Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Método de inmunoprecipitación de reticulado mejorado (eCLIP) para la identificación eficiente de ARN ligado a proteínas en Testis del ratón

doi: 10.3791/59681 Published: May 10, 2019
* These authors contributed equally

Summary

Aquí, presentamos un protocolo eCLIP para determinar los principales objetivos de ARN de los candidatos a RBP en Testis.

Abstract

La espermatogénesis define un proceso altamente ordenado de diferenciación de células germinales masculinas en mamíferos. En los Testis, la transcripción y la traducción están desacopladas, subrayando la importancia de la regulación post-transcripcional de la expresión génica orquestada por las RBP. Para dilucidar las funciones mecanicistas de un RBP, la metodología de reticulación inmunoprecipitation (CLIP) se puede utilizar para capturar sus objetivos de ARN directo endógeno y definir los sitios de interacción reales. El CLIP mejorado (eCLIP) es un método desarrollado recientemente que ofrece varias ventajas sobre los CLIPs convencionales. Sin embargo, el uso de eCLIP hasta ahora se ha limitado a las líneas celulares, pidiendo aplicaciones ampliadas. Aquí, empleamos a eCLIP para estudiar MOV10 y MOV10L1, dos helicasas de unión a ARN conocidas, en Testis de ratón. Como era de esperar, encontramos que MOV10 se une predominantemente a 3 ' regiones no traducidas (UTRs) de mRNA y MOV10L1 se une selectivamente a las transcripciones de precursores de ARN interactuante de Piwi (piRNA). Nuestro método eCLIP permite la rápida determinación de las principales especies de ARN vinculadas por diversos RBPs mediante la secuenciación a pequeña escala de subclones y, por lo tanto, la disponibilidad de bibliotecas calificadas, como una orden de proceder con secuenciación profunda. Este estudio establece una base aplicable para la eCLIP en los testículos de mamífero.

Introduction

Los testículos de mamífero representan un excelente modelo de desarrollo en el que un intrincado programa de diferenciación celular se ejecuta cíclicamente para producir numerosos espermatozoides. Un valor único de este modelo radica en la aparición de la inactivación transcripcional en ciertas etapas de la espermatogénesis, típicamente cuando la inactivación cromosómica del sexo meióticos (MSCI) ocurre1,2 y cuando los spermatidos redondos se someten a compactación nuclear drástica durante la espermiogénesis3. Estos eventos transcripcionales inconsecutivos requieren la regulación del gen post-transcripcional, en el cual las proteínas de unión al ARN (RBP) desempeñan un papel crucial, dando forma al transcriptoma y manteniendo la fertilidad masculina.

Para identificar los objetivos de ARN Bona fide de un RBP individual in vivo, el método de inmunoprecipitación reticulante (clip) se desarrolló4,5, basado en pero más allá de la inmunoprecipitación de ARN regular (RIP)6,7 , mediante la incorporación de pasos clave, incluyendo la reticulación ultravioleta (UV), el lavado estricto y la transferencia de gel para mejorar la especificidad de la señal. La aplicación avanzada del CLIP combinado con la secuenciación de alto rendimiento ha provocado un gran interés en el perfilado de la interacción proteína-ARN a niveles de genoma amplio8. Además de los estudios genéticos sobre la función de la RBP, estos métodos bioquímicos que identifican la interacción directa de la proteína endógena y el ARN han sido indispensables para dilucidar con precisión las funciones reguladoras de ARN de los RBPs. Por ejemplo, MOV10L1 es una helicasa de ARN específica de testis necesaria para la fertilidad masculina y la biogénesis9del ARN interactuante Piwi (Pirna). Su MOV10 de parálogo es conocido como un ARN helicogenamente expresado y multifuncional con funciones en múltiples aspectos de la biología de ARN10,11,12,13,14 , 15 , 16 , 17 , 18. mediante el empleo de los clip-SEQ convencionales, descubrimos que MOV10L1 une y regula los precursores primarios de Pirna para iniciar el procesamiento temprano de Pirna19,20, y que MOV10 une mRNA 3 ' UTRs y así como ARN no codificante especies en células germinales testiculares (datos no mostrados).

Sin embargo, CLIP es originalmente un laborioso, procedimiento radiactivo seguido por secuenciación de preparación de la biblioteca con una notable pérdida de etiquetas CLIP. En el CLIP convencional, se prepara una biblioteca cDNA utilizando adaptadores ligados en ambas extremidades del ARN. Después de la digestión proteica, los polipéptidos cortos reticulados permanecen Unidos a los fragmentos de ARN. Esta marca reticulante bloquea parcialmente la progresión de la transcriptasa inversa (rtasa) durante la síntesis de cDNA, resultando en cDNAs truncados que representan alrededor del 80% de la biblioteca de cDNA21,22. Por lo tanto, sólo fragmentos de cDNA resultantes de la Rtasa omitiendo el sitio de reticulación (lectura a través) están secuenciados. Recientemente, varios enfoques CLIP, tales como PAR-CLIP, iCLIP, eCLIP y uvCLAP, se han empleado para identificar sitios de enlace cruzado de RBPs en las células vivas. PAR-CLIP involucra la aplicación de radiación UV de 365 nm y análogos de nucleótidos fotoactivables y, por lo tanto, es exclusivo de las células vivas en cultivo, y la incorporación de análogos de nucleósidos en transcripciones recién sintetizadas es propensa a producir sesgo donde el ARN interactúa físicamente con la proteína23,24. En iCLIP, sólo un adaptador se ligaba a la extremidad 3 ' de los fragmentos de ARN reticulado. Después de la transcripción inversa (RT), las cDNAs truncadas y de lectura a través se obtienen mediante la circularización intramolecularmente y la relinearización seguida de la amplificación de la reacción en cadena de la polimerasa (PCR)25,26. Sin embargo, la eficiencia de la circularización intramolecular es relativamente baja. Aunque los protocolos CLIP más antiguos necesitan etiquetar ARN reticulada con un radioisótopo, la reticulación ULTRAVIOLETA y la purificación de afinidad (uvCLAP), con un proceso de purificación de afinidad en tándem estricta, no dependen de la radioactividad27. Sin embargo, uvclap se limita a las células cultivadas que deben ser transfectadas con el vector de expresión que lleva la etiqueta 3x Flag-HBH para la purificación de afinidad en tándem.

En eCLIP, los adaptadores fueron ligados primero en la extremidad 3 ' de ARN seguido por RT, y al lado de la 3 ' extremidad de cDNAs en un modo intermoleculares. Por lo tanto, eCLIP es capaz de capturar todos truncados y leídos-a través de cDNA28. Además, no está restringido al etiquetado radioactivo, ni al uso de líneas celulares basadas en su principio, manteniendo al mismo tiempo la resolución de un solo nucleótido.

Aquí, proporcionamos una descripción paso a paso de un protocolo eCLIP adaptado para los Testis del ratón. Brevemente, este protocolo eCLIP comienza con la reticulación UV de los túbulos testiculares, seguidos por la digestión parcial de la RNase e inmunoprecipitation usando un anticuerpo específico de proteína. A continuación, el ARN ligado a proteínas está desfosforilado, y el adaptador se ligaba a su extremo 3 '. Después de la electroforesis de gel de proteína y la transferencia de gel a membrana, el ARN se aísla cortando el área de la membrana de un rango de tamaño esperado. Después de RT, el adaptador de ADN está ligado al extremo 3 ' de cDNA seguido por la amplificación de PCR. El cribado de subclones antes de la secuenciación de alto rendimiento se toma como un control de calidad de la biblioteca. Este protocolo es eficiente en la identificación de las principales especies de ARN ligado a proteínas de RBP, ejemplificado por los dos ARN que expresan las helicasas MOV10L1 y MOV10.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Todos los experimentos realizados con animales han sido aprobados por el Comité de la Universidad médica de Nanjing. Los ratones masculinos C57BL/6 se mantuvieron bajo condiciones de fotoperiodo controladas y se suministraron con alimentos y agua.

1. recolección de tejido y reticulación UV

  1. Eutanasia 2 ratones adultos con dióxido de carbono (CO2) durante 1-2 min o hasta que la respiración se detenga. A continuación, realice la dislocación cervical en cada ratón.
  2. Cosechar alrededor de 100 mg de testículos de ratones de edad apropiada (un adulto testículos en este estudio) para cada experimento de inmunoprecipitación, y colocar los tejidos en el fosfato de hielo frío amortiguado (PBS).
  3. Retire suavemente la tunica túnica albugínea con un par de pinzas de punta fina.
  4. Añadir 3 mL de PBS helado en un molinillo de tejido y triturar el tejido mediante una fuerza mecánica suave utilizando un mortero de vidrio suelto (tipo A de mortero de vidrio).
    Nota: El propósito de este paso no es para LIZAR las células, pero para separar el tejido. La preservación de la viabilidad celular y la integridad es importante.
  5. Transfiera la suspensión de tejido a un plato de cultivo celular (10 cm de diámetro) y agregue PBS frío al hielo hasta 6 mL.
  6. Agitar la placa rápidamente para que el líquido cubra la parte inferior del plato uniformemente. Si el tejido está molido correctamente, los túbulos seminíferos distribuidos uniformemente serán visibles, mientras que la presencia de grumos de tejido indica que la dispersión del tejido es subóptima.
  7. CrossLink la suspensión tres veces con 400 mJ/cm2 a 254 nm en hielo. Mezcle la suspensión entre cada irradiación.
    Nota: Para cada experimento nuevo, se debe optimizar el reticulación.
  8. Recoger la suspensión en un tubo cónico de 15 mL y Pellet a 1.200 x g durante 5 min a 4 ° c. Retire el sobrenadante, Resuspender el pellet en 1 mL de PBS y luego transfiera la suspensión a un tubo de centrifugación de 1,5 mL. Gire a 4 ° c y 1.000 x g durante 2 min, y extraiga el sobrenadante.
  9. En este punto, proceder inmediatamente con el resto del Protocolo, o congelar los pellets en nitrógeno líquido y almacenar a-80 ° c hasta su uso.

2. abalorios preparación

  1. Añadir 125 μL de proteína a granos magnéticos por muestra (pellet) a un tubo de centrifugación fresca.
    Nota: Use granos magnéticos de proteína G para anticuerpos de ratón.
  2. Coloque el tubo en el imán para separar las perlas de la solución. Después de 10 s, retire el sobrenadante. Lavar las perlas dos veces con 1 mL de tampón de lisis helada.
    Nota: Posterior separación de la proteína una de las perlas magnéticas sigue este paso. La composición del tampón de lisis es de 50 mM Tris-HCl, pH 7,5; 100 mM NaCl; 1% NP-40; 0,1% SDS; 0,5% de desoxicolato de sodio; 1/50 Cóctel de inhibidores de la proteasa sin ácido ethylenediaminetetraacético (EDTA) (Añadir fresco).
  3. Resupend perlas en 100 μL de tampón de lisis en frío con 10 μg de anticuerpo eCLIP. Gire los tubos a temperatura ambiente durante 45 min.
    Nota: La concentración final de anticuerpos para la inmunoprecipitación es de 10 μg/mL. Si se desconoce la concentración de anticuerpos, se debe optimizar la cantidad de anticuerpos.
  4. Lavar las perlas dos veces con 1 mL de tampón de lisis helada.

3. lisis de tejidos y digestión de ARN parcial

  1. Resuspend los gránulos de tejido en 1 mL de tampón de lisis en frío (Añadir 22 μL de Cóctel inhibidor de proteínas libre de 50X (EDTA) y 11 μL de inhibidor de la RNase a 1 mL de tampón de lisis).
    1. Resuspend dos pellets con cruce de rayos UV y dos pellets no reticulada por grupo de experimentos: UV-reticulada-1 pellets para la biblioteca eCLIP (UV-1); UV-reticulante-2 pellets para biblioteca eCLIP (UV-2); no reticulante-1 pellets para la biblioteca eCLIP como un control (no UV); pellets no reticulantes-2 para IP IgG para demostrar la especificidad de los anticuerpos.
      Nota: el control ideal para la biblioteca eCLIP de los testículos de tipo ancho reticulada UV es el de los testículos nocautivos con Crosslinked UV de ratones de la misma camada.
  2. Mantenga las muestras en hielo durante 15 min (para evitar la degradación de la proteína y el ARN).
  3. Sonicar en un sonicador digital a 10% de amplitud durante 5 min, a 30 s on/30 s apagado. Coloque siempre la muestra sobre hielo y limpie la sonda con agua sin nucleasa entre cada muestra.
  4. Añada 4 μL de DNase a cada tubo y mezcle bien. Incubar durante 10 min a 37 ° c, sacudiendo a 1.200 rpm.
  5. Añadir 10 μL de Rnasa diluida I (4 U/μL de RNase I en PBS) y mezclar bien. Incubar durante 5 min a 37 ° c, sacudiendo a 1.200 rpm.
  6. Limpiar el lisado por centrifugación a 15.000 x g durante 20 min (a 4 ° c).
  7. Recoja cuidadosamente el sobrenadante. Dejar 50 μL de lisado y desechar el pellet con él.
  8. Guarde las muestras de entradas como rwb (ejecutar para Western blot) y RRI (se ejecutan para el aislamiento de ARN). Ahorre 20 μL (2%) de muestras UV-1, UV-2, no UV e IgG como insumos para la carga de gel RWB. Ahorre 20 μL (2%) de muestras de UV-1 o UV-2 como insumos para la carga de gel RRI.

4. inmunoprecipitación

  1. Añadir 1 mL del lisado (del paso 3,7) a las perlas (preparado en la sección 2) y rotar las muestras a 4 ° c durante 2 h o durante la noche.
  2. Recoja las perlas con un soporte magnético y deseche el sobrenadante. Lavar las perlas dos veces con 900 μL de tampón de alta sal (Tris-HCl de 50 mM, pH 7,5; 1 M NaCl; 1 mM EDTA; 1% NP-40; 0,1% SDS; 0,5% desoxicolato sódico), y luego lavar las perlas dos veces con 900 μL de tampón de lavado (Tris-HCl de 20 mM, pH 7,5; 10 mM MgCl2; 0,2% Tween-20).
    Nota: Para la muestra IgG, detenga el procedimiento aquí y guárdelo en hielo en el tampón de lavado.
  3. Lavar las perlas una vez con 500 μL de 1 Tampón de desfosforilación (Tris-HCl de 10 mM, pH 7,5; 5 mM MgCl2; 100 mm KCl; 0,02% Triton X-100).

5. desfosforilación del ARN 3 ' finaliza

  1. Recoja las perlas con un soporte magnético y deseche el sobrenadante. Retire el líquido residual con puntas finas de pipetas. Añadir 100 μL de mezcla maestra de desfosforilación (10 μL de tampón de desfosforilación 10x [100 mM Tris-HCl, pH 8,0; 50 mM MgCl2; 1 M KCl; 0,2% Triton X-100; 1 mg/ml de albúmina sérica bovina (BSA)]; 78 μl de agua sin nucleasa; 2 μl de inhibidor de la Rnasa; 2 μl de DNase; 8 μl de al fosfatasa de Kalina) a cada muestra, e incubar durante 15 min a 37 ° c, sacudiendo a 1.200 rpm.
  2. Añadir 300 μL de Polinucleótido quinasa (PNK) Master Mix (60 μL de 5x PNK pH 6,5 buffer [350 mM Tris-HCl, pH 6,5; 50 mM MgCl2]; 223 μl de agua sin nucleasa; 5 μl de inhibidor de la Rnasa; 2 μl de DNasa; 7 μl de enzima PNK; 3 μl de 0,1 M Dithiothreitol) a cada muestra , incubar durante 20 min a 37 ° c, sacudiendo a 1.200 rpm.
  3. Recoja las perlas con un soporte magnético y deseche el sobrenadante. Lave las perlas una vez con 500 μL de tampón de lavado en frío. Luego lave las perlas una vez con 500 μL de tampón frío de alta sal. Repite estos lavados una vez más en este orden.
  4. Lavar las perlas una vez con 500 μL de tampón de lavado en frío y luego dos veces con 300 μL de tampón frío de ligadura 1x (sin Dithiothreitol, 50 mM Tris-HCl, pH 7,5; 10 mM MgCl2).

6. ligadura del adaptador de ARN al ARN 3 ' finaliza

  1. Deseche el sobrenadante y extraiga el líquido residual con puntas finas de pipetas. Añadir 25 μL de mezcla maestra de 3 ' ligadura a cada muestra. Mezclar cuidadosamente mediante pipeteo. Este paso es propenso a producir burbujas.
    Nota: La mezcla maestra de ligadura contiene 3 μL de tampón de ligadura de 10x [500 mM Tris-HCl, pH 7,5; 100 mM MgCl2]; 9 μL de agua sin nucleasa; 0,4 μL de inhibidor de RNase; 0,3 μL de 0,1 M ATP; 0,8 μL de sulfóxido de dimetilo (DMSO); 9 μL de 50% polietilenglicol (PEG) 8000; 2,5 μL de ligasa de ARN [30 U/μL].
  2. Añadir 2,5 μL del adaptador de ARN X1A (tabla 1) y 2,5 μl de adaptador de ARN X1b (tabla 1) a cada muestra. Mezclar cuidadosamente mediante pipeteo o parpadeando, e incubar durante 75 min a 25 ° c, parpadeando para mezclar cada 10 min.
  3. Lave las perlas una vez con 500 μL de tampón de lavado en frío (reanudar la muestra IgG aquí).
  4. Lavar las perlas una vez con 500 μL de tampón frío de alta sal y luego con 500 μL de tampón de lavado en frío. Repite estos lavados una vez más.
  5. Separe magnéticamente las perlas y extraiga el líquido residual con puntas finas de pipetas.
  6. Resuspend las perlas en 100 μL de tampón de lavado en frío (ponga en pausa la muestra de IgG aquí y guárdela en el hielo en el tampón de lavado). Mover 20 μL a nuevos tubos como muestras de RWB. Separe magnéticamente los 80 μL restantes como muestras RRI. Retire el sobrenadante de las muestras de RRI y resuspender las perlas en 20 μL de tampón de lavado.
  7. Añadir 37,5 μL de tampón de la muestra 4X de dodecil sulfato de litio (LDS) y 15 μL de agente reductor de muestra 10x a la muestra IgG. Añadir 7,5 μL de tampón de muestreo de 4x LDS y 3 μL de agente reductor de muestra 10x a las muestras (restantes). (No mezclar por pipeteo). Incubar durante 10 min a 70 ° c, sacudiendo a 1.200 rpm. Enfriar en hielo durante 1 min, y centrifugar a 1.000 x g durante 1 min a 4 ° c.

7. SDS-PAGE y transferencia de membrana

  1. Geles de carga.
    1. Para el gel RRI (4-12% de gel de proteína bis-Tris, 10-Well, 1,5 mm) colocar los tubos sobre un imán y separar la proteína eluada de las perlas. Cargue 30 μL de muestra por pozo. Las muestras se espacian mediante un marcador de tamaño de proteína previamente teñida.
    2. Para el gel RWB (4-12% de gel de proteína bis-Tris, 10-Well, 1,5 mm) colocar los tubos sobre un imán y separar la proteína eluada de las perlas. Cargue 15 μL de muestra por pozo. Guarde las muestras restantes a-20 ° c como copias de seguridad.
  2. Añadir 500 μL de antioxidante a 500 mL de 1x buffer de ejecución SDS. Ejecute a 200 V en 1x búfer de ejecución SDS para 50 min o hasta que el frente de tinte está en la parte inferior.
    Nota: Antioxidante contiene N, N-dimetilformamida, Bisulfito sódico, que migra con proteínas reducidas para prevenir la reoxidación de aminoácidos sensibles como la metionina y el triptófano.
  3. Transfiera los complejos de proteína-ARN del gel a una membrana de nitrocelulosa a 10 V por 70 min en 1xtransfer buffer con 10% de metanol (vol/vol). Enjuague la membrana RRI en PBS frío, envuélvalo en envoltura plástica y almacene a-80 ° c.
  4. Bloquee la membrana RWB en un 5% de leche en TBST a temperatura ambiente durante 1 h. Enjuague la membrana en TBST. Incubar con anticuerpo primario en TBST a 4 ° c durante la noche. Lavar dos veces con TBST durante 5 min. incubar con anticuerpo secundario (1:5000 HRP anti-conejo IgG de cabra) en TBST a temperatura ambiente durante 1 h. lavar tres veces con TBST durante 5 min, 10 min y 15 min, respectivamente.
  5. Mezclar volúmenes iguales de electroquimioluminiscencia (ECL) tampón a y buffer B, añadir a la membrana e incubar durante 1 min. Cubra la membrana con una envoltura plástica y expíndela a una película de rayos X a temperatura ambiente durante 2-3 min. Luego desarrolla la película.
    Nota: La película con sobreexposición mostrará claramente la forma de los bordes de la membrana, por el cual la película se puede alinear de nuevo a la membrana RWB. A continuación, alinee las membranas RWB y RRI en función de las posiciones de los marcadores en él. Las capas en orden de abajo hacia arriba son la película, la membrana RWB y la membrana RRI en secuencia.

8. aislamiento de ARN

  1. Cortar la región de la banda de proteína a 75 kDa (acerca de 220 NT de ARN) por encima de ella, utilizando la membrana y la película RWB como guías.
    Nota: Como una molécula de ARN proteico protegida puede tener una longitud máxima de 225 bases, con alrededor de 340 da por base, es razonable cortar la región alrededor de 75 kDa por encima de la banda RBP para recuperar todos los complejos de proteína-ARN.
  2. Corte la pieza de membrana excisada en varias rebanadas pequeñas, y colóquelo en un tubo de centrifugación de 1,5 mL fresco. Añadir 200 μL de tampón de proteinasa K (PK) (100 mM Tris-HCl pH 7,5; 50 mM NaCl; 10 mM EDTA) con 40 μL de PK a las piezas de membrana. Mezclar e incubar durante 20 min a 37 ° c, sacudiendo a 1.200 rpm.
  3. Añadir 200 μL de tampón de urea PK (100 mM Tris-HCl pH 7,4; 50 mM NaCl; 10 mM EDTA; 7 M urea) a cada muestra. Incubar durante 20 min a 37 ° c, sacudiendo a 1.200 rpm.
  4. Añadir 400 μL de fenol ácido/cloroformo/alcohol isoamílico (25:24:1), mezclar bien e incubar durante 5 min a 37 ° c, sacudiendo a 1.200 rpm.
  5. Coloque el tubo pesado de gel de bloqueo de fase (PLG) de 2 mL en la centrífuga y gire a 15.000 x g durante 25 s.
  6. Transfiera todo el contenido excepto las rodajas de membrana al tubo pesado PLG. Incubar durante 5 min a 37 ° c, sacudiendo a 1.200 rpm.
  7. Gire a temperatura ambiente y 15.000 x g durante 15 min. transfiera la capa acuosa a un nuevo tubo cónico de 15 ml.
  8. Utilice columnas de purificación y concentración de ARN para extraer el ARN.
    1. Añadir 2 volúmenes (800 μL) de búfer de unión de ARN a cada muestra (desde el paso 8,7) y mezclar. Añadir un volumen igual (1200 μL) de etanol al 100% y mezclar.
    2. Transferir 750 μL de muestra (desde el paso 8.8.1) a las columnas de purificación y concentración de ARN en un tubo de recolección y centrifugar a 15.000 x g para el flujo de 30 s. discard.
    3. Repita el paso 8.8.2 hasta que todas las muestras se pasen a través de la columna. Añadir 400 μL de tampón de preparación de ARN a la columna y centrifugar a 15.000 x g para el flujo de 30 s. discard, aplicar 700 μl de tampón de lavado de ARN y centrifugar la columna a 15.000 x g durante 30 s. Deseche el flujo.
    4. Añadir 400 μL de tampón de lavado de ARN a la columna y centrifugar a 15.000 x g durante 2 min. transfiera la columna cuidadosamente a un nuevo tubo de 1,5 ml. Añadir 10 μL de agua sin nucleasa a la matriz de columna, dejar reposar durante 2 min, y centrifugar a 15.000 x g para 30 s. almacene muestras eclip a-80 ° c hasta RT (paso 11,1).

9. desfosforilación del ARN de entrada 3 ' finaliza

  1. Añadir 15 μL de mezcla maestra de desfosforilación (2,5 μL de tampón de desfosforilación 10x [100 mM Tris-HCl, pH 8,0; 50 mM MgCl2; 1 M KCl; 0,2% Triton X-100; 1 mg/ml BSA]; 9,5 μl de agua sin nucleasa; 0,5 μl de inhibidor de la rnasa; 2,5 μl de fosfatasa alcalina) a 10 μl de muestras de entrada (desde el paso 8.8.4). Incubar durante 15 min a 37 ° c, sacudiendo a 1.200 rpm.
  2. Añadir 75 μL de PNK Master Mix (20 μL de 5x PNK PH 6,5 buffer [350 mM Tris-HCl, pH 6,5; 50 mM MgCl2]; 44 μl de agua sin nucleasa; 1 μl de inhibidor de la Rnasa; 2 μl de DNase; 7 μl de enzima PNK; 1 μl de 0,1 M Dithiothreitol) a muestras. Incubar durante 20 min a 37 ° c, sacudiendo a 1.200 rpm.
  3. Limpieza del ARN de entrada
    1. Resuspend ácido thenucleic extracción magnética beadsin el vial (Vortex por más de 30 s). Añadir 20 μL de granos magnéticos de extracción de ácidos nucleicos para cada muestra a nuevos tubos. Recoja las perlas con un soporte magnético y deseche el sobrenadante.
    2. Lave las perlas una vez con 1 mL de tampón de lisis de purificación de ARN (tampón RLT). Coloque el tubo sobre un imán durante 30 s y deseche el sobrenadante.
      Nota: La posterior separación de los granos magnéticos de extracción de ácidos nucleicos siguió este paso.
    3. Resupend cuentas con 300 μL de tampón RLT y añádela a la muestra. Añadir 10 μL de NaCl de 5 M y 615 μL de alcohol etílico al 100% (EtOH) y mezclar mediante pipeteo. Gire a temperatura ambiente durante 15 min. Separe magnéticamente las perlas y quite el sobrenadante.
    4. Resuspend perlas en 1 mL de 75% EtOH y transfiera a un nuevo tubo. Después de 30 s, recoja las perlas con un soporte magnético y deseche el sobrenadante. Lavar dos veces con 75% EtOH, separar magnéticamente las perlas y desechar el líquido residual con puntas finas de pipetas. Secar al aire durante 5 min (evitar el secado excesivo).
    5. Resuspend las perlas con 10 μL de agua sin nucleasa e incubarla durante 5 min. granos magnéticamente separados, y mover 5 μL de sobrenadante a un nuevo tubo (para 3 ' ligadura del adaptador a continuación). El ARN restante se puede almacenar a-80 ° c como copias de seguridad.

10. ligadura del adaptador de ARN al ARN de entrada 3 ' finaliza

  1. Añadir 1,5 μL de DMSO y 0,5 μL de adaptador RiL19 (tabla 1) a 5 ΜL de ARN de entrada (desde el paso 9.3.5), incubar durante 2 min a 65 ° c, y colocar sobre hielo durante más de 1 min. Añadir 13,5 μl de mezcla de 3 ' ligadura maestra a cada muestra , mezclar por pipeteo e incubar durante 75 min a 25 ° c, con parpadeo para mezclar cada 15 min.
    Nota: La mezcla maestra de ligadura contiene 2 μL de tampón de ligadura de 10x [500 mM Tris-HCl, pH 7,5; 100 mM MgCl2; 10 mm Dithiothreitol]; 1,5 μL de agua sin nucleasa; 0,2 μL de inhibidor de la Rnasa; 0,2 μL de 0,1 M ATP; 0,3 μL de DMSO; 8 μL de 50% PEG8000; 1,3 μL de ligasa de ARN [30 U/μL].
  2. Limpieza del ARN de entrada ligado
    1. Separe magnéticamente 20 μL de granos magnéticos de extracción de ácidos nucleicos para cada muestra, y extraiga el sobrenadante. Lave las perlas una vez con 1 mL de tampón RLT.
    2. Resupend perlas en 61,6 μL de tampón de RLT y suspensión de transferencia a cada muestra. Añadir 61,6 μL de 100% EtOH. Utilice la pija para mezclar durante 15 min cada 5 min. granos magnéticamente separados, y quite el sobrenadante.
    3. Repita el paso 9.3.4.
    4. Resuspend perlas con 10 μL de agua sin nucleasa y deje reposar durante 5 min. Separe magnéticamente las perlas y transfiera 10 μL del sobrenadante a un nuevo tubo.
      Nota: Este es un posible punto de parada (las muestras de entrada se pueden almacenar a-80 ° c hasta el día siguiente).

11. transcripción inversa, la ligadura del adaptador de ADN a cDNA 3 ' termina

  1. Añadir 0,5 μL de imprimación RT (tabla 1) a 10 ΜL de ARN de entrada (desde el paso 10.2.4) y 10 ΜL de ARN clip (del paso 8.8.4) respectivamente, incubar durante 2 min en bloque PCR precalentado a 65 ° c, colocar sobre hielo durante más de 1 min.
  2. Añadir 10 μL de RT Master Mix (2 μL de buffer RT [500 mM Tris-HCl, pH 8,3; 750 mM KCl; 30 mM MgCl2]; 4 μL de agua sin nucleasa; 0,3 μl de inhibidor de la rinitis; 2 μl de 0,1 m Dithiothreitol; 0,2 μl de 0,1 m dATP; 0,2 μl de 0,1 m dCTP; 0,2 μl de 0,1 M dGTP; 0,2 μL de 0,1 M dTTP; 0,9 μL de transcriptasa inversa) a cada muestra, mezclar, incubar a 55 ° c para 45 min en un bloque pre-calentado PCR.
  3. Mezclar 20 μL de producto de reacción RT con 3,5 μL de reactivo de limpieza de producto PCR. Incubar durante 15 min a 37 ° c.
  4. Añadir 1 μL de 0,5 M EDTA, mezclar por pipeteo. Añadir 3 μL de NaOH de 1 M, mezclar por pipeteo e incubar durante 12 min a 70 ° c en un bloque PCR para hidrolizar el ARN de la plantilla.
  5. Añadir 3 μL de HCl de 1 M, una mezcla de pipetas para neutralizar el tampón.
  6. Limpieza de cDNA
    1. Separe magnéticamente 10 μL de granos magnéticos de extracción de ácido nucleico para cada muestra, extraiga el sobrenadante. Lavar una vez con 500 μL de tampón de RLT.
    2. Resupend perlas en 93 μL de tampón de RLT y suspensión de transferencia a la muestra. Añadir 111,6 μL de 100% EtOH, incubarlo durante 5 min, y mezclar la pija cada 2 min. Recoja las perlas con un soporte magnético y deseche el sobrenadante. Resuspend perlas con 1 mL de 80% EtOH y muévase a un nuevo tubo.
    3. Después de 30 s, recoja las perlas con un soporte magnético y deseche el sobrenadante. Lavar dos veces con 80% EtOH. Separe magnéticamente y deseche el líquido residual con la punta fina. Secar al aire durante 5 min (evitar el secado excesivo). Resuspend perlas en 5 μL de Tris-HCl de 5 mM e incubarla durante 5 min.
  7. Añadir 0,8 μL de adaptador de ADN (tabla 1) y 1 ΜL de DMSO a las perlas, incubar durante 2 min a 75 ° c. Colocar sobre hielo durante más de 1 min.
  8. Preparar 12,8 μL de mezcla maestra de ligadura (2 μL de tampón de ligadura de 10x [500 mM Tris-HCl; 100 mM MgCl2; 10 mm Dithiothreitol]; 1,1 μl de agua sin nucleasa; 0,2 μl de 0,1 M ATP; 9 μL de 50% PEG8000; 0,5 μl de ligasa de ARN [30 U/μl]) , deslice para mezclar, gire brevemente en una centrífuga y agréguelo a cada muestra, mezcle la muestra con la punta de la piruleta lentamente.
  9. Añadir otros 1 μL de ligasa de ARN [30 U/μL] a cada muestra y deslizar para mezclar. Incubar durante 30 s a 25 ° c, sacudiendo a 1.200 rpm. Incubar a 25 ° c durante la noche. Deslice para mezclar ligeramente de 5 a 6 veces, una vez por hora.
  10. Limpieza de cDNA ligada
    1. Separe magnéticamente 5 μL de granos magnéticos de extracción de ácidos nucleicos para cada muestra, y extraiga el sobrenadante.
    2. Lave una vez con 500 μL de tampón RLT.
    3. Resupend perlas en 60 μL de tampón de RLT a perlas y suspensión de transferencia a cada muestra. Añadir 60 μL de 100% EtOH, incubarlo durante 5 min y mezclar la pija cada 2 min. el sobrenadante de descarte magnéticamente se separa.
    4. Repita el paso 9.3.4.
    5. Resupend cuentas con 27 μL de Tris-HCl de 10 mM, incubarlo durante 5 min. separar magnéticamente, y mover 25 μL de muestra a un nuevo tubo. Diluir los 1 μL de cDNA ligada con 9 μL de agua sin nucleasa en un tubo nuevo. Almacene las muestras restantes a-20 ° c hasta el paso 13,1.

12. cuantificación de cDNA mediante PCR cuantitativa en tiempo real (qPCR)

  1. Añadir 9 μL de mezcla maestra de qPCR (5 μL de 2x mezcla maestra; 3,6 μL de agua sin nucleasa; 0,4 μL de mezcla de imprimación [10 μM PCR-F-D50X y 10 μM PCR-R-D70X]) a una placa de qPCR de 96-well. Añadir 1 μL de 1:10 diluido (en H2O) cDNA (a partir del paso 11.10.5), sellar y mezclar.
  2. Ejecute el programa qPCR en un termociclador: 2 min a 50 ° c; 2 min a 95 ° c; 3 s a 95 ° c seguido de 30 s a 68 ° c para 40 ciclos; 15 s a 95 ° c seguido de 60 s a 68 ° c seguido de 15 s a 95 ° c durante 1 ciclo. Nota valor de CT (umbral de ciclo).

13. amplificación PCR de cDNA

  1. Dispense 35 μL de mezcla maestra de PCR (25 μL de mezcla Master de PCR 2x; 5 μL de agua libre de nucleasas; 5 μL del primer Mix [20 μM PCR-F-D50X y 20 μM PCR-R-D70X]) en tiras de 8 pozo. Para el grupo CLIP, añada 12,5 μL de la muestra de CLIP + 2,5 μL de H2O; para el grupo de insumos, añada 10 μL de entradas + 5 μL de H2O. Mezcle bien y gire brevemente en la centrífuga.
  2. Ejecute el programa de PCR: 30 s a 98 ° c; 15 s a 98 ° c seguido de 30 s a 68 ° c seguidos de 40 s a 72 ° c durante 6 ciclos; 15 s a 98 ° c seguido de 60 s a 72 ° c para N ciclos = (valores de qPCR CT-3)-6; 60 s a 72 ° c; 4 ° c de retención.
    Nota: Es mejor realizar de 1 a 2 ciclos de PCR adicionales para el primer par de CLIPs.

14. purificación de gel

  1. Cargue las muestras en un gel de agarosa de alta resolución al 3%. Dejando 1 pozo vacío entre las muestras, y utilizar una escalera en ambos lados del gel. Ejecutar en 100 V para 75 min en 1x Tris-Borate-EDTA (TBE) buffer.
  2. Bajo la iluminación de luz azul, cortar rodajas de gel 175-350 BP utilizando cuchillas de afeitar frescas para cada muestra. Colóquelo en 15 mL de tubos cónicos.
    1. Pesar la rebanada de gel, y eluyen el gel usando un kit de extracción de gel.
    2. Añadir 6X volúmenes de tampón de disolución de gel para derretir el gel (100 mg gel = 600 μL de tampón de disolución de gel). Disolver el gel a temperatura ambiente. (Agitar para mezclar cada 15 minutos hasta que la rebanada de gel se haya disuelto por completo). Añadir 1 volumen de gel de 100% isopropanol y mezclar bien.
    3. Transferir 750 μL de muestra (desde el paso 14.2.2) a la columna de un tubo de recolección y centrifugar a 17.900 x g durante 1 min.
    4. Repita el paso 14.2.3 hasta que todas las muestras hayan pasado a través de la columna, lave una vez con 500 μL de tampón de disolución de gel.
    5. Añadir 750 μL de tampón de lavado (desde kit de extracción de gel) a la columna y centrifugar a 17.900 x g durante 1 min. Deseche el flujo, gire a 17.900 x g durante 2 min. Coloque la columna en un nuevo tubo de 1,5 ml.
    6. Retire todo el tampón de lavado restante del borde morado de plástico de la columna. Secar al aire durante 2 min. Añadir 12,5 μL de agua sin nucleasa al centro de la membrana. Deje reposar la columna durante 2 min a temperatura ambiente, y gire a 17.900 x g durante 1 min (para un rendimiento mejorado, repita el paso de elución).

15. clon TOPO de producto PCR

  1. Prepare la mezcla de reacción de clonación de TOPO (1 μL de producto PCR del paso 14.2.6; 1 μL de mezcla de clonación; 3 μL de agua estéril). Mezclar suavemente e incubar durante 5 min a 20-37 ° c. Enfriar en hielo.
  2. Descongelar bacterias de E. coli químicamente competentes en el hielo. Añadir 5 μL del producto de clonación TOPO a 100 μL de bacterias competentes29. Mezclar bien suavemente. Incubar sobre hielo durante 30 min.
  3. Calor-choque para 60 s a 42 ° c. A continuación, enfriar en hielo durante 2 min. Añadir 900 μL de medio de caldo de lisogenia (LB), incubar a 37 ° c durante 1 h, sacudiendo a 225 rpm. Gire a 1.000 x g durante 1 min y, a continuación, extraiga 900 μl de sobrenadante. Resuspend el resto de la solución.
  4. Matricula las bacterias transformadas en placas de agar 1,5% LB que contengan ampicilina (100 μg/mL) e incubar durante la noche a 37 ° c.
  5. Prepare al menos 20 tubos de centrifugación de 1,5 mL para cada construcción. Llene un conjunto con 500 μL de medio LB que contenga 100 μg/mL de ampicilina. Utilice una punta de pipetas estéril para arañar una colonia bacteriana al azar y mezclar (pipeteando) con 500 μL de media LB. Incubar a 37 ° c durante 5 h, sacudiendo a 225 rpm.
  6. Secuenciar el fragmento de inserción usando la imprimación inversa M13: CAGGAAACAGCTATGAC por Sanger secuenciación30.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

El procedimiento eclip y los resultados se ilustran en la figura 1, figura 2, figura 3, figura 4. Los ratones fueron eutanizados con dióxido de carbono y se hizo una pequeña incisión en la parte inferior del abdomen usando tijeras quirúrgicas (figura 2A,B). Se eliminaron los testículos del ratón, se detunicated y luego los UV-reticulados después de la molienda (figura 2C-I). Los resultados representativos de eclip del uso de dos helicasas de unión a ARN conocidas en los tejidos testículos se muestran en las figuras 3 y 4. Realizamos MOV10 eCLIP en testículos de ratones de tipo salvaje adulto, con una concentración común de 40 U/mL de RNase que trato el lisado reticulado. El panel superior de la figura 3a muestra que el tamaño de la proteína objetivo alrededor de 114 kDa se enriqueció con éxito. Western blot de las proteínas inmunoprecipitadas MOV10L1 se realizó con dos concentraciones (5 o 40 U/mL) de RNase I durante el proceso eCLIP (figura 3a). La figura 3B muestra qPCR utilizando 1:10 cDNA diluida (ya ligó con adaptador de ADN) de MOV10 y MOV10L1 de UV-reticulado, no reticulada, y la muestra de entrada coincidente de tamaño emparejado (sminput). Las muestras no reticulada muestran una recuperación de ARN disminuida. Observamos que, los valores de CT del grupo no reticulante eran generalmente 5 veces más que el grupo de los rayos UV-reticulante. La figura 4a muestra la amplificación de PCR y la selección de tamaño mediante electroforesis de gel de agarosa (corte 175-350 BP). El producto de primer-dimer aparece en aproximadamente 140 BP. Figura 4B muestra la vista del navegador de genoma UCSC de dos secuencias de subclones representativos. Las etiquetas eCLIP MOV10-Bound se encuentran ubicadas dentro de la 3 ' UTR del gen FTO; La tasa aproximada de 3 ' objetivos UTR representa el 75% (figura 4C), consistente con la mayoría de los objetivos MOV10 en las células HEK29310 y en los testículos (datos no mostrados). Por el contrario, se encuentra que las etiquetas eCLIP enlazadas a MOV10L1 se encuentran dentro de un cluster piRNA indicando que MOV10L1 apunta a precursores piRNA. La tasa aproximada de objetivos de precursor piRNA representa el 42% (Figura 4e), que refleja una tendencia de nuestro experimento anterior convencional clip20. MOV10L1 eCLIP con 40 U/mL de la digestión de la RMI I produce relativamente más secuencias con menos de 20 BP (Figura 4D).

Figure 1
Figura 1 : Representación esquemática de eCLIP. Los túbulos seminiferosos del ratón reticulado UV (paso 1) están lisados en tampón de lisis eCLIP y se sonican (paso 2). El lisado es tratado con RNase I para fragmentar el ARN, después de lo cual los complejos de proteína-ARN son inmunoprecipitados usando el anticuerpo anti-RBP (paso 3-4). Se realiza la desfosforilación de los fragmentos de ARN y la ligadura del adaptador de ARN de 3 ′ (paso 5-6). Los complejos de proteína-ARN se ejecutan en un gel SDS-PAGE y se transfieren a las membranas de nitrocelulosa (paso 7). El ARN se recupera de la membrana mediante la digestión de la proteína con proteinasa K y urea, lo que deja un pequeño polipéptido restante en el sitio de CrossLink. Se realiza la desfosforilación de los fragmentos de ARN de las muestras de entrada y la ligadura del adaptador de ARN de 3 ′ (paso 8). Realizar RT de ARN y ligadura de 3 ′ adaptador de ADN (paso 9-10). Realice la amplificación de PCR de la biblioteca de cDNA, extracción de gel y clonación de PCR de extremo romo para el control de calidad preliminar de la biblioteca (paso 11). Finalmente, realice una secuenciación de alto rendimiento (paso 12). Por favor, haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2 : Extracción de tejido Testis y reticulación UV. (A) la exposición del abdomen del ratón. (B) una incisión de 0,5 cm en la pared abdominal exponiendo el peritoneo. (C) se saca un par de testículos tirando de las almohadillas de grasa. (D) el tejido testicular se retira y se coloca en un plato pequeño que contiene PBS helada. (E) quite suavemente la tunica albuginea. (F) Presione el mortero suelto para triturar el tejido en un Dounce de amoladora de tejido. (G) los túbulos seminíferos distribuidos en una placa de 10 cm. (H) reticulación UV con 400 MJ/cm2 de energía. (I) las muestras reticuladas se recogen en tubos centrífugas de 1,5 ml. Por favor, haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3 : Resultados representativos de MOV10 y MOV10L1 eCLIP. (A) la validación de Western blot de MOV10 y MOV10L1 immunoprecipitates. (B) qPCR en 1:10 bibliotecas eclip diluidas de MOV10 y MOV10L1, con réplicas para UV, no UV y las muestras SMInput emparejadas. Por favor, haga clic aquí para ver una versión más grande de esta figura.

Figure 4
Figura 4 : preparación de la biblioteca eclip y evaluación de calidad. (A) se muestran las imágenes de gel de amplificación de PCR. El asterisco indica el dímero de imprimación. La línea de puntos rojos indica regiones excizadas para el producto de PCR de cDNA, en algún lugar entre 175 y 350 BP. (B) vista del navegador UCSC Genome de dos secuencias de subclones representativos31. (C) análisis de secuenciación de subclones a pequeña escala de MOV10. (D) las etiquetas enlazadas a MOV10L1 muestran patrones de distribución de longitud distintos cuando se procesan mediante dos concentraciones de RNase diferentes. (E) análisis de secuenciación de subclones a pequeña escala de MOV10L1. Por favor, haga clic aquí para ver una versión más grande de esta figura.

Nombre de secuencia Información de secuencia Descripción
Adaptadores de ARN
RNA X1A /5Phos/AUAUAGGNNNNNAGAUCGGAAGAGCGUCGUGUAG/3SpC3/ stock a 200 μM; trabajando a 20 μM
RNA X1B /5Phos/AAUAGCANNNNNAGAUCGGAAGAGCGUCGUGUAG/3SpC3/ stock a 200 μM; trabajando a 20 μM
RiL19 /5phos/AGAUCGGAAGAGCGUCGUG/3SpC3/ stock a 200 μM; trabajando a 40 μM
Adaptador de ADN
Rand103tr3 /5Phos/NNNNNNNNNNAGATCGGAAGAGCACACGTCTG/3SpC3/ stock a 200 μM; trabajando a 80 μM
La imprimación RT
AR17 ACACGACGCTCTTCCGA stock a 200 μM; trabajando a 20 μM
Cebadores de PCR

PCR-F-D 501
AATGATACGGCGACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACGACGCTCTTCCGATCT stock a 100 μM; trabajando a 20 μM
PCR-R-D 701 CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC stock a 100 μM; trabajando a 20 μM
(Consulte la carta de servicio al cliente de Illumina para D502-508, D702-712)

Tabla 1: secuencias de adaptador y imprimación. El adaptador contiene un Mer aleatorio en línea (ya sea N5 o N10) para determinar si dos lecturas secuenciadas idénticas indican dos fragmentos de ARN únicos o duplicados de PCR del mismo fragmento de ARN. "5 Phos" significa 5 ' fosforilación, que se necesita si se utiliza un oligo como sustrato para la ligasa de ADN/ARN. "3SpC3" significa un espaciador 3 ' C3, que puede evitar la ligadura entre los adaptadores.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Con el aumento de la comprensión del papel universal de la RBP en contextos biológicos y patológicos, los métodos de clip han sido ampliamente utilizados para revelar la función molecular de RBPs20,32,33, 34,35. El protocolo descrito aquí representa una aplicación adaptada del método eCLIP a los Testis del ratón.

Un desafío en la realización de eclip en los testículos es mantener la viabilidad y la integridad de las células testiculares frescas, que también es importante para la reticulación eficaz. La cización de los testículos con una fuerza mecánica leve usando el mortero suelto puede prevenir la lisis de la célula32,36. La digestión adecuada del ARN también es fundamental para los ensayos exitosos de eCLIP. Los fragmentos de ARN podrían ser más convergentes después de la digestión, pero la longitud inferior a 20 BP se puede eliminar mediante el procesamiento previo de las lecturas de la biblioteca. Con el fin de adoptar una dosis ideal de RNase para un candidato de RBP, sugerimos una prueba preliminar basada en los resultados de la secuenciación de subclones de bibliotecas eCLIP que pueden ser preparadas por el tratamiento de RNase con concentraciones que van desde 0 usted a 40 U (por mililitro de lisado). El análisis de secuenciación de subclones a pequeña escala es un paso recomendado para un examen fiable de la calidad de la biblioteca en nuestro método eCLIP. En primer lugar, el porcentaje de inserciones inferiores a 20 BP no debe ser demasiado alto, o el posterior procesamiento previo de la biblioteca eCLIP causará una costosa pérdida de lecturas. En segundo lugar, debe comprobarse la eficacia de la ligadura correcta de ambos adaptadores. Las muestras subestándar se pueden eliminar sin secuenciación profunda para garantizar una secuenciación profunda exitosa, los resultados de los cuales generalmente tardan mucho más en analizarse.

Aunque la viabilidad de eCLIP en los testículos del ratón todavía está limitada por la especificidad del anticuerpo para el paso de la inmunoprecipitación, eCLIP es ventajoso sobre los métodos convencionales de CLIP en varios aspectos. En primer lugar, es un método no radioactivo. Por eCLIP, los objetivos de ARN de RBPs se capturan directamente in vivo sin tener que recurrir a técnicas intensivas en mano de obra utilizando materiales radiactivos. En segundo lugar, el método consume menos tiempo. Todo el procedimiento tarda solo 4 días a través de la preparación de la biblioteca eCLIP. Tercero, diversidad de secuencias. Comparado con el ciclo de amplificación unificado convencional de 25-35 ciclos, eclip se refiere a los valores de CT de qPCR para establecer el número de ciclos de PCR específicamente. Por último, proporciona una relación señal-ruido más fuerte. La entrada de tamaño coincidente sirve como un fondo adecuado para los objetivos auténticos.

En Resumen, nuestros resultados eCLIP consolidan las conclusiones de que MOV10 y MOV10L1 tienen una preferencia vinculante para los precursores de mRNA 3 ' UTR y piRNA, respectivamente. El protocolo que Describimos aquí representa el primer empleo del método eCLIP en la reproducción, un área en la que el conocimiento de interacción RNA-RBP es bastante insuficiente, aunque los estudios genéticos han proporcionado una amplia información sobre los roles biológicos de RBPs. la visualización de este protocolo eCLIP puede ayudar a guiar sus aplicaciones generalizadas en áreas más amplias.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

Agradecemos a Eric L Van Nostrand y gene W Yeo por su guía útil con el protocolo original. K.Z. fue apoyado por el programa nacional de la clave R & D de China (2016YFA0500902, 2018YFC1003500), y la Fundación Nacional de Ciencias naturales de China (31771653). L.Y. fue apoyado por la Fundación Nacional de Ciencias naturales de China (81471502, 31871503) y el programa innovador y emprendedor de la provincia de Jiangsu.

Materials

Name Company Catalog Number Comments
Antibodies
Anti-mouse MOV10  antibody Proteintech, China 10370-1-AP
Anti-mouse MOV10L1 antibody Zheng et al.20109 polyclonal antisera UP2175 provided by P. Jeremy Wang lab, University of Pennsylvania
HRP Goat Anti-Rabbit IgG  ABclonal AS014
Rabbit IgG Beyotime, China A7016
Equipment
Centrifuge Eppendorf, Hamburg, Germany 5242R
Digital sonifier BRANSON,USA BBV12081048A 450 Watts; 50/60 Hz
DynaMag-2 Magnet Invitrogen,USA 12321D
Mini Blot Module Invitrogen,USA B1000
Mini Gel Tank Invitrogen,USA A25977
Shaking incubator Eppendorf, Hamburg, Germany Thermomixer comfort 
Tissue Grinder, Dounce PYREX, USA 1234F35 only  the "loose" pestle is used in this protocol
TProfessional standard 96 Gradient Biometra, Germany serial no.: 2604323
Tube Revolver  Crystal, USA serial no.: 3406051
UV-light cross-linker UVP, USA CL-1000
Materials
TC-treated Culture Dish Corning, USA 430167 100 mm 
Tubes Corning, USA 430791 15 mL
Microtubes tubes AXYGEN , USA MCT-150-C 1.5 mL 
Reagents 
Acid phenol/chloroform/isoamyl alcohol  Solarbio, China P1011 25:24:01
AffinityScript Enzyme Agilent, USA 600107
Antioxidant Invitrogen,USA NP0005
DH5α competent bacteria Thermo Scientific, USA 18265017 these economical cells yield >1 x 106 transformants/µg control DNA per 50 µL reaction.
DMSO Sigma-Aldrich, USA D8418
DNA Ladder Invitrogen, USA 10416014
dNTP Sigma-Aldrich, USA DNTP100-1KT
Dynabeads Protein A  Invitrogen, USA 10002D
ECL reagent Vazyme, China E411-04
EDTA Invitrogen, USA AM9260G
EDTA free protease inhibitor cocktail Roche, USA 04693132001 add fresh
Exo-SAP-IT Affymetrix, USA 78201 PCR Product Cleanup Reagent 
FastAP enzyme Thermo Scientific, USA EF0652
LDS Sample Buffer Thermo Scientific, USA NP0007
MetaPhor Agarose  lonza, Switzerland 50180
MgCl2 Invitrogen, USA AM9530G
MiniElute gel Extraction QIAGEN, Germany 28604 column store at 4 ?; buffer QG=gel dissolving buffer; buffer PE= wash buffer(for step 14)
MyONE Silane beads Thermo Scientific, USA 37002D nucleic acids extraction magnetic beads
NaCl Invitrogen,USA AM9759
 
NP-40 Amresco, USA M158-500ML
NuPAGE Bis-Tris Protein Gels Invitrogen, USA NP0336BOX 4%–12%,1.5 mm, 15-well
NuPAGE MOPS SDS Buffer Kit  Invitrogen, USA NP0050
PBS Gibco, USA 10010023
Phase-Locked Gel (PLG) heavy tube   TIANGEN, China WM5-2302831
PowerUp SYBR Green Master Mix Applied Biosystems, USA A25742
Proteinase K NEB, New England  P8107S
Q5 PCR master mix  NEB, New England  M0492L
RLT buffer QIAGEN, Germany 79216 RNA purification lysis buffer 
RNA Clean & Concentrator-5 columns  ZYMO RESEARCH, USA R1016 RNA purification and concentration columns
RNase I  Invitrogen, USA AM2295
RNase Inhibitor Promega, USA N251B
RQ1 DNase Promega,USA M610A
Sample Reducing Agent Invitrogen,USA NP0009
SDS Solution Invitrogen, USA 15553027 10%
Sodium deoxycholate Sigma-Aldrich, USA 30970 protect from light
T4 PNK enzyme NEB, New England  M0201L
T4 RNA ligase 1 high conc NEB, New England  M0437M
TA/Blunt-Zero Cloning Mix Vazyme, China C601-01
TBE Invitrogen,USA AM9863
Tris-HCI Buffer Invitrogen, USA 15567027
Triton X-100 Sangon Biotech, China A600198 
Tween-20 Sangon Biotech, China A600560
Urea Sigma-Aldrich, USA U5378
X-ray Films Caresteam, Canada 6535876

DOWNLOAD MATERIALS LIST

References

  1. Turner, J. M., Mahadevaiah, S. K., Ellis, P. J., Mitchell, M. J., Burgoyne, P. S. Pachytene asynapsis drives meiotic sex chromosome inactivation and leads to substantial postmeiotic repression in spermatids. Developmental Cell. 10, (4), 521-529 (2006).
  2. Turner, J. M. A. Meiotic sex chromosome inactivation. Development. 134, (10), 1823-1831 (2007).
  3. Kimmins, S., Sassone-Corsi, P. Chromatin remodelling and epigenetic features of germ cells. Nature. 434, (7033), 583-589 (2005).
  4. Ule, J., et al. CLIP identifies Nova-regulated RNA networks in the brain. Science. 302, (5648), 1212-1215 (2003).
  5. Ule, J., Jensen, K., Mele, A., Darnell, R. B. CLIP: a method for identifying protein-RNA interaction sites in living cells. Methods. 37, (4), 376-386 (2005).
  6. Trifillis, P., Day, N., Kiledjian, M. Finding the right RNA: identification of cellular mRNA substrates for RNA-binding proteins. RNA. 5, (8), 1071-1082 (1999).
  7. Tenenbaum, S. A., Carson, C. C., Lager, P. J., Keene, J. D. Identifying mRNA subsets in messenger ribonucleoprotein complexes by using cDNA arrays. Proceedings of National Acadamy of Sciences U S A. 97, (26), 14085-14090 (2000).
  8. Chi, S. W., Zang, J. B., Mele, A., Darnell, R. B. Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 460, (7254), 479-486 (2009).
  9. Zheng, K., et al. Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway. Proceedings of National Acadamy of Sciences U S A. 107, (26), 11841-11846 (2010).
  10. Gregersen, L. H., et al. MOV10 Is a 5' to 3' RNA helicase contributing to UPF1 mRNA target degradation by translocation along 3' UTRs. Molecular Cell. 54, (4), 573-585 (2014).
  11. Banerjee, S., Neveu, P., Kosik, K. S. A coordinated local translational control point at the synapse involving relief from silencing and MOV10 degradation. Neuron. 64, (6), 871-884 (2009).
  12. Choi, J., Hwang, S. Y., Ahn, K. Interplay between RNASEH2 and MOV10 controls LINE-1 retrotransposition. Nucleic Acids Research. 46, (4), 1912-1926 (2018).
  13. Goodier, J. L., Cheung, L. E., Kazazian, H. H. Jr MOV10 RNA helicase is a potent inhibitor of retrotransposition in cells. PLoS Genetics. 8, (10), e1002941 (2012).
  14. Haussecker, D., et al. Capped small RNAs and MOV10 in human hepatitis delta virus replication. Nature Structural & Molecular Biology. 15, (7), 714-721 (2008).
  15. Kenny, P. J., et al. MOV10 and FMRP regulate AGO2 association with microRNA recognition elements. Cell Reports. 9, (5), 1729-1741 (2014).
  16. Messaoudi-Aubert, S. E., et al. Role for the MOV10 RNA helicase in Polycomb-mediated repression of the INK4a tumor suppressor. Nature Structural & Molecular Biology. 17, (7), 862-868 (2010).
  17. Sievers, C., Schlumpf, T., Sawarkar, R., Comoglio, F., Paro, R. Mixture models and wavelet transforms reveal high confidence RNA-protein interaction sites in MOV10 PAR-CLIP data. Nucleic Acids Research. 40, (20), e160 (2012).
  18. Skariah, G., et al. Mov10 suppresses retroelements and regulates neuronal development and function in the developing brain. BMC Biology. 15, (1), 54 (2017).
  19. Zheng, K., Wang, P. J. Blockade of pachytene piRNA biogenesis reveals a novel requirement for maintaining post-meiotic germline genome integrity. PLoS Genetics. 8, (11), e1003038 (2012).
  20. Vourekas, A., et al. The RNA helicase MOV10L1 binds piRNA precursors to initiate piRNA processing. Genes & Development. 29, (6), 617-629 (2015).
  21. Hocq, R., Paternina, J., Alasseur, Q., Genovesio, A., Le Hir, H. Monitored eCLIP: high accuracy mapping of RNA-protein interactions. Nucleic Acids Research. 46, (21), 11553-11565 (2018).
  22. Huppertz, I., et al. iCLIP: protein-RNA interactions at nucleotide resolution. Methods. 65, (3), 274-287 (2014).
  23. Hafner, M., et al. Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 141, (1), 129-141 (2010).
  24. Hafner, M., et al. PAR-CliP--a method to identify transcriptome-wide the binding sites of RNA binding proteins. Journal of Visualized Experiments. (41), (2010).
  25. Konig, J., et al. iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nature Structural & Molecular Biology. 17, (7), 909-915 (2010).
  26. Konig, J., et al. iCLIP--transcriptome-wide mapping of protein-RNA interactions with individual nucleotide resolution. Journal of Visualized Experiments. (50), (2011).
  27. Maticzka, D., Ilik, I. A., Aktas, T., Backofen, R., Akhtar, A. uvCLAP is a fast and non-radioactive method to identify in vivo targets of RNA-binding proteins. Nature Communications. 9, (1), 1142 (2018).
  28. Van Nostrand, E. L., et al. Robust transcriptome-wide discovery of RNA-binding protein binding sites with enhanced CLIP (eCLIP). Nature Methods. 13, (6), 508-514 (2016).
  29. Radulovich, N., Leung, L., Tsao, M. S. Modified gateway system for double shRNA expression and Cre/lox based gene expression. BMC Biotechnology. 11, 24 (2011).
  30. Breunig, C. T., et al. A Customizable Protocol for String Assembly gRNA Cloning (STAgR). Journal of Visualized Experiments. (142), (2018).
  31. Kuhn, R. M., Haussler, D., Kent, W. J. The UCSC genome browser and associated tools. Briefings in Bioinformatics. 14, (2), 144-161 (2013).
  32. Vourekas, A., et al. Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis. Nature Structural & Molecular Biology. 19, (8), 773-781 (2012).
  33. Preitner, N., et al. APC is an RNA-binding protein, and its interactome provides a link to neural development and microtubule assembly. Cell. 158, (2), 368-382 (2014).
  34. Meyer, C., et al. The TIA1 RNA-Binding Protein Family Regulates EIF2AK2-Mediated Stress Response and Cell Cycle Progression. Molecular Cell. 69, (4), 622-635 (2018).
  35. Gerstberger, S., Hafner, M., Tuschl, T. A census of human RNA-binding proteins. Nature Reviews Genetics. 15, (12), 829-845 (2014).
  36. Vourekas, A., Mourelatos, Z. HITS-CLIP (CLIP-Seq) for mouse Piwi proteins. Methods in Molecular Biology. 1093, 73-95 (2014).
Método de inmunoprecipitación de reticulado mejorado (eCLIP) para la identificación eficiente de ARN ligado a proteínas en Testis del ratón
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Xu, Q., Wang, C., Ling, L., Yue, Q., Liu, M., Zhang, S., Fu, K., Ye, L., Zheng, K. Enhanced Crosslinking Immunoprecipitation (eCLIP) Method for Efficient Identification of Protein-bound RNA in Mouse Testis. J. Vis. Exp. (147), e59681, doi:10.3791/59681 (2019).More

Xu, Q., Wang, C., Ling, L., Yue, Q., Liu, M., Zhang, S., Fu, K., Ye, L., Zheng, K. Enhanced Crosslinking Immunoprecipitation (eCLIP) Method for Efficient Identification of Protein-bound RNA in Mouse Testis. J. Vis. Exp. (147), e59681, doi:10.3791/59681 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter