Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

माउस वृषण में प्रोटीन-बाउंड आरएनए की कुशल पहचान के लिए बढ़ाया क्रॉलिंकिंग इम्यूनोरेसिपिटेशन (eCLIP) विधि

doi: 10.3791/59681 Published: May 10, 2019
* These authors contributed equally

Summary

यहां, हम एक eCLIP प्रोटोकॉल प्रस्तुत करने के लिए वृषण में आरबीपी उंमीदवारों के मेजर आरएनए लक्ष्य निर्धारित करते हैं ।

Abstract

शुक्राणुजनन स्तनधारियों में पुरुष जनन कोशिका विभेदन की एक अत्यधिक क्रमित प्रक्रिया को परिभाषित करता है । वृषण, प्रतिलेखन और अनुवाद में अयुग्मित हैं, जीन अभिव्यक्ति के पोस्ट-ट्रांस्क्रिप्शनल रेगुलेशन के महत्व को रेखांकित करते हुए आरबीपीएस द्वारा करवाया गया । एक आरबीपी की यंत्रवादी भूमिकाओं को स्पष्ट करने के लिए, crosslinking इम्यूनोपिटिशन (क्लिप) पद्धति को इसके अंतर्जात प्रत्यक्ष आरएनए लक्ष्य पर कब्जा करने और वास्तविक संपर्क साइटों को परिभाषित करने के लिए इस्तेमाल किया जा सकता है । बढ़ी हुई क्लिप (eCLIP) एक नव विकसित तरीका है कि पारंपरिक क्लिप पर कई लाभ प्रदान करता है । हालांकि, eCLIP का उपयोग अभी तक सेल लाइनों के लिए सीमित किया गया है, विस्तारित अनुप्रयोगों के लिए बुला । यहाँ, हम MOV10 और MOV10L1, दो ज्ञात आरएनए बाध्यकारी हेलिकोसिस, माउस वृषण में अध्ययन करने के लिए eCLIP कार्यरत हैं । के रूप में की उंमीद है, हम पाते है कि MOV10 मुख्यतः के लिए बांध 3 ' अअनुवादित क्षेत्रों mRNA के (UTRs) और Piwi MOV10L1 चुनिंदा बांध-आरएनए (piRNA) अग्रदूत साबित टेप । हमारे eCLIP विधि प्रमुख आरएनए subclones के छोटे पैमाने पर अनुक्रमण और इस प्रकार योग्य पुस्तकालयों की उपलब्धता के माध्यम से विभिन्न RBPs द्वारा बाध्य के तेजी से दृढ़ संकल्प की अनुमति देता है, गहरी अनुक्रमण के साथ आगे बढ़ने के लिए एक वारंट के रूप में । यह अध्ययन स्तनधारी वृषण में eCLIP के लिए एक लागू आधार स्थापित करता है ।

Introduction

स्तनधारी वृषण एक उत्कृष्ट विकास मॉडल का प्रतिनिधित्व करता है जिसमें एक जटिल कोशिका विभेदन कार्यक्रम चक्रीय रूप से अनेक शुक्राणुजन को उत्पन्न करने के लिए चलता है । इस मॉडल का एक अनूठा मूल्य spermatogenesis के कुछ चरणों में ट्रांस्क्रिशनल निष्क्रियता के उद्भव में निहित है, आम तौर पर जब अर्धसूत्री सेक्स गुणसूत्र inactivation (एमएससीआई)1,2 होता है और जब दौर spermatids से गुजरना 3शुक्राणुजनन के दौरान कठोर नाभिकीय संघनक्रिया । इन लगातार अनुपर्णी घटनाओं के बाद के लिए आवश्यक जीन विनियमन, जिसमें आरएनए बाध्यकारी प्रोटीन (आरबीपीएस) एक महत्वपूर्ण भूमिका निभाते हैं, transcriptome आकार देने और पुरुष प्रजनन क्षमता को बनाए रखने ।

Vivo में एक व्यक्ति rbp के सदाशयी आरएनए लक्ष्यों की पहचान करने के लिए, crosslinking इम्यूनोरेसिपिटेशन (क्लिप) विधि विकसित किया गया था4,5, पर आधारित लेकिन परे नियमित आरएनए इम्यूनोपिटिशन (आरआईपी)6,7 , संकेत विशिष्टता में सुधार करने के लिए पराबैंगनी (यूवी) crosslinking, कड़े धोने और जेल हस्तांतरण सहित प्रमुख कदम के निगमन द्वारा । उच्च-थ्रूपुट अनुक्रमण के साथ संयोजित क्लिप के उन्नत अनुप्रयोग ने जीनोम-वाइड स्तर8पर प्रोटीन-आरएनए अन्योन्यक्रिया को प्रोफाइलिंग में बड़ी रुचि को उकसाया है । आरबीपी समारोह पर आनुवंशिक अध्ययन के अलावा, इस तरह के जैव रासायनिक तरीकों कि अंतर्जात प्रोटीन और आरएनए के प्रत्यक्ष परस्पर क्रिया की पहचान करने के लिए आरबीपीएस की आरएनए नियामक भूमिकाओं को सही ढंग से स्पष्ट करने के लिए अपरिहार्य है । उदाहरण के लिए, MOV10L1 एक वृषण-विशिष्ट RNA helicase पुरुष प्रजनन क्षमता और Piwi-अन्योन्यक्रिया आरएनए के लिए आवश्यक है (पिन्ना) जीवजनन इसके परलोगुए MOV10 को आरएनए जीवविज्ञान10,11,12,13,14 के कई पहलुओं में भूमिकाओं के साथ एक सर्वव्यापी रूप से व्यक्त और बहुकार्यात्मक आरएनए हेलिकाज़ के रूप में जाना जाता है । , 15 , 16 , 17 , 18. द्वारा पारंपरिक क्लिप-seq रोजगार, हमने पाया है कि MOV10L1 बांध और प्राथमिक पिन्ना व्यापारियों को नियंत्रित करने के लिए जल्दी पिन्ना19,20प्रसंस्करण शुरू करने, और यह MOV10 कि mrna 3 ' utrs और साथ ही noncoding वृषण रोगाणु कोशिकाओं में प्रजातियों (डेटा नहीं दिखाया गया है) ।

फिर भी, क्लिप मूलतः एक श्रमसाध्य, रेडियोधर्मी क्लिप टैग की एक उल्लेखनीय नुकसान के साथ अनुक्रमण पुस्तकालय तैयारी द्वारा पीछा किया प्रक्रिया है । पारंपरिक क्लिप में, एक सीडीएनए पुस्तकालय दोनों आरएनए extremities पर एडेप्टर ligated का उपयोग कर तैयार किया जाता है । प्रोटीन पाचन के बाद, crosslinked शॉर्ट पॉलिपेप्टाइड आरएनए के टुकड़ों से जुड़े रहते हैं । इस crosslinking आंशिक रूप से ब्लॉकों cdna संश्लेषण के दौरान रिवर्स ट्रांसक्रिप्टेस (rtase) प्रगति, काट cdnas जो cdna पुस्तकालय21,22के बारे में ८०% का प्रतिनिधित्व करने में जिसके परिणामस्वरूप । इस प्रकार, केवल सीडीएनए के टुकड़ों से जिसके परिणामस्वरूप RTase crosslinking साइट को दरकिनार (पढ़ने के माध्यम से) sequenced हैं । हाल ही में, सममूल्य क्लिप, आईसीओआईपी, eCLIP और uvCLAP के रूप में विभिंन क्लिप दृष्टिकोण, जीवित कोशिकाओं में RBPs के crosslink साइटों की पहचान करने के लिए नियोजित किया गया है । PAR-क्लिप ३६५ एनएम यूवी विकिरण और photoactivatable न्यूक्लियोटाइड analogs के आवेदन शामिल है और इसलिए में रहने वाले कोशिकाओं को culturing के लिए अनंय है, और नए संश्लेषित टेप में न्यूक्लियोसाइड analogs के समावेश पूर्वाग्रह उत्पादन करने के लिए प्रवण है जहां आरएनए शारीरिक रूप से23,24प्रोटीन के साथ इंटरैक्ट करता है । ICLIP में, केवल एक ही एडाप्टर crosslinked आरएनए टुकड़ों के 3 ' सिरा को ligated है । रिवर्स ट्रांसक्रिप्शन (आरटी) के बाद, दोनों काट दिया और पढ़ा-के माध्यम से cdnas intramolecularly और पुन: linearization द्वारा पोलीमरेज़ चेन रिएक्शन (पीसीआर) प्रवर्धन25,26के बाद प्राप्त कर रहे हैं । तथापि, इंट्राअणुक परिसंचरण की दक्षता अपेक्षाकृत कम है । हालांकि पुराने क्लिप प्रोटोकॉल एक रेडियोआइसोटोप, पराबैंगनी crosslinked और आत्मीयता शुद्धि (uvCLAP) के साथ crosslinked आरएनए के लेबल की जरूरत है, सख्ती के साथ मिलकर संबंध शुद्धि की एक प्रक्रिया के साथ, रेडियोधर्मिता पर भरोसा नहीं करता है27. फिर भी, uvCLAP सभ्य कोशिकाओं है कि अभिव्यक्ति 3x झंडा ले जाने वेक्टर के साथ transfected किया जाना चाहिए करने के लिए सीमित है-मिलकर संबंध शुद्धि के लिए HBH टैग ।

ECLIP में, एडॉप्टर को पहले ' आरएनए के ' 3 छोर पर, आर. टी. के बाद, और एक अंतरआण्विक विधा में cDNAs के 3 ' छोर पर अगले ligated गया था । इसलिए, eCLIP सभी कटा हुआ और पढ़ने के माध्यम से cDNA28पर कब्जा करने में सक्षम है । इसके अलावा, यह न तो रेडियोधर्मी लेबलिंग तक सीमित है, और न ही अपने सिद्धांत पर आधारित सेल लाइनों का उपयोग करने के लिए, जबकि एकल-न्यूकोटाइड संकल्प को बनाए रखने.

यहाँ, हम एक कदम दर कदम एक eCLIP प्रोटोकॉल का वर्णन माउस वृषण के लिए अनुकूलित प्रदान करते हैं । संक्षेप में, इस eCLIP प्रोटोकॉल वृषण tubules के यूवी crosslinking, आंशिक RNase पाचन और एक प्रोटीन-विशिष्ट एंटीबॉडी का उपयोग कर immunoprecipitation के बाद के साथ शुरू होता है । इसके बाद, प्रोटीन-बाउंड आरएनए विफॉस्फोलेटेड होता है, और एडाप्टर को इसके 3 सिरे पर लिखाया जाता है । प्रोटीन जेल वैद्युतकणसंचलन और जेल से झिल्ली स्थानांतरण के बाद, आरएनए एक अपेक्षित आकार सीमा के झिल्ली क्षेत्र को काटने से अलग है । आरटी के बाद, डीएनए एडाप्टर cDNA के 3 अंत करने के लिए ligated है और पीसीआर प्रवर्धन के बाद. उच्च थ्रूपुट अनुक्रमण से पहले सबक्लोनों की स्क्रीनिंग को एक पुस्तकालय गुणवत्ता नियंत्रण के रूप में लिया जाता है । यह प्रोटोकोल आरबीपीएस के प्रोटीन-बाउंड आरएनए की प्रमुख प्रजातियों की पहचान करने में दक्ष है, जो दो वृषण-आरएनए हेलिकोसिस MOV10L1 और MOV10 को व्यक्त करते हैं ।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

सभी प्रदर्शन पशु प्रयोगों नानजिंग मेडिकल यूनिवर्सिटी समिति द्वारा अनुमोदित किया गया है । नर C57BL/6 चूहों को नियंत्रित प्रकाशप्रचालन स्थिति में रखा गया था और उन्हें भोजन और पानी की आपूत की गई थी ।

1. ऊतक संचयन और यूवी Crosslinking

  1. 2 वयस्क 1-2 मिनट या जब तक सांस बंद हो जाता है के लिए कार्बन डाइऑक्साइड (CO2) का उपयोग चूहों euthanize । अगले, प्रत्येक माउस पर गर्भाशय ग्रीवा अव्यवस्था प्रदर्शन ।
  2. प्रत्येक इम्यूनोरेसिपिटेशन प्रयोग के लिए उपयुक्त आयु (इस अध्ययन में एक वयस्क वृषण) के चूहों से लगभग १०० मिलीग्राम वृषण का हार्वेस्ट करें, और ऊतकों को आइस-कोल्ड फॉस्फेट buffered खारा (pbs) में रखें ।
  3. एक जोड़ी महीन चिमटी के साथ धीरे से टुनिका albuginea निकालें ।
  4. एक ऊतक चक्की में बर्फ की 3 मिलीलीटर ठंडा PBS जोड़ें और हल्के यांत्रिक बल द्वारा ऊतक triturate एक ढीला गिलास मूसल का उपयोग (एक गिलास मूसल प्रकार) ।
    नोट: इस कदम का उद्देश्य कोशिकाओं lyse करने के लिए नहीं है, लेकिन अलग ऊतक खींचने के लिए । सेल की व्यवहार्यता और अखंडता का संरक्षण महत्वपूर्ण है ।
  5. ऊतक निलंबन एक सेल संस्कृति पकवान (व्यास में 10 सेमी) के लिए स्थानांतरण और बर्फ ठंडा PBS 6 मिलीलीटर के लिए जोड़ें ।
  6. थाली को जल्दी हिलाएं ताकि लिक्विड डिश के बॉटम को समान रूप से ढक सके । ऊतक clumps की उपस्थिति, ऊतक फैलाव suboptimal है कि इंगित करता है, जबकि ऊतकों ठीक से जमीन है, तो समान रूप से वितरित शुक्रजनक नलिकाओं दिखाई देगा ।
  7. Crosslink निलंबन बर्फ पर २५४ एनएम पर ४०० mJ/सेमी2 के साथ तीन बार । मिश्रण प्रत्येक विकिरण के बीच निलंबन ।
    नोट: प्रत्येक नए प्रयोग के लिए, crosslinking अनुकूलित किया जाना चाहिए ।
  8. एक 15 मिलीलीटर शंक्वाकार ट्यूब में निलंबन और १,२०० x g पर गोली 4 डिग्री सेल्सियस पर 5 मिनट के लिए ले लीजिए । Supernatant निकालें, PBS के 1 मिलीलीटर में गोली resuspend और फिर एक १.५ मिलीलीटर अपकेंद्रित्र ट्यूब के निलंबन हस्तांतरण । 4 ° c और १,००० x g पर 2 मिनट के लिए स्पिन, और supernatant हटा दें ।
  9. इस बिंदु पर, तुरंत प्रोटोकॉल के बाकी के साथ आगे बढ़ना, या स्नैप तरल नाइट्रोजन में छर्रों फ्रीज और दुकान पर-८० ° c का उपयोग करें जब तक.

2. मोती तैयारी

  1. एक ताजा अपकेंद्रित्र ट्यूब के लिए प्रति नमूना (गोली) एक चुंबकीय मोती प्रोटीन की १२५ μL जोड़ें ।
    नोट: माउस एंटीबॉडी के लिए प्रोटीन जी चुंबकीय मोती का प्रयोग करें ।
  2. मोतियों को घोल से अलग करने के लिए चुंबक पर ट्यूब रखें । 10 एस के बाद सुपरनेटंट को हटा दें । मोतियों को दो बार धो लें 1 मिलीलीटर बर्फ से ठंडा lysis बफर ।
    नोट: प्रोटीन के बाद जुदाई एक चुंबकीय मोती इस कदम के बाद । Lysis बफर संरचना ५० मिमी Tris-HCl, पीएच ७.५; १०० मिमी NaCl; 1% एनपी-४०; ०.१% एसडीएस; ०.५% सोडियम deoxycholate; 1/50 ethylenediaminetetraacetic एसिड (edta)-मुक्त प्रोटीज अवरोध करनेवाला कॉकटेल (ताजा जोड़ें) ।
  3. 10 माइक्रोग्राम eclip एंटीबॉडी के साथ ठंड lysis बफर के १०० μl में मोती फिर से निलंबित । कमरे के तापमान पर ४५ मिनट के लिए ट्यूबों घुमाएं ।
    नोट: इम्यूनोरेसिपिटेशन के लिए अंतिम एंटीबॉडी एकाग्रता 10 μg/mL है । एंटीबॉडी एकाग्रता अज्ञात है, तो एंटीबॉडी की राशि अनुकूलित किया जाना चाहिए ।
  4. मोतियों को दो बार धो लें 1 मिलीलीटर बर्फ से ठंडा lysis बफर ।

3. ऊतक Lysis और आंशिक आरएनए पाचन

  1. फिर से निलंबित ऊतक हिमपात में 1 मिलीलीटर की ठंड lysis बफर (जोड़ने के 22 μL 50x (EDTA)-मुक्त प्रोटीन अवरोध करनेवाला कॉकटेल और 11 μL RNase अवरोध करनेवाला के lysis बफर के 1 मिलीलीटर के लिए) ।
    1. दो यूवी crosslinked छर्रों और प्रयोगों के समूह प्रति दो गैर crosslinked छर्रों को निलंबित: eCLIP पुस्तकालय के लिए यूवी crosslinked-1 छर्रों (यूवी-1); यूवी crosslinked-2 छर्रों eCLIP पुस्तकालय के लिए (यूवी-2); गैर-crosslinked एक नियंत्रण (गैर-यूवी) के रूप में eCLIP पुस्तकालय के लिए 1 छर्रों; गैर-crosslinked IgG आईपी के लिए 2 छर्रों एंटीबॉडी की विशिष्टता प्रदर्शित करने के लिए.
      नोट: यूवी crosslinked वाइड प्रकार वृषण की eclip पुस्तकालय के लिए आदर्श नियंत्रण है कि एक ही कूड़े के चूहों से यूवी crosslinked नॉकआउट वृषण की है ।
  2. 15 मिनट (प्रोटीन और आरएनए की गिरावट को रोकने के लिए) के लिए बर्फ पर नमूने lysing रखो ।
  3. एक डिजिटल sonicator में 5 मिनट के लिए 10% आयाम में sonicate, 30 एस पर/ हमेशा बर्फ पर नमूना जगह और प्रत्येक नमूने के बीच nuclease मुक्त पानी के साथ जांच साफ ।
  4. प्रत्येक ट्यूब के लिए DNase के 4 μL जोड़ें, और अच्छी तरह से मिश्रण । ३७ ° c पर 10 मिनट के लिए सेक्यूबेट, १,२०० rpm पर मिलाते हुए ।
  5. पतला RNase मैं (PBS में 4 U/μL RNase) के 10 μL जोड़ें, और अच्छी तरह से मिश्रण । ३७ ° c पर 5 मिनट के लिए सेक्यूबेट, १,२०० rpm पर मिलाते हुए ।
  6. १५,००० x g पर 20 मिनट (4 डिग्री सेल्सियस) के लिए अपकेंद्रण द्वारा lysate साफ़ करें ।
  7. ध्यान से supernatant इकट्ठा । छोड़ ५० μL lysate और इसके साथ गोली त्यागने ।
  8. (वेस्टर्न ब्लॉट के लिए भागो) Rwb के रूप में आदानों के नमूने सहेजें और आरआरआई (आरएनए अलगाव के लिए रन) । सहेजें 20 μL (2%) यूवी-1, यूवी-2, गैर-यूवी और IgG नमूने के रूप में RWB जेल लोड करने के लिए आदानों के रूप में । सहेजें 20 μL (2%) आरआरआई जेल लोडिंग के लिए आदानों के रूप में यूवी-1 या यूवी-2 नमूनों की ।

4. इम्यूनोरेसिपिटेशन

  1. (खंड 2 में तैयार) (चरण ३.७ से) lysate के 1 मिलीलीटर जोड़ें और 4 डिग्री सेल्सियस पर 2 घंटे या रात भर के लिए नमूनों को घुमाएगी ।
  2. एक चुंबकीय स्टैंड के साथ मोती ले लीजिए और supernatant त्यागने । मोतियों को दो बार ९०० μL उच्च नमक बफर के साथ धो लें (५० mM Tris-HCl, पीएच ७.५; 1 एम NaCl; 1 मिमी EDTA; 1% एनपी-४०; ०.१% एसडीएस; ०.५% सोडियम डिऑक्सीकोलेट), और फिर मोतियों को दो बार धोकर ९०० μL वॉश बफर (20 मिमी Tris-HCl, पीएच ७.५; 10 मिमी MgCl2; ०.२% tween-20) ।
    नोट: IgG नमूना के लिए, यहाँ प्रक्रिया को थामने और धोने बफर में बर्फ पर स्टोर.
  3. मोतियों को एक बार धो लें ५०० μL of 1x deफ़ॉस्फोरिलेशन बफर (10 मिमी Tris-HCl, पीएच ७.५; 5 मिमी MgCl2; १०० मिमी kcl; ०.०२% ट्राइटन एक्स-१००) ।

5. आरएनए 3 के विफॉस्फोराइलन ' समाप्त होता है

  1. एक चुंबकीय स्टैंड के साथ मोती ले लीजिए और supernatant त्यागने । ठीक पिपेट सुझावों का उपयोग अवशिष्ट तरल निकालें । विफॉस्फोलिलेशन मास्टर मिक्स के १०० μL जोड़ें (10 μL 10x debuffer ylation बफर के [१०० mM Tris-HCl, पीएच ८.०; ५० एमएम एमजीसीएल2; 1 एम केसीएल; ०.२% ट्राइटन एक्स-१००; 1 एमजी/एमएल बोवाइन सीरम ऐल्ब्युमिन (बीएसए)]; ७८ μl न्यूक्लेस-फ्री वॉटर; kaline फॉस्फेट) प्रत्येक नमूने के लिए, और ३७ डिग्री सेल्सियस पर 15 मिनट के लिए सेते, १,२०० rpm पर मिलाते हुए ।
  2. पॉलीन्यूमोटाइड काइनेज (PNK) मास्टर मिक्स के ३०० μL जोड़ें (६० μL 5x PNK पीएच ६.५ बफर [३५० mM Tris-HCl, पीएच ६.५; ५० mM MgCl2]; २२३ μl of न्यूक्टेस-मुक्त पानी; 5 Μl rnase अवरोध करनेवाला; 2 Μl DNASE; pnk एंजाइम के 7 μl; ०.१ M dithiothreitol के 3 μl) प्रत्येक नमूने के लिए , ३७ डिग्री सेल्सियस पर 20 मिनट के लिए सेबेट, १,२०० rpm पर मिलाते हुए ।
  3. एक चुंबकीय स्टैंड के साथ मोती ले लीजिए और supernatant त्यागने । मोती एक बार कोल्ड वॉश बफर के ५०० μL के साथ धो लें । फिर मोती ठंडे उच्च नमक बफर के ५०० μL के साथ एक बार धो लो । इस क्रम में एक बार और इन washes दोहराएं ।
  4. मोती को एक बार धोएं कोल्ड वॉश बफर के ५०० μL के साथ और फिर दो बार ३०० μL के साथ ठंड 1x लिगेशन बफर (कोई dithiothreitol, ५० मिमी Tris-एचसीएल, पीएच ७.५; 10 मिमी MgCl2) ।

6. आरएनए एडाप्टर लिगेशन से आरएनए 3 ' समाप्त होता है

  1. Supernatant त्यागें, और ठीक पिपेट सुझावों के साथ अवशिष्ट तरल निकालें । प्रत्येक नमूने के लिए 3 ' बंधाव मास्टर मिक्स के 25 μl जोड़ें । ध्यान से pipetting द्वारा मिक्स । इस कदम बुलबुले उत्पादन करने के लिए प्रवण है ।
    नोट: बंधाव मास्टर मिक्स 10x लिगेशन बफर के 3 μl [५०० mm Tris-HCl, पीएच ७.५; १०० mm mgcl2शामिल हैं]; 9 μL of न्यूक्लेस-मुक्त पानी; RNase अवरोध करनेवाला का ०.४ μL; ०.३ μL की ०.१ एम एटीपी; डाइमेथिल सल्फॉनाइड (DMSO) की ०.८ μL; ५०% पॉलिएथिलीन ग्लाइकोल (पीईजी) ८००० की 9 μL; आरएनए लिग्नेस का २.५ μL [30 U/μL] ।
  2. आर. एन. ए. अनुकूलक X1A (तालिका 1) के २.५ μl और प्रत्येक नमूने के लिए आरएनए एडाप्टर X1B (तालिका 1) के २.५ μl जोड़ें । Pipetting या flicking द्वारा ध्यान से मिश्रण है, और 25 डिग्री सेल्सियस पर ७५ मिनट के लिए इनक्यूबेट, हर 10 मिनट में मिश्रण flicking ।
  3. धो मोती ठंडे धोने बफर के ५०० μL के साथ एक बार (फिर से शुरू IgG नमूना यहां) ।
  4. मोती एक बार ठंडे उच्च नमक बफर के ५०० μL के साथ धोने और फिर ५०० μL कोल्ड वॉश बफर के साथ । इन washes एक बार फिर से दोहराएं ।
  5. चुंबकीयत से मोती अलग, और ठीक पिपेट सुझावों के साथ अवशिष्ट तरल निकालें ।
  6. ठंडे धोने बफर के १०० μL में मोती resuspend (को रोकने के IgG यहां नमूना और धोने बफर में बर्फ पर स्टोर) । RWB नमूनों के रूप में नई ट्यूबों के लिए 20 μL हटो । चुंबकीयत शेष ८० μL आरआरआई नमूनों के रूप में अलग । RRI नमूने ' supernatant निकालें और 20 μL वॉश बफर में मोतियों को फिर से निलंबित ।
  7. जोड़ें ३७.५ μL of 4x लिथियम डोडेसिल सल्फेट (LDS) नमूना बफ़र और 15 μL की 10x नमूना को कम करने के लिए IgG नमूना है । 4x LDS नमूना बफर के ७.५ μL जोड़ें और 10x नमूना को कम करने के 3 μL एजेंट (शेष) नमूने । (Pipetting द्वारा मिश्रण नहीं है) । ७० ° c पर 10 मिनट के लिए सेक्यूबेट, १,२०० rpm पर मिलाते हुए । 1 मिनट के लिए बर्फ पर ठंडा है, और 4 डिग्री सेल्सियस पर 1 मिनट के लिए १,००० x g पर केंद्रागत्र ।

7. एसडीएस-पृष्ठ और झिल्ली स्थानांतरण

  1. लोड जैल.
    1. RRI जेल के लिए (4-12% बीआईएस-Tris प्रोटीन जेल, 10-well, १.५ mm) एक चुंबक पर जगह ट्यूबों और मोतियों से अलग प्रोटीन eluate । अच्छी तरह से प्रति नमूना के 30 μL लोड । नमूने पूर्व दाग प्रोटीन आकार मार्कर से दूरी पर हैं ।
    2. RWB जेल (4-12% Bis-Tris प्रोटीन जेल, 10-well, १.५ mm) के लिए एक चुंबक पर जगह ट्यूबों और मोतियों से अलग प्रोटीन eluate । प्रति अच्छी तरह से नमूना के 15 μL लोड । शेष नमूनों को बैकअप के रूप में-20 डिग्री सेल्सियस पर सहेजें ।
  2. ५०० मिलीलीटर 1x SDS के बफर चलाने के लिए एंटीऑक्सीडेंट के ५०० μL जोड़ें । 1x SDS में २०० V पर चलाने के ५० मिनट के लिए बफर चल रहा है या जब तक डाई सामने तल पर है ।
    नोट: एंटीऑक्सीडेंट में एन, एन-डाइमेथिलफार्माइड, सोडियम बाइसल्फाइट शामिल हैं, जो मिथाइयोनिन और ट्रिप्टोफान जैसे संवेदनशील अमीनो एसिड के पुनर्ऑक्सीकरण को रोकने के लिए कम प्रोटीन के साथ प्रवास करता है ।
  3. 10 5 में एक नाइट्रोसेलुलोस झिल्ली के लिए जेल से प्रोटीन-आरएनए परिसरों 10% मेथनॉल (vol/vol) के साथ 1xtransfer बफर में ७० मिनट के लिए स्थानांतरण । ठंड PBS में RRI झिल्ली कुल्ला, यह प्लास्टिक लपेटो में लपेटें, और-८० डिग्री सेल्सियस पर स्टोर ।
  4. 1 ज के लिए कमरे के तापमान पर TBST में 5% दूध में RWB झिल्ली ब्लॉक TBST में झिल्ली कुल्ला । 4 ° c रात में TBST में प्राथमिक एंटीबॉडी के साथ सेते । 5 मिनट के लिए TBST के साथ दो बार धो. सेक्यूबेट के साथ माध्यमिक एंटीबॉडी (1:5000 HRP बकरी विरोधी खरगोश IgG) TBST में 1 घंटे के लिए कमरे के तापमान पर 5 मिनट, 10 मिनट और 15 मिनट के लिए TBST के साथ तीन बार धोने क्रमशः ।
  5. मिश्रण के बराबर मात्रा में electrochemiluminescence (ईसीएल) बफर A और बफर B, झिल्ली में जोड़ें और 1 मिनट के लिए इंक्यूबेट । प्लास्टिक की चादर के साथ झिल्ली को कवर, और यह 2-3 मिनट के लिए कमरे के तापमान पर एक एक्स-रे फिल्म के लिए बेनकाब । इसके बाद फिल्म को डेवलप करें ।
    नोट: ओवरएक्सपोजर वाली फिल्म में झिल्ली के किनारों की आकृति साफ दिखाई देगी, जिसके द्वारा फिल्म को वापस आरएसबी मेम्ब्रेन में संरेखित किया जा सकता है । फिर, इसमें मार्कर की स्थिति के आधार पर RWB और RRI झिल्ली संरेखित करें । नीचे से ऊपर के क्रम में स्तरित फिल्म, आरएसबी झिल्ली और आरआरआई झिल्ली अनुक्रम में हैं ।

8. आरएनए अलगाव

  1. इस क्षेत्र में प्रोटीन बैंड से ७५ केडीए (के बारे में २२० nt आर. एन. ए.) के ऊपर काट, आरएसबी झिल्ली और गाइड के रूप में फिल्म का उपयोग कर ।
    नोट: के रूप में एक प्रोटीन से संरक्षित आरएनए अणु अधिकतम २२५ कुर्सियां हो सकता है, लगभग ३४० Da प्रति आधार के साथ, यह सभी प्रोटीन-आरएनए परिसरों को पुनः प्राप्त करने के लिए RBP बैंड के ऊपर ७५ केडीए के बारे में क्षेत्र में कटौती करने के लिए उचित है ।
  2. कई छोटे स्लाइस में झिल्ली के excised टुकड़ा काट, और उंहें एक ताजा १.५ मिलीलीटर अपकेंद्रित्र ट्यूब में जगह है । २०० μL के प्रोटीनेज K (पीके) बफर (१०० मिमी Tris-HCl पीएच ७.५; ५० मिमी NaCl; 10 मिमी EDTA) के साथ जोड़ें झिल्ली के टुकड़े करने के लिए पीके की ४० । मिक्स और ३७ ° c पर 20 मिनट के लिए इंक्यूबेट, १,२०० rpm पर मिलाते हुए ।
  3. पीके यूरिया बफर के २०० μL जोड़ें (१०० mM Tris-HCl पीएच ७.४; ५० mM NaCl; 10 मिमी EDTA; 7 एम यूरिया) प्रत्येक नमूने के लिए । ३७ ° c पर 20 मिनट के लिए इनक्यूबेट, १,२०० rpm पर मिलाते हुए ।
  4. एसिड phenol के ४०० μL/क्लोरोफॉर्म/isoamyl अल्कोहल (25:24:1), अच्छी तरह से मिक्स और ३७ डिग्री सेल्सियस पर 5 मिनट के लिए इनक्यूबेट, १,२०० rpm पर मिलाते हुए ।
  5. 2 एमएल चरण लॉक जेल (PLG) केंद्राभ में भारी ट्यूब और स्पिन 25 एस के लिए १५,००० x g पर प्लेस ।
  6. झिल्ली स्लाइस को छोड़कर सभी सामग्री हस्तांतरण करने के लिए भारी ट्यूब PLG । ३७ ° c पर 5 मिनट के लिए सेक्यूबेट, १,२०० rpm पर मिलाते हुए ।
  7. कमरे के तापमान पर स्पिन और 15 मिनट के लिए १५,००० x g . एक नई 15 मिलीलीटर शंक्वाकार नली में जलीय परत का अंतरण ।
  8. आरएनए शुद्धि और एकाग्रता स्तंभों का उपयोग करें RNA निकालने के लिए ।
    1. प्रत्येक नमूने (चरण ८.७ से) और मिश्रण करने के लिए आरएनए बंधन बफर के 2 खंड (८०० μL) जोड़ें । १००% इथेनॉल और मिश्रण की एक बराबर की मात्रा (१२०० μL) जोड़ें ।
    2. स्थानांतरण ७५० μL नमूना (चरण 8.8.1 से) के लिए आरएनए शुद्धि और एकाग्रता कॉलम में एक संग्रह ट्यूब और केंद्रान्तरण पर १५,००० x g के लिए 30 s. त्यागने प्रवाह के माध्यम से ।
    3. दोहराएं चरण 8.8.2 तक सभी नमूने स्तंभ के माध्यम से दिया गया है । स्तंभ के लिए आरएनए तैयारी बफर के ४०० μl जोड़ें और 30 एस के लिए १५,००० एक्स जी पर केंद्राचयक प्रवाह के माध्यम से, लागू ७०० μl के आरएनए धोने बफर और 30 एस के लिए १५,००० पर स्तंभ केंद्रा
    4. आरएनए वॉश बफर के ४०० μL स्तंभ के लिए जोड़ें और 2 मिनट के लिए १५,००० x g पर अपकेंद्रित्र. कॉलम को ध्यान से एक नई १.५ मिलीलीटर ट्यूब में स्थानांतरित करें । कॉलम मैट्रिक्स को nuclease मुक्त पानी के 10 μL जोड़ें, दो मिनट के लिए बैठते हैं, और १५,००० एक्स जी पर 30 एस. स्टोर eclip नमूने के लिए ८० डिग्री सेल्सियस तक आरटी में (कदम ११.१) ।

9. इनपुट आरएनए 3 के विफॉस्फोराइलन ' समाप्त होता है

  1. विफॉस्फोलिलेशन मास्टर मिक्स के 15 μL जोड़ें (२.५ μL 10x debuffer ylation बफर के [१०० mM Tris-HCl, पीएच ८.०; ५० एमएम एमजीसीएल2; 1 एम केसीएल; ०.२% ट्राइटन एक्स-१००; 1 एमजी/एमएल बीएसए]; ९.५ μl ऑफ न्यूक्लेस-फ्री वॉटर; ०.५ Μl ऑफ रेनेज इनडबेटर; २.५ μl ऑफ क्षारीय फॉस्फेट) से 10 μl इनपुट नमूने (चरण 8.8.4 से) । ३७ ° c पर 15 मिनट के लिए इनक्यूबेट, १,२०० rpm पर मिलाते हुए ।
  2. PNK मास्टर मिक्स के ७५ μL जोड़ें (5x PNK पीएच ६.५ बफर के 20 μL [३५० mM Tris-HCl, पीएच ६.५; ५० एमएम एमजीसीएल2]; ४४ μl ऑफ न्यूक्टेस-फ्री वॉटर; 1-एल ऑफ र्नेनेस इनहिबिटोर; 2 Μl DNASE; पीएनके एंजाइम का 7 μl; 1 μl Of ०.१ M dithiothreitol) नमूनों को । ३७ ° c पर 20 मिनट के लिए इनक्यूबेट, १,२०० rpm पर मिलाते हुए ।
  3. इनपुट आरएनए की सफाई
    1. Thenucleic एसिड निष्कर्षण चुंबकीय beadsin शीशी (30 से अधिक एस के लिए भंवर) को पुनः निलंबित । नए ट्यूबों के लिए प्रत्येक नमूने के लिए न्यूक् लिक एसिड निष्कर्षण चुंबकीय मोतियों की 20 μL जोड़ें । एक चुंबकीय स्टैंड के साथ मोती ले लीजिए और supernatant त्यागने ।
    2. एक बार शाही सेना शुद्धि lysis बफर (RLT बफर) के 1 मिलीलीटर के साथ धोने मोती । 30 एस के लिए एक चुंबक पर ट्यूब प्लेस और supernatant त्यागने ।
      नोट: न्यूक्लिक एसिड निष्कर्षण चुंबकीय मनकों के बाद जुदाई इस कदम का पीछा किया ।
    3. ३०० μL RLT बफर के साथ मोतियों को निलंबित और नमूना करने के लिए जोड़ें । 5 एम NaCl के 10 μL और १००% एथिल अल्कोहल (EtOH) के ६१५ μL जोड़ें और pipetting द्वारा मिक्स । 15 मिनट के लिए कमरे के तापमान पर घुमाएं । चुंबकीयत मोतियों को अलग करें और सुपरनेटंट को हटा दें ।
    4. ७५% EtOH के 1 मिलीलीटर में मोतियों को फिर से निलंबित और एक नई ट्यूब के लिए स्थानांतरण । 30 एस के बाद, एक चुंबकीय स्टैंड के साथ मोती इकट्ठा और supernatant त्यागने । ७५% etoh के साथ दो बार धो, चुंबकीयत से मोती अलग है, और ठीक पिपेट सुझावों के साथ अवशिष्ट तरल छोड़ना । 5 मिनट के लिए हवा सूखी (अत्यधिक सुखाने से बचें) ।
    5. 10 माइक्रोन के न्यूक्लिन-मुक्त पानी के साथ मोतियों को फिर से निलंबित और 5 मिनट के लिए इसे सेते. चुंबकीयत से अलग मनकों, और एक नई ट्यूब के लिए supernatant के 5 μl कदम (3 के लिए नीचे एडाप्टर बंधाव) । शेष आरएनए बैकअप के रूप में-८० डिग्री सेल्सियस पर संग्रहित किया जा सकता है ।

10. आरएनए एडाप्टर निषेध इनपुट आरएनए 3 ' समाप्त होता है

  1. RiL19 एडाप्टर के DMSO और ०.५ μL के १.५ μL जोड़ें (तालिका 1) इनपुट आरएनए के 5 μl करने के लिए (चरण 9.3.5 से), ६५ डिग्री सेल्सियस पर 2 मिनट के लिए इनक्यूबेट, और 1 मिनट से अधिक के लिए बर्फ पर जगह. जोड़ें १३.५ प्रत्येक नमूने के लिए मास्टर मिक्स 3 , pipetting द्वारा मिश्रण है, और 25 डिग्री सेल्सियस पर ७५ मिनट के लिए इनक्यूबेट, हर 15 मिनट के मिश्रण करने के लिए flicking के साथ ।
    नोट: बंधाव मास्टर मिक्स 10x लिगेशन बफर के 2 μl है [५०० mm Tris-HCl, पीएच ७.५; १०० mm mgcl2; 10 मिमी dithiothreitol]; १.५ μL न्यूक्लेस-मुक्त पानी; RNase अवरोध करनेवाला का ०.२ μL; ०.२ μL की ०.१ एम एटीपी; DMSO की ०.३ μL; ५०% PEG8000 की 8 μL; आरएनए लिग्नेस का १.३ μL [30 U/μL] ।
  2. Ligated इनपुट आरएनए की सफाई
    1. प्रत्येक नमूने के लिए चुंबकीयत से न्यूक् लिक एसिड निष्कर्षण चुंबकीय मोतियों की 20 μL अलग है, और supernatant हटा दें । एक बार आरएलटी बफर के 1 मिलीलीटर के साथ मोती धो लो ।
    2. RLT बफर और स्थानांतरण निलंबन के ६१.६ μL में मोतियों को पुनः निलंबित प्रत्येक नमूने के लिए । १००% EtOH के ६१.६ μL जोड़ें । का प्रयोग करें पिपेट 15 मिनट के लिए हर 5 मिनट के लिए मिश्रण । चुंबकीयत से अलग मनकों, और supernatant हटा दें ।
    3. दोहराएं चरण 9.3.4 ।
    4. 10 μL के न्यूमेरेज-मुक्त पानी के साथ मोतियों को निलंबित करें, और इसे 5 मिनट के लिए बैठते हैं । चुंबकीयत से मोतियों को अलग करें और supernatant के 10 μL स्थानांतरित करने के लिए एक नई ट्यूब ।
      नोट: यह एक संभव रोक बिंदु (इनपुट नमूने अगले दिन तक-८० ° c पर संग्रहित किया जा सकता है) है ।

11. रिवर्स ट्रांसक्रिप्शन, डीएनए एडाप्टर Ligation cDNA 3 ' समाप्त होता है

  1. आरटी प्राइमर के ०.५ μL (तालिका 1) इनपुट आरएनए के 10 μl (चरण 10.2.4 से) और 10 ΜL क्लिप आरएनए (चरण 8.8.4 से) क्रमशः, ६५ डिग्री सेल्सियस पर पूर्व-गर्म पीसीआर ब्लॉक में 2 मिनट के लिए इनक्यूबेट, 1 मिनट से अधिक के लिए बर्फ पर जगह ।
  2. आरटी मास्टर मिक्स के 10 μL जोड़ें (आरटी बफर के 2 μL [५०० मिमी Tris-एचसीएल, पीएच ८.३; ७५० एमएम केसीएल; 30 एमएम एमजीसीएल2]; 4 μl ऑफ न्यूक्लेस-फ्री वॉटर; ०.३ Μl ऑफ र्नेनेस इनहिबिटॉल; 2 μl Of ०.१ m dithiothreitol; ०.२ μl ऑफ़ ०.१ m datp; ०.२ μl Of ०.१ m dctp; ०.२ μl ऑफ़ ०.१ M dGTP; ०.२ μL की ०.१ मीटर dTTP; रिवर्स ट्रांसक्रिप्टेस के ०.९ μL) प्रत्येक नमूने के लिए, मिश्रण, एक पूर्व गर्म पीसीआर ब्लॉक पर ४५ मिनट के लिए ५५ डिग्री सेल्सियस पर सेते ।
  3. पीसीआर उत्पाद क्लीनअप अभिकर्मक की ३.५ μL के साथ आर टी रिएक्शन उत्पाद के 20 μL मिश्रण । ३७ डिग्री सेल्सियस पर 15 मिनट के लिए सेक्यूबेट ।
  4. ०.५ एम EDTA के 1 μL जोड़ें, pipetting द्वारा मिश्रण । 1 मी NaOH के 3 μL जोड़ें, pipetting द्वारा मिश्रण, और ७० डिग्री सेल्सियस पर 12 मिनट के लिए एक पीसीआर ब्लॉक पर सेते के लिए एक टेम्पलेट आरएनए hydrolyze ।
  5. बफर बेअसर करने के लिए 1 एम एचसीएल, पिपेट मिश्रण के 3 μL जोड़ें ।
  6. सीडीएनए की सफाई
    1. चुंबकीयत से अलग 10 μl के न्यूक्लिक एसिड निष्कर्षण चुंबकीय मोती प्रत्येक नमूने के लिए, supernatant निकालें । RLT बफर के ५०० μL के साथ एक बार धो लो ।
    2. Resuspend मोती ९३ μL RLT बफर और स्थानांतरण निलंबन में नमूना करने के लिए । १००% etoh के १११.६ μl जोड़ें, यह 5 मिनट के लिए सेते, और पिपेट मिश्रण हर 2 मिनट । एक चुंबकीय स्टैंड के साथ मोती ले लीजिए और supernatant त्यागें । ८०% EtOH के 1 मिलीलीटर के साथ मोती resuspend और एक नई ट्यूब के लिए कदम ।
    3. 30 एस के बाद, एक चुंबकीय स्टैंड के साथ मोती इकट्ठा और supernatant त्यागने । ८०% EtOH के साथ दो बार धो लो । चुंबकीयत से अलग और ठीक टिप के साथ अवशिष्ट तरल त्यागने । 5 मिनट के लिए हवा सूखी (अत्यधिक सुखाने से बचें) । 5 मिमी Tris-HCl के 5 μL में मोतियों को फिर से निलंबित और 5 मिनट के लिए इसे सेते ।
  7. (तालिका 1) डीएनए एडाप्टर के ०.८ μl जोड़ें और dmso की 1 μl के लिए मोती, 2 मिनट के लिए ७५ डिग्री सेल्सियस पर सेते । बर्फ पर 1 मिनट से अधिक के लिए प्लेस ।
  8. बंधाव मास्टर मिक्स के १२.८ μl (10x लिगेशन बफर के 2 μl [५०० मिमी Tris-एचसीएल तैयार; १०० मिमी एमजीसीएल2; 10 मिमी डाइथायोथ्रीटॉल]; १.१-एल ऑफ न्यूक्टेस-फ्री वॉटर; ०.२ μl ऑफ ०.१ एम एटीपी; 9 μl ५०% PEG8000; ०.५ μl ऑफ आरएनए लिगानेस [30 यू/μl]) , झटका मिश्रण करने के लिए, एक अपकेंद्रित्र में संक्षेप में स्पिन, और यह प्रत्येक नमूने के लिए जोड़ने के लिए, पिपेट टिप धीरे से नमूना हलचल.
  9. प्रत्येक नमूने और मिश्रण करने के लिए झटका करने के लिए आरएनए ligase के एक और 1 μL [30 U/μL] जोड़ें । 25 डिग्री सेल्सियस पर 30 एस के लिए सेक्यूबेट, १,२०० rpm पर मिलाते हुए । 25 ° c रात में सेक्यूबेट । हल्के से 5 से 6 बार, प्रति घंटे एक बार मिश्रण करने के लिए झटका ।
  10. Ligated cDNA की सफाई
    1. प्रत्येक नमूने के लिए चुंबकीयत से न्यूपिक एसिड निष्कर्षण चुंबकीय मोतियों की 5 μL, और supernatant निकालें ।
    2. ५०० μL RLT बफर के साथ एक बार धो लो ।
    3. मोती का ६० μL में मोतियों की माला और प्रत्येक नमूने के लिए स्थानांतरण निलंबन को फिर से निलंबित । १००% etoh के ६० μl जोड़ें, यह 5 मिनट और पिपेट मिश्रण हर 2 मिनट के लिए सेते । चुंबकीयत से अलग, supernatant छोड़ें ।
    4. दोहराएं चरण 9.3.4 ।
    5. 10 मिमी Tris-HCl के 27 μL के साथ मोती resuspend, यह 5 मिनट के लिए सेते । चुंबकीयत से अलग है, और एक नई ट्यूब के लिए नमूना के 25 μL चाल । एक नए ट्यूब में 9 μL न्यूक्लाइज़-मुक्त पानी के साथ ligated cDNA के 1 μL को पतला । शेष नमूनों को-20 ° c पर चरण १३.१ तक संग्रहीत है ।

12. वास्तविक समय मात्रात्मक पीसीआर (qPCR) द्वारा cDNA का परिमाणीकरण

  1. एक ९६-कूप qPCR प्लेट के लिए qPCR मास्टर मिक्स के 9 μL (2x मास्टर मिक्स के 5 μL; ३.६ μL न्यूक्लेस-फ्री पानी; ०.४ μL प्राइमर मिक्स (10 μM पीसीआर-एफ-D50X और 10 μM पीसीआर-आर-D70X])) जोड़ें । (एच2ओ) cdna (चरण 11.10.5 से), सील और मिश्रण में 1 μl 1:10 पतला जोड़ें ।
  2. एक thermocycler में qPCR कार्यक्रम भागो: ५० डिग्री सेल्सियस पर 2 मिनट; ९५ डिग्री सेल्सियस पर 2 मिनट; ९५ डिग्री सेल्सियस पर 3 एस ४० चक्र के लिए ६८ डिग्री सेल्सियस पर 30 एस के बाद; ९५ डिग्री सेल्सियस पर 15 एस और उसके बाद ६८ डिग्री सेल्सियस पर ६० एस के बाद 15 एस के लिए ९५ ° c 1 चक्र के लिए । नोट सीटी (सायकल थ्रेशोल्ड) मान ।

13. सीडीएन की पीसीआर प्रवर्धन

  1. 8 कूप पट्टियों में पीसीआर मास्टर मिक्स के ३५ μL (2x पीसीआर मास्टर मिक्स के 25 μL, 5-l न्यूक्लेस-फ्री पानी; 5 μL प्राइमर मिक्स [20 μM पीसीआर-एफ-D50X और 20 μM पीसीआर-आर-D70X]) का वितरण । क्लिप समूह के लिए, H2O की क्लिप नमूना + २.५ μl के १२.५ μl जोड़ें; आदानों के समूह के लिए, 10 μL आदानों की + 5 μL एच2ओ मिश्रण अच्छी तरह से और अपकेंद्रित्र में संक्षेप में स्पिन ।
  2. पीसीआर कार्यक्रम भागो: ९८ डिग्री सेल्सियस पर 30 एस; ९८ डिग्री सेल्सियस पर 15 एस और उसके बाद ६८ डिग्री सेल्सियस पर 30 एस के बाद ४० एस के लिए ७२ डिग्री सेल्सियस पर 6 चक्रों के लिए; 15 एस ९८ डिग्री सेल्सियस पर ६० एस के बाद ७२ डिग्री सेल्सियस पर N चक्र के लिए = (qPCR सीटी मान-3)-6; ६० एस पर ७२ ° c; 4 डिग्री सेल्सियस पकड़ो ।
    नोट: यह क्लिप की पहली जोड़ी के लिए 1 से 2 अतिरिक्त पीसीआर चक्र प्रदर्शन करने के लिए बेहतर है ।

14. जेल शुद्धि

  1. एक 3% उच्च संकल्प agarose जेल पर लोड नमूने । नमूनों के बीच 1 खाली अच्छी तरह से छोड़ रहा है, और जेल के दोनों किनारों पर एक सीढ़ी का उपयोग करें । 1x Tris-बोरेट-EDTA (TBE) बफर में ७५ मिनट के लिए १०० V पर चलाएँ ।
  2. नीली बत्ती रोशनी के तहत, काट जेल स्लाइस 175-350 bp प्रत्येक नमूने के लिए ताजा रेज़र ब्लेड का उपयोग कर । इन्हें 15 मिलीलीटर शंक्वाकार ट्यूब में रखें ।
    1. जेल टुकड़ा तौलना, और elute जेल निष्कर्षण किट का उपयोग कर जैल ।
    2. जेल भंग बफर के 6x मात्रा जोड़ें जेल पिघल करने के लिए (१०० मिलीग्राम जेल = ६०० μL जेल भंग बफर) । जेल को कमरे के तापमान पर घोल लें । शेक (हर 15 मिनट के मिश्रण को जब तक जेल टुकड़ा पूरी तरह से भंग कर दिया है) । १००% isopropanol के 1 जेल मात्रा जोड़ें और अच्छी तरह से मिश्रण ।
    3. एक संग्रह ट्यूब में स्तंभ के लिए नमूना (चरण 14.2.2 से) का स्थानांतरण ७५० μL और १७,९०० x g पर केंद्रान्तरण 1 मिनट के लिए. त्यागने प्रवाह के माध्यम से ।
    4. दोहराएं कदम 14.2.3 जब तक सभी नमूनों कॉलम के माध्यम से पारित कर दिया है, एक बार धोने के ५०० μL जेल भंग बफर के साथ ।
    5. धोने बफर के ७५० μL जोड़ें (जेल निष्कर्षण किट से) स्तंभ के लिए और 1 मिनट के लिए १७,९०० x g पर अपकेंद्रित्र-प्रवाह के माध्यम से फेंक, 2 मिनट के लिए १७,९०० x g पर स्पिन । स्तंभ को किसी नए १.५ mL ट्यूब पर रखें ।
    6. स्तंभ के प्लास्टिक बैंगनी रिम से सभी शेष धोने बफर निकालें । 2 मिनट के लिए एयर सूखी-झिल्ली के केंद्र में १२.५-l nuclease-मुक्त पानी जोड़ें । चलो कॉलम कमरे के तापमान पर 2 मिनट के लिए खड़े हो जाओ, और 1 मिनट के लिए १७,९०० x g पर स्पिन (एक बेहतर उपज के लिए, इस कदम को दोहराने) ।

15. पीसीआर उत्पाद के TOPO क्लोन

  1. TOPO क्लोनिंग रिएक्शन मिश्रण (कदम 14.2.6 से पीसीआर उत्पाद के 1 μL; क्लोनिंग मिश्रण के 1 μl; 3 μL बाँझ पानी) तैयार करें । धीरे से मिलाएं और 20-37 डिग्री सेल्सियस पर 5 मिनट के लिए सेते । बर्फ पर ठंडा ।
  2. बर्फ पर रासायनिक सक्षम ई. कोलाई बैक्टीरिया पिघलना । टोपो क्लोनिंग उत्पाद के 5 μL १०० μL करने के लिए सक्षम बैक्टीरिया29जोड़ें । धीरे से अच्छे से मिलाएं । 30 मिनट के लिए बर्फ पर सेबेट ।
  3. ६० एस के लिए हीट शॉक ४२ डिग्री सेल्सियस पर । फिर बर्फ पर 2 मिनट के लिए ठंडा करें । जोड़ें ९०० μl लयजनकता शोरबा (पौंड) मध्यम, 1 एच के लिए ३७ ° c पर इनक्यूबेट, २२५ rpm पर मिलाते हुए । 1 मिनट के लिए १,००० x g पर स्पिन, और फिर supernatant के ९०० μl निकालें । शेष समाधान को पुन: निलंबित करें ।
  4. प्लेट परिवर्तित बैक्टीरिया पर १.५% पौंड आगर एम्पीसिलीन युक्त प्लेटों (१०० μg/एमएल), और ३७ डिग्री सेल्सियस पर रात भर सेते ।
  5. प्रत्येक निर्माण के लिए कम से 20 १.५ मिलीलीटर अपकेंद्रित्र ट्यूबों तैयार करें । एक सेट को ५०० μL पौंड मीडियम से भरें जिसमें १०० μg/mL एम्पीसिलीन हो । एक बाँझ पिपेट टिप बेतरतीब ढंग से एक बैक्टीरियल कॉलोनी बंद खरोंच और (पिपेट द्वारा) पौंड मध्यम के ५०० μl के साथ मिश्रण करने के लिए उपयोग करें । 5 एच के लिए ३७ डिग्री सेल्सियस पर सेक्यूबेट, २२५ rpm पर मिलाते हुए ।
  6. अनुक्रम संमिलित करें टुकड़ा M13 रिवर्स प्राइमर का उपयोग: Sanger अनुक्रमण द्वारा CAGGAAACAGCTATGAC30

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

क्रांतिप्रक्रिया और परिणाम चित्र 1, अंक 2, अंक 3, अंक 4में दर्शाए गए हैं । चूहों कार्बन डाइऑक्साइड के साथ euthanized थे और एक छोटा सा चीरा सर्जिकल कैंची का उपयोग कर पेट के निचले स्तर में किया गया था (चित्रा 2a,B). माउस वृषण हटा दिया गया था, detunicated और तब यूवी crosslinked पीसने के बाद (चित्र 2c-I) । प्रतिनिधि eCLIP वृषण ऊतकों में दो ज्ञात आरएनए बाध्यकारी helicases का उपयोग करने के परिणाम चित्र 3 और 4में चित्रित कर रहे हैं । हम वयस्क जंगली प्रकार चूहों से वृषण में MOV10 eclip प्रदर्शन किया, ४० U के आम एकाग्रता के साथ/ चित्रा 3a के शीर्ष पैनल से पता चलता है कि लक्ष्य प्रोटीन आकार लगभग ११४ केडीए को सफलतापूर्वक समृद्ध किया गया था । Immunopreciated MOV10L1 प्रोटीन के पश्चिमी धब्बा दो सांद्रता (5 या ४० U/mL) के साथ प्रदर्शन किया गया RNase मैं eCLIP प्रक्रिया के दौरान (चित्रा 3a) MOV10 और MOV10L1 यूवी crosslinked, गैर crosslinked और युग्मित आकार मिलान इनपुट (SMInput) नमूना से (पहले से ही डीएनए एडाप्टर के साथ ligated) 1:10 पतला cDNA का उपयोग कर qPCR चित्रा 3b दिखाता है । गैर-क्रॉसलिंक्ड नमूनों में आरएनए रिकवरी घटी । हमने देखा कि, गैर-crosslinked समूह का सीटी मान सामान्यतया यूवी-क्रॉसलिंक्ड समूह से 5 गुना अधिक था । चित्रा 4a agarose जेल वैद्युतकणसंचलन (कट 175-350 बीपी) के माध्यम से पीसीआर प्रवर्धन और आकार चयन प्रदर्शित करता है । प्राइमर-dimer उत्पाद के बारे में १४० बीपी पर प्रकट होता है । चित्रा 4b दो प्रतिनिधि उपक्लोन दृश्यों के ucsc जीनोम ब्राउज़र को देखने से पता चलता है । MOV10-बाउंड eCLIP टैग जीन Ftoके 3 ' utr के भीतर स्थित होना पाया जाता है; 3 ' utr की अनुमानित दर ७५% के लिए खातों (अंक 4c), HEK293 कोशिकाओं10 और वृषण में MOV10 लक्ष्यों के बहुमत के अनुरूप है (डेटा नहीं दिखाया गया है) । इसके विपरीत में, MOV10L1-बाउंड eCLIP टैग एक पिन्ना क्लस्टर के भीतर स्थित होने के लिए MOV10L1 लक्ष्य पिन्ना व्यापारियों का संकेत पाया जाता है । ४२% (चित्रा 4E) है, जो हमारे पिछले पारंपरिक क्लिप प्रयोग20से एक प्रवृत्ति को दर्शाता है के लिए पिन्ना अग्रदूत साबित लक्ष्यों की अनुमानित दर । MOV10L1 eCLIP के साथ ४० U/एमएल RNase मैं पाचन से कम 20 बीपी (चित्रा 4d) के साथ अपेक्षाकृत अधिक दृश्यों पैदावार ।

Figure 1
चित्रा 1 : ECLIP का योजनाबद्ध प्रतिनिधित्व । यूवी crosslinked माउस शुक्रजनक नलिकाओं (चरण 1) eclip lysis बफर और sonicated में एक (चरण 2) हैं । Lysate RNase मैं टुकड़ा शाही सेना के साथ इलाज किया है, जिसके बाद प्रोटीन-आरएनए परिसरों immunopreciated विरोधी आरबीपी एंटीबॉडी (कदम 3-4) का उपयोग कर रहे हैं । आरएनए के अंशों का विफॉस्फोराइलन और 3 ' आरएनए अनुकूलक का निषेध (चरण 5-6) किया जाता है । प्रोटीन-आरएनए परिसरों को एसडीएस-पृष्ठ जेल पर चलाया जाता है और नाइट्रोसेलुलोस झिल्लियों में स्थानांतरित किया जाता है (चरण 7) । आरएनए प्रोटीनसे K और यूरिया के साथ प्रोटीन पचा द्वारा झिल्ली से बरामद किया जाता है जो crosslink साइट पर शेष एक छोटा पॉलीपेप्टाइड छोड़ता है । आरएनए इनपुट नमूनों और 3 ' आरएनए एडाप्टर के निषेध के टुकड़ों के विफॉस्फोराइलन किया जाता है (चरण 8) । आरएनए और 3 ' डीएनए एडाप्टर के बंधाव के आरटी प्रदर्शन (कदम 9-10) । प्रारंभिक पुस्तकालय गुणवत्ता नियंत्रण के लिए cDNA पुस्तकालय, जेल निष्कर्षण, और कुंद-end पीसीआर क्लोनिंग के पीसीआर प्रवर्धन प्रदर्शन (11 कदम) । अंतत:, उच्च-थ्रूपुट sequencing (चरण 12) निष्पादित करें । इस आंकड़े का बड़ा संस्करण देखने के लिए कृपया यहां क्लिक करें ।

Figure 2
चित्रा 2 : वृषण ऊतक संचयन और यूवी crosslinking । () मूषक उदर का उद्भासन । () उदर भित्ति में ०.५ बउ चीरा लगाकर पेरिटोनियम को उजागर करना । () वसा पैड को खींचकर एक जोड़ी वृषण को बाहर निकाला जाता है । () वृषण ऊतक को हटा दिया जाता है और इसे एक छोटी डिश में रखा जाता है जिसमें आइस-कोल्ड पीबीएस होती है । () टुनिका ऐल्कुजीनिया को धीरे से हटाएं । () ऊतक ग्राइंडर डीऔंस में ऊतक को triturate करने के लिए ढीले मूसल दबाएं । () 10 बउ प्लेट में अर्धजनक नलिकाओं का वितरण किया । () ४०० mJ/सेमी2 ऊर्जा के साथ यूवी crosslinking । (I) क्रॉसलिंक्ड नमूने १.५ मिलीलीटर अपकेंद्रित्र ट्यूबों में एकत्र किए जाते हैं । इस आंकड़े का बड़ा संस्करण देखने के लिए कृपया यहां क्लिक करें ।

Figure 3
चित्रा 3 : MOV10 और MOV10L1 eCLIP के प्रतिनिधि परिणाम । () MOV10 के वेस्टर्न ब्लॉट वैधीकरण और MOV10L1 इम्यूनोरेसिपिएंट्स । () 1:10 पर qpcr, यूवी, गैर-यूवी और युग्मित sminput नमूनों के लिए प्रतिकृति के साथ MOV10 और MOV10L1 की रिक्लिप पुस्तकालयों । इस आंकड़े का बड़ा संस्करण देखने के लिए कृपया यहां क्लिक करें ।

Figure 4
चित्रा 4 : Eclip पुस्तकालय तैयार करने और गुणवत्ता मूल्यांकन । () पीसीआर प्रवर्धन की जेल छवियों को दर्शाया जाता है । तारांकन चिह्न प्राइमर dimer इंगित करता है । लाल बिंदीदार लाइन सीडीएनए के पीसीआर उत्पाद के लिए excised क्षेत्रों को इंगित करता है, कहीं के बीच १७५ और ३५० बीपी । () दो प्रतिनिधि उपक्लोन अनुक्रम31के यूसीएससी जीनोम ब्राउज़र को देखें । () MOV10 के छोटे पैमाने पर उपक्लोन अनुक्रमण विश्लेषण । () MOV10L1-बाउंड टैग्स दो भिंन RNase सांद्रता द्वारा संसाधित किए जाने पर लंबाई वितरण के भिंन प्रतिमान प्रदर्शित करते हैं । () MOV10L1 के छोटे पैमाने पर उपक्लोन अनुक्रमण विश्लेषण । इस आंकड़े का बड़ा संस्करण देखने के लिए कृपया यहां क्लिक करें ।

अनुक्रम नाम अनुक्रम सूचना विवरण
आरएनए एडेप्टर
आरएनए X1A /5फोटो/Auaggnnnnagaucgagagसीजीजीएमगुग/3spc3/ २०० μM पर स्टॉक; 20 μM पर कार्य करना
आरएनए X1B /5Phos/aauagcannnnagaucgagagसीजीयूगुग/3spc3/ २०० μM पर स्टॉक; 20 μM पर कार्य करना
RiL19 /5Phosggaagagcgucg/3spc3/ २०० μM पर स्टॉक; ४० μM पर कार्य करना
डीएनए एडाप्टर
Rand103tr3 (क) को पूरा करने के लिए क्या-क्या-क्या-क्या-क्या कर रहे हैं? २०० μM पर स्टॉक; ८० μM पर कार्य करना
आर टी प्राइमर
AR17 ऐसकगेक्सीजीसीटीटीसीसीजीए २०० μM पर स्टॉक; 20 μM पर कार्य करना
पीसीआर प्राइमर्स

पीसीआर-एफ-डी ५०१
(क) के लिए, यदि हां, तो इस पर कोई कार्रवाई नहीं की गई है; और (i) १०० μM पर स्टॉक; 20 μM पर कार्य करना
पीसीआर-आर-डी ७०१ CAAGAGAAGACGGCATACGAGATTGTGCTCTTCCGTC के लिए, १०० μM पर स्टॉक; 20 μM पर कार्य करना
(D502 के लिए Illumina ग्राहक सेवा पत्र देखें-508, D702-712)

तालिका 1: एडाप्टर और प्राइमर दृश्यों । एडाप्टर में एक इन-लाइन रैंडम-mer (या तो N5 या N10) दो समान अनुक्रम पढ़ता दो अद्वितीय RNA फ़्रेग्मेंट्स या एक ही आरएनए खंड के पीसीआर डुप्लिकेट का संकेत है कि क्या यह निर्धारित करने के लिए है । "5 phos" के लिए खड़ा है 5 ' फॉस्फोराइलेशन, जो की जरूरत है अगर एक oligo डीएनए के लिए एक सब्सट्रेट के रूप में प्रयोग किया जाता है/ "3spc3" 3 के लिए खड़ा है ' C3 spacer, जो एडेप्टर के बीच बंधाव को रोकने कर सकते हैं.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

जैविक और रोग दोनों संदर्भों के तहत आरबीपीएस की सार्वभौमिक भूमिका की समझ बढ़ाने के साथ,20,३२,३३, rbps के आणविक कार्य को प्रकट करने के लिए क्लिप विधियों का व्यापक रूप से उपयोग किया गया है । ३४,३५। प्रोटोकॉल यहां वर्णित एक अनुकूलित अनुप्रयोग का प्रतिनिधित्व करता है eCLIP विधि के लिए माउस वृषण ।

वृषण में प्रदर्शन eCLIP में एक चुनौती व्यवहार्यता और ताजा वृषण कोशिकाओं है, जो भी प्रभावी crosslinking के लिए महत्वपूर्ण है की अखंडता को बनाए रखने है । हल्के यांत्रिक बल ढीला मूसल का उपयोग कर के साथ वृषण बाल काटना सेल lysis३२,३६को रोका जा सकता है । सफल ग्रहण के लिए आरएनए का उचित पाचन भी महत्वपूर्ण है । शाही सेना के टुकड़े पाचन के बाद और अधिक अभिसरण हो सकता है, लेकिन लंबाई से कम 20 बीपी पूर्व के माध्यम से हटाया जा सकता है पुस्तकालय के प्रसंस्करण पढ़ता है । आदेश में एक RBP उंमीदवार के लिए एक आदर्श RNase खुराक को अपनाने के लिए, हम एक प्रारंभिक परीक्षा eCLIP पुस्तकालयों के subclone अनुक्रमण के परिणामों के आधार पर सुझाव है कि के साथ RNase उपचार द्वारा तैयार किया जा सकता 0 से ४० U (lysate के milliliter प्रति) । छोटे पैमाने subclone अनुक्रमण विश्लेषण हमारे eCLIP विधि में पुस्तकालय की गुणवत्ता का एक विश्वसनीय परीक्षा के लिए एक अनुशंसित कदम है । सबसे पहले, की तुलना में कम 20 bp सम्मिलित करता है की प्रतिशतता बहुत अधिक नहीं होना चाहिए, या, बाद पूर्व-eCLIP पुस्तकालय के प्रसंस्करण पढ़ता का एक महंगा नुकसान का कारण होगा । दूसरे, दोनों एडेप्टर के सही लिगेशन की दक्षता की जांच की जानी चाहिए । घटिया नमूनों को गहरी अनुक्रमण के बिना समाप्त किया जा सकता है सफल गहरी अनुक्रमण सुनिश्चित करने के लिए, जो के परिणाम आम तौर पर अधिक समय लेने के लिए विश्लेषण ।

हालांकि माउस वृषण में eCLIP की व्यवहार्यता अभी भी immunoprecipitation के कदम के लिए एंटीबॉडी की विशिष्टता द्वारा सीमित है, eCLIP कई पहलुओं में पारंपरिक क्लिप तरीकों से अधिक लाभप्रद है । पहला, यह एक गैर रेडियोधर्मी तरीका है । ECLIP द्वारा, आरबीपीएस का आरएनए लक्ष्य प्रत्यक्ष रूप से रेडियोधर्मी सामग्री का उपयोग कर श्रम-गहन तकनीकों का सहारा लिए बिना vivo में कब्जा कर लिया है । दूसरे, विधि कम समय गहन है । पूरी प्रक्रिया eCLIP पुस्तकालय तैयारी के माध्यम से केवल 4 दिन लगते हैं । तीसरा, अनुक्रम विविधता । 25-३५ चक्र के पारंपरिक एकीकृत प्रवर्धन चक्र के साथ तुलना में, eclip विशेष रूप से पीसीआर चक्र की संख्या निर्धारित करने के लिए Qpcr के सीटी मूल्यों को संदर्भित करता है । अंत में, यह मजबूत संकेत करने के लिए शोर अनुपात प्रदान करता है । आकार-मिलान इनपुट प्रामाणिक लक्ष्यों के लिए एक उपयुक्त पृष्ठभूमि के रूप में कार्य करता है ।

संक्षेप में, हमारे eCLIP परिणाम निष्कर्ष है कि MOV10 और MOV10L1 के लिए एक बाध्यकारी वरीयता है mRNA 3 ' UTR और पिन्ना व्यापारियों, क्रमशः मजबूत । प्रोटोकॉल हम यहां वर्णित प्रजनन में eCLIP विधि के पहले रोजगार का प्रतिनिधित्व करता है, एक क्षेत्र में आरएनए-RBP बातचीत ज्ञान नहीं बल्कि अपर्याप्त है, हालांकि आनुवंशिक अध्ययन की जैविक भूमिकाओं के बारे में पर्याप्त जानकारी प्रदान की है RBPs. इस eCLIP प्रोटोकॉल के दृश्य मदद व्यापक क्षेत्रों में अपने व्यापक अनुप्रयोगों मार्गदर्शन कर सकते हैं ।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों के पास खुलासा करने के लिए कुछ नहीं है ।

Acknowledgments

हम मूल प्रोटोकॉल के साथ उपयोगी मार्गदर्शन के लिए एरिक एल वान नथना और जीन डब्ल्यू Yeo धंयवाद । K.Z. चीन के राष्ट्रीय कुंजी आर & डी कार्यक्रम (2016YFA0500902, 2018YFC1003500), और चीन के राष्ट्रीय प्राकृतिक विज्ञान फाउंडेशन (३१७७१६५३) द्वारा समर्थित किया गया था । L.Y. चीन के राष्ट्रीय प्राकृतिक विज्ञान फाउंडेशन (८१४७१५०२, ३१८७१५०३) और जियांग्सू प्रांत के अभिनव और उद्यमशीलता कार्यक्रम द्वारा समर्थित किया गया ।

Materials

Name Company Catalog Number Comments
Antibodies
Anti-mouse MOV10  antibody Proteintech, China 10370-1-AP
Anti-mouse MOV10L1 antibody Zheng et al.20109 polyclonal antisera UP2175 provided by P. Jeremy Wang lab, University of Pennsylvania
HRP Goat Anti-Rabbit IgG  ABclonal AS014
Rabbit IgG Beyotime, China A7016
Equipment
Centrifuge Eppendorf, Hamburg, Germany 5242R
Digital sonifier BRANSON,USA BBV12081048A 450 Watts; 50/60 Hz
DynaMag-2 Magnet Invitrogen,USA 12321D
Mini Blot Module Invitrogen,USA B1000
Mini Gel Tank Invitrogen,USA A25977
Shaking incubator Eppendorf, Hamburg, Germany Thermomixer comfort 
Tissue Grinder, Dounce PYREX, USA 1234F35 only  the "loose" pestle is used in this protocol
TProfessional standard 96 Gradient Biometra, Germany serial no.: 2604323
Tube Revolver  Crystal, USA serial no.: 3406051
UV-light cross-linker UVP, USA CL-1000
Materials
TC-treated Culture Dish Corning, USA 430167 100 mm 
Tubes Corning, USA 430791 15 mL
Microtubes tubes AXYGEN , USA MCT-150-C 1.5 mL 
Reagents 
Acid phenol/chloroform/isoamyl alcohol  Solarbio, China P1011 25:24:01
AffinityScript Enzyme Agilent, USA 600107
Antioxidant Invitrogen,USA NP0005
DH5α competent bacteria Thermo Scientific, USA 18265017 these economical cells yield >1 x 106 transformants/µg control DNA per 50 µL reaction.
DMSO Sigma-Aldrich, USA D8418
DNA Ladder Invitrogen, USA 10416014
dNTP Sigma-Aldrich, USA DNTP100-1KT
Dynabeads Protein A  Invitrogen, USA 10002D
ECL reagent Vazyme, China E411-04
EDTA Invitrogen, USA AM9260G
EDTA free protease inhibitor cocktail Roche, USA 04693132001 add fresh
Exo-SAP-IT Affymetrix, USA 78201 PCR Product Cleanup Reagent 
FastAP enzyme Thermo Scientific, USA EF0652
LDS Sample Buffer Thermo Scientific, USA NP0007
MetaPhor Agarose  lonza, Switzerland 50180
MgCl2 Invitrogen, USA AM9530G
MiniElute gel Extraction QIAGEN, Germany 28604 column store at 4 ?; buffer QG=gel dissolving buffer; buffer PE= wash buffer(for step 14)
MyONE Silane beads Thermo Scientific, USA 37002D nucleic acids extraction magnetic beads
NaCl Invitrogen,USA AM9759
 
NP-40 Amresco, USA M158-500ML
NuPAGE Bis-Tris Protein Gels Invitrogen, USA NP0336BOX 4%–12%,1.5 mm, 15-well
NuPAGE MOPS SDS Buffer Kit  Invitrogen, USA NP0050
PBS Gibco, USA 10010023
Phase-Locked Gel (PLG) heavy tube   TIANGEN, China WM5-2302831
PowerUp SYBR Green Master Mix Applied Biosystems, USA A25742
Proteinase K NEB, New England  P8107S
Q5 PCR master mix  NEB, New England  M0492L
RLT buffer QIAGEN, Germany 79216 RNA purification lysis buffer 
RNA Clean & Concentrator-5 columns  ZYMO RESEARCH, USA R1016 RNA purification and concentration columns
RNase I  Invitrogen, USA AM2295
RNase Inhibitor Promega, USA N251B
RQ1 DNase Promega,USA M610A
Sample Reducing Agent Invitrogen,USA NP0009
SDS Solution Invitrogen, USA 15553027 10%
Sodium deoxycholate Sigma-Aldrich, USA 30970 protect from light
T4 PNK enzyme NEB, New England  M0201L
T4 RNA ligase 1 high conc NEB, New England  M0437M
TA/Blunt-Zero Cloning Mix Vazyme, China C601-01
TBE Invitrogen,USA AM9863
Tris-HCI Buffer Invitrogen, USA 15567027
Triton X-100 Sangon Biotech, China A600198 
Tween-20 Sangon Biotech, China A600560
Urea Sigma-Aldrich, USA U5378
X-ray Films Caresteam, Canada 6535876

DOWNLOAD MATERIALS LIST

References

  1. Turner, J. M., Mahadevaiah, S. K., Ellis, P. J., Mitchell, M. J., Burgoyne, P. S. Pachytene asynapsis drives meiotic sex chromosome inactivation and leads to substantial postmeiotic repression in spermatids. Developmental Cell. 10, (4), 521-529 (2006).
  2. Turner, J. M. A. Meiotic sex chromosome inactivation. Development. 134, (10), 1823-1831 (2007).
  3. Kimmins, S., Sassone-Corsi, P. Chromatin remodelling and epigenetic features of germ cells. Nature. 434, (7033), 583-589 (2005).
  4. Ule, J., et al. CLIP identifies Nova-regulated RNA networks in the brain. Science. 302, (5648), 1212-1215 (2003).
  5. Ule, J., Jensen, K., Mele, A., Darnell, R. B. CLIP: a method for identifying protein-RNA interaction sites in living cells. Methods. 37, (4), 376-386 (2005).
  6. Trifillis, P., Day, N., Kiledjian, M. Finding the right RNA: identification of cellular mRNA substrates for RNA-binding proteins. RNA. 5, (8), 1071-1082 (1999).
  7. Tenenbaum, S. A., Carson, C. C., Lager, P. J., Keene, J. D. Identifying mRNA subsets in messenger ribonucleoprotein complexes by using cDNA arrays. Proceedings of National Acadamy of Sciences U S A. 97, (26), 14085-14090 (2000).
  8. Chi, S. W., Zang, J. B., Mele, A., Darnell, R. B. Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 460, (7254), 479-486 (2009).
  9. Zheng, K., et al. Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway. Proceedings of National Acadamy of Sciences U S A. 107, (26), 11841-11846 (2010).
  10. Gregersen, L. H., et al. MOV10 Is a 5' to 3' RNA helicase contributing to UPF1 mRNA target degradation by translocation along 3' UTRs. Molecular Cell. 54, (4), 573-585 (2014).
  11. Banerjee, S., Neveu, P., Kosik, K. S. A coordinated local translational control point at the synapse involving relief from silencing and MOV10 degradation. Neuron. 64, (6), 871-884 (2009).
  12. Choi, J., Hwang, S. Y., Ahn, K. Interplay between RNASEH2 and MOV10 controls LINE-1 retrotransposition. Nucleic Acids Research. 46, (4), 1912-1926 (2018).
  13. Goodier, J. L., Cheung, L. E., Kazazian, H. H. Jr MOV10 RNA helicase is a potent inhibitor of retrotransposition in cells. PLoS Genetics. 8, (10), e1002941 (2012).
  14. Haussecker, D., et al. Capped small RNAs and MOV10 in human hepatitis delta virus replication. Nature Structural & Molecular Biology. 15, (7), 714-721 (2008).
  15. Kenny, P. J., et al. MOV10 and FMRP regulate AGO2 association with microRNA recognition elements. Cell Reports. 9, (5), 1729-1741 (2014).
  16. Messaoudi-Aubert, S. E., et al. Role for the MOV10 RNA helicase in Polycomb-mediated repression of the INK4a tumor suppressor. Nature Structural & Molecular Biology. 17, (7), 862-868 (2010).
  17. Sievers, C., Schlumpf, T., Sawarkar, R., Comoglio, F., Paro, R. Mixture models and wavelet transforms reveal high confidence RNA-protein interaction sites in MOV10 PAR-CLIP data. Nucleic Acids Research. 40, (20), e160 (2012).
  18. Skariah, G., et al. Mov10 suppresses retroelements and regulates neuronal development and function in the developing brain. BMC Biology. 15, (1), 54 (2017).
  19. Zheng, K., Wang, P. J. Blockade of pachytene piRNA biogenesis reveals a novel requirement for maintaining post-meiotic germline genome integrity. PLoS Genetics. 8, (11), e1003038 (2012).
  20. Vourekas, A., et al. The RNA helicase MOV10L1 binds piRNA precursors to initiate piRNA processing. Genes & Development. 29, (6), 617-629 (2015).
  21. Hocq, R., Paternina, J., Alasseur, Q., Genovesio, A., Le Hir, H. Monitored eCLIP: high accuracy mapping of RNA-protein interactions. Nucleic Acids Research. 46, (21), 11553-11565 (2018).
  22. Huppertz, I., et al. iCLIP: protein-RNA interactions at nucleotide resolution. Methods. 65, (3), 274-287 (2014).
  23. Hafner, M., et al. Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 141, (1), 129-141 (2010).
  24. Hafner, M., et al. PAR-CliP--a method to identify transcriptome-wide the binding sites of RNA binding proteins. Journal of Visualized Experiments. (41), (2010).
  25. Konig, J., et al. iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nature Structural & Molecular Biology. 17, (7), 909-915 (2010).
  26. Konig, J., et al. iCLIP--transcriptome-wide mapping of protein-RNA interactions with individual nucleotide resolution. Journal of Visualized Experiments. (50), (2011).
  27. Maticzka, D., Ilik, I. A., Aktas, T., Backofen, R., Akhtar, A. uvCLAP is a fast and non-radioactive method to identify in vivo targets of RNA-binding proteins. Nature Communications. 9, (1), 1142 (2018).
  28. Van Nostrand, E. L., et al. Robust transcriptome-wide discovery of RNA-binding protein binding sites with enhanced CLIP (eCLIP). Nature Methods. 13, (6), 508-514 (2016).
  29. Radulovich, N., Leung, L., Tsao, M. S. Modified gateway system for double shRNA expression and Cre/lox based gene expression. BMC Biotechnology. 11, 24 (2011).
  30. Breunig, C. T., et al. A Customizable Protocol for String Assembly gRNA Cloning (STAgR). Journal of Visualized Experiments. (142), (2018).
  31. Kuhn, R. M., Haussler, D., Kent, W. J. The UCSC genome browser and associated tools. Briefings in Bioinformatics. 14, (2), 144-161 (2013).
  32. Vourekas, A., et al. Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis. Nature Structural & Molecular Biology. 19, (8), 773-781 (2012).
  33. Preitner, N., et al. APC is an RNA-binding protein, and its interactome provides a link to neural development and microtubule assembly. Cell. 158, (2), 368-382 (2014).
  34. Meyer, C., et al. The TIA1 RNA-Binding Protein Family Regulates EIF2AK2-Mediated Stress Response and Cell Cycle Progression. Molecular Cell. 69, (4), 622-635 (2018).
  35. Gerstberger, S., Hafner, M., Tuschl, T. A census of human RNA-binding proteins. Nature Reviews Genetics. 15, (12), 829-845 (2014).
  36. Vourekas, A., Mourelatos, Z. HITS-CLIP (CLIP-Seq) for mouse Piwi proteins. Methods in Molecular Biology. 1093, 73-95 (2014).
माउस वृषण में प्रोटीन-बाउंड आरएनए की कुशल पहचान के लिए बढ़ाया क्रॉलिंकिंग इम्यूनोरेसिपिटेशन (eCLIP) विधि
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Xu, Q., Wang, C., Ling, L., Yue, Q., Liu, M., Zhang, S., Fu, K., Ye, L., Zheng, K. Enhanced Crosslinking Immunoprecipitation (eCLIP) Method for Efficient Identification of Protein-bound RNA in Mouse Testis. J. Vis. Exp. (147), e59681, doi:10.3791/59681 (2019).More

Xu, Q., Wang, C., Ling, L., Yue, Q., Liu, M., Zhang, S., Fu, K., Ye, L., Zheng, K. Enhanced Crosslinking Immunoprecipitation (eCLIP) Method for Efficient Identification of Protein-bound RNA in Mouse Testis. J. Vis. Exp. (147), e59681, doi:10.3791/59681 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter