimere konverteringen effektivitet, vi også injisert dyr med en grobunn-avhengige GFP under allestedsnærværende CBA promoter, rendering alle målrettede celler GFP+. Ved hjelp av denne sammenligningen, anslått vi at 66,81% ± 38,38% av målrettede celler omdannes til neurons. For validering av uttrykk for hver enkelt av genene, kan komplementære dobbelt immunofluorescent-farging utføres for GFP/Ascl1, GFP/Lmx1a og GFP/Nurr1. I tillegg kan det være at alle gener som enkelt celle RNA-sekvenser avslører tilstedeværelsen av genene i de omprogrammeres cellene.

Representative Results

Injeksjon av AAV vektorer brukes for å kunne programmere bosatt NG2 glia celler i neurons i NG2-grobunn-mus striatum (figur 1a). For spesifikt å målrette mot NG2-glia, blir FLEX-vektorer med omprogrammering/reporter-gener satt inn i en antisens retning og flankert av to par med antiparallel, heterotypic loxP-områder (figur 1B). Hver av de tre omprogrammering gener (Ascl1, Lmx1a og Nurr1) er plassert under kontroll av allestedsnærværende CBA promoter på individuelle vektorer. For å sikre at GFP uttrykk er begrenset til omprogrammeres neurons som stammer fra en grobunn-uttrykker celle, er GFP plassert under kontroll av Nevron-spesifikke synapsin promoter, (også i en FLEX vektor).

Bruken av kombinasjonen av omprogrammering og reporter konstruerer tillater generering av GFP-positive neurons i musen striatum (figur 1C, C '). Bruken av reporteren konstruere uten tilstedeværelse av omprogrammering gener gir ikke GFP-positive neurons (figur 1d).

De omprogrammeres neurons som er biocytin er synlige etter obduksjon Immuno-farging (figur 2a). Hvis konverteringen er vellykket, bør det være omfattende neuronal morfologi. Elektrofysiologisk innspillinger av omprogrammeres neurons viser tilstedeværelsen av postsynaptic funksjonelle forbindelser med spontane aktivitets tiltak (fig. 2b, C). Dette kan blokkeres med enten ionotrope GABAergic eller glutamatergic blocker (Pikrotoksin eller CNQX), noe som tyder både eksitatoriske og hemmende Synaptic innspill til omprogrammeres neurons. Forekomsten av spontan aktivitet øker med tiden etter viral injeksjon (figur 2D), noe som indikerer en gradvis modning.

Current-indusert handling potensialer er til stede i funksjonelle neurons. Handlingen potensialer økning i antall over tid etter konvertering (figur 2e). Dette indikerer ytterligere modning i neuronal funksjon. I en umoden Nevron, gjeldende vil indusere enten ingen eller svært få handling potensialer (figur 2F).

Avfyring mønstre av en Nevron er celle type bestemt som det avhenger av faktorer som morfologi av cellene og kanal uttrykket15. De innspilte mønstrene i in vivo omprogrammeres neurons kan skilles i grupper og i forhold til endogene neuronal under typer, f. eks fast-skyter interneurons (Cell type B, figur 3b) eller andre celletyper (figur 3a, C, D ). De observerte elektrofysiologisk forskjellene kan bekreftes ved tilstedeværelsen av spesifikke under type markører og co-uttrykk med GFP (figur 3e-H). I alt tyder disse dataene på at de omprogrammeres neurons som finnes i striatum har egenskaper av ulike typer interneurons, slik som Parvalbumin-, ChAt-og NPY-uttrykker interneurons, så vel som stria tale medium spiny Nevron identitet (DARPP32 +) ( Figur 3e -H).

Figure 1
Figur 1: in vivo omprogrammering av bosatt NG2 glia inn neurons. (A) skjematisk fremstilling av AAV virus-mediert in vivo omprogrammering av stria tale NG2 glia. (B) skjematisk fremstilling av AAV5 Flex konstruerer brukt for in vivo omprogrammering, der genuttrykk er regulert av grobunn uttrykk i målrettede celler. (C og C ') in vivo omprogrammeres neurons, som følge av syn-GFP + ALN-injeksjon i striatum. (D) fravær av omprogrammeres neurons når ingen omprogrammering faktorer er lagt inn i viral cocktail, og bare reporter konstruere injiseres in vivo. Vektstenger = 100 mm (C), 25 mm (C '), 25 mm (D). Vennligst klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: in vivo omprogrammeres neurons er funksjonell og viser modning over tid. (A) Biocytin-fylt omprogrammeres Nevron, viser eldre neuronal morfologi, inkludert dendrittiske pigger. Spor viser (B) hemmende (GABAergic) aktivitet som er blokkert med pikrotoksin, en GABAen reseptor motstander og (C) EKSITATORISKE aktivitet som er blokkert med CNQX, en AMPA reseptor motstander. (D) antall neurons med postsynaptic aktivitet øker over tid. (E) lappet neurons Vis repeterende avfyring allerede på 5 uker etter injeksjon (w.p.i.) og fortsette å vise at ved 8 og 12 W.p.i. (F) Current-indusert handling potensial og postsynaptic aktivitet av en umoden Nevron, viser få Synaptic hendelser og få handling potensialer i forhold til B og D. Scale bar = 25 mm Vennligst klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3: in vivo omprogrammeres neurons viser immunhistokjemiske og elektrofysiologisk egenskaper stria tale interneurons. (A-D) Avfyring mønstre av in vivo omprogrammeres neurons kan være av forskjellige typer: (A) type A er lik endogene medium spiny NEVRON (DARPP32 +); (B) ligner på hurtig SKYTER (PV +) interneurons; (C) lik lav terskel skyter neurons med fremtredende sag (NPY +); (D) neurons avfyring med store etter-hyperpolarization (chat +). (E-H) Konfokalmikroskopi bilder som viser co-lokalisering av GFP og interneuron markører PV (E), ChAT (F), NPY (G), og projeksjon Nevron markør DARPP32 (H). Alle skala bars = 50 mm. Vennligst klikk her for å se en større versjon av dette tallet.

Discussion

In vivo direkte omprogrammering kan oppnås ved hjelp av AAV FLEX vektorer i grobunn-uttrykker musen stammer. Det er viktig å merke seg at forskjellene mellom mus stammer med hensyn til omprogrammering effekt er observert. For in vivo-omprogrammering i striatum har NG2-grobunn vist seg å være mer effektiv sammenlignet med andre stammer. Før du begynner å bruke en ny dyr belastning, er det viktig å sjekke musen leverandøren retningslinjer angående grobunn uttrykk over tid, som en alder av dyr ofte påvirker spesifisitet av dette proteinet uttrykket. I våre studier, dyr eldre enn 12 uker ble ikke brukt til in vivo omprogrammering som det var en risiko for grobunn uttrykk i celler enn NG2 glia. Den konstante tilstedeværelsen og overvåking av kontroll dyr injiseres bare med Synapsin-FLEX-GFP konstruere anbefales. Dette gjør det mulig å overvåke dyrene for GFP-positive celler som ikke skal være til stede hvis ingen omprogrammering gener (ALN) brukes.

For å identifisere de nylig omprogrammeres neurons, en Nevron-spesifikk identifisering metode som beskrevet i denne protokollen er av største betydning. Dette gir en riktig identifisering og forskjellsbehandling av omprogrammeres neurons fra endogene omkringliggende celler som er av særlig relevans når omprogrammering i en homotopic region.

Det er også viktig å målrette riktig struktur for viral injeksjon. Derfor er stereotaxic kirurgi for viral injeksjon viktig og må nærmet med nøyaktighet, spesielt når målretting mindre strukturer i hjernen.

Vi har tidligere vist11 at det ikke er pålitelig å forutsi utfallet av in vivo-omprogrammering basert på in vitro omprogrammering eksperimenter ved bruk av de samme omprogrammering faktorene. Alle faktorer av interesse må derfor testes in vivo. I våre hender gir mange forskjellige faktor kombinasjoner den samme under typen av neurons (dvs. interneurons11 in vivo) til tross for at disse genene har vært innblandet i utviklingen av andre neurons.

Hel celle patch klemme for omprogrammeres neurons er en delikat teknikk og vev behandling er viktig for et godt utfall. Med iskald Krebs-oppløsning forbedres vevs kvaliteten. Også lappet neurons må behandles nøye. Selv om modning og fenotypiske identiteten til omprogrammeres neurons kan bli noe vurdert ved hjelp av hele cellen patch klemme, disse cellene er ikke helt sammenlignbare med sine endogene kolleger. Flere typer analyser, for eksempel sekvens sekvenser (for eksempel RNA-sekvenser), bør brukes for å bekrefte omprogrammeres celle identitet ytterligere.

Teknikken beskrevet her er kan vurderes for utvikling av fremtidige terapier der neuronal utskifting er nødvendig i hjernen. Selv om in vivo omprogrammering fortsatt er på et tidlig stadium og oversettelsen til mennesker ennå ikke er forutsett, kan denne teknikken gi en metode for å vurdere eksogene gen funksjon i hjernen og studere celle modning i vivo.

Disclosures

Forfatterne har ingenting å avsløre.

Acknowledgments

Marcella Birtele har blitt finansiert av European Union Horizon 2020 program (H2020-MSCA-ITN-2015) under Marie Skłodowska-Curie nyskapende trening nettverk og Grant Agreement no. 676408. Daniella Rylander Ottosson har blitt finansiert av Swedish Research Council (2017-01234).

Materials

Name Company Catalog Number Comments
REAGENTS FOR AAV5 CLONING AND VIRAL VECTOR PREPARATION
pAAV-CA-FLEX AddGene 38042
Ascl1 AddGene 67291 NM_008553.4
Lmx1a AddGene 33013 NM_0033652.5
Nurr1 AddGene 35000 NM_013613.2
GFP-syn AddGene 30456
LoxP (FLEX) sequence 1 GATCTccataacttcgtataaagtatcctatac
gaagttatatcaaaataggaagaccaatgcttc
accatcgacccgaattgccaagcatcaccatcg
acccataacttcgtataatgtatgctatacgaa
gttatactagtcccgggaaggcgaagacgcgga
agaggctctaga
LoxP (FLEX) sequences 2 tactagtataacttcgtataggatactttatac
gaagttatcattgggattcttcctattttgatc
caagcatcaccatcgaccctctagtccacatct
caccatcgacccataacttcgtatagcatacat
tatacgaagttatgtccctcgaagaggttcgaa
ttcgtttaaacGGTACCCTCGAC
pDP5 Plasmid Factory PF435
pDP6 Plasmid Factory PF436
Phosphate-Buffered Saline (PBS) Thermo Fisher Scientific 10010023
FBS (Fetal bovine serum) Thermo Fisher Scientific 10500064
Penicillin streptomycin Thermo Fisher Scientific 15140122
DMEM (Dulbecco's Modified Eagle Medium)+ Glutamax Thermo Fisher Scientific 61965026
DPBS (Dulbecco's Phosphate Buffer Saline) Thermo Fisher Scientific 14190094
HEK293 cells Thermo Fisher Scientific 85120602-1VL
Flasks BD Falcon 10078780 175 cm2
Tris H-CL Sigma Aldrich 10812846001 For TE buffer use 10 mM, pH 8.0; for lysis buffer use 50mM, pH 8.5; for IE buffer use 20 mM, pH 8.0; for elution buffer use 20 mM, pH 8.0
EDTA EDTA: Invitrogen EDTA: AM9260G For TE buffer use 1 mM EDTA
Ultrapure water see Ultrapure water system
CaCl2 SigmaAldrich C5080 2.5 M
Dulbecco´s phosphate-buffered saline (DPBS) Thermo Fisher Scientific 14190136
NaCl Sigma-Aldrich S3014 FOR HBS use 140 mM; for Lysis Buffer use 150 mM; for IE buffer use 15 mM; for elution buffer use 250 mM
MgCl2 Sigma-Aldrich M8266-100G For lysis Buffer: 1 mM
Ultracentrifuge sealing tubes Beckman Coulter Quick-Seal® Polypropylene Tube
OptiPrep™ Density Gradient Medium Sigma Aldrich D1556-250ML
10-mL syringe-18G needle BD 305064
Laboratory glass bottles VWR ?
Anion exchange filter PALL laboratory MSTG25Q6 Acrodisc unit with Mustang Q membrane
Centrifugal filter unit Merck Z740210-24EA Amicon Ultra-4 device
Endotoxin-Free Plasmid DNA Isolation Kits Thermo Fisher Scientific A33073
Na2PO4 Sigma-Aldrich S7907
HEPES Sigma-Aldrich H7523 15 mL
Falcon tube Thermo Fisher Scientific Corning 352196
Falcon tube Thermo Fisher Scientific Corning 352070
Glass Vials Novatech 30209-1232 CGGCCTCAGFGAGCGA
Forward Primer for Inverted Terminal Repeat (ITR) sequence GGAACCCCTAGTGATGGAGTT
Reverse Primer for Inverted Terminal Repeat (ITR) sequence CACTCCCTCTCTGCGCGCTCG
5´FAM / 3´BHQ1 probe Jena Bioscience
0.22 mm filter Merck SLGV004SL Millex-GV filter
EQUIPMENT AAV5 VIRAL VECTOR PREPARATION
Freezer -20 °C
Freezer -80 °C
Fridge +4 °C
AAV viral room
Ultrapure Water system Merck Milli-Q® IQ 7000
Vortex mixer VWR 444-0004
Ultracentrifuge Beckman Coulter Beckman Optima LE-80K Ultracentrifuge
Autoclave Tuttnauer 2540 EL
Polymerase Chain Reaction (PCR) BioRad C1000 Touch Thermal Cycler
Quantitative PCR (qPCR) Roche LightCycler® 480 System
Centrifuge Thermo Fisher Scientific Sorvall ST16
Water Bath Thermo Fisher Scientific TSGP02
ANIMAL MODEL
NG2-Cre mice Jackson NG2-CrexB6129, Stock #008533
REAGENTS FOR INJECTION OF REPROGRAMMING FACTORS INTO THE BRAIN
Water
Saline Apoteket AB 70%
Ethanol Solveco
Isolfurane Apoteket AB Dilute to 1% solution with warm water.
Virkon Viroderm 7511 
Pentobarbital Apoteket AB P0500000 i.p. for terminal procedure at the dose of 60 mg/ml.
Sucrose Merck S0389-500G
Trypan Blu Thermo Fisher Scientific 15250061
Retrobeads Lumafluor R170
Buprenorphine Apoteket AB
EQUIPMENT FOR INJECTION OF REPROGRAMMING FACTORS INTO THE BRAIN From RSG Solingen.
Scissors VWR 233-1552 From Biochem.
Tweezers VWR 232-0007
Forcep VWR 232-0120
Scalpel holder VWR RSGA106.621 Number 20.
Scalpel VWR RSGA106.200
Stereotaxic frame Stoelting Europe 51500D
Mouse ear bars Stoelting Europe 51648 5 ul
Syringe with Removable needle Hamilton Company 65 0,75 inner diameter and 1.5 outer diameter.
Glass capilaries Stoelting 50811
Glass capillary puller Sutter company P-1000
Dental drill Agnthos AB 1464
Shaver Agnthos AB GT420
Isoflurane Chamber and pump Agnthos AB 8323101 2 mL
Syringes Merck Z118400-30EA 25G
Needles Merck Z192414 Aldrich
Mouse and neonatal rat adaptor for stereotaxic fram Stoelting 51625
Heating pad Braintree scientific, inc 53800M From Covidien 2187.
Cotton gauze Fisher Scientific 22-037-902
Rubber tube Elfa Distrelec HFT-A-9.5/4.8 PO-X BK 150
Cotton swabs Fisher Scientific 18-366-473
REAGENTS FOR WHOLE-CELL PATCH CLAMP RECORDINGS
NaCl Sigma-Aldrich S3014
KCl Sigma-Aldrich P9333
NaH2PO4-H2O Sigma-Aldrich S9638
MgCl2-6 H2O Sigma-Aldrich M2670
CaCl2-6 H2O Sigma-Aldrich C8106
MgSO4-7 H2O Sigma-Aldrich 230391
NaHCO3 Sigma-Aldrich S5761
Glucose Sigma-Aldrich G7021 see Ultrapure Water system
Ultrapure Water Prepare 1 or 2M.
KOH Sigma-Aldrich P5958-500G
K-D-gluconate Sigma-Aldrich G4500 Sigma
KCl Sigma-Aldrich P9541
KOH-EGTA (Etilene glycol-bis-N-tetracetic acid) Sigma-Aldrich E3889 Sigma
KOH- Hepes acid (N-2-hydroxyethylpiperazine-N’-2-ethanesulfonic acid) Sigma-Aldrich H7523
NaCl Sigma-Aldrich S3014
Mg2ATP Sigma-Aldrich A9187
Na3GTP Sigma-Aldrich G8877
Biocytin Sigma-Aldrich B4261
Picrotoxin Merck P1675 Sigma
CNQX Merck C239 Sigma
Ice
EQUIPMENT FOR WHOLE-CELL PATCH CLAMP RECORDINGS
Borosilicate glass pipette Sutter Company B150-86-10
Glass capillary puller Sutter company P-1000
Vibratome Leica Leica VT1000 S
WaterBath Thermo Fisher Scientific TSGP02
Clampfit software Molecular Devices
Multiclamp software Molecular Devices
REAGENTS FOR IMMUNOHISTOCHEMISTRY Use at a concentration of 4%. CAUTION: PFA is a potent fixative. Avoid ingestion and contact with skin.
Paraformaldehyde (PFA) Merck Millipore 1040051000 Use at a concentration of 0.1%.
Triton X-100 Fisher Scientific 10254640 Donkey.Use at a concentration of 1 : 400.
Serum Merck Millipore S30-100ML Reconstitute the powder in Milli-Q water to 1 mg/mL. Aliquot and store at -20°C, light sensitive. Use at a concentration of 1 : 500.
4′,6-Diamidino-2′-phenylindole dihydrochloride (DAPI) Sigma Aldrich D9542 1: 600 in KPBS-T.
streptavidin- Cy3 Thermo Fisher Scientific 434315 1:5000, rabbit.
Anti-GAD65/67 Abcam 1:2000, mouse.
Anti-PV Sigma P3088 1:200, goat.
Anti-Chat Merk AB143 1:5000, rabbit.
Anti-NPY Immunostar 22940
K2HPO4 Sigma-Aldrich P3786
NaCl Sigma-Aldrich S3014
KH2PO4 Sigma-Aldrich NIST200B 1:1000, chicken.
Anti-GFP Abcam ab13970
Mounting solution Merck 10981 Polyvinyl alcohol mounting medium with DABCO®, antifading
OCT Agar Scientific
Glycerol Sigma-Aldrich G9012-100ML
Distilled water
Anti-freeze solution Tissue Pro Technology AFS05-1000N, 1000 mL/ea.
EQUIPMENT FOR IMMUNOHISTOCHEMISTRY
Inverted fluorescence microscope Leica DMI6000 B
Confocal microscope Leica TCS SP8 laser scanning confocal microscope.
Prism GraphPad
Microtome Leica SM2010R

DOWNLOAD MATERIALS LIST

References

  1. Barker, R. A., Parmar, M., Studer, L., Takahashi, J. Human Trials of Stem Cell-Derived Dopamine Neurons for Parkinson's Disease: Dawn of a New Era. Cell Stem Cell. 21, (5), 569-573 (2017).
  2. Southwell, D. G., et al. Interneurons from embryonic development to cell-based therapy. Science. 344, (6180), 1240622 (2014).
  3. Parmar, M., Torper, O., Drouin-Ouellet, J. Cell-based therapy for Parkinson's disease: A journey through decades toward the light side of the Force. European Journal of Neuroscience. (2018).
  4. Torper, O., et al. In Vivo Reprogramming of Striatal NG2 Glia into Functional Neurons that Integrate into Local Host Circuitry. Cell Reports. 12, (3), 474-481 (2015).
  5. Su, Z., Niu, W., Liu, M. L., Zou, Y., Zhang, C. L. In vivo conversion of astrocytes to neurons in the injured adult spinal cord. Nature Communication. 5, 3338 (2014).
  6. Liu, Y., et al. Ascl1 Converts Dorsal Midbrain Astrocytes into Functional Neurons In Vivo. Journal of Neuroscience. 35, (25), 9336-9355 (2015).
  7. Guo, Z., et al. In vivo direct reprogramming of reactive glial cells into functional neurons after brain injury and in an Alzheimer's disease model. Cell Stem Cell. 14, (2), 188-202 (2014).
  8. Grande, A., et al. Environmental impact on direct neuronal reprogramming in vivo in the adult brain. Nature Communication. 4, 2373 (2013).
  9. Niu, W., et al. In vivo reprogramming of astrocytes to neuroblasts in the adult brain. Nature Cell Biology. 15, (10), 1164-1175 (2013).
  10. Weinberg, M. S., Criswell, H. E., Powell, S. K., Bhatt, A. P., McCown, T. J. Viral Vector Reprogramming of Adult Resident Striatal Oligodendrocytes into Functional Neurons. Molecular Therapy. 25, (4), 928-934 (2017).
  11. Pereira, M., et al. Direct Reprogramming of Resident NG2 Glia into Neurons with Properties of Fast-Spiking Parvalbumin-Containing Interneurons. Stem Cell Reports. 9, (3), 742-751 (2017).
  12. Rivetti di Val Cervo, P., et al. Induction of functional dopamine neurons from human astrocytes in vitro and mouse astrocytes in a Parkinson's disease model. Nature Biotechnology. 35, (5), 444-452 (2017).
  13. Crosson, S. M., Dib, P., Smith, J. K., Zolotukhin, S. Helper-free Production of Laboratory Grade AAV and Purification by Iodixanol Density Gradient Centrifugation. Molecular Therapy Methods & Clinial Development. 10, 1-7 (2018).
  14. Torper, O., et al. Generation of induced neurons via direct conversion in vivo. Proceedings of the National Academy of Sciences of the United States of America. 110, (17), 7038-7043 (2013).
  15. Kawaguchi, Y., Kubota, Y. Correlation of physiological subgroupings of nonpyramidal cells with parvalbumin- and calbindinD28k-immunoreactive neurons in layer V of rat frontal cortex. Journal of Neurophysiology. 70, (1), 387-396 (1993).
  16. Grealish, S., et al. The A9 dopamine neuron component in grafts of ventral mesencephalon is an important determinant for recovery of motor function in a rat model of Parkinson's disease. Brain. 133, (Pt 2), 482-495 (2010).
  17. Thompson, L., Barraud, P., Andersson, E., Kirik, D., Bjorklund, A. Identification of dopaminergic neurons of nigral and ventral tegmental area subtypes in grafts of fetal ventral mesencephalon based on cell morphology, protein expression, and efferent projections. Journal of Neuroscience. 25, (27), 6467-6477 (2005).
In vivo Direct omprogrammering av Resident gliacellene Cells til Interneurons av Intracerebrale injeksjon av viral vektorer
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Pereira, M., Birtele, M., Rylander Ottosson, D. In Vivo Direct Reprogramming of Resident Glial Cells into Interneurons by Intracerebral Injection of Viral Vectors. J. Vis. Exp. (148), e59465, doi:10.3791/59465 (2019).More

Pereira, M., Birtele, M., Rylander Ottosson, D. In Vivo Direct Reprogramming of Resident Glial Cells into Interneurons by Intracerebral Injection of Viral Vectors. J. Vis. Exp. (148), e59465, doi:10.3791/59465 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter