Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Metodo di immunoprecipitazione crosslinking migliorato (eCLIP) per un'identificazione efficiente dell'RNA legato alle proteine nei testis del topo

doi: 10.3791/59681 Published: May 10, 2019
* These authors contributed equally

Summary

Qui, presentiamo un protocollo eCLIP per determinare i principali obiettivi di RNA dei candidati RBP in testis.

Abstract

La spermatogenesi definisce un processo altamente ordinato di differenziazione delle cellule germinate maschili nei mammiferi. In testis, la trascrizione e la traduzione sono disaccoppiate, sottolineando l'importanza della regolazione post-trascrizionale dell'espressione genica orchestrata dagli RPB. Per chiarire i ruoli meccanicistici di un RBP, la metodologia di immunoprecipitazione reticolazione (clip) può essere utilizzata per catturare i suoi bersagli endogeni diretti dell'RNA e definire i siti di interazione effettivi. Il CLIP migliorato (eCLIP) è un metodo appena sviluppato che offre diversi vantaggi rispetto alle clip convenzionali. Tuttavia, l'uso di eCLIP è stato finora limitato alle linee cellulari, chiedendo applicazioni espanse. Qui, abbiamo impiegato eCLIP per studiare MOV10 e MOV10L1, due helicasi di legame RNA noto, in testis del topo. Come previsto, troviamo che MOV10 si lega prevalentemente a 3' regioni non tradotte (UTR) di mRNA e MOV10L1 si lega selettivamente alle trascrizioni precursori di RNA (piRNA) che interagiscono con PIWI. Il nostro metodo eCLIP permette la determinazione rapida delle principali specie di RNA legate da vari RPB attraverso il sequenziamento su piccola scala di subcloni e quindi la disponibilità di biblioteche qualificate, come un mandato per procedere con sequenziamento profondo. Questo studio stabilisce una base applicabile per eCLIP nei testicoli per mammiferi.

Introduction

Il testicolo dei mammiferi rappresenta un ottimo modello evolutivo in cui un intricato programma di differenziazione cellulare corre ciclicamente per produrre numerosi spermatozoi. Un valore unico di questo modello risiede nell'emergere dell'inattivazione trascrizionale in certe fasi della spermatogenesi, tipicamente quando l'inattivazione del cromosoma del sesso meiotico (MSCI) si verifica1,2 e quando i spermatidi rotondi subiscono drastica compattazione nucleare durante lo spermiogenesi3. Questi eventi trascrizionali inconsecutivi richiedono una regolazione genica post-trascrizionale, in cui le proteine leganti l'RNA (RBPs) svolgono un ruolo cruciale, modellando il trascrittoma e mantenendo la fertilità maschile.

Per identificare gli obiettivi di RNA in buona fede di un singolo RBP in vivo, è stato sviluppato il metodo reticolazione immunoprecipitazione (clip)4,5, basato ma oltre l'immunoprecipitazione dell'RNA regolare (RIP)6,7 , per incorporazione di passaggi chiave tra cui cross-linking ultravioletti (UV), lavaggio rigoroso e trasferimento di gel per migliorare la specificità del segnale. L'applicazione avanzata della CLIP combinata con il sequenziamento ad alto rendimento ha suscitato grande interesse nella profilazione dell'interazione proteina-RNA a livelli di genoma8. Oltre agli studi genetici sulla funzione RBP, tali metodi biochimici che identificano l'interazione diretta di proteina e RNA endogeni sono stati indispensabili per chiarire accuratamente i ruoli normativi dell'RNA nei RPB. Ad esempio, MOV10L1 è una elicasi di RNA specifica per i testicoli necessaria per la fertilità maschile e la biogenesi9dell'RNA che interagisce con PIWI (Pirna). Il suo paralogo MOV10 è conosciuto come un onnipresente e multifunzionale RNA elicasi con ruoli in molteplici aspetti della biologia dell'RNA10,11,12,13,14 , 15 anni di , 16 anni di , 17 anni di , 18. impiegando le clip-Seq convenzionali, abbiamo scoperto che MOV10L1 lega e regola i precursori Pirna primari per avviare l'elaborazione iniziale di Pirna19,20, e che MOV10 lega le UTR di mRNA 3' e così come RNA non codificante specie nelle cellule germinate testicolari (dati non mostrati).

Tuttavia, CLIP è in origine una laboriosa, procedura radioattiva seguita da sequenza di preparazione della libreria con una notevole perdita di tag CLIP. Nella CLIP convenzionale, una libreria cDNA viene preparata utilizzando adattatori ligati ad entrambe le estremità dell'RNA. Dopo la digestione delle proteine, i polipeptidi corti reticolati restano attaccati ai frammenti di RNA. Questo segno di reticolazione blocca parzialmente la progressione della trascrittasi inversa (RTase) durante la sintesi di cDNA, risultando in cDNA troncati che rappresentano circa il 80% della libreria cDNA21,22. Pertanto, vengono sequenziati solo i frammenti cDNA risultanti da RTase che bypassano il sito di reticolazione (read-through). Recentemente, diversi approcci di CLIP, come PAR-CLIP, iCLIP, eCLIP e uvCLAP, sono stati impiegati per identificare i siti Crosslink di RBPs nelle cellule viventi. PAR-CLIP prevede l'applicazione di 365 nm di radiazione UV e analoghi nucleotidici fotoattivabili ed è quindi esclusivo per le cellule viventi in-coltura, e l'incorporazione di analoghi nucleosidici in trascrizioni di nuova sintesi è incline a produrre pregiudizi dove RNA interagisce fisicamente con la proteina23,24. In iCLIP, solo un singolo adattatore è legato all'estremità 3' di frammenti di RNA reticolati. Dopo la trascrizione inversa (RT), i cDNA troncati e read-through sono ottenuti mediante circolarizzazione intramoleularmente e re-linearizzazione seguita dall'amplificazione della reazione a catena della polimerasi (PCR)25,26. Tuttavia, l'efficienza della circolarizzazione intramolecolare è relativamente bassa. Sebbene i vecchi protocolli clip debbano etichettare l'RNA reticolato con un radioisotopo, il reticolazione ultravioletta e la purificazione dell'affinità (uvclap), con un processo di rigorosa purificazione dell'affinità di tandem, non si basano sulla radioattività27. Tuttavia, uvCLAP è limitato alle cellule coltivate che devono essere trasfected con il vettore di espressione portando il 3x FLAG-HBH tag per la purificazione di affinità tandem.

In eCLIP, gli adattatori sono stati legati prima all'estremità 3' dell'RNA seguita da RT, e successivamente all'estremità 3' dei cDNA in modalità intermolecolare. ECLIP è quindi in grado di catturare tutti i cDNA28troncati e read-through. Inoltre, non è limitato all'etichettatura radioattiva, né all'utilizzo di linee cellulari basate sul suo principio, pur mantenendo la risoluzione a singolo nucleotide.

Qui, forniamo una descrizione passo-passo di un protocollo eCLIP adattato per testis del mouse. Brevemente, questo protocollo eCLIP inizia con reticolazione UV dei tubuli testicolari, seguita da digestione parziale della RNAsi e immunoprecipitazioni utilizzando un anticorpo specifico per le proteine. Successivamente, l'RNA legato alla proteina è defosforilato e l'adattatore è legato alla sua estremità 3'. Dopo l'elettroforesi del gel proteico e il trasferimento da gel a membrana, l'RNA è isolato tagliando l'area della membrana di una gamma di dimensioni attese. Dopo RT, l'adattatore DNA è legato all'estremità 3' del cDNA seguita dall'amplificazione della PCR. Lo screening dei subcloni prima del sequenziamento ad alto throughput è considerato un controllo di qualità della libreria. Questo protocollo è efficace nell'identificare le principali specie di RNA legato alle proteine di RBPs, esemplificato dai due RNA che esprimono i testicoli MOV10L1 e MOV10.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Tutti gli esperimenti condotti sugli animali sono stati approvati dal comitato universitario di medicina di Nanjing. I topi maschi topi C57BL/6 sono stati mantenuti in condizioni di fotoperiodo controllato e sono stati forniti con cibo e acqua.

1. raccolta dei tessuti e crosslinking UV

  1. Euthanize 2 topi adulti che utilizzano anidride carbonica (CO2) per 1-2 min o fino a quando la respirazione si arresta. Successivamente, eseguire la dislocazione cervicale su ogni mouse.
  2. Raccogli circa 100 mg di testicoli da topi di età appropriata (un testone adulto in questo studio) per ogni esperimento di immunoprecipitazione e posiziona i tessuti in soluzione salina tampone di fosfato ghiacciato (PBS).
  3. Rimuovere la tunica albuginea delicatamente con un paio di pinzette a punta fine.
  4. Aggiungere 3 ml di PBS ghiacciato in un tritacarne e triturati il tessuto con una leggera forza meccanica utilizzando un pestolo di vetro sciolto (tipo a pestello di vetro).
    Nota: Lo scopo di questo passaggio non è quello di lisare le cellule, ma di separare il tessuto. È importante preservare la vitalità e l'integrità delle cellule.
  5. Trasferire la sospensione tissutale in un piatto di coltura cellulare (10 cm di diametro) e aggiungere un PBS ghiacciato fino a 6 mL.
  6. Agitare rapidamente il piatto in modo che il liquido copra uniformemente il fondo del piatto. Se il tessuto è macinato correttamente, i tubuli seminiferi distribuiti uniformemente saranno visibili, mentre la presenza di grumi di tessuto indica che la dispersione tissutale è non ottimale.
  7. Crosslink la sospensione tre volte con 400 mJ/cm2 a 254 nm su ghiaccio. Mescolare la sospensione tra ogni irraggiamento.
    Nota: Per ogni nuovo esperimento, il reticolazione deve essere ottimizzato.
  8. Raccogliere la sospensione in un tubo conico da 15 mL e pellet a 1.200 x g per 5 min a 4 ° c. Rimuovere il surnatante, risospendere il pellet in 1 mL di PBS e poi trasferire la sospensione in una provetta da centrifuga da 1,5 mL. Girare a 4 ° c e 1.000 x g per 2 min, e rimuovere supernatant.
  9. A questo punto, procedere immediatamente con il resto del protocollo, o bloccare a scatto i pellet in azoto liquido e conservare a-80 ° c fino all'uso.

2. preparazione delle perle

  1. Aggiungere 125 μL di proteine A perle magnetiche per campione (pellet) a una provetta centrifuga fresca.
    Nota: Utilizzare perle magnetiche G proteine per gli anticorpi del topo.
  2. Posizionare il tubo sul magnete per separare le perle dalla soluzione. Dopo 10 s, rimuovere il supernatante. Lavare le perle due volte con 1 mL di tampone di lisi ghiacciata.
    Nota: Successiva separazione della proteina le perle magnetiche seguono questo passo. La composizione del tampone di Lisi è 50 mM Tris-HCl, pH 7,5; 100 mM di NaCl; 1% NP-40; 0,1% SDS; 0,5% di desossicolato di sodio; 1/50 acido etilendiamminetetraacetico (EDTA)-libero inibitore della proteasi cocktail (aggiungere fresco).
  3. Risospendere le perle in 100 μL di tampone di Lisi a freddo con anticorpo eCLIP da 10 μg. Ruotare i tubi a temperatura ambiente per 45 min.
    Nota: La concentrazione finale di anticorpi per l'immunoprecipitazione è di 10 μg/mL. Se la concentrazione di anticorpi è sconosciuta, la quantità di anticorpo deve essere ottimizzata.
  4. Lavare le perle due volte con 1 mL di tampone di lisi ghiacciata.

3. Lisi tissutale e digestione a RNA parziale

  1. Risospendere i pellet di tessuto in 1 mL di tampone di Lisi a freddo (aggiungere 22 μL di cocktail di inibitore proteico esente da 50 x (EDTA) e 11 μL di inibitore della RNAsi a 1 mL di tampone di lisi).
    1. Risospendere due pellet a reticolato UV e due pellet non reticolati per gruppo di esperimenti: pellet UV-reticolato-1 per libreria eCLIP (UV-1); UV-crosslinked-2 pellet per libreria eCLIP (UV-2); pellet non reticolato-1 per libreria eCLIP come controllo (non UV); pellet non reticolato-2 per IgG IP per dimostrare la specificità degli anticorpi.
      Nota: il controllo ideale per la libreria eclip dei testicoli Wide-Cross-Linked UV è quello dei testicoli Knockout UV-crosslinked dai topi della stessa lettiera.
  2. Tenere lising i campioni su ghiaccio per 15 min (per prevenire la degradazione di proteine e RNA).
  3. Sonicare in un sonicatore digitale al 10% di ampiezza per 5 min, a 30 s on/30 s off. Collocare sempre il campione sul ghiaccio e pulire la sonda con acqua priva di nucleasi tra ciascun campione.
  4. Aggiungere 4 μL di DNase a ciascun tubo e mescolare bene. Incubare per 10 min a 37 ° c, scuotendo a 1.200 giri/min.
  5. Aggiungere 10 μL di RNasi I diluito (4 U/μL di RNasi I in PBS) e mescolare bene. Incubare per 5 min a 37 ° c, scuotendo a 1.200 giri/min.
  6. Eliminare il lisato mediante centrifugazione a 15.000 x g per 20 min (a 4 ° c).
  7. Raccogliere con cautela il supernatante. Lasciare 50 μL di lisato e gettare il pellet con esso.
  8. Salvare i campioni di input come RWB (Run per Western blot) e RRI (eseguire per l'isolamento dell'RNA). Risparmia 20 μL (2%) dei campioni UV-1, UV-2, non UV e IgG come input per il caricamento del gel RWB. Risparmia 20 μL (2%) di campioni UV-1 o UV-2 come input per il caricamento del gel RRI.

4. immunoprecipitazione

  1. Aggiungere 1 mL di lisato (dal passaggio 3,7) alle perle (preparate nel paragrafo 2) e ruotare i campioni a 4 ° c per 2 ore o durante la notte.
  2. Raccogli le perle con un supporto magnetico e scartare il surnatante. Lavare le perle due volte con 900 μL di tampone ad alto sale (50 mM Tris-HCl, pH 7,5; 1 M NaCl; 1 mM EDTA; 1% NP-40; 0,1% SDS; 0,5% sodio desossicolato), quindi lavare le perle due volte con 900 μL di tampone di lavaggio (20 mM Tris-HCl, pH 7,5; 10 mM MgCl2; 0,2% Tween-20).
    Nota: Per il campione IgG, sospendere la procedura qui e conservare sul ghiaccio nel tampone di lavaggio.
  3. Lavare le perle una volta con 500 μL di tampone di defosforilazione 1x (Tris-HCl da 10 mM, pH 7,5; 5 mM MgCl2; 100 mm kcl; 0,02% Triton X-100).

5. defosforilazione di RNA 3' estremità

  1. Raccogli le perle con un supporto magnetico e scartare il surnatante. Rimuovere il liquido residuo utilizzando puntali per pipette sottili. Aggiungere 100 μL di miscela Master di defosforilazione (10 μL di tampone di defosforilazione 10x [100 mM Tris-HCl, pH 8,0; 50 mM MgCl2; 1 M kcl; 0,2% Triton X-100; 1 mg/ml di albumina sierica bovina (BSA)]; 78 μl di acqua priva di nucleasi; 2 μl di inibitore della RNAsi; 2 μl di dnasi; 8 μl di al per ogni campione, e incubare per 15 min a 37 ° c, scuotendo a 1.200 rpm.
  2. Aggiungere 300 μL di miscela di polinucleotide chinasi (PNK) Master (60 μL di 5x PNK pH 6,5 buffer [350 mM Tris-HCl, pH 6,5; 50 mM MgCl2]; 223 μl di acqua priva di nucleasi; 5 μl di inibitore della RNAsi; 2 μl di dnasi; 7 μl di enzima PNK; 3 μl di 0,1 M di dithiothreitol) ad ogni campione , incubare per 20 min a 37 ° c, scuotendo a 1.200 rpm.
  3. Raccogli le perle con un supporto magnetico e scartare il surnatante. Lavare le perle una volta con 500 μL di tampone di lavaggio a freddo. Quindi lavare le perle una volta con 500 μL di tampone ad alto sale freddo. Ripetere questi Lavini ancora una volta in questo ordine.
  4. Lavare le perle una volta con 500 μL di tampone di lavaggio a freddo e poi due volte con 300 μL di tampone di legazione 1x freddo (no dithiothreitol, 50 mM Tris-HCl, pH 7,5; 10 mM MgCl2).

6. RNA adattatore legazione a RNA 3' estremità

  1. Eliminare il surnatante e rimuovere il liquido residuo con puntali per pipette sottili. Aggiungere 25 μL di miscela Master di legatura da 3' a ciascun campione. Mescolare accuratamente con il pipettaggio. Questo passo è incline alla produzione di bolle.
    Nota: La miscela Master di legazione contiene 3 μL di tampone di legazione 10x [500 mM Tris-HCl, pH 7,5; 100 mM MgCl2]; 9 μL di acqua priva di nucleasi; 0,4 μL di inibitore della RNAsi; 0,3 μL di 0,1 M di ATP; 0,8 μL di dimetilsolfossido (DMSO); 9 μL di 50% polietilenglicole (PEG) 8000; 2,5 μL di RNA ligasi [30 U/μL].
  2. Aggiungere 2,5 μL di adattatore RNA X1A (tabella 1) e 2,5 μl di adattatore RNA X1B (tabella 1) a ciascun campione. Miscelare accuratamente con pipettaggio o sfogliando, e incubare per 75 min a 25 ° c, per miscelare ogni 10 min.
  3. Lavare le perle una volta con 500 μL di tampone di lavaggio a freddo (riprendere il campione IgG qui).
  4. Lavare le perle una volta con 500 μL di tampone ad alto sale freddo e poi con 500 μL di tampone di lavaggio a freddo. Ripeti questi Lavini ancora una volta.
  5. Separare magneticamente le perle e rimuovere il liquido residuo con puntali per pipette sottili.
  6. Risospendere le perle in 100 μL di tampone di lavaggio a freddo (mettere in pausa il campione di IgG qui e conservare sul ghiaccio nel tampone di lavaggio). Spostare 20 μL in nuovi tubi come campioni di RWB. Separare magneticamente i restanti 80 μL come campioni RRI. Rimuovere il supernatante dei campioni RRI e risospendere le perle in 20 μL di tampone di lavaggio.
  7. Aggiungere 37,5 μL di tampone di campionamento 4x di dodecilsolfato (LDS) al litio e 15 μL di 10 volte l'agente riducente al campione IgG. Aggiungere 7,5 μL di tampone campione di 4x LDS e 3 μL di 10 volte l'agente riducente ai campioni (rimanenti). (Non miscelare con il pipettaggio). Incubare per 10 min a 70 ° c, scuotendo a 1.200 giri/min. Raffreddare su ghiaccio per 1 min, e centrifugare a 1.000 x g per 1 min a 4 ° c.

7. SDS-PAGE e trasferimento a membrana

  1. Caricare i gel.
    1. Per il gel RRI (gel proteico 4-12% bis-tris, 10-Well, 1,5 mm) Posizionare i tubi su un magnete e separare le proteine dalle perle. Caricare 30 μL di campione per pozzetto. I campioni sono distanziati da marker di dimensione proteica pre-macchiato.
    2. Per il gel RWB (gel proteico 4-12% bis-tris, 10-Well, 1,5 mm) Posizionare i tubi su un magnete e separare le proteine dalle perle. Caricare 15 μL di campione per pozzetto. Salvare i campioni rimanenti a-20 ° c come backup.
  2. Aggiungere 500 μL di antiossidante a 500 mL di 1x tampone SDS in esecuzione. Eseguire a 200 V nel buffer 1x SDS in esecuzione per 50 min o fino a quando il colorante anteriore è in basso.
    Nota: Antiossidante contiene N, N-dimetilformamide, bisulfite di sodio, che migra con proteine ridotte per prevenire la reossidazione di aminoacidi sensibili come la metionina e il triptofano.
  3. Trasferire i complessi di proteina-RNA dal gel a una membrana nitrocellulosa a 10 V per 70 min nel buffer 1xtransfer con il 10% di metanolo (vol/vol). Sciacquare la membrana RRI in PBS freddo, avvolgerla in involucro di plastica e conservare a-80 ° c.
  4. Bloccare la membrana RWB nel 5% di latte in TBST a temperatura ambiente per 1 h. Sciacquare la membrana in TBST. Incubare con l'anticorpo primario in TBST a 4 ° c durante la notte. Lavare due volte con TBST per 5 min. Incubare con anticorpo secondario (1:5000 IgG anti-coniglio di capra HRP) in TBST a temperatura ambiente per 1 h. lavare tre volte con TBST per 5 min, 10 min e 15 min, rispettivamente.
  5. Mescolare i volumi uguali di elettrochemiluminescenza (ECL) buffer A e tampone B, aggiungere alla membrana e incubare per 1 min. coprire la membrana con involucro di plastica, e esporla a un film a raggi X a temperatura ambiente per 2-3 min. Poi sviluppare il film.
    Nota: Il film con sovraesposizione mostrerà chiaramente la forma dei bordi della membrana, con cui il film può essere allineato di nuovo alla membrana RWB. Quindi, allineare le membrane RWB e RRI in base alle posizioni dei marcatori in esso. Strati in ordine dal basso verso l'alto sono il film, la membrana RWB e la membrana RRI in sequenza.

8. isolamento dell'RNA

  1. Tagliare la regione dalla banda proteica a 75 kDa (circa 220 NT di RNA) sopra di esso, utilizzando la membrana RWB e pellicola come guide.
    Nota: Poiché una molecola di RNA protetta da proteine può avere una lunghezza massima di 225 basi, con circa 340 da per base, è ragionevole tagliare la regione circa 75 kDa sopra la banda RBP per recuperare tutti i complessi di proteina-RNA.
  2. Tagliare il pezzo di membrana asportato in diverse piccole fette e metterli in una nuova provetta da centrifuga da 1,5 mL. Aggiungere 200 μL di tampone di proteinasi K (PK) (100 mM Tris-HCl pH 7,5; 50 mM NaCl; 10 mM EDTA) con 40 μL di PK ai pezzi di membrana. Mescolare e incubare per 20 min a 37 ° c, scuotendo a 1.200 giri/min.
  3. Aggiungere 200 μL di tampone di urea PK (100 mM Tris-HCl pH 7,4; 50 mM NaCl; 10 mM EDTA; 7 M urea) ad ogni campione. Incubare per 20 min a 37 ° c, scuotendo a 1.200 giri/min.
  4. Aggiungere 400 μL di acido fenolo/cloroformio/alcool isoamilico (25:24:1), mescolare bene e incubare per 5 min a 37 ° c, scuotendo a 1.200 rpm.
  5. Posizionare 2 mL di gel di blocco di fase (PLG) nella centrifuga e girare a 15.000 x g per 25 s.
  6. Trasferire tutti i contenuti eccetto le fette di membrana al tubo pesante PLG. Incubare per 5 min a 37 ° c, scuotendo a 1.200 giri/min.
  7. Girare a temperatura ambiente e 15.000 x g per 15 min. trasferire lo strato acquoso in un nuovo tubo conico da 15 ml.
  8. Utilizzare le colonne di purificazione e concentrazione dell'RNA per estrarre RNA.
    1. Aggiungere 2 volumi (800 μL) di tampone di binding RNA a ciascun campione (dal passaggio 8,7) e mescolare. Aggiungere un volume uguale (1200 μL) di etanolo 100% e mescolare.
    2. Trasferire 750 μL di campione (da Step 8.8.1) alle colonne di purificazione e concentrazione dell'RNA in un tubo di raccolta e centrifugare a 15.000 x g per 30 s. eliminare il flusso passante.
    3. Ripetere il passaggio 8.8.2 fino a quando tutti i campioni vengono passati attraverso la colonna. Aggiungere 400 μL di tampone di preparazione RNA alla colonna e centrifugare a 15.000 x g per 30 s. eliminare il flusso passante, applicare 700 μl di tampone di lavaggio RNA e centrifugare la colonna a 15.000 x g per 30 s. eliminare il flusso passante.
    4. Aggiungere 400 μL di tampone di lavaggio RNA alla colonna e centrifugare a 15.000 x g per 2 min. trasferire accuratamente la colonna in un nuovo tubo da 1,5 ml. Aggiungere 10 μL di acqua priva di nucleasi alla matrice di colonna, lasciare riposare per 2 minuti e centrifugare a 15.000 x g per 30 s. conservare i campioni eclip a-80 ° c fino a RT (passo 11,1).

9. defosforilazione dell'RNA di ingresso 3' estremità

  1. Aggiungere 15 μL di miscela Master di defosforilazione (2,5 μL di tampone di defosforilazione 10x [100 mM Tris-HCl, pH 8,0; 50 mM MgCl2; 1 M kcl; 0,2% Triton X-100; 1 mg/ml BSA]; 9,5 μl di acqua priva di nucleasi; 0,5 μl di inibitore della RNAsi; 2,5 μl di fosfatasi alcalina) a 10 μl di campioni di ingresso (dal passo 8.8.4). Incubare per 15 min a 37 ° c, scuotendo a 1.200 giri/min.
  2. Aggiungere 75 μL di PNK Master Mix (20 μL di 5x PNK PH 6,5 buffer [350 mM Tris-HCl, pH 6,5; 50 mM MgCl2]; 44 μl di acqua priva di nucleasi; 1 μl di inibitore della RNAsi; 2 μl di dnasi; 7 μl di enzima PNK; 1 μl di 0,1 M di dithiothreitol) ai campioni. Incubare per 20 min a 37 ° c, scuotendo a 1.200 giri/min.
  3. Pulizia dell'RNA di ingresso
    1. Risospendere gli acidi thenucleici estrazione magnetica beadsin il flaconcino (vortice per più di 30 s). Aggiungere 20 μL di acidi nucleici di estrazione di perle magnetiche per ogni campione di nuovi tubi. Raccogli le perle con un supporto magnetico e scartare il surnatante.
    2. Lavare le perle una volta con 1 mL di tampone di lisi di purificazione dell'RNA (tampone RLT). Posizionare il tubo su un magnete per 30 s e scartare il surnatante.
      Nota: Successiva separazione di acidi nucleici perle magnetiche estrazione ha seguito questo passo.
    3. Risospendere i grani con 300 μL di tampone RLT e aggiungerlo al campione. Aggiungere 10 μL di NaCl da 5 M e 615 μL di alcool etilico al 100% (EtOH) e miscelare mediante pipettaggio. Ruotare a temperatura ambiente per 15 minuti. Separare magneticamente le perle e rimuovere il surnatante.
    4. Risospendere le perle in 1 mL di 75% EtOH e trasferirla in un nuovo tubo. Dopo 30 s, Raccogli le perle con un supporto magnetico e scartare il surnatante. Lavare due volte con 75% EtOH, separare magneticamente le perle e scartare il liquido residuo con puntali per pipette sottili. Asciugare all'aria per 5 minuti (evitare l'essiccazione eccessiva).
    5. Risospendere le perle con 10 μL di acqua priva di nucleasi e incubare per 5 min. perline magneticamente separate e spostare 5 μL di supernatante in un nuovo tubo (per la legatura dell'adattatore 3' sotto). Il rimanente RNA può essere conservato a-80 ° c come backup.

10. RNA adattatore legazione all'ingresso RNA 3' estremità

  1. Aggiungere 1,5 μL di DMSO e 0,5 μL di adattatore RiL19 (tabella 1) a 5 ΜL di RNA di ingresso (dal passo 9.3.5), incubare per 2 minuti a 65 ° c e posizionarlo su ghiaccio per più di 1 minuto. aggiungere 13,5 μl di miscela Master di legatura 3' per ogni campione , mescolare per pipettaggio e incubare per 75 min a 25 ° c, con la miscelazione per mescolare ogni 15 min.
    Nota: La legazione Master Mix contiene 2 μL di tampone di legazione 10x [500 mM Tris-HCl, pH 7,5; 100 mM MgCl2; 10 mm dithiothreitol]; 1,5 μL di acqua priva di nucleasi; 0,2 μL di inibitore della RNAsi; 0,2 μL di 0,1 M di ATP; 0,3 μL di DMSO; 8 μL di 50% PEG8000; 1,3 μL di RNA ligasi [30 U/μL].
  2. Pulizia dell'RNA di ingresso Ligato
    1. Separare magneticamente 20 μL di acidi nucleici di estrazione di perle magnetiche per ogni campione, e rimuovere il surnatante. Lavare le perle una volta con 1 mL di tampone RLT.
    2. Risospendere le perle in 61,6 μL di tampone RLT e sospensione di trasferimento ad ogni campione. Aggiungere 61,6 μL di 100% di EtOH. Usare la pipetta per mescolare per 15 min ogni 5 min. perline magneticamente separate, e rimuovere supernatant.
    3. Ripetere il passaggio 9.3.4.
    4. Risospendere le perle con 10 μL di acqua priva di nucleasi e lasciarlo riposare per 5 minuti. Separare magneticamente le perle e trasferire 10 μL di supernatante in un nuovo tubo.
      Nota: Questo è un possibile punto di arresto (i campioni di ingresso possono essere conservati a-80 ° c fino al giorno successivo).

11. trascrizione inversa, DNA adattatore legazione a cDNA 3' estremità

  1. Aggiungere 0,5 μL di primer RT (tabella 1) a 10 ΜL di RNA di ingresso (da Step 10.2.4) e 10 ΜL di RNA clip (dal passo 8.8.4) rispettivamente, incubare per 2 minuti in un blocco PCR preriscaldato a 65 ° c, posizionarlo su ghiaccio per più di 1 minuto.
  2. Aggiungere 10 μL di Master Mix RT (2 μL di tampone RT [500 mM Tris-HCl, pH 8,3; 750 mM KCl; 30 mM MgCl2]; 4 μl di acqua priva di nucleasi; 0,3 μL di inibitore della RNAsi; 2 μl di 0,1 m di dithiothreitol; 0,2 μl di 0,1 m di dATP; 0,2 μl di 0,1 m dCTP; 0,2 μl di 0,1 M dGTP; 0,2 μL di 0,1 M di dTTP; 0,9 μL di trascrittasi inversa) ad ogni campione, miscelare, incubare a 55 ° c per 45 min su un blocco PCR preriscaldato.
  3. Miscelare 20 μL di prodotto di reazione RT con 3,5 μL di reagente per la pulizia del prodotto PCR. Incubare per 15 minuti a 37 ° c.
  4. Aggiungere 1 μL di 0,5 M EDTA, miscelare mediante pipettaggio. Aggiungere 3 μL di NaOH di 1 M, miscelare per pipettaggio e incubare per 12 minuti a 70 ° c su un blocco PCR per idroidinare il modello RNA.
  5. Aggiungere 3 μL di HCl 1 M, miscela di pipette per neutralizzare il tampone.
  6. Pulizia di cDNA
    1. Separare magneticamente 10 μL di perle magnetiche di estrazione dell'acido nucleico per ogni campione, rimuovere il surnatante. Lavare una volta con 500 μL di tampone RLT.
    2. Risospendere le perle in 93 μL di tampone RLT e sospendere il trasferimento al campione. Aggiungere 111,6 μL di 100% di EtOH, incubare per 5 minuti e miscelare la pipetta ogni 2 min. Raccogli le perle con un supporto magnetico e scartare il surnatante. Risospendere le perle con 1 mL di 80% EtOH e passare ad un nuovo tubo.
    3. Dopo 30 s, Raccogli le perle con un supporto magnetico e scartare il surnatante. Lavare due volte con 80% EtOH. Separare magneticamente e smaltire il liquido residuo con una punta fine. Asciugare all'aria per 5 minuti (evitare l'essiccazione eccessiva). Risospendere le perle in 5 μL di Tris-HCl da 5 mM e incubare per 5 min.
  7. Aggiungere 0,8 μL di adattatore di DNA (tabella 1) e 1 ΜL di DMSO alle perle, incubare per 2 min a 75 ° c. Mettere sul ghiaccio per più di 1 min.
  8. Preparare 12,8 μL di miscela Master di legatura (2 μL di tampone di legazione 10x [500 mM Tris-HCl; 100 mM MgCl2; 10 mm dithiothreitol]; 1,1 μl di acqua priva di nucleasi; 0,2 μl di 0,1 M ATP; 9 μl di 50% PEG8000; 0,5 ΜL di RNA ligasi [30 U/μl]) , Flick per mescolare, girare brevemente in una centrifuga, e aggiungerlo a ogni campione, mescolare il campione con la punta della pipetta lentamente.
  9. Aggiungere un altro 1 μL di RNA ligasi [30 U/μL] a ciascun campione e scorrere per miscelare. Incubare per 30 s a 25 ° c, scuotendo a 1.200 giri/min. Incubare a 25 ° c durante la notte. Flick per mescolare leggermente 5 a 6 volte, una volta all'ora.
  10. Pulizia della cDNA ligata
    1. Separare magneticamente 5 μL di acidi nucleici di estrazione di perle magnetiche per ogni campione, e rimuovere surnatante.
    2. Lavare una volta con 500 μL di tampone RLT.
    3. Risospendere le perle in 60 μL di tampone RLT su perline e trasferire la sospensione ad ogni campione. Aggiungere 60 μL di 100% di EtOH, incubare per 5 minuti e miscelare la pipetta ogni 2 min. Separare magneticamente, scartare surnatante.
    4. Ripetere il passaggio 9.3.4.
    5. Risospendere le perle con 27 μL di Tris-HCl da 10 mM, incubare per 5 min. Separare magneticamente e spostare 25 μL di campione in un nuovo tubo. Diluire i 1 μL di cDNA ligata con 9 μL di acqua priva di nucleasi in un nuovo tubo. Conservare i campioni rimanenti a-20 ° c fino al passaggio 13,1.

12. quantificazione della cDNA mediante PCR quantitativa in tempo reale (qPCR)

  1. Aggiungere 9 μL di miscela Master qPCR (5 μL di mix master 2x; 3,6 μL di acqua priva di nucleasi; 0,4 μL di miscela di primer [10 μM PCR-F-D50X e 10 μM PCR-R-D70X]) su una piastra qPCR da 96 pozzetti. Aggiungere 1 μL di 1:10 diluito (in H2O) cDNA (da Step 11.10.5), sigillare e miscelare.
  2. Eseguire il programma qPCR in un termociclatore: 2 min a 50 ° c; 2 min a 95 ° c; 3 s a 95 ° c seguita da 30 s a 68 ° c per 40 cicli; 15 s a 95 ° c seguita da 60 s a 68 ° c seguita da 15 s a 95 ° c per 1 ciclo. Nota CT (soglia ciclo) valore.

13. amplificazione della PCR di cDNA

  1. Erogare 35 μL di miscela Master PCR (25 μL di miscela Master 2x PCR; 5 μL di acqua priva di nucleasi; 5 μL di miscela di primer [20 μM PCR-F-D50X e 20 μM PCR-R-D70X]) in strisce da 8 pozzetti. Per il gruppo CLIP, aggiungere 12,5 μL di campione CLIP + 2,5 μL di H2O; per il gruppo di ingressi, aggiungere 10 μL di ingressi + 5 μL di H2O. mescolare bene e ruotare brevemente in centrifugazione.
  2. Eseguire il programma PCR: 30 s a 98 ° c; 15 s a 98 ° c seguita da 30 s a 68 ° c seguita da 40 s a 72 ° c per 6 cicli; 15 s a 98 ° c seguita da 60 s a 72 ° c per N cicli = (valori qPCR CT-3)-6; 60 s a 72 ° c; 4 ° c tenere premuto.
    Nota: È preferibile eseguire da 1 a 2 cicli PCR aggiuntivi per il primo paio di clip.

14. purificazione del gel

  1. Caricare campioni su un gel di agarosio ad alta risoluzione del 3%. Lasciando 1 pozzo vuoto tra i campioni, e utilizzare una scala su entrambi i lati del gel. Eseguire a 100 V per 75 min in 1x tampone Tris-Borato-EDTA (TBE).
  2. Sotto l'illuminazione di luce blu, tagliare le fette di gel 175-350 BP utilizzando lame di rasoio fresco per ogni campione. Metterli in 15 mL di tubi conici.
    1. Pesare la fetta di gel e eluire il gel utilizzando un kit di estrazione del gel.
    2. Aggiungere 6x volumi di tampone di dissoluzione del gel per fondere il gel (100 mg di gel = 600 μL di tampone di dissoluzione del gel). Sciogliere il gel a temperatura ambiente. (Agitare per mescolare ogni 15 minuti fino a quando la fetta di gel è completamente disciolta). Aggiungere 1 volume di gel di 100% isopropanolo e mescolare bene.
    3. Trasferire 750 μL di campione (da Step 14.2.2) alla colonna in un tubo di raccolta e centrifugare a 17.900 x g per 1 min. eliminare il flusso passante.
    4. Ripetere il passo 14.2.3 fino a quando tutti i campioni sono passati attraverso la colonna, lavare una volta con 500 μL di tampone di dissoluzione del gel.
    5. Aggiungere 750 μL di tampone di lavaggio (dal kit di estrazione del gel) alla colonna e centrifugare a 17.900 x g per 1 min. eliminare il flusso passante, girare a 17.900 x g per 2 min. Posizionare la colonna su un nuovo tubo da 1,5 ml.
    6. Rimuovere tutto il tampone di lavaggio rimanente dal bordo viola di plastica della colonna. Asciugare l'aria per 2 min. aggiungere 12,5 μL di acqua priva di nucleasi al centro della membrana. Lasciate riposare la colonna per 2 minuti a temperatura ambiente e ruotate a 17.900 x g per 1 min (per una resa migliorata, ripetete la fase di eluizione).

15. TOPO Clone di prodotto PCR

  1. Preparare il mix di reazione di clonazione TOPO (1 μL di prodotto PCR dal passo 14.2.6; 1 μL di miscela di clonazione; 3 μL di acqua sterile). Mescolare delicatamente e incubare per 5 min a 20-37 ° c. Raffreddare sul ghiaccio.
  2. Scongelare i batteri E. coli chimicamente competenti sul ghiaccio. Aggiungere 5 μL del prodotto di clonazione TOPO a 100 μL di batteri competenti29. Mescolare delicatamente bene. Incubare su ghiaccio per 30 min.
  3. Shock termico per 60 s a 42 ° c. Poi raffreddare su ghiaccio per 2 min. aggiungere 900 μl di brodo di lisogenia (lb) medio, incubare a 37 ° c per 1 h, scuotendo a 225 rpm. Girare a 1.000 x g per 1 minuto, quindi rimuovere 900 μl di supernatante. Risospendere il resto della soluzione.
  4. Piastra i batteri trasformati su 1,5% LB piastre agar contenenti ampicillina (100 μg/mL), e incubare durante la notte a 37 ° c.
  5. Preparare almeno 20 1,5 mL di provette centrifughe per ogni costrutto. Riempire un set con 500 μL di mezzo LB contenente 100 μg/mL di ampicillina. Utilizzare una punta di pipetta sterile per graffiare una colonia batterica in modo casuale e mescolare (pipettando) con 500 μL di mezzo LB. Incubare a 37 ° c per 5 ore, scuotendo a 225 giri/min.
  6. Sequenza del frammento di inserto utilizzando il fondo di inversione M13: CAGGAAACAGCTATGAC di Sanger sequenziamento30.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

La procedura eclip e i risultati sono illustrati nella figura 1, figura 2, Figura 3, figura 4. I topi sono stati eutanizzati con anidride carbonica e una piccola incisione è stata fatta nel basso addome utilizzando forbici chirurgiche (Figura 2a,B). Testicoli del mouse sono stati rimossi, detunicated e poi UV-crosslinked dopo la macinazione (Figura 2C-I). I risultati di eCLIP rappresentativi dell'uso di due helicasi leganti RNA conosciute nei tessuti testali sono rappresentati nelle figure 3 e 4. Abbiamo eseguito MOV10 eCLIP in testicoli da topi wild-type adulti, con concentrazione comune di 40 U/mL di RNase I trattamento del lisato reticolato. Il pannello superiore della Figura 3A Mostra che la proteina bersaglio di dimensioni circa 114 kDa è stata arricchita con successo. Western blot delle proteine MOV10L1 immunoprecipitate è stata eseguita con due concentrazioni (5 o 40 U/mL) di RNasi I durante il processo eCLIP (Figura 3A). La Figura 3B Mostra qPCR utilizzando 1:10 cDNA diluito (già legati con adattatore DNA) da MOV10 e MOV10L1 UV-crosslinked, non reticolato, e il campione di input abbinato dimensione corrispondente (sminput). I campioni non reticolati mostrano una riduzione del recupero dell'RNA. Abbiamo osservato che, i valori di CT del gruppo non reticolato era generalmente 5 volte più di UV-crosslinked gruppo. La Figura 4a Visualizza l'amplificazione della PCR e la selezione delle dimensioni tramite elettroforesi con gel di agarosio (Cut 175-350 BP). Primer-dimer prodotto appare a circa 140 BP. Figura 4B Mostra la vista del browser del genoma UCSC di due sequenze subclone rappresentative. I tag eCLIP MOV10-Bound si trovano all'interno del 3' UTR del gene FTO; Il tasso approssimativo di 3' obiettivi UTR conti per 75% (Figura 4c), coerente con la maggior parte dei bersagli MOV10 in HEK293 celle10 e nei testicoli (dati non mostrati). Al contrario, i tag eCLIP con associazione a MOV10L1 si trovano all'interno di un cluster piRNA che indica MOV10L1 bersagli piRNA precursori. Il tasso approssimativo di bersagli precursori di piRNA rappresenta il 42% (Figura 4E), che riflette una tendenza rispetto al nostro precedente esperimento clip20convenzionale. MOV10L1 eCLIP con 40 U/mL la digestione di RNasi I produce relativamente più sequenze con meno di 20 BP (Figura 4D).

Figure 1
Figura 1 : Rappresentazione schematica di eCLIP. I tubuli seminiferi con puntatore UV-crosslinked (fase 1) sono lisati nel tampone di lisi eCLIP e sonicato (fase 2). Il lisato viene trattato con RNasi I a frammento di RNA, dopo di che i complessi di proteina-RNA sono immunoprecipitati utilizzando l'anticorpo anti-RBP (passaggio 3-4). Vengono eseguite defosforilazione di frammenti di RNA e Legazione di 3 ′ RNA Adapter (passo 5-6). I complessi di proteina-RNA vengono eseguiti su un gel SDS-PAGE e trasferiti alle membrane di nitrocellulosa (fase 7). RNA viene recuperato dalla membrana digerendo la proteina con proteinasi K e urea che lascia un breve polipeptide rimanente nel sito di collegamento incrociato. Viene eseguita la defosforilazione dei frammenti di RNA dei campioni di input e la legatura dell'adattatore di 3 ′ RNA (fase 8). Eseguire RT di RNA e Legazione di 3 ′ adattatore di DNA (passo 9-10). Eseguire l'amplificazione della PCR della libreria cDNA, l'estrazione del gel e la clonazione di PCR smussata per il controllo preliminare della qualità della libreria (passaggio 11). Infine, eseguire il sequenziamento ad alta velocità (passaggio 12). Si prega di cliccare qui per visualizzare una versione più grande di questa cifra.

Figure 2
Figura 2 : Raccolta tissutale testis e reticolazione UV. (A) l'esposizione dell'addome del topo. B) un'incisione di 0,5 cm nella parete addominale che espone il peritoneo. (C) una coppia di testicoli viene tolto tirando fuori i tamponi di grasso. D) il tessuto testicolare viene rimosso e collocato in un piccolo piatto contenente PBS ghiacciato. (E) rimuovere delicatamente la tunica albuginea. (F) Premere il pestolo sciolto per triturati il tessuto in una smerigliatrice tessuto Dounce. G) tubuli seminiferi distribuiti in una placca da 10 cm. H) reticolazione UV con 400 MJ/cm2 di energia. I) i campioni reticolati sono raccolti in provette da centrifuga da 1,5 ml. Si prega di cliccare qui per visualizzare una versione più grande di questa cifra.

Figure 3
Figura 3 : Risultati rappresentativi di MOV10 e MOV10L1 eCLIP. (A) convalida Western Blot di immunoprecipitates MOV10 e MOV10L1. (B) qpcr su 1:10 librerie eclip diluite di MOV10 e MOV10L1, con repliche per i campioni UV, non UV e sminput accoppiati. Si prega di cliccare qui per visualizzare una versione più grande di questa cifra.

Figure 4
Figura 4 : preparazione della libreria eclip e valutazione della qualità. (A) vengono mostrate le immagini in gel dell'amplificazione PCR. Asterisco indica il dimero del primer. La linea rossa punteggiata indica le regioni asportate per il prodotto PCR di cDNA, da qualche parte tra 175 e 350 BP. (B) vista del browser del genoma UCSC di due sequenze di subclone rappresentative31. (C) analisi del sequenziamento del subclone su piccola scala di MOV10. (D) i tag con associazione a MOV10L1 visualizzano modelli distinti di distribuzione della lunghezza quando elaborati da due diverse concentrazioni di RNAsi. (E) analisi del sequenziamento del subclone su piccola scala di MOV10L1. Si prega di cliccare qui per visualizzare una versione più grande di questa cifra.

Nome sequenza Informazioni sulla sequenza descrizione
Adattatori RNA
RNA X1A /5Phos/AUAUAGGNNNNNAGAUCGGAAGAGCGUCGUGUAG/3SpC3/ stock a 200 μM; lavorare a 20 μM
RNA X1B /5Phos/AAUAGCANNNNNAGAUCGGAAGAGCGUCGUGUAG/3SpC3/ stock a 200 μM; lavorare a 20 μM
RiL19 /5phos/AGAUCGGAAGAGCGUCGUG/3SpC3/ stock a 200 μM; lavorare a 40 μM
Adattatore DNA
Rand103tr3 /5Phos/NNNNNNNNNNAGATCGGAAGAGCACACGTCTG/3SpC3/ stock a 200 μM; lavorare a 80 μM
Primer RT
AR17 Di ACACGACGCTCTTCCGA stock a 200 μM; lavorare a 20 μM
Primer PCR

PCR-F-D 501
L'AATGATACGGCGACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACGACRCTCTTCCGATCT stock a 100 μM; lavorare a 20 μM
PCR-R-D 701 CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC stock a 100 μM; lavorare a 20 μM
(Vedere la lettera di assistenza clienti illumina per D502-508, D702-712)

Tabella 1: sequenze di adattatori e primer. L'adapter contiene un in-line Random-Mer (N5 o N10) per determinare se due letture sequenziate identiche indicano due frammenti di RNA univoci o duplicati PCR dello stesso frammento di RNA. "5 Phos" sta per 5' fosforilazione, che è necessaria se un oligo è usato come substrato per DNA/RNA ligasi. "3SpC3" sta per 3' C3 distanziatore, che può impedire la legazione tra gli adattatori.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Con la crescente comprensione del ruolo universale degli RBPS in contesti sia biologici che patologici, i metodi di ritaglio sono stati ampiamente utilizzati per rivelare la funzione molecolare di RBPS20,32,33, 34,35. Il protocollo qui descritto rappresenta un'applicazione adattata del metodo eCLIP ai testis del mouse.

Una sfida nell'esecuzione di eclip in testicolo è mantenere la vitalità e l'integrità delle cellule testicolari fresche, che è anche importante per l'efficace reticolazione. Cesellare il testicolo con forza meccanica lieve utilizzando il pestello sciolto può prevenire la lisi cellulare32,36. Una corretta digestione dell'RNA è fondamentale anche per i saggi eCLIP di successo. I frammenti di RNA potrebbero essere più convergenti dopo la digestione, ma la lunghezza inferiore a 20 BP può essere rimossa tramite la pre-elaborazione delle letture della libreria. Al fine di adottare un dosaggio ideale di RNAsi per un candidato RBP, suggeriamo un test preliminare basato sui risultati del sequenziamento del subclone di librerie eCLIP che possono essere preparati dal trattamento RNase con concentrazioni che vanno da 0 a 40 U (per millilitro di lisato). L'analisi del sequenziamento del subclone su piccola scala è un passo consigliato per un esame affidabile della qualità della libreria nel nostro metodo eCLIP. In primo luogo, la percentuale di inserti inferiori a 20 BP non dovrebbe essere troppo alta, oppure, la successiva pre-elaborazione della libreria eCLIP causerà una costosa perdita di letture. In secondo luogo, deve essere verificata l'efficienza della corretta legazione di entrambi gli adattatori. I campioni substandard possono essere eliminati senza sequenziamento profondo per garantire un sequenziamento profondo di successo, i cui risultati generalmente ci vogliono molto più tempo per l'analisi.

Anche se la fattibilità di eclip nei testicolo del topo è ancora limitata dalla specificità dell'anticorpo per la fase di immunoprecipitazione, eclip è vantaggioso rispetto ai metodi tradizionali di clip in diversi aspetti. In primo luogo, è un metodo non radioattivo. Con eCLIP, gli obiettivi RNA di RBPs sono direttamente catturati in vivo senza dover ricorrere a tecniche intensive di manodopera che utilizzano materiali radioattivi. In secondo luogo, il metodo è meno intensivo di tempo. L'intera procedura richiede solo 4 giorni attraverso la preparazione della libreria eCLIP. Terzo, la diversità di sequenza. Confrontato con il ciclo di amplificazione unificato convenzionale di 25-35 cicli, eclip si riferisce ai valori CT di qPCR per impostare il numero di cicli PCR specificamente. Infine, fornisce un rapporto segnale/rumore più forte. L'input corrispondente alle dimensioni funge da sfondo appropriato per gli obiettivi autentici.

In sintesi, i nostri risultati eCLIP consolidano le conclusioni che MOV10 e MOV10L1 hanno una preferenza vincolante per i precursori di mRNA 3' UTR e piRNA, rispettivamente. Il protocollo che abbiamo descritto qui rappresenta il primo impiego del metodo eCLIP nella riproduzione, un'area in cui la conoscenza dell'interazione RNA-RBP è piuttosto insufficiente, anche se gli studi genetici hanno fornito ampie informazioni sui ruoli biologici di RBPs. la visualizzazione di questo protocollo eCLIP può aiutare a guidare le sue applicazioni diffuse in aree più ampie.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno nulla da rivelare.

Acknowledgments

Ringraziamo Eric L Van Nostrand e gene W Yeo per una guida utile con il protocollo originale. K.Z. è stato supportato da National Key R & D programma della Cina (2016YFA0500902, 2018YFC1003500), e la Fondazione nazionale di scienze naturali della Cina (31771653). L.Y. è stato sostenuto dalla Fondazione nazionale di scienze naturali della Cina (81471502, 31871503) e dal programma innovativo e imprenditoriale della provincia di Jiangsu.

Materials

Name Company Catalog Number Comments
Antibodies
Anti-mouse MOV10  antibody Proteintech, China 10370-1-AP
Anti-mouse MOV10L1 antibody Zheng et al.20109 polyclonal antisera UP2175 provided by P. Jeremy Wang lab, University of Pennsylvania
HRP Goat Anti-Rabbit IgG  ABclonal AS014
Rabbit IgG Beyotime, China A7016
Equipment
Centrifuge Eppendorf, Hamburg, Germany 5242R
Digital sonifier BRANSON,USA BBV12081048A 450 Watts; 50/60 Hz
DynaMag-2 Magnet Invitrogen,USA 12321D
Mini Blot Module Invitrogen,USA B1000
Mini Gel Tank Invitrogen,USA A25977
Shaking incubator Eppendorf, Hamburg, Germany Thermomixer comfort 
Tissue Grinder, Dounce PYREX, USA 1234F35 only  the "loose" pestle is used in this protocol
TProfessional standard 96 Gradient Biometra, Germany serial no.: 2604323
Tube Revolver  Crystal, USA serial no.: 3406051
UV-light cross-linker UVP, USA CL-1000
Materials
TC-treated Culture Dish Corning, USA 430167 100 mm 
Tubes Corning, USA 430791 15 mL
Microtubes tubes AXYGEN , USA MCT-150-C 1.5 mL 
Reagents 
Acid phenol/chloroform/isoamyl alcohol  Solarbio, China P1011 25:24:01
AffinityScript Enzyme Agilent, USA 600107
Antioxidant Invitrogen,USA NP0005
DH5α competent bacteria Thermo Scientific, USA 18265017 these economical cells yield >1 x 106 transformants/µg control DNA per 50 µL reaction.
DMSO Sigma-Aldrich, USA D8418
DNA Ladder Invitrogen, USA 10416014
dNTP Sigma-Aldrich, USA DNTP100-1KT
Dynabeads Protein A  Invitrogen, USA 10002D
ECL reagent Vazyme, China E411-04
EDTA Invitrogen, USA AM9260G
EDTA free protease inhibitor cocktail Roche, USA 04693132001 add fresh
Exo-SAP-IT Affymetrix, USA 78201 PCR Product Cleanup Reagent 
FastAP enzyme Thermo Scientific, USA EF0652
LDS Sample Buffer Thermo Scientific, USA NP0007
MetaPhor Agarose  lonza, Switzerland 50180
MgCl2 Invitrogen, USA AM9530G
MiniElute gel Extraction QIAGEN, Germany 28604 column store at 4 ?; buffer QG=gel dissolving buffer; buffer PE= wash buffer(for step 14)
MyONE Silane beads Thermo Scientific, USA 37002D nucleic acids extraction magnetic beads
NaCl Invitrogen,USA AM9759
 
NP-40 Amresco, USA M158-500ML
NuPAGE Bis-Tris Protein Gels Invitrogen, USA NP0336BOX 4%–12%,1.5 mm, 15-well
NuPAGE MOPS SDS Buffer Kit  Invitrogen, USA NP0050
PBS Gibco, USA 10010023
Phase-Locked Gel (PLG) heavy tube   TIANGEN, China WM5-2302831
PowerUp SYBR Green Master Mix Applied Biosystems, USA A25742
Proteinase K NEB, New England  P8107S
Q5 PCR master mix  NEB, New England  M0492L
RLT buffer QIAGEN, Germany 79216 RNA purification lysis buffer 
RNA Clean & Concentrator-5 columns  ZYMO RESEARCH, USA R1016 RNA purification and concentration columns
RNase I  Invitrogen, USA AM2295
RNase Inhibitor Promega, USA N251B
RQ1 DNase Promega,USA M610A
Sample Reducing Agent Invitrogen,USA NP0009
SDS Solution Invitrogen, USA 15553027 10%
Sodium deoxycholate Sigma-Aldrich, USA 30970 protect from light
T4 PNK enzyme NEB, New England  M0201L
T4 RNA ligase 1 high conc NEB, New England  M0437M
TA/Blunt-Zero Cloning Mix Vazyme, China C601-01
TBE Invitrogen,USA AM9863
Tris-HCI Buffer Invitrogen, USA 15567027
Triton X-100 Sangon Biotech, China A600198 
Tween-20 Sangon Biotech, China A600560
Urea Sigma-Aldrich, USA U5378
X-ray Films Caresteam, Canada 6535876

DOWNLOAD MATERIALS LIST

References

  1. Turner, J. M., Mahadevaiah, S. K., Ellis, P. J., Mitchell, M. J., Burgoyne, P. S. Pachytene asynapsis drives meiotic sex chromosome inactivation and leads to substantial postmeiotic repression in spermatids. Developmental Cell. 10, (4), 521-529 (2006).
  2. Turner, J. M. A. Meiotic sex chromosome inactivation. Development. 134, (10), 1823-1831 (2007).
  3. Kimmins, S., Sassone-Corsi, P. Chromatin remodelling and epigenetic features of germ cells. Nature. 434, (7033), 583-589 (2005).
  4. Ule, J., et al. CLIP identifies Nova-regulated RNA networks in the brain. Science. 302, (5648), 1212-1215 (2003).
  5. Ule, J., Jensen, K., Mele, A., Darnell, R. B. CLIP: a method for identifying protein-RNA interaction sites in living cells. Methods. 37, (4), 376-386 (2005).
  6. Trifillis, P., Day, N., Kiledjian, M. Finding the right RNA: identification of cellular mRNA substrates for RNA-binding proteins. RNA. 5, (8), 1071-1082 (1999).
  7. Tenenbaum, S. A., Carson, C. C., Lager, P. J., Keene, J. D. Identifying mRNA subsets in messenger ribonucleoprotein complexes by using cDNA arrays. Proceedings of National Acadamy of Sciences U S A. 97, (26), 14085-14090 (2000).
  8. Chi, S. W., Zang, J. B., Mele, A., Darnell, R. B. Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 460, (7254), 479-486 (2009).
  9. Zheng, K., et al. Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway. Proceedings of National Acadamy of Sciences U S A. 107, (26), 11841-11846 (2010).
  10. Gregersen, L. H., et al. MOV10 Is a 5' to 3' RNA helicase contributing to UPF1 mRNA target degradation by translocation along 3' UTRs. Molecular Cell. 54, (4), 573-585 (2014).
  11. Banerjee, S., Neveu, P., Kosik, K. S. A coordinated local translational control point at the synapse involving relief from silencing and MOV10 degradation. Neuron. 64, (6), 871-884 (2009).
  12. Choi, J., Hwang, S. Y., Ahn, K. Interplay between RNASEH2 and MOV10 controls LINE-1 retrotransposition. Nucleic Acids Research. 46, (4), 1912-1926 (2018).
  13. Goodier, J. L., Cheung, L. E., Kazazian, H. H. Jr MOV10 RNA helicase is a potent inhibitor of retrotransposition in cells. PLoS Genetics. 8, (10), e1002941 (2012).
  14. Haussecker, D., et al. Capped small RNAs and MOV10 in human hepatitis delta virus replication. Nature Structural & Molecular Biology. 15, (7), 714-721 (2008).
  15. Kenny, P. J., et al. MOV10 and FMRP regulate AGO2 association with microRNA recognition elements. Cell Reports. 9, (5), 1729-1741 (2014).
  16. Messaoudi-Aubert, S. E., et al. Role for the MOV10 RNA helicase in Polycomb-mediated repression of the INK4a tumor suppressor. Nature Structural & Molecular Biology. 17, (7), 862-868 (2010).
  17. Sievers, C., Schlumpf, T., Sawarkar, R., Comoglio, F., Paro, R. Mixture models and wavelet transforms reveal high confidence RNA-protein interaction sites in MOV10 PAR-CLIP data. Nucleic Acids Research. 40, (20), e160 (2012).
  18. Skariah, G., et al. Mov10 suppresses retroelements and regulates neuronal development and function in the developing brain. BMC Biology. 15, (1), 54 (2017).
  19. Zheng, K., Wang, P. J. Blockade of pachytene piRNA biogenesis reveals a novel requirement for maintaining post-meiotic germline genome integrity. PLoS Genetics. 8, (11), e1003038 (2012).
  20. Vourekas, A., et al. The RNA helicase MOV10L1 binds piRNA precursors to initiate piRNA processing. Genes & Development. 29, (6), 617-629 (2015).
  21. Hocq, R., Paternina, J., Alasseur, Q., Genovesio, A., Le Hir, H. Monitored eCLIP: high accuracy mapping of RNA-protein interactions. Nucleic Acids Research. 46, (21), 11553-11565 (2018).
  22. Huppertz, I., et al. iCLIP: protein-RNA interactions at nucleotide resolution. Methods. 65, (3), 274-287 (2014).
  23. Hafner, M., et al. Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 141, (1), 129-141 (2010).
  24. Hafner, M., et al. PAR-CliP--a method to identify transcriptome-wide the binding sites of RNA binding proteins. Journal of Visualized Experiments. (41), (2010).
  25. Konig, J., et al. iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nature Structural & Molecular Biology. 17, (7), 909-915 (2010).
  26. Konig, J., et al. iCLIP--transcriptome-wide mapping of protein-RNA interactions with individual nucleotide resolution. Journal of Visualized Experiments. (50), (2011).
  27. Maticzka, D., Ilik, I. A., Aktas, T., Backofen, R., Akhtar, A. uvCLAP is a fast and non-radioactive method to identify in vivo targets of RNA-binding proteins. Nature Communications. 9, (1), 1142 (2018).
  28. Van Nostrand, E. L., et al. Robust transcriptome-wide discovery of RNA-binding protein binding sites with enhanced CLIP (eCLIP). Nature Methods. 13, (6), 508-514 (2016).
  29. Radulovich, N., Leung, L., Tsao, M. S. Modified gateway system for double shRNA expression and Cre/lox based gene expression. BMC Biotechnology. 11, 24 (2011).
  30. Breunig, C. T., et al. A Customizable Protocol for String Assembly gRNA Cloning (STAgR). Journal of Visualized Experiments. (142), (2018).
  31. Kuhn, R. M., Haussler, D., Kent, W. J. The UCSC genome browser and associated tools. Briefings in Bioinformatics. 14, (2), 144-161 (2013).
  32. Vourekas, A., et al. Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis. Nature Structural & Molecular Biology. 19, (8), 773-781 (2012).
  33. Preitner, N., et al. APC is an RNA-binding protein, and its interactome provides a link to neural development and microtubule assembly. Cell. 158, (2), 368-382 (2014).
  34. Meyer, C., et al. The TIA1 RNA-Binding Protein Family Regulates EIF2AK2-Mediated Stress Response and Cell Cycle Progression. Molecular Cell. 69, (4), 622-635 (2018).
  35. Gerstberger, S., Hafner, M., Tuschl, T. A census of human RNA-binding proteins. Nature Reviews Genetics. 15, (12), 829-845 (2014).
  36. Vourekas, A., Mourelatos, Z. HITS-CLIP (CLIP-Seq) for mouse Piwi proteins. Methods in Molecular Biology. 1093, 73-95 (2014).
Metodo di immunoprecipitazione crosslinking migliorato (eCLIP) per un'identificazione efficiente dell'RNA legato alle proteine nei testis del topo
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Xu, Q., Wang, C., Ling, L., Yue, Q., Liu, M., Zhang, S., Fu, K., Ye, L., Zheng, K. Enhanced Crosslinking Immunoprecipitation (eCLIP) Method for Efficient Identification of Protein-bound RNA in Mouse Testis. J. Vis. Exp. (147), e59681, doi:10.3791/59681 (2019).More

Xu, Q., Wang, C., Ling, L., Yue, Q., Liu, M., Zhang, S., Fu, K., Ye, L., Zheng, K. Enhanced Crosslinking Immunoprecipitation (eCLIP) Method for Efficient Identification of Protein-bound RNA in Mouse Testis. J. Vis. Exp. (147), e59681, doi:10.3791/59681 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter