Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Forbedret Cross Linking Immunutfelling (eCLIP) metode for effektiv identifisering av protein-bundet RNA i mus testikkel

doi: 10.3791/59681 Published: May 10, 2019
* These authors contributed equally

Summary

Her presenterer vi en eCLIP-protokoll for å fastslå store RNA-mål for RBP-kandidater i testikkel.

Abstract

Spermatogenesis definerer en høyt bestilt prosess av mannlig bakterie celle differensiering i pattedyr. I testikkel, transkripsjon og oversettelse er lokomotivet, understreker viktigheten av post-transcriptional regulering av genuttrykk orkestrert av RBPs. For å belyse mekanistisk roller i en RBP, kan Cross Linking immunutfelling (CLIP) brukes til å fange opp sine endogene direkte RNA-mål og definere de faktiske samhandlings stedene. Den forbedrede CLIP (eCLIP) er en nyutviklet metode som gir flere fordeler sammenlignet med konvensjonelle klipp. Imidlertid har bruken av eCLIP hittil vært begrenset til cellelinjer, og oppfordret til utvidede applikasjoner. Her har vi ansatt eCLIP for å studere MOV10 og MOV10L1, to kjente RNA-bindende helicases, i mus testikkel. Som forventet, finner vi at MOV10 hovedsakelig binder seg til 3 ' uoversatt regioner (UTRs) av mRNA og MOV10L1 selektivt binder seg til Piwi-samspill RNA (piRNA) forløper transkripsjoner. Vår eCLIP metoden tillater rask bestemmelse av store RNA arter bundet av ulike RBPs via småskala sekvensering av subclones og dermed tilgjengeligheten av kvalifiserte biblioteker, som garanterer for fortsetter med dype sekvensering. Denne studien etablerer et aktuelt grunnlag for eCLIP i pattedyr testikkel.

Introduction

Pattedyr testikkel representerer en utmerket utviklingsmessige modell hvor en intrikat celle differensiering programmet går syklisk å gi mange spermatozoa. En unik verdi av denne modellen ligger i fremveksten av transcriptional inaktive på visse stadier av spermatogenesis, vanligvis når meiotic sex kromosom inaktive (MSCI) oppstår1,2 og når runde via gjennomgår drastisk kjernefysisk komprimering under spermiogenesis3. Disse sammenhengende transcriptional hendelsene nødvendiggjør transcriptional gen regulering, der RNA-bindende proteiner (RBPs) spiller en avgjørende rolle, former transcriptome og opprettholder mannlig fertilitet.

Å identifisere bona fide RNA målene for en individuell RBP in vivo, den Cross Linking immunutfelling (klipp) metoden ble utviklet4,5, basert på, men utover den vanlige RNA immunutfelling (RIP)6,7 , ved inkorporering av viktige trinn inkludert ultrafiolett (UV) Cross Linking, strenge vask og gel overføring for å forbedre signal spesifisitet. Den avanserte anvendelsen av CLIP kombinert med høy gjennomstrømming sekvensering har provosert stor interesse for profilering protein-RNA interaksjon på Genova-brede nivåer8. I tillegg til genetiske studier på RBP funksjon, har slike biokjemiske metoder som identifiserer det direkte samspillet av endogene proteiner og RNA vært uunnværlig for å nøyaktig belyse de RNA regulatoriske rollene til RBPs. For eksempel, MOV10L1 er en testikkel-spesifikk RNA-helicase som er nødvendig for mannlig fertilitet og Piwi RNA (piRNA) kognitiv9. Dens paralogue MOV10 er kjent som en overalt uttrykt og multifunksjonell RNA helicase med roller i flere aspekter av RNA biologi10,11,12,13,14 , 15 priser og , 16 flere , 17 i , 18. ved å ansette den konvensjonelle Clip-SEQ, fant vi at MOV10L1 binder og regulerer primære piRNA forløpere til å initiere tidlig piRNA prosessering19,20, og at MOV10 binder mRNA 3 ' UTRs og så vel som Noncoding RNA arter i testicular bakterieceller (data ikke vist).

Imidlertid er CLIP opprinnelig en møysommelig, radioaktivt prosedyre etterfulgt av sekvensering biblioteket forberedelse med et bemerkelsesverdig tap av CLIP-koder. I den konvensjonelle CLIP, en cDNA biblioteket er utarbeidet ved hjelp av adaptere ligaturer på begge RNA ekstremiteter. Etter at protein fordøyelsen, krysskoblet korte polypeptider fortsatt festet til RNA fragmenter. Dette Cross Linking merket delvis blokkerer Reverse transkriptase (RTase) progresjon under cDNA syntese, noe som resulterer i avkortet cDNAs som representerer ca 80% av cDNA biblioteket21,22. Således, bare cDNA fragmenter resulterer fra RTase omgåelsen det Cross Linking sted (lese-igjennom) er sekvensert. I den seneste tid, forskjellige hefte tilnærmelser, som PAR-hefte, iCLIP, eCLIP og uvCLAP, ha blitt ansatt å identifisere krysskobling steder av RBPs inne leverceller. PAR-CLIP innebærer anvendelse av 365 NM UV-stråling og photoactivatable nukleotid analogs og er derfor eksklusivt til in-dyrking levende celler, og innlemmelse av nukleosid analogs i nylig syntetisert transkripsjoner er tilbøyelig til å produsere bias der RNA fysisk samhandler med protein23,24. I iCLIP er det kun en enkelt adapter som er ligaturer til 3 ' enden av krysskoblet RNA-fragmenter. Etter omvendt transkripsjon (RT), både avkortet og lese gjennom cDNAs oppnås ved intramolecularly circularization og re-linearization etterfulgt av polymerase kjedere reaksjon (PCR) forsterkning25,26. Imidlertid er effektiviteten av intramolekylær circularization relativt lav. Selv om eldre CLIP protokoller trenger merking av krysskoblet RNA med en radioisotop, ultrafiolett Cross Linking og affinitet rensing (uvCLAP), med en prosess av strenge tandem affinitet rensing, ikke stole på radioaktivitet27. Likevel, uvCLAP er begrenset til kulturperler celler som må transfekterte med uttrykket vektor bærer 3x FLAG-HBH tag for tandem affinitet rensing.

I eCLIP ble adaptere ligaturer først på 3 ' enden av RNA etterfulgt av RT, og ved siden av 3 ' enden av cDNAs i en Intermoleylære modus. Herav, eCLIP er kjøpedyktig fange alle avkortet og lese-igjennom cDNA28. Det er heller ikke begrenset til radioaktivt merking, eller å bruke cellelinjer basert på prinsippet sitt, og samtidig opprettholde nukleotid oppløsning.

Her gir vi en trinnvis beskrivelse av en eCLIP-protokoll som er tilpasset muse testikkel. Kort sagt starter denne eCLIP-protokollen med UV-Cross Linking av testikkel tubuli, etterfulgt av delvis RNase-fordøyelse og immunutfelling ved hjelp av et protein spesifikt antistoff. Deretter blir den protein bundne RNA-en dephosphorylated, og adapteren er ligaturer til dens 3-end. Etter protein gel elektroforese og gel-til-membran-overføring, er RNA isolert ved å skjære membran området til et forventet størrelsesområde. Etter RT er DNA-adapteren ligaturer til 3 ' enden av cDNA etterfulgt av PCR forsterkning. Screening av subclones før høy gjennomstrømming sekvensering er tatt som et bibliotek kvalitetskontroll. Denne protokollen er effektiv til å identifisere store arter av protein-bundet RNA av RBPs, som er et eksempel på de to testikkel RNA helicases MOV10L1 og MOV10.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle utførte dyre eksperimenter er godkjent av Nanjing Medical University Committee. Mann C57BL/6 mus ble holdt under kontrollerte photoperiod forhold og ble levert med mat og vann.

1. vev høsting og UV Cross Linking

  1. Euthanize 2 voksen mus bruker karbondioksid (CO2) for 1-2 min eller til pusten stopper. Deretter utfører du cervical forvridning på hver mus.
  2. Harvest ca 100 mg testiklene fra mus av passende alder (en voksen testikkel i denne studien) for hver immunutfelling eksperiment, og plassere vev i iskald fosfat bufret saltvann (PBS).
  3. Fjern tunika albuginea forsiktig med ett par med fin-spiss pinsett.
  4. Tilsett 3 mL iskald PBS i en vev jeksel og triturate vevet ved mild mekanisk kraft ved hjelp av en løs glass morter (type A glass morter).
    Merk: Hensikten med dette trinnet er ikke å lyse celler, men å trekke fra hverandre vevet. Bevaring av celle levedyktighet og integritet er viktig.
  5. Overfør vev suspensjonen til en cellekultur parabolen (10 cm i diameter) og tilsett iskald PBS opp til 6 mL.
  6. Rist platen raskt slik at væsken dekker bunnen av fatet jevnt. Hvis vevet er malt riktig, jevnt fordelt sæd tubuli vil være synlig, mens tilstedeværelsen av vev klumper indikerer at vev dispersjon er suboptimal.
  7. Krysskobling suspensjonen tre ganger med 400 mJ/cm2 ved 254 NM på isen. Bland suspensjon mellom hver bestråling.
    Merk: For hvert nye eksperiment bør Cross Linking optimaliseres.
  8. Samle suspensjonen i et 15 mL konisk rør og pellets ved 1 200 x g i 5 min ved 4 ° c. Fjern supernatanten, resuspend pellet i 1 mL PBS og Overfør deretter suspensjonen til et 1,5 mL sentrifugerør. Spin ved 4 ° c og 1 000 x g i 2 min, og fjern supernatanten.
  9. På dette punktet, umiddelbart fortsette med resten av protokollen, eller snap fryse pellets i flytende nitrogen og lagre ved-80 ° c til bruk.

2. perler forberedelse

  1. Tilsett 125 μL av protein en magnetisk perler per prøve (pellet) til et friskt sentrifugerør.
    Merk: Bruk protein G magnetiske perler for mus antistoffer.
  2. Plasser røret på magneten for å skille perlene fra løsningen. Etter 10 s, Fjern supernatanten. Vask perlene to ganger med 1 mL iskald lyseringsbuffer.
    Merk: Påfølgende separasjon av protein en magnetisk perler følger dette trinnet. Lyseringsbuffer sammensetningen er 50 mM Tris-HCl, pH 7,5; 100 mM NaCl; 1% NP-40; 0,1% SDS; 0,5% natrium natriumdeoksykolat; 1/50 ethylenediaminetetraacetic acid (EDTA)-gratis protease inhibitor cocktail (Legg frisk).
  3. Resuspend perler i 100 μL av kald lyseringsbuffer med 10 μg eCLIP antistoff. Roter rørene ved romtemperatur i 45 min.
    Merk: Den endelige antistoff konsentrasjonen for immunutfelling er 10 μg/mL. Hvis antistoff konsentrasjonen er ukjent, bør mengden av antistoff optimaliseres.
  4. Vask perlene to ganger med 1 mL iskald lyseringsbuffer.

3. tissue lyse og delvis RNA fordøyelsen

  1. Resuspend vevs pellets i 1 mL kaldt lyseringsbuffer (tilsett 22 μL av 50x (EDTA)-fri protein inhibitor cocktail og 11 μL av RNase-hemmere til 1 mL lyseringsbuffer).
    1. Resuspend to UV-krysskoblet pellets og to ikke-krysskoblet pellets per gruppe av eksperimenter: UV-krysskoblet-1 pellets for eCLIP bibliotek (UV-1); UV-krysskoblet-2 pellets for eCLIP bibliotek (UV-2); ikke-krysskoblet-1 pellets for eCLIP bibliotek som en kontroll (ikke-UV); ikke-krysskoblet-2 pellets for IgG IP å demonstrere spesifisitet av antistoffer.
      Merk: den ideelle kontrollen for eCLIP biblioteket av UV-krysskoblet bred-type testiklene er at av UV-krysskoblet knockout testiklene fra mus av samme kull.
  2. Hold lysering prøvene på isen i 15 min (for å hindre nedbrytning av protein og RNA).
  3. Sonikere i en digital sonicator ved 10% amplitude i 5 min, ved 30 s på/30 s off. Plasser alltid prøven på isen og rengjør proben med nuklease vann mellom hver prøve.
  4. Tilsett 4 μL av DNase til hvert rør, og bland godt. Ruge i 10 min ved 37 ° c, risting ved 1 200 rpm.
  5. Tilsett 10 μL av fortynnet RNase i (4 U/μL RNase i i PBS), og bland godt. Ruge i 5 min ved 37 ° c, risting ved 1 200 rpm.
  6. Fjern lysat ved å sentrifugering ved 15 000 x g i 20 min (ved 4 ° c).
  7. Nøye samle supernatanten. La 50 μL av lysat og kast pellet med den.
  8. Lagre innganger prøver som RWB (Run for Western Blot) og RRI (Run for RNA isolasjon). Spar 20 μL (2%) av UV-1, UV-2, ikke-UV og IgG-prøver som innganger for RWB gel lasting. Spar 20 μL (2%) av UV-1 eller UV-2 prøver som innganger for RRI gel lasting.

4. immunutfelling

  1. Tilsett 1 mL lysat (fra trinn 3,7) til perlene (fremstilt i avsnitt 2) og roter prøvene ved 4 ° c for 2 t eller over natten.
  2. Samle perlene med et magnetisk stativ og kast supernatanten. Vask perlene to ganger med 900 μL av høy salt buffer (50 mM Tris-HCl, pH 7,5; 1 M NaCl; 1 mM EDTA; 1% NP-40; 0,1% SDS; 0,5% natrium natriumdeoksykolat), og vask deretter perlene to ganger med 900 μL vaskebuffer (20 mM Tris, pH 7,5; 10 mM MgCl2; 0,2% mellom-20).
    Merk: For IgG-prøven kan du stanse prosedyren her og lagre på is i vaske bufferen.
  3. Vask perlene en gang med 500 μL av 1x defosforylering buffer (10 mM Tris-HCl, pH 7,5; 5 mM MgCl2; 100 mm KCl; 0,02% Triton X-100).

5. defosforylering av RNA 3 ' ender

  1. Samle perlene med et magnetisk stativ og kast supernatanten. Fjern rester av væske ved hjelp av fine pipette tips. Tilsett 100 μL av defosforylering Master mix (10 μL av 10x defosforylering buffer [100 mM Tris-HCl, pH 8,0; 50 mM MgCl2; 1 M KCl; 0,2% Triton X-100; 1 mg/ml blod serum ALBUMIN (BSA)]; 78 μL av nuklease-fritt vann; 2 μL av RNase-hemmer; 2 μL av DNase; 8 μL av Al kaline fosfatase) til hver prøve, og ruge i 15 minutter ved 37 ° c, risting ved 1 200 rpm.
  2. Tilsett 300 μL av polynucleotide kinase (PNK) Master mix (60 μL av 5x PNK pH 6,5 buffer [350 mM Tris-HCl, pH 6,5; 50 mM MgCl2]; 223 μL av nuklease-fritt vann; 5 μL RNase-hemmer; 2 μL DNase; 7 ΜL av pnk-enzym; 3 μl av 0,1 M dithiotreitol) til hver prøve , ruge i 20 min ved 37 ° c, risting ved 1 200 rpm.
  3. Samle perlene med et magnetisk stativ og kast supernatanten. Vask perlene en gang med 500 μL av kald vaskebuffer. Vask deretter perlene en gang med 500 μL av kaldt høyt salt buffer. Gjenta disse vasker igjen i denne rekkefølgen.
  4. Vask perlene en gang med 500 μL av kulde vask buffer og deretter to ganger med 300 μL av kald 1x ligation buffer (ingen dithiotreitol, 50 mM Tris-HCl, pH 7,5; 10 mM MgCl2).

6. RNA adapter-ligation til RNA 3-endene

  1. Kast supernatanten, og fjern rester av væske med fine pipette tips. Tilsett 25 μL av 3 ' ligation Master Mix til hver prøve. Bland forsiktig av pipettering. Dette trinnet er tilbøyelig til å produsere bobler.
    Merk: Ligation Master Mix inneholder 3 μL av 10x ligation buffer [500 mM Tris-HCl, pH 7,5; 100 mM MgCl2]; 9 μL av nuklease vann; 0,4 μL av RNase-hemmer; 0,3 μL av 0,1 M ATP; 0,8 μL av dimethyl sulfoxide (DMSO); 9 μL av 50% polyetylen glykol (PEG) 8000; 2,5 μL av RNA-ligase [30 U/μL].
  2. Tilsett 2,5 μL av RNA adapter X1A (tabell 1) og 2,5 ΜL av RNA adapter X1B (tabell 1) i hvert utvalg. Bland forsiktig ved å pipettering eller sveipe, og ruge i 75 min ved 25 ° c, og skyv for å blande hver 10 min.
  3. Vask perlene én gang med 500 μL av kald vaskebuffer (gjenoppta IgG-prøven her).
  4. Vask perler en gang med 500 av kaldt høy salt buffer og deretter med 500 μL kjøle vask buffer. Gjenta disse vasker igjen.
  5. Magnetisk separate perler, og fjerne rester av væske med fine pipette tips.
  6. Resuspend perlene i 100 μL av kjøle vask buffer (stans IgG-prøven her og oppbevar den på is i vaskebuffer). Flytt 20 μL til nye rør som RWB-prøver. Magnetisk separat de resterende 80 μL som RRI prøver. Fjern RRI-prøvene ' supernatanten og resuspend perlene i 20 μL vaskebuffer.
  7. Tilsett 37,5 μL av 4X litium natriumdodecylsulfat sulfat (LDS) prøve buffer og 15 μL av 10x prøve reduksjonsmiddel til IgG-prøven. Tilsett 7,5 μL av 4X LDS prøve buffer og 3 μL av 10x prøve reduksjonsmiddel til (gjenværende) prøvene. (Ikke bland med pipettering). Ruge i 10 min ved 70 ° c, risting ved 1 200 rpm. Avkjøl på isen i 1 min, og sentrifuger ved 1 000 x g i 1 min ved 4 ° c.

7. SDS-side og membran overføring

  1. Last gels.
    1. For RRI gel (4-12% BIS-Tris protein gel, 10-brønn, 1,5 mm), plasser rør på en magnet og separate protein eluatet fra perlene. Last 30 μL av prøve per brønn. Prøvene er avstand av pre-farget protein størrelse markør.
    2. For RWB gel (4-12% BIS-Tris protein gel, 10-brønn, 1,5 mm), plasser rør på en magnet og separate protein eluatet fra perlene. Last 15 μL av prøve per brønn. Lagre de resterende prøvene ved-20 ° c som sikkerhetskopier.
  2. Tilsett 500 μL av antioksidant til 500 mL 1x SDS-buffer som kjører. Kjør på 200 V i 1x SDS kjører buffer for 50 min eller til Dye fronten er nederst.
    Merk: Antioksidant inneholder N, N-Dimethylformamide, natrium bisulfite, som migrerer med reduserte proteiner for å hindre reoxidation av sensitive aminosyrer som metionin og tryptofan.
  3. Overfør protein-RNA komplekser fra gelen til en nitrocellulose membran ved 10 V for 70 min i 1xtransfer buffer med 10% metanol (Vol/Vol). Skyll RRI-membranen i kald PBS, Pakk den i plastfolie og oppbevar ved-80 ° c.
  4. Blokker RWB-membranen i 5% melk i TBST ved romtemperatur i 1 time skyll membranen i TBST. Ruge med primært antistoff i TBST ved 4 ° c over natten. Vask to ganger med TBST i 5 min. ruge med sekundært antistoff (1:5000 HRP geit anti-kanin IgG) i TBST ved romtemperatur for 1 h. vask tre ganger med TBST i 5 min, 10 min og 15 min, henholdsvis.
  5. Bland like volumer av electrochemiluminescence (ECL) buffer A og buffer B, Legg til membran og ruge i 1 min. dekk membranen med plastfolie, og utsett den for en røntgen film ved romtemperatur i 2-3 min. Deretter utvikle filmen.
    Merk: Filmen med flere vil tydelig vise formen på membran kantene, der filmen kan justeres tilbake til RWB-membranen. Deretter justere RWB og RRI membraner basert på posisjonene til markører deri. Lagvis i rekkefølge fra bunn til topp er filmen, RWB membranen og RRI membranen i rekkefølge.

8. RNA-isolasjon

  1. Skjær regionen fra protein bånd til 75 kDa (ca 220 NT av RNA) over den, ved hjelp av RWB membran og film som guider.
    Merk: Som et protein-beskyttet RNA molekyl kan ha en maksimal lengde på 225 baser, med ca 340 da per base, er det rimelig å kutte regionen rundt 75 kDa over RBP bandet for å hente alle protein-RNA komplekser.
  2. Skjær excised stykke membran i flere små skiver, og legg dem inn i en frisk 1,5 mL sentrifuge slange. Tilsett 200 μL av proteinase K (PK) buffer (100 mM Tris-HCl pH 7,5; 50 mM NaCl; 10 mM EDTA) med 40 μL av PK til membran brikkene. Bland og ruge i 20 min ved 37 ° c, risting ved 1 200 rpm.
  3. Tilsett 200 μL av PK urea buffer (100 mM Tris-HCl pH 7,4; 50 mM NaCl; 10 mM EDTA; 7 M urea) til hver prøve. Ruge i 20 min ved 37 ° c, risting ved 1 200 rpm.
  4. Tilsett 400 μL av syre fenol/kloroform/isoamylacetat alkohol (25:24:1), bland godt og ruge i 5 min ved 37 ° c, risting ved 1 200 rpm.
  5. Plasser 2 mL fase lås gel (PLG) tunge rør i sentrifuge og spinn på 15 000 x g for 25 s.
  6. Overfør alt innhold unntatt membran skiver til PLG tunge rør. Ruge i 5 min ved 37 ° c, risting ved 1 200 rpm.
  7. Snurr ved romtemperatur og 15 000 x g i 15 min. Overfør det vandige laget til et nytt 15 ml konisk rør.
  8. Bruk RNA rensing og konsentrasjon kolonner for å trekke ut RNA.
    1. Tilsett 2 bind (800 μL) av RNA binding buffer til hvert utvalg (fra trinn 8,7) og bland. Legg til et lik volum (1200 μL) på 100% etanol og bland.
    2. Overføring 750 μL av prøven (fra trinn 8.8.1) til RNA rensing og konsentrasjon kolonner i en samling rør og sentrifuge ved 15 000 x g for 30 s. kast gjennomstrømning.
    3. Gjenta trinn-8.8.2 til alle prøvene er passert gjennom kolonnen. Tilsett 400 μL av RNA prep buffer til søylen og sentrifuger ved 15 000 x g for 30 s. kast gjennomstrømning, Påfør 700 ΜL av RNA vaskebuffer og sentrifuger kolonnen ved 15 000 x g for 30 s. kast gjennomstrømning.
    4. Tilsett 400 μL av RNA vaskebuffer til søylen og sentrifuger ved 15 000 x g i 2 min. Overfør kolonnen forsiktig inn i et nytt 1,5 ml rør. Tilsett 10 μL av nuklease-fritt vann til kolonnen matrise, la sitte i 2 min, og sentrifuger på 15 000 x g for 30 s. lagre eCLIP prøver ved-80 ° c til RT (trinn 11,1).

9. defosforylering av input RNA 3 ' ender

  1. Tilsett 15 μL av defosforylering Master mix (2,5 μL av 10x defosforylering buffer [100 mM Tris-HCl, pH 8,0; 50 mM MgCl2; 1 M KCl; 0,2% Triton X-100; 1 mg/ml BSA]; 9,5 μL av nuklease-fritt vann; 0,5 μL av RNase-hemmer; 2,5 μL av alkalisk fosfatase) til 10 μL av inn data prøvene (fra trinn 8.8.4). Ruge i 15 min ved 37 ° c, risting ved 1 200 rpm.
  2. Tilsett 75 μL av PNK Master mix (20 μL av 5x PNK PH 6,5 buffer [350 mM Tris-HCl, pH 6,5; 50 mM MgCl2]; 44 μL av nuklease-fritt vann; 1 ΜL av RNase-hemmer; 2 μL av DNase; 7 ΜL av pnk-enzym; 1 μl av 0,1 M dithiotreitol) til prøver. Ruge i 20 min ved 37 ° c, risting ved 1 200 rpm.
  3. Opprydding av inn data RNA
    1. Resuspend thenucleic syre avsug magnetisk beadsin hetteglasset (Vortex for mer enn 30 s). Tilsett 20 μL av nukleinsyre yre ekstraksjon magnetiske perler for hver prøve til nye rør. Samle perlene med et magnetisk stativ og kast supernatanten.
    2. Vask perlene en gang med 1 mL RNA rense lyseringsbuffer (RLT buffer). Plasser røret på en magnet i 30 s og kast supernatanten.
      Merk: Påfølgende separasjon av nukleinsyre syrer utvinning magnetiske perler fulgt dette trinnet.
    3. Resuspend perler med 300 μL av RLT buffer og legge til prøven. Tilsett 10 μL av 5 M NaCl og 615 μL av 100% etanol (EtOH) og bland med pipettering. Roter ved romtemperatur i 15 min. magnetisk skille perlene og fjerne supernatanten.
    4. Resuspend perler i 1 mL 75% EtOH og overføre til et nytt rør. Etter 30 s, samle perlene med et magnetisk stativ og kast supernatanten. Vask to ganger med 75% EtOH, magnetisk skille perlene, og kast rest væske med fine pipette tips. Lufttørke i 5 minutter (unngå overdreven tørking).
    5. Resuspend perlene med 10 μL av nuklease vann og ruge det i 5 min. magnetisk separate perler, og Flytt 5 μL av supernatanten til et nytt rør (for 3 ' adapter ligation nedenfor). Den resterende RNA-en kan lagres ved-80 ° c som sikkerhetskopier.

10. RNA adapter ligation til inngang RNA 3 ' ender

  1. Tilsett 1,5 μL av DMSO og 0,5 μL av RiL19-adapter (tabell 1) til 5 μL av inn data RNA (fra trinn 9.3.5), ruge i 2 minutter ved 65 ° c, og plasser på isen i mer enn 1 min. legg til 13,5 μL av 3 ' ligation Master Mix til hver prøve , bland med pipettering og ruge i 75 min ved 25 ° c, med å bla til mix hver 15 min.
    Merk: Ligation Master Mix inneholder 2 μL av 10x ligation buffer [500 mM Tris-HCl, pH 7,5; 100 mM MgCl2; 10 mm dithiotreitol]; 1,5 μL av nuklease vann; 0,2 μL av RNase-hemmer; 0,2 μL av 0,1 M ATP; 0,3 μL av DMSO; 8 μL av 50% PEG8000; 1,3 μL av RNA-ligase [30 U/μL].
  2. Opprydding av ligaturer inn data RNA
    1. Magnetisk separat 20 μL av nukleinsyre yre ekstraksjon magnetiske perler for hver prøve, og fjerne supernatanten. Vask perlene en gang med 1 mL RLT buffer.
    2. Resuspend perler i 61,6 μL av RLT buffer og overføring suspensjon til hver prøve. Tilsett 61,6 μL av 100% EtOH. Bruk pipette til å mikse i 15 minutter hver 5 min. magnetisk separate perler, og fjern supernatanten.
    3. Gjenta trinn-9.3.4.
    4. Resuspend perler med 10 μL av nuklease vann, og la det sitte i 5 min. magnetisk skille perlene og overføre 10 μL av supernatanten til et nytt rør.
      Merk: Dette er et mulig stoppe punkt (inngangs prøver kan lagres ved-80 ° c til neste dag).

11. Reverse transkripsjon, DNA adapter ligation til cDNA 3 ' ender

  1. Tilsett 0,5 μL av RT primer (tabell 1) til 10 μL av inn data RNA (fra trinn 10.2.4) og 10 ΜL av klips RNA (fra trinn 8.8.4) henholdsvis ruge i 2 minutter i forvarmet PCR-blokk ved 65 ° c, plasser på isen i mer enn 1 min.
  2. Tilsett 10 μL av RT Master mix (2 μL av RT-buffer [500 mM Tris-HCl, pH 8,3; 750 mM KCl; 30 mM MgCl2]; 4 μL av nuklease vann; 0,3 μL av RNase inhibitor; 2 μL av 0,1 m dithiotreitol; 0,2 μl av 0,1 m dATP; 0,2 μl av 0,1 m dCTP; 0,2 μL av 0,1 M dGTP; 0,2 μL av 0,1 M dTTP; 0,9 μL av revers transkriptase) til hver prøve, mix, ruge ved 55 ° c i 45 min på en forvarmet PCR-blokk.
  3. Bland 20 μL av RT reaksjons produkt med 3,5 μL av PCR produkt opprydding reagens. Ruge for 15 min ved 37 ° c.
  4. Tilsett 1 μL 0,5 M EDTA, bland med pipettering. Tilsett 3 μL av 1 M NaOH, bland med pipettering og ruge i 12 min ved 70 ° c i en PCR-blokk for å hydrolyserer mal RNA.
  5. Tilsett 3 μL av 1 M HCl, pipette-mix for å nøytralisere bufferen.
  6. Opprydding av cDNA
    1. Magnetisk separat 10 μL av nukleinsyre syre avsug magnetiske perler for hver prøve, Fjern supernatanten. Vask én gang med 500 μL av RLT-buffer.
    2. Resuspend perler i 93 μL av RLT buffer og overføring suspensjon til prøven. Tilsett 111,6 μL av 100% EtOH, ruge det i 5 min, og Pipetter Mix hver 2 min. samle perlene med et magnetisk stativ og kast supernatanten. Resuspend perler med 1 mL 80% EtOH og flytte til et nytt rør.
    3. Etter 30 s, samle perlene med et magnetisk stativ og kast supernatanten. Vask to ganger med 80% EtOH. Magnetisk separat og kast rest væske med fin tupp. Lufttørke i 5 minutter (unngå overdreven tørking). Resuspend perler i 5 μL 5 mM Tris-HCl og ruge det i 5 min.
  7. Tilsett 0,8 μL av DNA-adapter (tabell 1) og 1 ΜL av DMSO i perlene, ruge i 2 minutter ved 75 ° c. Plasser på isen i mer enn 1 min.
  8. Forbered 12,8 μL av ligation Master mix (2 μL av 10x ligation buffer [500 mM Tris-HCl; 100 mM MgCl2; 10 mm dithiotreitol]; 1,1 μL av nuklease fritt vann; 0,2 μL av 0,1 M ATP; 9 μL av 50% PEG8000; 0,5 ΜL av RNA-ligase [30 U/μL]) , sveip for å mikse, spinn kort i en sentrifuge, og legg den til hver prøve, rør prøven med pipette spissen langsomt.
  9. Tilsett ytterligere 1 μL RNA-ligase [30 U/μL] i hver prøve og sveip for å blande. Ruge 30 s ved 25 ° c, risting ved 1 200 rpm. Ruge ved 25 ° c over natten. Sveip for å blande lett 5 til 6 ganger, en gang per time.
  10. Opprydding av ligaturer cDNA
    1. Magnetisk separat 5 μL av nukleinsyre yre ekstraksjon magnetiske perler for hver prøve, og fjerne supernatanten.
    2. Vask én gang med 500 μL RLT-buffer.
    3. Resuspend perler i 60 μL av RLT buffer til perler og overføring suspensjon til hver prøve. Tilsett 60 μL av 100% EtOH, ruge den i 5 min og pipette Mix hver 2 min. magnetisk separat, kast supernatanten.
    4. Gjenta trinn-9.3.4.
    5. Resuspend perler med 27 μL av 10 mM Tris-HCl, ruge den i 5 min. magnetisk separat, og Flytt 25 μL av prøven til et nytt rør. Fortynne 1 μL av ligaturer cDNA med 9 μL av nuklease vann i et nytt rør. Oppbevar de resterende prøvene ved-20 ° c til trinn 13,1.

12. kvantifisering av cDNA av Real-Time kvantitative PCR (qPCR)

  1. Tilsett 9 μL av qPCR Master mix (5 μL av 2x Master Mix; 3,6 μL av nuklease vann; 0,4 μL av primer Mix [10 μM PCR-F-D50X og 10 μM PCR-R-D70X]) til en 96-brønn qPCR plate. Tilsett 1 μL av 1:10 fortynnet (i H2O) cDNA (fra trinn 11.10.5), tetning og bland.
  2. Kjør qPCR-programmet i en thermocycler: 2 min ved 50 ° c; 2 min ved 95 ° c; 3 s ved 95 ° c etterfulgt av 30 s ved 68 ° c for 40 sykluser; 15 s ved 95 ° c etterfulgt av 60 s ved 68 ° c, etterfulgt av 15 s ved 95 ° c i 1 syklus. Merk CT (syklus terskel) verdi.

13. PCR forsterkning av cDNA

  1. Dispensere 35 μL av PCR Master mix (25 μL av 2x PCR Master Mix; 5 μL av nuklease vann; 5 μL av primer Mix [20 μM PCR-F-D50X og 20 μM PCR-R-D70X]) i 8-brønn strimler. For CLIP-gruppen legger du til 12,5 μL av CLIP-sample + 2,5 μL av H2O; for inn datagruppe, tilsett 10 μL av innganger + 5 μL av H2O. Bland godt og snurr kort i sentrifuge.
  2. Kjør PCR-programmet: 30 s ved 98 ° c; 15 s ved 98 ° c etterfulgt av 30 s ved 68 ° c, etterfulgt av 40 s ved 72 ° c i 6 sykluser; 15 s ved 98 ° c etterfulgt av 60 s ved 72 ° c for N sykluser = (qPCR CT verdier-3)-6; 60 s ved 72 ° c; 4 ° c hold.
    Merk: Det er bedre å utføre 1 til 2 ekstra PCR-sykluser for de første par klippene.

14. gel rensing

  1. Last prøver på en 3% høyoppløselig agarose gel. Leaving 1 tomme brønnen mellom prøvene, og bruke en stige på begge sider av gel. Kjør på 100-V for 75 min i 1x Tris-borate-EDTA (TBE)-buffer.
  2. Under blått lys belysning, kutte gel skiver 175-350 BP med friske barberhøvel blader for hver prøve. Plasser dem i 15 mL koniske rør.
    1. Veie gel skive, og eluere gelen ved hjelp av en gel Extraction Kit.
    2. Legg til 6 ganger volum av gel oppløsnings buffer for å smelte gelen (100 mg gel = 600 μL av gel oppløsnings buffer). Løs opp gelen ved romtemperatur. (Rist for å blande hver 15 min til gel Slice har helt oppløst). Tilsett 1 gel volum på 100% isopropanol og bland godt.
    3. Overføring 750 μL av prøven (fra trinn 14.2.2) til kolonnen i et oppsamlings rør og sentrifuge ved 17 900 x g for 1 min. kast gjennomstrømning.
    4. Gjenta trinn-14.2.3 til alle prøvene har passert gjennom søylen, vask én gang med 500 μL av gel oppløsnings buffer.
    5. Tilsett 750 μL vaskebuffer (fra gel Extraction Kit) til kolonnen og sentrifuger ved 17 900 x g for 1 min. kast gjennomstrømning, spinn på 17 900 x g i 2 min. Plasser kolonnen til en ny 1,5 ml tube.
    6. Fjern all gjenværende vaskebuffer fra den lilla kanten på søylen. Lufttørke i 2 min. Tilsett 12,5 μL av nuklease vann til midten av membranen. La kolonnen stå i 2 min ved romtemperatur, og spinne på 17 900 x g i 1 min (for en forbedret yield, gjentar eluering trinn).

15. TOPO-klone av PCR-produktet

  1. Forbered TOPO kloning reaksjons miks (1 μL av PCR produkt fra trinn 14.2.6; 1 μL av kloning Mix; 3 μL av sterilt vann). Bland forsiktig og ruge i 5 minutter ved 20-37 ° c. Kult på isen.
  2. Tin kjemisk kompetente E. coli bakterier på isen. Tilsett 5 μL av TOPO kloning produktet til 100 μL av kompetente bakterier29. Bland godt. Ruge på isen i 30 minutter.
  3. Varme-sjokk for 60 s ved 42 ° c. Deretter avkjøles på isen i 2 min. Tilsett 900 μL av lysogeny buljong (LB) medium, ruge ved 37 ° c i 1 time, risting ved 225 RPM. Snurr på 1 000 x g i 1 min, og fjern deretter 900 μL av supernatanten. Resuspend resten av løsningen.
  4. Plate den transformert bakterier på 1,5% LB agar plater som inneholder Ampicillin (100 μg/mL), og ruge over natten ved 37 ° c.
  5. Forbered minst 20 1,5 mL sentrifugerør for hver konstruksjon. Fyll ett sett med 500 μL av LB medium som inneholder 100 μg/mL Ampicillin. Bruk en steril pipette tupp til å skrape av en bakterie koloni tilfeldig og bland (ved pipettering) med 500 μL av LB medium. Ruge ved 37 ° c i 5 timer, risting ved 225 RPM.
  6. Sekvens innsatsen fragment ved hjelp av M13 omvendt primer: CAGGAAACAGCTATGAC av sanger sekvensering30.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

ECLIP prosedyren og resultatene er illustrert i figur 1, figur 2, Figur 3, Figur 4. Mus ble euthanized med karbondioksid og et lite snitt ble gjort i nedre del av magen ved hjelp av kirurgisk saks (figur 2a,B). Mus testiklene ble fjernet, detunicated og deretter UV-krysskoblet etter sliping (figur 2C-I). Representative eCLIP resultater av å bruke to kjente RNA-bindende helicases i testikkel vev er avbildet i Figur 3 og 4. Vi utførte MOV10 eCLIP i testiklene fra voksen vill-type mus, med felles konsentrasjon av 40 U/mL av RNase jeg behandler krysskoblet lysat. Det øverste panelet i figur 3a viser at mål protein størrelsen rundt 114 KDA ble vellykket beriket. Western Blot av immunoprecipitated MOV10L1 proteiner ble utført med to konsentrasjoner (5 eller 40 U/mL) av RNase i under eCLIP prosessen (figur 3a). Figur 3b viser qPCR ved hjelp av 1:10 fortynnet cDNA (allerede LIGATURER med DNA-adapter) fra MOV10 og MOV10L1 UV-krysskoblet, ikke-krysskoblet, og den sammenkoblede størrelsen matchet input (SMInput) prøven. Ikke-krysskoblet prøver viser redusert RNA-gjenoppretting. Vi observerte at CT-verdiene av den ikke-krysskoblet gruppen var generelt 5 ganger mer enn UV-krysskoblet gruppe. Figur 4a viser PCR forsterkning og størrelsesvalg via agarose gel elektroforese (cut 175-350 BP). Primer-dimer produktet vises på ca 140 BP. figur 4b viser UCSC Genova Leservisning av to representative subclone sekvenser. MOV10-Bound eCLIP koder er funnet å være plassert innenfor 3 ' UTR av genet FTO; Den omtrentlige rate på 3 ' UTR mål står for 75% (figur 4c), i samsvar med FLERTALLET av MOV10 mål i HEK293 celler10 og i testiklene (data ikke vist). I motsetning til dette, er MOV10L1-Bound eCLIP-koder funnet å være plassert i en piRNA-klynge som indikerer MOV10L1 mål for piRNA forløpere. Den omtrentlige frekvensen av piRNA forløper mål står for 42% (figur 4e), noe som reflekterer en trend fra vår forrige konvensjonelle Clip eksperiment20. MOV10L1 eCLIP med 40 U/mL RNase jeg fordøyelsen gir relativt flere sekvenser med mindre enn 20 BP (figur 4d).

Figure 1
Figur 1 : Skjematisk representasjon av eCLIP. UV-krysskoblet mus sæd tubuli (trinn 1) er lysert i eCLIP lyseringsbuffer og sonikert (trinn 2). Lysat behandles med RNase I for å fragment RNA, hvoretter protein-RNA-komplekser immunoprecipitated ved hjelp av anti-RBP-antistoff (trinn 3-4). Defosforylering av RNA fragmenter og ligation av 3 ' RNA adapter er utført (trinn 5-6). Protein-RNA komplekser kjøres på en SDS-side gel og overføres til nitrocellulose membraner (trinn 7). RNA utvinnes fra membranen ved å fordøye proteinet med proteinase K og urea som etterlater en kort polypeptid som gjenstår på krysskobling stedet. Defosforylering av RNA-fragmenter av inn data prøver og ligation av 3 ' RNA-adapter utføres (trinn 8). Utfør RT av RNA og ligation av 3 ' DNA adapter (trinn 9-10). Utfør PCR-forsterkning av cDNA-biblioteket, gel-ekstraksjon og Blunt-end PCR-kloning for foreløpig bibliotek kvalitetskontroll (trinn 11). Til slutt utfører du en sekvens med høy gjennomstrømming (Trinn 12). Vennligst klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2 : Testikkel vev høsting og UV Cross Linking. (A) eksponering av musen magen. (B) en 0,5 cm snitt i bukveggen utsette peritoneum. (C) et par testiklene er tatt ut ved å trekke ut fettet pads. (D) testikkel vevet fjernes og plasseres i en liten tallerken som inneholder iskald PBS. (E) Fjern tunika albuginea forsiktig. (F) Trykk på Loose-morter for å triturate vevet i en vevs kvern dounce. (G) distribuert sæd tubuli i en 10 cm plate. (H) UV cross linking med 400 mJ/cm2 energi. (I) krysskoblet prøvene er samlet i 1,5 ml sentrifugerør. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3 : Representative resultater fra MOV10 og MOV10L1 eCLIP. (A) Western Blot validering av MOV10 og MOV10L1 immunoprecipitates. (B) qPCR på 1:10 fortynnet eCLIP-BIBLIOTEKER med MOV10 og MOV10L1, med replikeres for UV, ikke-UV og de sammenkoblede SMInput-prøvene. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4 : eCLIP bibliotek forberedelse og kvalitetsvurdering. (A) gel-bildene til PCR-forsterkningen vises. Asterisk indikerer primer dimer. Rød stiplet linje indikerer regioner excised for PCR produkt av cDNA, et sted mellom 175 og 350 BP. (B) UCSC Genova Leservisning av to representative subclone sekvenser31. (C) liten skala subclone sekvensering analyse av MOV10. (D) MOV10L1-bundne koder viser distinkte mønstre for lengde fordeling når de behandles av to forskjellige RNase-konsentrasjoner. (E) liten skala subclone sekvensering analyse av MOV10L1. Vennligst klikk her for å se en større versjon av dette tallet.

Navn på sekvens Informasjon om sekvenser Beskrivelse
RNA-adaptere
RNA X1A /5Phos/AUAUAGGNNNNNAGAUCGGAAGAGCGUCGUGUAG/3SpC3/ lager ved 200 μM; arbeider ved 20 μM
RNA X1B /5Phos/AAUAGCANNNNNAGAUCGGAAGAGCGUCGUGUAG/3SpC3/ lager ved 200 μM; arbeider ved 20 μM
RiL19 /5phos/AGAUCGGAAGAGCGUCGUG/3SpC3/ lager ved 200 μM; arbeider på 40 μM
DNA-adapter
Rand103tr3 /5Phos/NNNNNNNNNNAGATCGGAAGAGCACACGTCTG/3SpC3/ lager ved 200 μM; arbeider på 80 μM
RT primer
AR17 ACACGACGCTCTTCCGA lager ved 200 μM; arbeider ved 20 μM
PCR-primere

PCR-F-D 501
AATGATACGGCGACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACGACGCTCTTCCGATCT lager ved 100 μM; arbeider ved 20 μM
PCR-R-D 701 CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC lager ved 100 μM; arbeider ved 20 μM
(Se Illumina kundeservice brev for D502-508, D702-712)

Tabell 1: adapter og primer sekvenser. Kortet inneholder en in-line Random-mer (enten N5 eller N10) for å finne ut om to identiske sekvens tall leser indikerer to unike RNA-fragmenter eller PCR-duplikater av samme RNA-fragment. "5 Phos" står for 5 ' fosforylering, som er nødvendig hvis en oligo brukes som et substrat for DNA/RNA ligase. "3SpC3" står for 3 ' C3 spacer, som kan forhindre ligation mellom adaptere.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Med økende forståelse av den universelle rolle RBPs under både biologiske og patologiske kontekster, har klipp metodene blitt mye benyttet for å avdekke molekyl funksjonen til RBPs20,32,33, 34,35. Protokollen som beskrives her, representerer en tilpasset anvendelse av eCLIP-metoden til mus-testikkel.

En utfordring i å utføre eCLIP i testikkel er å opprettholde levedyktighet og integritet av ferske testikkel celler, som også er viktig for effektiv Cross Linking. Klipping av testikkel med mild mekanisk kraft ved hjelp av den løse morter kan forhindre cellelyse32,36. Riktig fordøyelse av RNA er også avgjørende for vellykkede eCLIP-analyser. RNA fragmenter kan være mer konvergent etter fordøyelsen, men lengden mindre enn 20 BP kan fjernes via pre-prosessering av biblioteket leser. For å vedta en ideell RNase dosering for en RBP kandidat, foreslår vi en foreløpig test basert på resultatene av subclone sekvensering av eCLIP biblioteker som kan tilberedes ved RNase behandling med konsentrasjoner fra 0 til 40 U (per milliliter lysat). Den småskala subclone sekvensering analysen er et anbefalt skritt for en pålitelig undersøkelse av biblioteket kvalitet i vår eCLIP metode. Først, prosentandelen av innsatser kortere enn 20 BP bør ikke være for høy, eller den påfølgende pre-prosessering av eCLIP biblioteket vil føre til en kostbar tap av leser. For det andre bør effektiviteten av riktig ligation av begge adaptere sjekkes. Substandard prøver kan elimineres uten dype sekvenser for å sikre vellykket dyp sekvensering, resultatene som vanligvis tar mye lengre tid å analysere.

Selv om muligheten for eCLIP i musen testikkel er fortsatt begrenset av spesifisitet av antistoff for trinnet av immunutfelling, er eCLIP fordelaktig over konvensjonelle CLIP metoder i flere aspekter. For det første er det en ikke-radioaktiv metode. Ved eCLIP er RNA-målene for RBPs direkte fanget in vivo uten å måtte ty til arbeidskrevende teknikker ved hjelp av radioaktivt materiale. For det andre er metoden mindre tidkrevende. Hele prosedyren tar bare 4 dager gjennom eCLIP biblioteket forberedelse. For det tredje, sekvens mangfold. Sammenlignet med den konvensjonelle enhetlig forsterkning syklus av 25-35 sykluser, eCLIP refererer til CT-verdier av qPCR å angi antall PCR sykluser spesielt. Til slutt gir det sterkere signal-til-støy-forhold. Den størrelses tilpassede inngangen fungerer som en passende bakgrunn for autentiske mål.

Oppsummert, våre eCLIP resultater konsolidere konklusjonene som MOV10 og MOV10L1 har en bindende preferanse til mRNA 3 ' UTR og piRNA forløpere, henholdsvis. Protokollen vi beskrev her representerer den første ansettelse av eCLIP metoden i reproduksjon, et område der RNA-RBP interaksjon kunnskap er ganske utilstrekkelig, selv om genetiske studier har gitt god informasjon om de biologiske rollene til RBPs. visualisering av denne eCLIP protokollen kan bidra til å veilede sine omfattende applikasjoner i større områder.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ingenting å avsløre.

Acknowledgments

Vi takker Eric L Van Nostrand og Gene W Yeo for nyttig veiledning med den opprinnelige protokollen. K.Z. var understøttet av nasjonal nøkkel R & D program av porselen (2016YFA0500902, 2018YFC1003500), og nasjonal naturlig vitenskap opprettelsen av porselen (31771653). Ly ble støttet av National Natural Science Foundation i Kina (81471502, 31871503) og innovativ og gründer program av Jiangsu Province.

Materials

Name Company Catalog Number Comments
Antibodies
Anti-mouse MOV10  antibody Proteintech, China 10370-1-AP
Anti-mouse MOV10L1 antibody Zheng et al.20109 polyclonal antisera UP2175 provided by P. Jeremy Wang lab, University of Pennsylvania
HRP Goat Anti-Rabbit IgG  ABclonal AS014
Rabbit IgG Beyotime, China A7016
Equipment
Centrifuge Eppendorf, Hamburg, Germany 5242R
Digital sonifier BRANSON,USA BBV12081048A 450 Watts; 50/60 Hz
DynaMag-2 Magnet Invitrogen,USA 12321D
Mini Blot Module Invitrogen,USA B1000
Mini Gel Tank Invitrogen,USA A25977
Shaking incubator Eppendorf, Hamburg, Germany Thermomixer comfort 
Tissue Grinder, Dounce PYREX, USA 1234F35 only  the "loose" pestle is used in this protocol
TProfessional standard 96 Gradient Biometra, Germany serial no.: 2604323
Tube Revolver  Crystal, USA serial no.: 3406051
UV-light cross-linker UVP, USA CL-1000
Materials
TC-treated Culture Dish Corning, USA 430167 100 mm 
Tubes Corning, USA 430791 15 mL
Microtubes tubes AXYGEN , USA MCT-150-C 1.5 mL 
Reagents 
Acid phenol/chloroform/isoamyl alcohol  Solarbio, China P1011 25:24:01
AffinityScript Enzyme Agilent, USA 600107
Antioxidant Invitrogen,USA NP0005
DH5α competent bacteria Thermo Scientific, USA 18265017 these economical cells yield >1 x 106 transformants/µg control DNA per 50 µL reaction.
DMSO Sigma-Aldrich, USA D8418
DNA Ladder Invitrogen, USA 10416014
dNTP Sigma-Aldrich, USA DNTP100-1KT
Dynabeads Protein A  Invitrogen, USA 10002D
ECL reagent Vazyme, China E411-04
EDTA Invitrogen, USA AM9260G
EDTA free protease inhibitor cocktail Roche, USA 04693132001 add fresh
Exo-SAP-IT Affymetrix, USA 78201 PCR Product Cleanup Reagent 
FastAP enzyme Thermo Scientific, USA EF0652
LDS Sample Buffer Thermo Scientific, USA NP0007
MetaPhor Agarose  lonza, Switzerland 50180
MgCl2 Invitrogen, USA AM9530G
MiniElute gel Extraction QIAGEN, Germany 28604 column store at 4 ?; buffer QG=gel dissolving buffer; buffer PE= wash buffer(for step 14)
MyONE Silane beads Thermo Scientific, USA 37002D nucleic acids extraction magnetic beads
NaCl Invitrogen,USA AM9759
 
NP-40 Amresco, USA M158-500ML
NuPAGE Bis-Tris Protein Gels Invitrogen, USA NP0336BOX 4%–12%,1.5 mm, 15-well
NuPAGE MOPS SDS Buffer Kit  Invitrogen, USA NP0050
PBS Gibco, USA 10010023
Phase-Locked Gel (PLG) heavy tube   TIANGEN, China WM5-2302831
PowerUp SYBR Green Master Mix Applied Biosystems, USA A25742
Proteinase K NEB, New England  P8107S
Q5 PCR master mix  NEB, New England  M0492L
RLT buffer QIAGEN, Germany 79216 RNA purification lysis buffer 
RNA Clean & Concentrator-5 columns  ZYMO RESEARCH, USA R1016 RNA purification and concentration columns
RNase I  Invitrogen, USA AM2295
RNase Inhibitor Promega, USA N251B
RQ1 DNase Promega,USA M610A
Sample Reducing Agent Invitrogen,USA NP0009
SDS Solution Invitrogen, USA 15553027 10%
Sodium deoxycholate Sigma-Aldrich, USA 30970 protect from light
T4 PNK enzyme NEB, New England  M0201L
T4 RNA ligase 1 high conc NEB, New England  M0437M
TA/Blunt-Zero Cloning Mix Vazyme, China C601-01
TBE Invitrogen,USA AM9863
Tris-HCI Buffer Invitrogen, USA 15567027
Triton X-100 Sangon Biotech, China A600198 
Tween-20 Sangon Biotech, China A600560
Urea Sigma-Aldrich, USA U5378
X-ray Films Caresteam, Canada 6535876

DOWNLOAD MATERIALS LIST

References

  1. Turner, J. M., Mahadevaiah, S. K., Ellis, P. J., Mitchell, M. J., Burgoyne, P. S. Pachytene asynapsis drives meiotic sex chromosome inactivation and leads to substantial postmeiotic repression in spermatids. Developmental Cell. 10, (4), 521-529 (2006).
  2. Turner, J. M. A. Meiotic sex chromosome inactivation. Development. 134, (10), 1823-1831 (2007).
  3. Kimmins, S., Sassone-Corsi, P. Chromatin remodelling and epigenetic features of germ cells. Nature. 434, (7033), 583-589 (2005).
  4. Ule, J., et al. CLIP identifies Nova-regulated RNA networks in the brain. Science. 302, (5648), 1212-1215 (2003).
  5. Ule, J., Jensen, K., Mele, A., Darnell, R. B. CLIP: a method for identifying protein-RNA interaction sites in living cells. Methods. 37, (4), 376-386 (2005).
  6. Trifillis, P., Day, N., Kiledjian, M. Finding the right RNA: identification of cellular mRNA substrates for RNA-binding proteins. RNA. 5, (8), 1071-1082 (1999).
  7. Tenenbaum, S. A., Carson, C. C., Lager, P. J., Keene, J. D. Identifying mRNA subsets in messenger ribonucleoprotein complexes by using cDNA arrays. Proceedings of National Acadamy of Sciences U S A. 97, (26), 14085-14090 (2000).
  8. Chi, S. W., Zang, J. B., Mele, A., Darnell, R. B. Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 460, (7254), 479-486 (2009).
  9. Zheng, K., et al. Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway. Proceedings of National Acadamy of Sciences U S A. 107, (26), 11841-11846 (2010).
  10. Gregersen, L. H., et al. MOV10 Is a 5' to 3' RNA helicase contributing to UPF1 mRNA target degradation by translocation along 3' UTRs. Molecular Cell. 54, (4), 573-585 (2014).
  11. Banerjee, S., Neveu, P., Kosik, K. S. A coordinated local translational control point at the synapse involving relief from silencing and MOV10 degradation. Neuron. 64, (6), 871-884 (2009).
  12. Choi, J., Hwang, S. Y., Ahn, K. Interplay between RNASEH2 and MOV10 controls LINE-1 retrotransposition. Nucleic Acids Research. 46, (4), 1912-1926 (2018).
  13. Goodier, J. L., Cheung, L. E., Kazazian, H. H. Jr MOV10 RNA helicase is a potent inhibitor of retrotransposition in cells. PLoS Genetics. 8, (10), e1002941 (2012).
  14. Haussecker, D., et al. Capped small RNAs and MOV10 in human hepatitis delta virus replication. Nature Structural & Molecular Biology. 15, (7), 714-721 (2008).
  15. Kenny, P. J., et al. MOV10 and FMRP regulate AGO2 association with microRNA recognition elements. Cell Reports. 9, (5), 1729-1741 (2014).
  16. Messaoudi-Aubert, S. E., et al. Role for the MOV10 RNA helicase in Polycomb-mediated repression of the INK4a tumor suppressor. Nature Structural & Molecular Biology. 17, (7), 862-868 (2010).
  17. Sievers, C., Schlumpf, T., Sawarkar, R., Comoglio, F., Paro, R. Mixture models and wavelet transforms reveal high confidence RNA-protein interaction sites in MOV10 PAR-CLIP data. Nucleic Acids Research. 40, (20), e160 (2012).
  18. Skariah, G., et al. Mov10 suppresses retroelements and regulates neuronal development and function in the developing brain. BMC Biology. 15, (1), 54 (2017).
  19. Zheng, K., Wang, P. J. Blockade of pachytene piRNA biogenesis reveals a novel requirement for maintaining post-meiotic germline genome integrity. PLoS Genetics. 8, (11), e1003038 (2012).
  20. Vourekas, A., et al. The RNA helicase MOV10L1 binds piRNA precursors to initiate piRNA processing. Genes & Development. 29, (6), 617-629 (2015).
  21. Hocq, R., Paternina, J., Alasseur, Q., Genovesio, A., Le Hir, H. Monitored eCLIP: high accuracy mapping of RNA-protein interactions. Nucleic Acids Research. 46, (21), 11553-11565 (2018).
  22. Huppertz, I., et al. iCLIP: protein-RNA interactions at nucleotide resolution. Methods. 65, (3), 274-287 (2014).
  23. Hafner, M., et al. Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 141, (1), 129-141 (2010).
  24. Hafner, M., et al. PAR-CliP--a method to identify transcriptome-wide the binding sites of RNA binding proteins. Journal of Visualized Experiments. (41), (2010).
  25. Konig, J., et al. iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nature Structural & Molecular Biology. 17, (7), 909-915 (2010).
  26. Konig, J., et al. iCLIP--transcriptome-wide mapping of protein-RNA interactions with individual nucleotide resolution. Journal of Visualized Experiments. (50), (2011).
  27. Maticzka, D., Ilik, I. A., Aktas, T., Backofen, R., Akhtar, A. uvCLAP is a fast and non-radioactive method to identify in vivo targets of RNA-binding proteins. Nature Communications. 9, (1), 1142 (2018).
  28. Van Nostrand, E. L., et al. Robust transcriptome-wide discovery of RNA-binding protein binding sites with enhanced CLIP (eCLIP). Nature Methods. 13, (6), 508-514 (2016).
  29. Radulovich, N., Leung, L., Tsao, M. S. Modified gateway system for double shRNA expression and Cre/lox based gene expression. BMC Biotechnology. 11, 24 (2011).
  30. Breunig, C. T., et al. A Customizable Protocol for String Assembly gRNA Cloning (STAgR). Journal of Visualized Experiments. (142), (2018).
  31. Kuhn, R. M., Haussler, D., Kent, W. J. The UCSC genome browser and associated tools. Briefings in Bioinformatics. 14, (2), 144-161 (2013).
  32. Vourekas, A., et al. Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis. Nature Structural & Molecular Biology. 19, (8), 773-781 (2012).
  33. Preitner, N., et al. APC is an RNA-binding protein, and its interactome provides a link to neural development and microtubule assembly. Cell. 158, (2), 368-382 (2014).
  34. Meyer, C., et al. The TIA1 RNA-Binding Protein Family Regulates EIF2AK2-Mediated Stress Response and Cell Cycle Progression. Molecular Cell. 69, (4), 622-635 (2018).
  35. Gerstberger, S., Hafner, M., Tuschl, T. A census of human RNA-binding proteins. Nature Reviews Genetics. 15, (12), 829-845 (2014).
  36. Vourekas, A., Mourelatos, Z. HITS-CLIP (CLIP-Seq) for mouse Piwi proteins. Methods in Molecular Biology. 1093, 73-95 (2014).
Forbedret Cross Linking Immunutfelling (eCLIP) metode for effektiv identifisering av protein-bundet RNA i mus testikkel
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Xu, Q., Wang, C., Ling, L., Yue, Q., Liu, M., Zhang, S., Fu, K., Ye, L., Zheng, K. Enhanced Crosslinking Immunoprecipitation (eCLIP) Method for Efficient Identification of Protein-bound RNA in Mouse Testis. J. Vis. Exp. (147), e59681, doi:10.3791/59681 (2019).More

Xu, Q., Wang, C., Ling, L., Yue, Q., Liu, M., Zhang, S., Fu, K., Ye, L., Zheng, K. Enhanced Crosslinking Immunoprecipitation (eCLIP) Method for Efficient Identification of Protein-bound RNA in Mouse Testis. J. Vis. Exp. (147), e59681, doi:10.3791/59681 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter