Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

마우스 고환에서 단백질 결합 RNA를 효율적으로 식별 하기 위한 향상 된 가교 면역 침전 (eCLIP) 방법

doi: 10.3791/59681 Published: May 10, 2019
* These authors contributed equally

Summary

여기에서, 우리는 고환에서 RBP 후보자의 주요 RNA 표적을 결정 하는 eCLIP 프로토콜을 제시 합니다.

Abstract

정자 생성은 포유류에서 남성 생식 세포 분화의 고도로 주문 된 과정을 정의 합니다. 고환에서, 전사 및 번역은 결합 되지 않습니다, RBPs에 의해 조율 된 유전자 발현의 포스트 전사 조절의 중요성을 밑줄. RBP의 기계적 역할을 명료 하 게 하기 위해, 가교 면역 침전 (CLIP) 방법론은 내 인 성 직접 RNA 표적을 포착 하 고 실제 상호작용 부위를 정의 하는데 사용 될 수 있다. 향상 된 클립 (eCLIP)은 기존 클립에 비해 여러 가지 장점을 제공 하는 새롭게 개발 된 방법입니다. 그러나, eCLIP의 사용은 지금까지 확장 된 응용 프로그램에 대 한 호출, 셀 라인에 제한 되었습니다. 여기에서, 우리는 마우스 고환에서 두 개의 알려진 RNA 결합 헬 리 아 제를 연구 하기 위해 eCLIP을 사용 했습니다. MOV10 및 MOV10L1 예상한 바와 같이, 우리는 MOV10 우세 하 게 mRNA의 3 ' 미 번역 지역 (UTRs)에 결합 하 고 MOV10L1 선택적으로 Piwi 상호 작용 RNA (피 르 나) 전 구체 전사체에 묶는 것을 발견 합니다. 우리의 eCLIP 방법은 깊은 시퀀싱을 진행 하기 위한 영장으로 서브 클론의 소규모 시퀀싱 및 자격을 갖춘 라이브러리의 가용성을 통해 다양 한 RBPs에 의해 바인딩된 주요 RNA 종의 빠른 결정을 할 수 있습니다. 본 연구는 포유류 고환에서의 eCLIP에 대 한 적용 가능한 기초를 확립 한다.

Introduction

포유류 고환은 다 수의 정자를 생산 하기 위해 복잡 한 세포 분화 프로그램이 순환적으로 실행 되는 우수한 발달 모델을 나타낸다. 이 모델의 독특한 가치는 정자의 특정 단계에서 전사 불 활성화의 출현에 놓여 있으며, 일반적으로 meiotic 성 염색체 불 활성화 (MSCI)가 발생 하면1,2 및 둥근 spermatogenesis가 발생할 때 정 동안 급격 한 핵 압축. 이 연속적인 전사 이벤트는 RNA 결합 단백질 (RBPs)이 전사체를 형성 하 고 남성의 비 옥을 유지 하는 중요 한 역할을 하는 전사 후 유전자 조절을 필요로 합니다.

생체 내에서 개별 rbp의 선의의 rna 표적을 규명 하기 위해, 상기 가교 면역 침전 (CLIP) 법은 통상의 rna 면역 침전 (RIP)을 넘어서는것을 기준으로4,5를 개발 하였으며,7 , 자외선 (UV) 가교 결합, 엄격한 세척 및 겔 전달을 포함 하는 주요 단계의 혼 입에 의해 신호 특이성을 향상 시킨다. 고 처리량 시퀀싱과 결합 된 클립의 진보 된 응용은 게놈 전체 수준8에서 단백질 RNA 상호작용을 프로 파일링 하는 것에 큰 관심을 불러 일으킨 것입니다. RBP 기능에 대 한 유전 연구 외에, 내 인 성 단백질과 RNA의 직접적인 상호 작용을 식별 하는 이러한 생화학 적 방법은 Rbp의 RNA 규제 역할을 정확 하 게 해명 하는 데 필수적입니다. 예를 들어, MOV10L1는 남성의 비 옥 및 Piwi 상호작용 RNA (피 르 나) 생물 발생9에 필요한 고환 특이 rna 헬 리 아 제 이다. 그것의 paralogue MOV10는 rna 생물학의 다 양상에서 역할을 가진 ubiquitously 표현 되 고 다기능 rna 헬 리 아 제로 알려져 있습니다10,11,12,13 , 15 , 16 , 17 , 18. 종래의 클립-서 열을 채용 함으로써, 우리는 MOV10L1이 초기 피 르 나 전 구체를 결합 하 고 조절 하는 것을 발견19,20, 그리고 MOV10 mRNA 3 ' utrs 뿐만 아니라 비 코딩 RNA를 개시 하기 위하여 고환 배아 세포의 종 (데이터가 표시 되지 않음).

그럼에도 불구 하 고, 클립은 원래 힘든, 클립 태그의 현저한 손실로 시퀀싱 라이브러리 준비 뒤에 방사성 절차. 종래의 클립에 있어서, cDNA 라이브러리는 양쪽 RNA 말단에서 결 찰 어댑터를 사용 하 여 제조 된다. 단백질 소화 후, 가교 된 짧은 폴 리 펩타이드는 RNA 단편에 부착 된 상태로 유지 됩니다. 이 가교 마크는 cdna 합성 동안 부분적으로 역방향 역전사 (rtase) 진행을 차단 하 여, cdna 라이브러리21,22의 약 80%를 나타내는 잘린 cdnas를 생성 한다. 따라서, 가교 결합 부위 (read)를 우회 하는 RTase에서 기인 하는 cDNA 단편만이 시퀀싱 된다. 최근에는 파 클립, iCLIP, eCLIP 및 uvCLAP와 같은 다양 한 클립 접근법이 살아있는 세포에서 RBPs의 크로스 링크 사이트를 식별 하는 데 사용 되었습니다. PAR 클립은 365 nm UV 방사선 및 광 활성화 가능한 뉴클레오티드 유사 체의 적용을 포함 하 고, 따라서 배양 살아있는 세포에 배타적 이며, 새로 합성 된 전사체에 뉴 클레 오 유사 체의 혼 입은 편견을 일으키기 쉽다 RNA가 물리적으로 단백질23,24와 상호 작용 하는 곳. ICLIP에서 단일 어댑터만이 가교 된 RNA 단편의 3 ' 말단에 결 찰 됩니다. 역 전사 (RT) 후에, 잘린 및 읽기-스루 cdnas는 중 합 효소 연쇄 반응 (PCR) 증폭25,26에의 한 인트라 내 순환 화 및 재 선형화에 의해 얻어진 다. 그러나, 분 자체 순환의 효율은 상대적으로 낮다. 구형 클립 프로토콜은 방사성 동위 원소, 자외선 가교 결합 및 친화성 정제 (uvCLAP)와 함께 가교 된 RNA의 라벨링이 필요 하지만, 엄격한 탠덤 친화성 정제 과정을 통해 방사능27에 의존 하지 않는다. 그럼에도 불구 하 고, uvCLAP는 탠덤 친화성 정제를 위해 3x FLAG-HBH 태그를 운반 하는 발현 벡터로 형질 감염 되어야 하는 배양 세포로 제한 된다.

ECLIP에서, 어댑터는 RT의 3 인치 말단에서 먼저, 그리고 분자 간 모드에서 cDNAs의 3 가지 말단에서 다음으로 결 찰 되었습니다. 따라서, eCLIP은 모든 절단 및 판독을 통해 cDNA (28)를 캡처할 수 있다. 또한, 단일 뉴클레오티드 분해능을 유지 하면서도, 방사성 라벨링에 국한 되지 않고, 그 원리에 기초한 세포 주를 사용 하지 않는다.

여기서는 마우스 고환에 적합 한 eCLIP 프로토콜에 대 한 단계별 설명을 제공 합니다. 간단히 말해서,이 eCLIP 프로토콜은 고환 세관의 UV 가교 결합으로 시작 하 여 단백질 특이 적 항 체를 사용 하는 부분적인 RNase 소화 및 면역 침전이 이어집니다. 다음으로, 단백질 결합 RNA는 dephosphorylated이 고, 어댑터는 3 ' 말단으로 결 찰 된다. 단백질 겔 전기 영동 및 겔-막 전달 후, RNA는 예상 된 크기 범위의 멤브레인 영역을 절단 하 여 분리 된다. RT 후, DNA 어댑터는 PCR 증폭에 이어서 cDNA의 3 ' 말단에 결 찰 된다. 높은 처리량 시퀀싱 전에 서브 클론의 스크리닝은 라이브러리 품질 관리로 취합니다. 이 프로토콜은 두 개의 고환 발현 RNA 헬 리 아 제 MOV10L1 및 MOV10에 의해 예시 되는 RBPs의 단백질 결합 RNA의 주요 종을 식별 하는 데 효율적입니다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

모든 수행 동물 실험은 난징 의료 대학 위원회에 의해 승인 되었습니다. 수 컷 C57BL/6 마리의 마우스는 조절 된 광 기간 조건 하에서 유지 되었고, 음식과 물과 함께 공급 되었다.

1. 조직 수확 및 UV 가교 결합

  1. 성인 마우스 2 개를 1-2 분 동안 또는 호흡이 멈출 때까지 이산화탄소를 이용 하 여 안락사 시켰다. 다음, 각 마우스에 자 궁 경부 탈 구를 수행.
  2. 각각의 면역 침전 실험에 대 한 적절 한 연령 (본 연구에서 1 성인 고환)의 생쥐 로부터 고환의 약 100 mg을 수확 하 고,이 조직을 빙 냉 인산 완충 식 염 액 (PBS)에 배치 한다.
  3. 섬세 한 팁을 가진 핀셋을 사용 하 여 튜 니 카 알 부 니 아를 부드럽게 제거 하세요.
  4. 티슈 분쇄기에 3 mL의 얼음 차가운 PBS를 첨가 하 고 느슨한 유리 유 봉 (유리 유 봉)을 사용 하 여 온화한 기계적 힘으로 조직을 삼 출 합니다.
    참고: 이 단계의 목적은 세포를 lyse 하는 것이 아니라 조직을 분리 하는 것입니다. 세포 생존 력과 완전성의 보전이 중요 합니다.
  5. 조직 현 탁 액을 세포 배양 접시에 옮겨 넣고 (지름 10cm), 최대 6ml의 얼음 차가운 PBS를 추가 합니다.
  6. 접시를 빨리 흔들어 액체가 접시 바닥을 고르게 덮으 십시오. 조직이 제대로 지상에 있는 경우에, 균등 하 게 분산 된 수 관 세관은 보일 것입니다, 반면 조직 덩어리의 존재는 조직 분산이 최적이 아님을 나타냅니다.
  7. Ice에서 254 nm에서 400 mJ/cm2 로 현 탁 액을 세 번 교차 연결 합니다. 각 조사 사이에 서 스 펜 션을 섞는다.
    참고: 각각의 새로운 실험에 대해 가교를 최적화 해야 합니다.
  8. 4 ° c에서 5 분 동안 1200 x g 에서 15 mL 원뿔형 튜브 및 펠 릿에서 현 탁 액을 수집 한다. 상층 액을 제거 하 고, 펠 렛을 PBS 1 mL에 소생 시킨 다음, 현 탁 액을 1.5 mL 원심 분리기 튜브로 옮깁니다. 4°c 및 1000 x g 에서 2 분간 스핀 하 고 상층 액을 제거 한다.
  9. 이 시점에서, 즉시 프로토콜의 나머지 부분을 진행 하거나, 액체 질소로 펠 렛을 스냅 동결 하 고, 사용 될 때까지-80 ° c에서 저장 한다.

2. 구슬 준비

  1. 125 µ L의 단백질을 시료 당 자기 비드 (펠 렛)에 넣고 신선한 원심 분리기 튜브에 추가 합니다.
    참고: 마우스 항 체를 위한 단백질 G 마그네틱 비드를 사용 합니다.
  2. 용액에서 비드를 분리 하기 위해 자석에 튜브를 놓습니다. 10 초 후 상층 액을 제거 합니다. 구슬 2 개를 얼음-차가운 용 해 완충 액 1Ml 씩 두 번 씻으십시오.
    참고: 후속 단백질의 분리 자성 비드는이 단계를 따른다. 용 해 완충 제 조성 물은 50 mM 트리-HCl, pH 7.5; 100 mM 염화 나트륨; 1% NP-40; 0.1% SDS; 0.5% 나트륨 deoxycholate; 1/50 ethylenediaminetetraacetic 산 (EDTA)-프리 프로 테아 제 억제제 칵테일 (신선 하 게 추가).
  3. 10 µ g eCLIP 항 체를 가진 차가운 용 해 완충 액의 100 µ L에 있는 구슬의 소생. 45 분 동안 실 온에서 튜브를 돌립니다.
    참고: 면역 침전에 대 한 최종 항 체 농도는 10 µ 이다. 항 체 농도가 알려지지 않은 경우, 항 체의 양은 최적화 되어야 한다.
  4. 구슬 2 개를 얼음-차가운 용 해 완충 액 1Ml 씩 두 번 씻으십시오.

3. 조직 용 해 및 부분적인 RNA 소화

  1. 차가운 용 해 완충 액 1Ml의 소생 조직 펠 렛 (EDTA) 무 첨가 단백질 억제제 칵테일과 µ의 RNase 억제제의 11 µ L을 용 해 완충 액 1 mL에 추가 한다.
    1. 실험 군 당 2 개의 자외선 가교 펠 렛과 2 개의 비 가교 된 펠 렛을 소생: UV-가교 된 eCLIP 라이브러리 용 펠 렛 (UV-1); UV 가교-eCLIP 라이브러리에 대 한 2 개의 펠 릿 (UV-2); 대조 군으로 서 eCLIP 라이브러리를 위한 비 가교-1 펠 렛 (비 UV); IgG IP에 대 한 비 가교-2 개의 펠 렛은 항 체의 특이성을 입증 한다.
      참고: UV 가교 된 넓은 유형의 고환의 eCLIP 라이브러리에 대 한 이상적인 제어는 동일한 쓰레기의 쥐에서 UV 가교 된 녹아웃 고환의 것입니다.
  2. 단백질 및 RNA의 분해를 방지 하기 위해 15 분 동안 얼음에 샘플을 보관 하십시오.
  3. 디지털 초음파 발생기에서 10%의 진폭에서 30 초/30 초 off로 5 분 동안 초음파 처리 합니다. 샘플을 항상 얼음 위에 놓고 각 시료 사이에 뉴 클레 아 제가 없는 물로 프로브를 청소 하십시오.
  4. 각 튜브에 DNase의 4 µ L을 추가 하 고 잘 섞는다. 37 ° c에서 10 분 동안 배양 하 여 1200 rpm으로 흔들어 준다.
  5. 희석 된 RNase I (PBS에 4U/µ L RNase I)의 10 µ L을 추가 하 고 잘 섞는다. 37 ° c에서 5 분 동안 배양 하 여 1200 rpm으로 흔들어 준다.
  6. 15000 x g 에서 4 ° c에서 20 분간 원심 분리 하 여 파쇄 물을 지웁니다.
  7. 상 등 액을 조심 스럽게 모으십시오. 50 µ L의 용 해물을 남겨 두고 펠 렛을 버리십시오.
  8. 입력 샘플을 Rwb (웨스턴 블랏을 위해 실행) 및 RWB (RNA 격리를 위해 실행)로 저장 합니다. 저장 20 µ (2%) uv-1, uv 2, 비 UV 및 IgG 샘플의 RWB 겔 로딩에 대 한 입력으로. 저장 20 µ (2%) RRI 겔 로딩을 위한 입력으로 서의 UV-1 또는 UV-2 샘플.

4. 면역 침전

  1. 상기 파쇄 물 (3.7 단계부터)을 비드에 1 mL 첨가 하 여 2 시간 또는 하룻밤 동안 4°c에서 샘플을 회전 시켰다.
  2. 마그네틱 스탠드를 사용 하 여 구슬을 수집 하 고 상층 액을 버립니다. 900 µ l의 고 염 완충 액 (50 mM 트리 스-HCl을 사용 하 여 구슬 두 번 세척 ph 7.5; 1%의 염화 나트륨; 1% NP-40; 0.1% deoxycholate 나트륨)을 사용 하 여 구슬 2 개를 세척 완충 액의 µ l로 세척 하 고 0.5, 10mmmgcl 2; 900% 트윈-20).
    참고: IgG 샘플의 경우 여기에서 절차를 일시 중지 하 고 얼음 위에 세척 완충 액에 보관 하십시오.
  3. 500 µ L의 1 배의 탈 인 산화 완충 액 (10mm 트리 스-HCl, pH 7.5, 5Mmmgcl2; 100 mm KCl; 0.02% 트리톤 X-100).

5. RNA 3 ' 말단의 탈 인 산화

  1. 마그네틱 스탠드를 사용 하 여 구슬을 수집 하 고 상층 액을 버립니다. 미세한 파이 펫 팁을 사용 하 여 잔류 액체를 제거 합니다. 추가 100 µ L의 탈 인 산화 마스터 믹스 (10 µ L의 탈 인 산화 완충 액 [100 mM 트리 스-HCl, pH 8.0; 50. 1 mg의 보 소 혈 청 알 부 민; 1 밀리 그램/m l. 뉴 클레 아 제 무 첨가 물; µ의 µ l의 rnase ase 억제제; 2 µ 78의 l 0.2 칼 린 인산 가수분해 효소)를 각각의 샘플에, 37 ° c에서 15 분 동안 배양 하 고, 1200 rpm에서 흔들어 준다.
  2. 추가 300 µ L 폴 리 뉴클레오티드 키나 제 (PNK) 마스터 믹스 (60 µ L의 PNK pH 6.5 완충 액 [350 mM 트리 스-HCl, pH 6.5; 50);; 223 µ l의 뉴 클레 아 제 불포함 물; 5 µ l rnase 억제제; pnk 효소의 7 µ l; 각 시료에 대해 3 µ l의 0.1 M 디 티 오 스 톨) 1200 rpm에서 37 ° c에서 20 분 동안 배양 합니다.
  3. 마그네틱 스탠드를 사용 하 여 구슬을 수집 하 고 상층 액을 버립니다. 500 µ L의 차가운 워시 버퍼를 사용 하 여 구슬을 한 번 씻으십시오. 그런 다음 차가운 고 염 완충 액의 500 µ L로 한 번 구슬을 씻으십시오. 이 순서 대로 한 번 더이 세척을 반복 합니다.
  4. 차가운 세척 완충 액의 500 µ l을 한 번 세척 하 고, 300 µ의 차가운 1 배 결 찰 7.5 50 완충 액으로 2 번 씻는 다. 10 mm mgcl 2).

6. rna 어댑터는 RNA 3 ' 끝에 결 찰

  1. 상층 액을 버리고 미세한 파이 펫 팁으로 잔류 액체를 제거 하십시오. 각 샘플에 3 ' 결 찰 마스터 믹스 25 µ L을 추가 합니다. 파이 펫 팅으로 조심 스럽게 섞으 세요. 이 단계는 기포를 생성 하는 경향이 있다.
    참고: 결 찰 마스터 믹스는 10 배 결 찰 완충 액의 3 µ L를 포함 합니다 [500 mM 트리 스-HCl, pH 7.5; 100 mM MgCl2]; 9 µ L 뉴 클레 아 제 무-물; RNase 억제제의 0.4 µ L; 0.3 µ L 0.1 M ATP; 디 메 틸 설 폭 사이드의 0.8 µ L; 50% 폴 리 에틸렌 글리콜 (PEG) 8000의 9 µ L; 2.5 µ l의 RNA 리가 제 [30u/µ l].
  2. 추가 2.5 µ L의 RNA 어댑터 X1A (표 1) 및 2.5 µ l의 RNA 어댑터 X1B (표 1) 각 샘플에. 피 펫 팅 또는 25 ° c에서 75 분 동안 배양 하 여 신중 하 게 혼합 하 고 10 분 마다 섞어 쓸으 십시오.
  3. 500 µ L의 콜드 워시 완충 액으로 한 번 비드를 씻으 세요 (여기에서 IgG 샘플을 재개 하십시오).
  4. 500 µ L의 차가운 고 염 완충 액으로 한 번 비드를 씻고 500 µ L 콜드 워시 버퍼를 사용 하십시오. 이 세척을 한 번 더 반복 하십시오.
  5. 비드를 자기적으로 분리 하 고 미세한 파이 펫 팁으로 잔류 액체를 제거 합니다.
  6. 콜드 워시 완충 액의 100 µ L에 구슬을 소생 (여기에 IgG 샘플을 일시 중지 하 고 세척 버퍼에 얼음에 저장). RWB 샘플로 20 µ L을 새 튜브로 옮깁니다. 나머지 80 µ L을 RRI 샘플로 자기적으로 분리 합니다. RRI 샘플의 상층 액을 제거 하 고 세척 완충 액의 20 µ L에서 비드를 소생 시킵니다.
  7. 37.5 µ L의 4 배 리튬도 데 실 황산 염 (LDS) 샘플 완충 액 및 15 µ L의 10 배 시료 감소 제를 IgG 시료에 추가 합니다. 7.5 µ L의 LDS 샘플 버퍼 4 개를 추가 하 고 (나머지) 샘플에 3 µ L의 10 배 샘플을 줄입니다. (파이 펫 팅으로 혼합 하지 마십시오). 70 ° c에서 10 분 동안 배양 하 여 1200 rpm으로 흔들어 준다. 얼음을 1 분간 식힌 후 4°c에서 1 분 동안 1000 x g 에서 원심 분리 합니다.

7. SDS 페이지 및 멤브레인 전송

  1. 젤을 로드 합니다.
    1. RRI 젤 (4-12% 비스 트리 스 프로 틴 젤, 10 웰, 1.5 mm) 용 출 액에서 튜브를 자석에 놓고 분리 된 단백질을 구슬에서 넣습니다. 웰 당 샘플 30 µ L을 로드 합니다. 샘플은 미리 염색 된 단백질 크기 마커로 이격 되어 있습니다.
    2. RWB 젤 (4-12% Bis-트리 스 프로 틴 젤, 10well 1.5 mm)에 튜브를 자석에 놓고 분리 된 단백질을 구슬에서 용 출 액. 웰 당 샘플 15 µ L을 로드 합니다. 나머지 샘플을-20°c에서 백업으로 저장 합니다.
  2. 500 µ L의 항 산화 제를 500 mL의 1x SDS 실행 버퍼에 추가 하십시오. 50 분 동안 또는 염료 전면이 하단에 있을 때까지 1x SDS 실행 버퍼에서 200 V에서 실행 하십시오.
    참고: 산화 방지 제에는 N, Dimethylformamide, 아 황산 수소 나트륨이 포함 되어 있으며,이는 감소 된 단백질로 마이그레이션하여 메티오닌 및 트립토판과 같은 민감한 아미노산의 재 산화를 예방 합니다.
  3. 겔에서 니트로 멤브레인으로 10% 메탄올에서 70 분의 단백질 RNA 복합체를 10v/min의 1xtransfer 버퍼로 전달 합니다. RRI 멤브레인을 차가운 PBS에 헹 구 고 플라스틱 랩으로 싸서-80 ° c로 보관 하십시오.
  4. RWB 멤브레인을 1 시간 동안 실 온에서 TBST의 5% 우유로 차단 하십시오. TBST에서 멤브레인을 헹 구 십시오. 4 ° c 하룻밤 동안 TBST에서 일차 항 체와 함께 배양 합니다. Tbst로 5 분간 2 회 세척 하 고, 상 온에서 1 시간 동안 2 차 항 체 (1:5000 HRP 염소 반 토끼 IgG)를 사용 하 여 5 분간 TBST로 3 회 세척 합니다.
  5. 동일한 부피의 전기 발광 (ECL) 버퍼 A와 버퍼 B를 혼합 하 여 멤브레인에 추가 하 고 1 분간 배양 합니다. 플라스틱 랩으로 멤브레인을 덮고 2-3 분 동안 실 온에서 X 선 필름에 노출 시킵니다. 그런 다음 필름을 개발 합니다.
    참고: 과다 노출을 가진 필름은 막이 RWB 막에 다시 정렬 될 수 있는 멤브레인의 가장자리의 모양을 명확 하 게 보여줍니다. 그런 다음 내부 마커의 위치를 기준으로 RWB 및 RWB 멤브레인을 정렬 합니다. 바닥에서 상부로 순차적으로 층은 필름, RWB 멤브레인 및 RWB 멤브레인을 순차적으로 계층화 한다.

8. RNA 분리

  1. 단백질 밴드에서 75 kDa (RNA의 약 220 nt)의 영역을 가이드로 서 RWB 멤브레인과 필름을 사용 하 여 절단 한다.
    참고: 단백질 보호 RNA 분자는 225 염기의 최대 길이를 가질 수 있는 것으로 서, 염기 당 약 340 Da와 함께, 모든 단백질 RNA 복합체를 회수 하기 위해 RBP 밴드 이상의 75 kDa에 대 한 영역을 절단 하는 것이 합리적 이다.
  2. 멤브레인을 적 출하 여 몇 개의 작은 조각으로 자른 후 신선한 1.5 mL 원심 분리기 튜브에 넣습니다. 추가 200 µ l의 프로 테이 나 제 K (pk) 완충 액 (100 mm 트리 스-HCl pH 7.5, 50 mm 염화 나트륨 10mmedta 40)을 첨가 하 여 멤브레인 조각에 µ. 37 ° c에서 20 분 동안 혼합 하 고 배양 하 여 1200 rpm에서 흔들어 줍니다.
  3. 각 시료에 200 µ l의 PK 우 50 7.4 레 아 완충 액 (100 mm)을 추가 합니다. 37 ° c에서 20 분 동안 배양 하 여 1200 rpm으로 흔들어 준다.
  4. 400 µ L의 페 놀/클로로 포 름/isoamyl 알콜 (25:24:1)을 첨가 하 고 37 ° c에서 5 분 동안 잘 섞어 1200 rpm에서 흔들어 줍니다.
  5. 원심 분리기에 2 mL 상 락 젤 (PLG)을 넣고 25 초 동안 15000 x g 에서 회전 시킵니다.
  6. 멤브레인 슬라이스를 제외한 모든 내용물을 PLG 무거운 튜브로 전송 합니다. 37 ° c에서 5 분 동안 배양 하 여 1200 rpm으로 흔들어 준다.
  7. 실 온에서 스핀을 하 고 15 분 동안 15000 x g 의 새 15 mL 원추형 튜브로 수성 층을 전달 합니다.
  8. Rna 정제 및 농축 컬럼을 사용 하 여 RNA를 추출 합니다.
    1. 각 샘플 (8.7 단계에서)에 RNA 결합 버퍼의 2 개의 볼륨 (800 µ L)을 추가 하 고 섞는다. 100% 에탄올과 혼합의 동등한 부피 (1200 µ L)를 추가 합니다.
    2. 750 µ L 샘플 (단계 8.8.1에서)을 수집 튜브에 있는 RNA 정제 및 농축 칼럼에 전달 하 고 30 초 동안 15000 x g 에서 원심 분리기를 통과 시켰다.
    3. 모든 샘플이 열을 통과할 때까지 8.8.2 단계를 반복 합니다. 추가 400 µ L에 RNA 준비 버퍼를 열 및 원심 분리기에서 30 초 동안 15000 x g . 플로우 스루를 버리고, rna 세척 완충 액의 700 µ l를 바르고 30 초 동안 15000 x g 에서 컬럼을 원심 분리 하십시오. 흐름을 취소 합니다.
    4. 400 µ L을 추가 하 고 2 분 동안 원심 분리기를 15000 x g 에서 열을 세척 합니다. 열을 조심 스럽게 새 1.5 mL 튜브로 옮깁니다. 열 매트릭스에 뉴 클레 아 제 없는 물 10 µ L을 추가 하 고 2 분간 방치 한 후 30 초 동안 15000 x g 에서 원심 분리기를 사용 하십시오. RT (단계 11.1)까지-80 ° c에서 eclip 샘플을 저장 하십시오.

9. 입력 RNA 3 ' 말단의 탈 인 산화

  1. 추가 15 µ L의 탈 인 산화 마스터 믹스 (2.5 µ L의 10 배 인 산화 버퍼 [100 mM 트리 스-HCl, pH 8.0; 50 mM MgCl2; 1m KCl; 0.2% 트리톤 X-100; 9.5 µ l-뉴 클레 아 제 무 함유 물; RNase 억제제의 0.5 µ l) 내지 10 µ l의 입력 샘플 (단계 8.8.4에서). 37 ° c에서 15 분 동안 1200 rpm으로 흔들어 배양 합니다.
  2. Pnk 마스터 믹스 75 µ l 추가 (20 µ l/5 pnk PH 6.5 버퍼 [350 mM 트리 스-HCl, PH 6.5; 50); 44 µ l의 뉴 클레 아 제 불포함 물; 1 µ l의 rnase 억제제; pnk 효소의 2 µ l;의 7µ l을 샘플에. 0.1 37 ° c에서 20 분 동안 배양 하 여 1200 rpm으로 흔들어 준다.
  3. 입력 RNA의 정리
    1. 인공 thenucleic 산을 추출 하는 인공 바이 알 (소용돌이 30 초 이상). 새로운 튜브에 각 샘플에 대 한 핵 산 추출 자기 비드의 20 µ L을 추가 합니다. 마그네틱 스탠드를 사용 하 여 구슬을 수집 하 고 상층 액을 버립니다.
    2. 1 mL의 RNA 정제 용 해 완충 액 (RLT 완충 액)을 한 번에 비드를 씻으십시오. 30 초 동안 자석에 튜브를 놓고 상층 액을 버립니다.
      참고: 이후 핵 산 추출 자성 비드의 분리는이 단계를 따랐습니다.
    3. 300 µ L의 RLT 버퍼를 사용 하 여 구슬을 소생 하 고 샘플에 추가 합니다. Μ의 5m 염화 나트륨 및 615 µ L의 100% 에틸 알콜을 추가 하 고 피 펫 팅 하 여 혼합 합니다. 실 온에서 15 분간 회전 시켜 서 비드를 자기적으로 분리 하 고 상층 액을 제거 합니다.
    4. 75%에 토에의 한 1 mL의 구슬을 소생 하 고 새로운 튜브로 이송 한다. 30 초 후, 마그네틱 스탠드를 사용 하 여 비드를 수집 하 고 상층 액을 버립니다. 에 토 h 75%로 두 번 세척 하 고, 구슬을 자기 분리 하 고, 잔류 액체를 미세한 파이 펫 팁으로 버리십시오. 5 분 동안 공기 건조 (과도 한 건조를 피하십시오).
    5. 뉴 클레 아 제 없는 물 10 µ L로 비드를 소생 하 고 5 분간 자기 분리 된 비드를 배양 하 고, 상층 액의 5 µ L을 새로운 튜브 (아래 3 ' 어댑터 결 찰)로 이동 한다. 나머지 RNA는-80 ° c에서 백업으로 저장 될 수 있다.

10. rna 어댑터는 입력 RNA 3 ' 끝에 결 찰

  1. RiL19 어댑터의 DMSO 및 0.5 µ L의 1.5 µ L을 추가하 고 (단계 9.3.5에서) 입력 RNA의 5 µ l을 65 ° c에서 2 분 동안 배양 하 고 얼음 위에 1 분 이상 둡니다. 각 샘플에 3 ' 결 찰 마스터 믹스의 13.5 µ l 추가 , 피 펫 팅으로 혼합 하 고, 25 ° c에서 75 분 동안 배양 하 고, 15 분 마다 섞으 세요.
    참고: 결 찰 마스터 믹스에는 10 배 결 찰 완충 액의 2 µ L이 포함 되어 있습니다 [500 mM의 트리 스-HCl, pH 7.5; 100 Mm mgcl; 1.5 µ L 뉴 클레 아 제 무-물; RNase 억제제의 0.2 µ L; 0.2 µ L 0.1 M ATP; DMSO 0.3 µ L; 8 µ L의 50% PEG8000; 1.3 µ l의 RNA 리가 제 [30u/µ l].
  2. 결 찰 된 입력 RNA의 정리
    1. 각각의 시료에 대해 자기 비드의 핵 산 추출 20 µ L을 자기적으로 분리 하 고 상층 액을 제거 한다. 1 mL RLT 완충 액으로 한 번 비드를 씻으십시오.
    2. 61.6 µ L의 RLT 완충 액 및 각 시료에 대 한 전사 서 스 펜 션의 소생 비드. 추가 61.6 µ L 100%에 토. 피 펫을 사용 하 여 5 분 마다 15 분 동안 섞어 줍니다. 자기 분리 된 구슬 및 상층 액을 제거 합니다.
    3. 9.3.4 단계를 반복 합니다.
    4. 뉴 클레 아 제 없는 물 10 µ를 갖는 비드를 소생 하 고 5 분간 그대로 둡니다. 상기 비드를 자기적으로 분리 하 고 상층 액의 10 µ L을 새로운 튜브에 전달 한다.
      참고: 이것은 가능한 정지 지점 (입력 샘플은 다음 날까지-80 ° c에서 저장 될 수 있다).

11. 역 전사, DNA 어댑터 cDNA 3 ' 끝에 결 찰

  1. 0.5 µ L의 RT 프라이 머 (표 1) 내지 10µ의 입력 rna (단계 10.2.4에서) 및 10µ l의 클립 rna (스텝 8.8.4에서)를 각각 2 분 동안 65 ° c에서 예비가 열 된 PCR 블록으로 배양 하 여 1 분 이상 얼음 위에 놓습니다.
  2. Rt 마스터 믹스 10 µ L 추가 (2 µ L의 RT 버퍼 [500 mM 트리 스-HCl, pH 8.3; 750 mM KCl; 4 µ의 뉴클레 아 제 불포함 물;의 RNase 억제제의 0.3 µ l; 0.2 µ l의 0.1 m datp; 0.2 µ l of 0.1 µ의 0.1 lltp; 0.1 M dGTP; 0.2 µ L의 0.1 M dTTP; 0.9 µ L의 역방향 역전사)을 각 시료에 혼합 하 고, 55 ° c에서 미리가 열 된 PCR 블록에 45 분 동안 배양 한다.
  3. 3.5 µ L의 PCR 산물 정화 시 약을 사용 하 여 RT 반응 생성 물의 20 µ L을 섞어 줍니다. 37 ° c에서 15 분 동안 배양 합니다.
  4. 0.5 M EDTA의 1 µ L을 추가 하 고 파이 펫 팅으로 섞어 줍니다. PCR 블록에서 70 ° c에서 3 µ 리터의 NaOH를 첨가 하 고, 피 펫 팅 하 고 12 분 동안 배양 하 여 상기 템플릿 RNA를 가수분해 한다.
  5. 1m HCl의 3 µ L을 추가 하 고 피 펫-믹스를 통해 완충 액을 중화 시킵니다.
  6. CDNA의 정화
    1. 자기적으로 분리 된 10 µ L의 핵 산 추출 마그네틱 비드는 각 시료에 대해, 상층 액을 제거 한다. RLT 완충 액 500 µ L로 한 번 씻으십시오.
    2. RLT 완충 액의 93 µ L 및 샘플로의 이동 현 탁 액에서의 소생 비드. 111.6 µ L의 100%에 토를 추가 하 고 5 분간 배양 한 후 2 분 마다 파이 펫을 혼합 합니다. 마그네틱 스탠드를 사용 하 여 비드를 수집 하 고 상층 액을 버립니다. 80%의에 토를 1 mL의 구슬을 소생 하 고 새로운 튜브로 이동 합니다.
    3. 30 초 후, 마그네틱 스탠드를 사용 하 여 비드를 수집 하 고 상층 액을 버립니다. 에 토에 80%로 두 번 씻으십시오. 자석으로 분리 하 고 미세한 팁으로 잔류 액체를 버리십시오. 5 분 동안 공기 건조 (과도 한 건조를 피하십시오). 5 µ의 5 mM 트리 스-HCl에서 비드를 소생 하 고 5 분간 배양 하였다.
  7. 0.8 µ L의 DNA 어댑터 (표 1) 및 DMSO 1 µ을 비드에 넣고 75 ° c에서 2 분 동안 배양 한다. 1 분 이상 얼음 위에 놓습니다.
  8. 준비 12.8 µ l 결 찰 마스터 믹스 (2 µ l의 10 배 결 찰 완충 액 [500 mM 트리 스-HCl; 100); 1.1 µ의 뉴 클레 아 제-무료 물; 0.2 µ l의 0.1의 µ; 50 µ l의 RNA 리가 제 [30u/µ l]) (PEG8000 , 가볍게 섞어, 원심 분리기에서 짧게 회전 하 고, 각 샘플에 추가 하 고, 파이 펫 팁으로 샘플을 천천히 저 어 줍니다.
  9. 각 샘플에 RNA 리가 제 [30u/µ l]의 또 다른 1 µ l을 추가 하 고 섞어 주세요. 25 ° c에서 30 초 동안 1200 rpm으로 흔들어 배양 합니다. 밤새 25°c에서 배양 합니다. 1 시간에 한 번씩 5 ~ 6 회 가볍게 섞어 줍니다.
  10. 결 찰 cDNA의 클린업
    1. 자기적으로 분리 된 5 µ L의 핵 산을 각 시료에 대해 자성 비드를 추출 하 고 상층 액을 제거 한다.
    2. 500 µ L RLT 버퍼로 한 번 씻으십시오.
    3. RLT 완충 액에 60 µ L의 구슬 및 각 시료에 현 탁 액을 전달 합니다. 100%에 토에 60 µ L을 추가 하 고, 5 분 동안이를 배양 하 고 2 분 간격으로 파이 펫을 혼합 합니다. 자석으로 분리 하 여 상층 액을 버리십시오.
    4. 9.3.4 단계를 반복 합니다.
    5. 트리 스-HCl의 27µ L의 소생 비드를 5 분간 배양 하 여 25 µ 리터의 시료를 새로운 튜브로 이동 시킵니다. 새로운 튜브에 뉴 클레 아 제 없는 물 9 µ L와 함께 결 찰 cDNA의 1 µ L을 희석 한다. 13.1 단계까지-20°c에서 나머지 샘플을 저장 한다.

12. 실시간 정량 PCR에의 한 cDNA의 정량화 (qPCR)

  1. 9 µ L의 qPCR 마스터 믹스 (5 µ L)를 추가 하십시오; 3.6 µ L 뉴 클레 아 제 무 첨가 물; 프라이 머 믹스의 0.4 µ L은 96 웰 qPCR 플레이트에 [10µ M PCR-D50X 및 10µ M PCR-D70X]). 11.10.5 단계에서 µ의 희석 된 1:10의 1리터를 첨가 하 여 밀봉 하 고 섞어 줍니다.
  2. 써 모 사이 더에서 qPCR 프로그램 실행: 50 ° c에서 2 분; 95 ° c에서 2 분; 95 ° c에서 3 초 후 40 사이클 동안 68 ° c에서 30 초; 95 ° c에서 15 초 후 68 ° c에서 60 초 후 1 사이클 동안 95 ° c에서 15 초. Ct (주기 임계값) 값을 기록해 둡니다.

13. cDNA의 PCR 증폭

  1. 35 µ의 PCR 마스터 믹스의 분배 (25 µ L; 5 µ의 뉴 클레 아 제 불포함 물; 프라이 머 믹스 5µ L [20 µ M PCR-D50X 및 20µ M PCR-D70X]) 8 웰 스트립에. 클립 그룹의 경우 12.5 µ L의 클립 샘플 + 2.5 µ L을 추가 합니다. 입력 그룹의 경우 입력 10 µ L + 5 µ L을 잘 섞어 원심분리기에서 짧게 회전 시킵니다.
  2. PCR 프로그램 실행: 98 ° c에서 30 초; 98 ° c에서 15 초 후 68 ° c에서 30 초 후에 72 ° c에서 6 사이클 동안 40 s; 98 ° c에서 15 초 뒤에 60의 N 싸이 클에 대해 72 ° c에서 = (qPCR Ct 값-3); 60의 72 ° c; 4°c 홀드.
    참고: 첫 번째 클립 몇 개에 대해 1 ~ 2 개의 추가 PCR 주기를 수행 하는 것이 좋습니다.

14. 젤 정제

  1. 3% 고 분해능 아가 로스 젤에 샘플을 적재 합니다. 샘플 사이에 1 개의 빈을 잘 남겨두고 젤 양쪽에 사다리를 사용 합니다. 스 트리-붕 산 염-EDTA (TBE) 완충 액에서 75 분 동안 100 V에서 실행 하십시오.
  2. 청색 광 조명에서 각 시료에 대해 신선한 면도날을 사용 하 여 젤 슬라이스 175-350 bp를 잘라 냅니다. 15 mL의 원뿔형 튜브에 넣습니다.
    1. 젤 슬라이스를 계량 하 고 겔 추출 키트를 사용 하 여 젤을 용 출 합니다.
    2. 겔 용 해 완충 액의 6 배 부피를 추가 하 여 겔을 녹여 냅니다 (100 겔 = 600 µ 젤 용 해 완충 액). 실 온에서 젤을 녹 이세요. (젤 조각이 완전히 녹을 때까지 15 분 마다 섞어 흔들어 주세요). 1 젤 부피 100%의이 소 프로 판 올을 넣고 잘 섞어 줍니다.
    3. 750 µ L 샘플 (스텝 14.2.2에서)을 수집 튜브의 칼럼에 17900 x g 에서 1 분간 원심 분리 하 여 통과 시킵니다.
    4. 모든 샘플이 컬럼을 통과 할 때까지 14.2.3 단계를 반복 하 고 젤 용 해 완충 액을 500 µ L로 한 번 씻으십시오.
    5. 750 µ L의 세척 완충 액 (젤 추출 키트에서)을 칼럼에 추가 하 고 17900 x g 에서 1 분간 원심 분리기를 제거 합니다. 플로우 스루를 버리고 2 분 동안 17900 x g 에서 스핀 하십시오. 열을 새 1.5 mL 튜브에 놓습니다.
    6. 열의 플라스틱 보라색 테두리에서 남아 있는 세척 버퍼를 모두 제거 합니다. 공기 건조 2 분 동안 멤브레인의 중앙에 뉴 클레 아 제 없는 물 12.5 µ L을 추가 합니다. 칼럼을 실 온에서 2 분 동안 방치 하 고 1 분 동안 17900 x g 에서 회전 시킨다 (향상 된 수율을 위해, 용 출 단계를 반복 한다).

15. PCR 산물의 토 포 클론

  1. 상기 14.2.6 단계 로부터 PCR 산물 1 µ l을 생성 하는 토 포 클로닝 반응 믹스 1 µ L. 멸 균 수 3 µ L). 20-37 ° c에서 5 분간 부드럽게 섞은 후 배양 하십시오. 얼음 위에서 식혀 보세요.
  2. 얼음에 화학적으로 유능한 대장균 박테리아를 해 동. 추가 5 µ L에 토 포 클로닝 제품의 유능한 박테리아의 100 µ L29. 부드럽게 잘 섞어 주세요. 30 분간 얼음을 배양 합니다.
  3. 42 ° c에서 60의 열 충격. 그런 다음 얼음을 2 분간 식힙니다. 900 µ L을 추가 하 고, 37 ° c에서 1 시간 동안 배양 하 여 225 rpm으로 흔들어 준다. 1000 x g 에서 1 분간 스핀 한 다음 상층 액의 900 µ l을 제거 합니다. 나머지 솔루션을 소생 합니다.
  4. 형질 전환 된 세균을 앰 피 실린 (100 µ)를 함유 하는 1.5% LB 아가 플레이트 상에 플레이트 하 고, 37 ° c에서 밤새 배양 한다.
  5. 각 구성에 대해 적어도 20 1.5 mL 원심 분리기 튜브를 준비 하십시오. 100 µ g/mL 암 피 실린을 함유한 500 µ L의 LB 배지로 1 세트를 채웁니다. 멸 균 피 펫 팁을 사용 하 여 1 개의 세균 식민지를 무작위로 긁어 내 고 LB µ의 500에 따라 (파이 펫 팅으로) 혼합 하십시오. 37 ° c에서 5 시간 동안, 225 rpm으로 흔들어 배양 한다.
  6. M13 역 프라이 머를 이용 하 여 인서트 단편을 서 열 하 고, 생거 염기 서 열 분석 법으로30.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

상기 eclip 절차 및 결과는도 1,도 2,도 3에 도시 되어 있다. 마우스는 외과 용가 위를 이용 하 여 하복 부에 제조 하였으며 작은 절 개를 이산화탄소로 안락사 시켰다 (도 2a,B). 마우스 고환 제거, 디 툰 후 연 삭 후 UV 가교 (그림 2c-I). 고환 조직에서 두 개의 알려진 RNA 결합 헬 리 아 제를 사용 하는 대표적인 eCLIP 결과는 도 34에 묘사 되어 있다. 우리는 MOV10 eCLIP을 성인 야생 형 마우스에서, 가교 된 파쇄 물을 처리 하는 RNase의 40 U/m l의 일반적인 농도로 수행 했습니다. 도 3a 의 상부 패널은 약 114 kDa의 표적 단백질 크기가 성공적으로 농축 되었다는 것을 보여준다. 로 면역 침전 MOV10L1 단백질의 웨스턴 블랏은 eCLIP 과정 중에 RNase I의 2 개의 농도 (5 또는 40)로 수행 하였다 (도 3a). 도 3b 는 MOV10 및 MOV10L1 UV 가교, 비 가교 화 및 짝 크기 정합 입력 (SMInput) 샘플 로부터 1:10 희석 된 cDNA (이미 DNA 어댑터와 결 찰 된)를 사용 하 여 qpcr을 보여준다. 비 가교 샘플은 RNA 회수율을 감소 보여줍니다. 우리는 비 가교 기의 Ct 값이 일반적으로 UV 가교 그룹 보다 5 배 이상 이었다는 것을 관찰 하였다. 도 4a 는 아가 로스 겔 전기 영동을 통한 PCR 증폭 및 크기 선택 (cut 175-350 bp)을 표시 한다. 프라이 머-이 량 체 제품은 약 140 bp에 나타납니다. 도 4b 는 두 개의 대표적인 서브 클론 시퀀스 들의 ucsc 게놈 브라우저 뷰를 보여준다. MOV10 결합 된 eCLIP 태그는 유전자 Fto의 3 ' UTR 내에 위치 하는 것으로 밝혀졌다; 대략 3 ' UTR 표적 비율은 HEK293 세포에 있는 MOV10 표적의 대다수와 일치 하는 75% (그림 4c)를, 고환 에서 (데이터는 표시 되지 않음). 대조적으로, MOV10L1 eCLIP 태그는 피 르 나 전 구체를 표적으로 하 MOV10L1 피 르 나 군집 내에 위치 하는 것으로 발견 된다. 피 르 나 전 구체의 대략적인 비율은 이전의 종래의 클립 실험20의 추세를 반영 하는 42% (도 4e)를 차지 한다. MOV10L1 eCLIP와 40 U/mL RNase I 소화는 20 bp 미만으로 상대적으로 더 많은 시퀀스를 생성 합니다 (그림 4d).

Figure 1
그림 1 : ECLIP의 도식 표현입니다. 자외선 가교 된 마우스 세 근 관 (단계 1)은 eCLIP 용 해 완충 액에서 분해 되 고 초음파 처리 (2 단계). 파쇄 물은 RNA 단편으로 RNase I로 처리 되 고, 그 후 단백질-RNA 복합체는 항 RBP 항 체를 사용 하 여로 면역 침전 (단계 3-4). RNA 단편의 탈 인 산화 및 3 ' RNA 어댑터의 결 찰이 수행 된다 (단계 5-6). 단백질-RNA 복합체는 SDS-PAGE 겔 상에 서 실행 되 고 니트로 막으로 옮겼다 (단계 7). RNA는 단백질을 분해 하 여 분리 막 으로부터 회수 되는 프로 테이 나 제 K 및 우 레 아로 서,이는 크로스 링크 부 위에서 잔존 하는 짧은 폴 리 펩타이드를 남긴다. 입력 샘플의 RNA 단편의 탈 인 산화 및 3 ' RNA 어댑터의 결 찰이 수행 된다 (단계 8). RNA의 RT를 수행 하 고 3 ' DNA 어댑터의 결 찰 (단계 9-10). 예비 라이브러리 품질 관리를 위한 cDNA 라이브러리, 겔 추출 및 둔 단 PCR 클로닝의 PCR 증폭을 수행 한다 (단계 11). 마지막으로 높은 처리량의 시퀀싱을 수행 합니다 (단계 12). 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
그림 2 : 고환 조직 수확 및 UV 가교 결합. (A) 마우스 복 부의 노출. (B) 복 막에 0.5 cm의 절 개를 하 여 개복을 노출 한다. (C) 고환의 한 쌍은 지방 패드를 당겨 밖으로 촬영. (D) 고환 조직을 제거 하 고 얼음 차가운 PBS를 포함 하는 작은 접시에 넣었다. (E) 튜 니 카 알 부 니를 부드럽게 제거 한다. (F) 휴지를 눌러 조직 분쇄기에 티슈를 삼 출 한다. (G) 10cm 플레이트에 분산 된 세 뇨 관. (H) 자외선 가교 결합 400 mJ/cm2 에너지. (I) 가교 된 샘플은 1.5 mL 원심 분리기 튜브에 수집 된다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 3
그림 3 : MOV10 및 MOV10L1 립의 대표적인 결과. (A) MOV10 및 MOV10L1 면역 모방의 웨스턴 블랏 유효성 검사. (B) MOV10 및 MOV10L1의 희석 된 eclip 라이브러리 1:10에 대 한 qpcr은 uv, 비 uv 및 쌍을 이루는 sminput 샘플에 대해 복제 합니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 4
그림 4 : Eclip 라이브러리 준비 및 품질 평가. (A) PCR 증폭의 겔 이미지를 나타내 었 다. 별표는 프라이 머이 량 체를 나타낸다. 빨간색 점선은 175 및 350 bp 사이에서 cDNA의 PCR 산물을 적 출하는 부위를 나타낸다. (B) 두 개의 대표적인 서브 클론 서 열 (31)의 ucsc 게놈 브라우저 보기. (C) MOV10의 소규모 서브 클론 시퀀싱 분석. (D) MOV10L1 태그는 두 개의 상이한 rnase 농도로 처리 될 때 길이 분포의 뚜렷한 패턴을 표시 한다. (E) MOV10L1의 소규모 서브 클론 시퀀싱 분석. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

시퀀스 이름 시퀀스 정보 설명
RNA 어댑터
RNA X1A /나의/나가//또는/또는/////// 200 µ에서 주식; 20 µ M에서 근무
RNA X1B //5/3/, 3/////또는/또는///////- 200 µ에서 주식; 20 µ M에서 근무
RiL19 /5 개/3 Spc3/acgg 200 µ에서 주식; 40 µ M에서 근무
DNA 어댑터
Rand103tr3 /3Spc3/cagagacgtctg/3/ 200 µ에서 주식; 80 µ M에서 근무
RT 프라이 머
AR17 이은 지 200 µ에서 주식; 20 µ M에서 근무
PCR 프라이 머

PCR-F D 501
AATGATACGGCGACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACGACGCTCTTCCGATCT 100 µ에서 주식; 20 µ M에서 근무
PCR-D 701 이은 하가의가 게에 대 한 모든 것을 ... ... ... ... .... 100 µ에서 주식; 20 µ M에서 근무
(D502-508, D702에 대 한 일 루미나 고객 서비스 문자를 참조 하십시오.)

표 1: 어댑터 및 프라이 머 시퀀스. 이 어댑터에는 인라인 랜덤 메 르 (어느 N5 또는 N10)가 포함 되어 있어 두 개의 동일한 시퀀싱 읽기가 동일한 RNA 단편의 두 개의 고유한 RNA 단편 또는 PCR 중복을 나타내는 지 여부를 결정 합니다. "5 phos"는 올리고 DNA/RNA ligase에 대 한 기질로 사용 되는 경우 필요한 5 ' 인 산화를 의미 합니다. "3SpC3"은 어댑터 간의 결 찰을 방지할 수 있는 3 ' C3 스페이서를 의미 합니다.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

생물학적 및 병리학 적 맥락에서 rbps의 보편적 역할에 대 한 이해가 증가 함에 따라, 클립 방법은 rbps20,32,33의 분자 기능을 공개 하는 데 널리 활용 되 고 있습니다. 34,35. 여기에 설명 된 프로토콜은 마우스 고환에 대 한 eCLIP 방법의 적응 된 응용 프로그램을 나타냅니다.

고환에서 eCLIP을 수행 하는 한 가지 과제는 신선한 고환 세포의 생존 성과 무결성을 유지 하는 것 이며,이는 효과적인 가교 결합에도 중요 합니다. 느슨한 유 봉을 사용 하 여 온화한 기계적인 힘으로 고환을 깎는 것은 세포 용 해32,36를 방지할 수 있습니다. RNA의 적당 한 소화는 또한 성공적인 eCLIP 분석을 위해 중요 합니다. RNA 단편은 소화 후에 더 수렴 될 수 있었지만, 20 bp 미만의 길이는 라이브러리 판독의 사전 처리를 통해 제거 될 수 있다. RBP 후보에 대 한 이상적인 RNase 복용량을 채택 하기 위해, 우리는 0에서 40에 이르기까지 농도와 RNase 처리에 의해 제조 될 수 있는 eCLIP 라이브러리의 서브 클론 시퀀싱의 결과에 따라 예비 테스트를 제안 합니다 (용 해물의 밀리 리터 당). 소규모 서브 클론 시퀀싱 분석은 eCLIP 방식에서 라이브러리 품질을 안정적으로 검사 하는 데 권장 되는 단계입니다. 첫째, 20bp 보다 짧은 인서트의 비율은 너무 높거나, eCLIP 라이브러리의 후속 전처리로 인해 비용이 많이 드는 읽기가 손실 될 수 있습니다. 둘째, 두 어댑터의 올바른 결 찰의 효율성을 확인 해야 합니다. 심층 시퀀싱을 수행 하기 위해 정밀 염기 서 열 분석 없이 하위 표준 샘플을 제거할 수 있으며,이 결과는 일반적으로 분석이 훨씬 더 오래 걸립니다.

마우스 고환에서의 eCLIP의 타당성은 여전히 면역 침전의 단계에 대 한 항 체의 특이성에 의해 제한 되지만, eCLIP는 여러 측면에서 통상적인 클립형 방법에 비해 유리 하다. 첫째, 비 방사성 방법 이다. ECLIP에 의해, RBPs의 RNA 대상은 방사성 물질을 사용 하 여 노동 집약적 인 기술에 의존 하지 않고 생체 내에서 직접 포착 됩니다. 둘째,이 방법은 시간이 많이 소요 됩니다. 전체 절차는 eCLIP 라이브러리 준비를 통해 4 일 밖에 걸리지 않습니다. 셋째, 시퀀스 다양성. 25-35 주기의 종래의 통합 증폭 주기와 비교 하 여, ECLIP는 pcr 사이클 수를 구체적으로 설정 하기 위해 Qpcr의 Ct 값을 지칭 한다. 마지막으로 더 강력한 신호 대 잡음비를 제공 합니다. 크기 일치 입력은 실제 대상에 적합 한 배경으로 제공 됩니다.

요약 하자면, 우리의 eCLIP 결과는 MOV10 및 MOV10L1가 각각 mRNA 3 ' UTR 및 피 르 나 전 구체에 대 한 결합 선호도를 갖는 결론을 통합 합니다. 여기에서 설명 하는 프로토콜은 유전자 연구에서 생물학적 역할에 대 한 충분 한 정보를 제공 했지만, RNA-RBP 상호 작용 지식이 다소 불충분 한 영역 인 재생산의 eCLIP 방법의 첫 번째 고용을 나타냅니다. RBPs .이 eCLIP 프로토콜의 시각화는 광범위 한 영역에서 광범위 한 응용 프로그램을 안내 하는 데 도움이 될 수 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 공개 할 것이 없습니다.

Acknowledgments

우리는 원래 프로토콜에 도움이 되는 지침에 대 한 에릭 L 밴 Nostrand과 유전자 W 감사 합니다. K.Z.는 중국의 국가 키 R & D 프로그램 (2016YFA0500902, 2018YFC1003500) 및 중국의 국가 자연 과학 재단 (31771653)에 의해 지원 되었다. L.Y.는 중국의 국립 자연과학 재단 (81471502, 31871503)과 강 소 지방의 혁신적이 고 기업가 프로그램에 의해 지원 되었다.

Materials

Name Company Catalog Number Comments
Antibodies
Anti-mouse MOV10  antibody Proteintech, China 10370-1-AP
Anti-mouse MOV10L1 antibody Zheng et al.20109 polyclonal antisera UP2175 provided by P. Jeremy Wang lab, University of Pennsylvania
HRP Goat Anti-Rabbit IgG  ABclonal AS014
Rabbit IgG Beyotime, China A7016
Equipment
Centrifuge Eppendorf, Hamburg, Germany 5242R
Digital sonifier BRANSON,USA BBV12081048A 450 Watts; 50/60 Hz
DynaMag-2 Magnet Invitrogen,USA 12321D
Mini Blot Module Invitrogen,USA B1000
Mini Gel Tank Invitrogen,USA A25977
Shaking incubator Eppendorf, Hamburg, Germany Thermomixer comfort 
Tissue Grinder, Dounce PYREX, USA 1234F35 only  the "loose" pestle is used in this protocol
TProfessional standard 96 Gradient Biometra, Germany serial no.: 2604323
Tube Revolver  Crystal, USA serial no.: 3406051
UV-light cross-linker UVP, USA CL-1000
Materials
TC-treated Culture Dish Corning, USA 430167 100 mm 
Tubes Corning, USA 430791 15 mL
Microtubes tubes AXYGEN , USA MCT-150-C 1.5 mL 
Reagents 
Acid phenol/chloroform/isoamyl alcohol  Solarbio, China P1011 25:24:01
AffinityScript Enzyme Agilent, USA 600107
Antioxidant Invitrogen,USA NP0005
DH5α competent bacteria Thermo Scientific, USA 18265017 these economical cells yield >1 x 106 transformants/µg control DNA per 50 µL reaction.
DMSO Sigma-Aldrich, USA D8418
DNA Ladder Invitrogen, USA 10416014
dNTP Sigma-Aldrich, USA DNTP100-1KT
Dynabeads Protein A  Invitrogen, USA 10002D
ECL reagent Vazyme, China E411-04
EDTA Invitrogen, USA AM9260G
EDTA free protease inhibitor cocktail Roche, USA 04693132001 add fresh
Exo-SAP-IT Affymetrix, USA 78201 PCR Product Cleanup Reagent 
FastAP enzyme Thermo Scientific, USA EF0652
LDS Sample Buffer Thermo Scientific, USA NP0007
MetaPhor Agarose  lonza, Switzerland 50180
MgCl2 Invitrogen, USA AM9530G
MiniElute gel Extraction QIAGEN, Germany 28604 column store at 4 ?; buffer QG=gel dissolving buffer; buffer PE= wash buffer(for step 14)
MyONE Silane beads Thermo Scientific, USA 37002D nucleic acids extraction magnetic beads
NaCl Invitrogen,USA AM9759
 
NP-40 Amresco, USA M158-500ML
NuPAGE Bis-Tris Protein Gels Invitrogen, USA NP0336BOX 4%–12%,1.5 mm, 15-well
NuPAGE MOPS SDS Buffer Kit  Invitrogen, USA NP0050
PBS Gibco, USA 10010023
Phase-Locked Gel (PLG) heavy tube   TIANGEN, China WM5-2302831
PowerUp SYBR Green Master Mix Applied Biosystems, USA A25742
Proteinase K NEB, New England  P8107S
Q5 PCR master mix  NEB, New England  M0492L
RLT buffer QIAGEN, Germany 79216 RNA purification lysis buffer 
RNA Clean & Concentrator-5 columns  ZYMO RESEARCH, USA R1016 RNA purification and concentration columns
RNase I  Invitrogen, USA AM2295
RNase Inhibitor Promega, USA N251B
RQ1 DNase Promega,USA M610A
Sample Reducing Agent Invitrogen,USA NP0009
SDS Solution Invitrogen, USA 15553027 10%
Sodium deoxycholate Sigma-Aldrich, USA 30970 protect from light
T4 PNK enzyme NEB, New England  M0201L
T4 RNA ligase 1 high conc NEB, New England  M0437M
TA/Blunt-Zero Cloning Mix Vazyme, China C601-01
TBE Invitrogen,USA AM9863
Tris-HCI Buffer Invitrogen, USA 15567027
Triton X-100 Sangon Biotech, China A600198 
Tween-20 Sangon Biotech, China A600560
Urea Sigma-Aldrich, USA U5378
X-ray Films Caresteam, Canada 6535876

DOWNLOAD MATERIALS LIST

References

  1. Turner, J. M., Mahadevaiah, S. K., Ellis, P. J., Mitchell, M. J., Burgoyne, P. S. Pachytene asynapsis drives meiotic sex chromosome inactivation and leads to substantial postmeiotic repression in spermatids. Developmental Cell. 10, (4), 521-529 (2006).
  2. Turner, J. M. A. Meiotic sex chromosome inactivation. Development. 134, (10), 1823-1831 (2007).
  3. Kimmins, S., Sassone-Corsi, P. Chromatin remodelling and epigenetic features of germ cells. Nature. 434, (7033), 583-589 (2005).
  4. Ule, J., et al. CLIP identifies Nova-regulated RNA networks in the brain. Science. 302, (5648), 1212-1215 (2003).
  5. Ule, J., Jensen, K., Mele, A., Darnell, R. B. CLIP: a method for identifying protein-RNA interaction sites in living cells. Methods. 37, (4), 376-386 (2005).
  6. Trifillis, P., Day, N., Kiledjian, M. Finding the right RNA: identification of cellular mRNA substrates for RNA-binding proteins. RNA. 5, (8), 1071-1082 (1999).
  7. Tenenbaum, S. A., Carson, C. C., Lager, P. J., Keene, J. D. Identifying mRNA subsets in messenger ribonucleoprotein complexes by using cDNA arrays. Proceedings of National Acadamy of Sciences U S A. 97, (26), 14085-14090 (2000).
  8. Chi, S. W., Zang, J. B., Mele, A., Darnell, R. B. Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 460, (7254), 479-486 (2009).
  9. Zheng, K., et al. Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway. Proceedings of National Acadamy of Sciences U S A. 107, (26), 11841-11846 (2010).
  10. Gregersen, L. H., et al. MOV10 Is a 5' to 3' RNA helicase contributing to UPF1 mRNA target degradation by translocation along 3' UTRs. Molecular Cell. 54, (4), 573-585 (2014).
  11. Banerjee, S., Neveu, P., Kosik, K. S. A coordinated local translational control point at the synapse involving relief from silencing and MOV10 degradation. Neuron. 64, (6), 871-884 (2009).
  12. Choi, J., Hwang, S. Y., Ahn, K. Interplay between RNASEH2 and MOV10 controls LINE-1 retrotransposition. Nucleic Acids Research. 46, (4), 1912-1926 (2018).
  13. Goodier, J. L., Cheung, L. E., Kazazian, H. H. Jr MOV10 RNA helicase is a potent inhibitor of retrotransposition in cells. PLoS Genetics. 8, (10), e1002941 (2012).
  14. Haussecker, D., et al. Capped small RNAs and MOV10 in human hepatitis delta virus replication. Nature Structural & Molecular Biology. 15, (7), 714-721 (2008).
  15. Kenny, P. J., et al. MOV10 and FMRP regulate AGO2 association with microRNA recognition elements. Cell Reports. 9, (5), 1729-1741 (2014).
  16. Messaoudi-Aubert, S. E., et al. Role for the MOV10 RNA helicase in Polycomb-mediated repression of the INK4a tumor suppressor. Nature Structural & Molecular Biology. 17, (7), 862-868 (2010).
  17. Sievers, C., Schlumpf, T., Sawarkar, R., Comoglio, F., Paro, R. Mixture models and wavelet transforms reveal high confidence RNA-protein interaction sites in MOV10 PAR-CLIP data. Nucleic Acids Research. 40, (20), e160 (2012).
  18. Skariah, G., et al. Mov10 suppresses retroelements and regulates neuronal development and function in the developing brain. BMC Biology. 15, (1), 54 (2017).
  19. Zheng, K., Wang, P. J. Blockade of pachytene piRNA biogenesis reveals a novel requirement for maintaining post-meiotic germline genome integrity. PLoS Genetics. 8, (11), e1003038 (2012).
  20. Vourekas, A., et al. The RNA helicase MOV10L1 binds piRNA precursors to initiate piRNA processing. Genes & Development. 29, (6), 617-629 (2015).
  21. Hocq, R., Paternina, J., Alasseur, Q., Genovesio, A., Le Hir, H. Monitored eCLIP: high accuracy mapping of RNA-protein interactions. Nucleic Acids Research. 46, (21), 11553-11565 (2018).
  22. Huppertz, I., et al. iCLIP: protein-RNA interactions at nucleotide resolution. Methods. 65, (3), 274-287 (2014).
  23. Hafner, M., et al. Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 141, (1), 129-141 (2010).
  24. Hafner, M., et al. PAR-CliP--a method to identify transcriptome-wide the binding sites of RNA binding proteins. Journal of Visualized Experiments. (41), (2010).
  25. Konig, J., et al. iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nature Structural & Molecular Biology. 17, (7), 909-915 (2010).
  26. Konig, J., et al. iCLIP--transcriptome-wide mapping of protein-RNA interactions with individual nucleotide resolution. Journal of Visualized Experiments. (50), (2011).
  27. Maticzka, D., Ilik, I. A., Aktas, T., Backofen, R., Akhtar, A. uvCLAP is a fast and non-radioactive method to identify in vivo targets of RNA-binding proteins. Nature Communications. 9, (1), 1142 (2018).
  28. Van Nostrand, E. L., et al. Robust transcriptome-wide discovery of RNA-binding protein binding sites with enhanced CLIP (eCLIP). Nature Methods. 13, (6), 508-514 (2016).
  29. Radulovich, N., Leung, L., Tsao, M. S. Modified gateway system for double shRNA expression and Cre/lox based gene expression. BMC Biotechnology. 11, 24 (2011).
  30. Breunig, C. T., et al. A Customizable Protocol for String Assembly gRNA Cloning (STAgR). Journal of Visualized Experiments. (142), (2018).
  31. Kuhn, R. M., Haussler, D., Kent, W. J. The UCSC genome browser and associated tools. Briefings in Bioinformatics. 14, (2), 144-161 (2013).
  32. Vourekas, A., et al. Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis. Nature Structural & Molecular Biology. 19, (8), 773-781 (2012).
  33. Preitner, N., et al. APC is an RNA-binding protein, and its interactome provides a link to neural development and microtubule assembly. Cell. 158, (2), 368-382 (2014).
  34. Meyer, C., et al. The TIA1 RNA-Binding Protein Family Regulates EIF2AK2-Mediated Stress Response and Cell Cycle Progression. Molecular Cell. 69, (4), 622-635 (2018).
  35. Gerstberger, S., Hafner, M., Tuschl, T. A census of human RNA-binding proteins. Nature Reviews Genetics. 15, (12), 829-845 (2014).
  36. Vourekas, A., Mourelatos, Z. HITS-CLIP (CLIP-Seq) for mouse Piwi proteins. Methods in Molecular Biology. 1093, 73-95 (2014).
마우스 고환에서 단백질 결합 RNA를 효율적으로 식별 하기 위한 향상 된 가교 면역 침전 (eCLIP) 방법
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Xu, Q., Wang, C., Ling, L., Yue, Q., Liu, M., Zhang, S., Fu, K., Ye, L., Zheng, K. Enhanced Crosslinking Immunoprecipitation (eCLIP) Method for Efficient Identification of Protein-bound RNA in Mouse Testis. J. Vis. Exp. (147), e59681, doi:10.3791/59681 (2019).More

Xu, Q., Wang, C., Ling, L., Yue, Q., Liu, M., Zhang, S., Fu, K., Ye, L., Zheng, K. Enhanced Crosslinking Immunoprecipitation (eCLIP) Method for Efficient Identification of Protein-bound RNA in Mouse Testis. J. Vis. Exp. (147), e59681, doi:10.3791/59681 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter