Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Förbättrad crosslinking Immunutfällning (eCLIP) metod för effektiv identifiering av protein-bundet RNA i mus testis

doi: 10.3791/59681 Published: May 10, 2019
* These authors contributed equally

Summary

Här presenterar vi ett eCLIP-protokoll för att fastställa viktiga RNA-mål för RBP-kandidater i testis.

Abstract

Spermatogenes definierar en högt beställd process av manlig köns cell differentiering hos däggdjur. I testis, transkription och översättning är okopplade, understryker vikten av post-transkriptionell reglering av gen uttryck iscensatt av RBPs. För att belysa mekanistiska roller i en RBP, crosslinking immunutfällning (CLIP) metodik kan användas för att fånga dess endogena direkt RNA mål och definiera de faktiska interaktions platser. Den förstärkta CLIP (eCLIP) är en nyutvecklad metod som erbjuder flera fördelar jämfört med konventionella CLIPs. Dock har användningen av eCLIP hittills begränsats till cellinjer, vilket kräver utökade tillämpningar. Här använde vi eCLIP för att studera MOV10 och MOV10L1, två kända RNA-bindande helicases, i mus testis. Som väntat, finner vi att MOV10 huvudsakligen binder till 3 "oöversatta regioner (UTRs) av mRNA och MOV10L1 selektivt binder till piwi-interagerande RNA (piRNA) föregångare transkriptioner. Vår eCLIP metod tillåter snabb bestämning av stora RNA arter bundna av olika RBPs via småskalig sekvensering av subkloner och därmed till gång till kvalificerade bibliotek, som en teckningsoption för att fortsätta med djup sekvensering. I denna studie fastställs en tillämplig grund för eCLIP i testis i däggdjurs celler.

Introduction

Däggdjurs testiklarna representerar en utmärkt utvecklings modell där en intrikata cell differentiering program löper cykliskt att ge många spermatozoa. Ett unikt värde av denna modell ligger i uppkomsten av transkriptionell inaktive ring vid vissa stadier av spermatogenes, typiskt när meiotiska kön kromosom inaktive ring (MSCI) inträffar1,2 och när runda spermatider genomgå drastiska nukleär packning under spermiogenesis3. Dessa inpå varandra följande transkriptionella händelser nödvändiggör post-transkriptionell gen reglering, där RNA-bindande proteiner (RBPs) spelar en avgörande roll, forma transkriptome och bibehålla manlig fertilitet.

För att identifiera de bona fide RNA-målen för en individuell RBP in vivo, den crosslinking immunutfällning (Clip)-metoden utvecklades4,5, baserat på men bortom den vanliga RNA immunonederbörden (RIP)6,7 , genom införlivande av viktiga steg inklusive ultraviolett (UV) crosslinking, stränga tvätta och gel överföring för att förbättra signalspecificitet. Den avancerade tillämpningen av CLIP kombinerat med hög genom strömning sekvensering har provocerat stort intresse för profilering av protein-RNA interaktion på genomtäckande nivåer8. Förutom genetiska studier av RBP-funktion har sådana biokemiska metoder som identifierar det direkta samspelet mellan endogent protein och RNA varit oumbärliga för att exakt belysa RNA-regulatoriska roller i RBPs. Till exempel, MOV10L1 är en testis-specifika RNA helicase krävs för manlig fertilitet och piwi-interagerande RNA (Pirna) biogenes9. Dess paralogue MOV10 är känd som en ubiquitously uttryckt och multifunktionella RNA helicase med roller i flera aspekter av RNA biologi10,11,12,13,14 , 15 , 16 för att , 17 i den , 18. genom att använda den konventionella Clip-SEQ fann vi att MOV10L1 binder och reglerar primära Pirna prekursorer för att initiera tidig Pirna bearbetning19,20, och att MOV10 binder mRNA 3 ' utrs och liksom icke-kodning RNA arter i testikelköns celler (data visas inte).

Ändå är CLIP ursprungligen ett mödosamt, radioaktivt förfarande följt av sekvensering bibliotek förberedelse med en anmärknings värd förlust av CLIP Taggar. I den konventionella Clip, ett cDNA-bibliotek förbereds med adaptrar liga turer på båda RNA extremiteter. Efter protein nedbrytning förblir tvär bundna korta polypeptider knutna till RNA-fragment. Detta crosslinking mark delvis blockerar omvänd transkriptase (rtase) progression under cDNA syntes, vilket resulterar i trunkerade cdnas som representerar cirka 80% av cDNA-biblioteket21,22. Sålunda, bara cDNA fragment resulterande från RTase förbifartsleden den crosslinking tomt (läsa-igenom) är sekvenserade. På senare tid har olika CLIP-metoder, som PAR-CLIP, iCLIP, eCLIP och uvCLAP, använts för att identifiera tvär bindnings platser för RBPs i levande celler. PAR-CLIP innebär tillämpning av 365 nm UV-strålning och photoactivatable nukleotid analoger och är därför exklusivt för in-odling av levande celler, och inkorporering av nukleosidanaloger till nyligen syntetiserade utskrifter är benägna att producera bias där RNA fysiskt interagerar med protein23,24. I iclip, endast en enda adapter är liga turer till 3 ' extremiteterna av tvär bunden RNA fragment. Efter Omvänd transkription (RT), både trunkerad och genomläsning cdnas erhålls genom intramoleculärt cirkularization och re-linearization följt av polymeras kedje reaktion (PCR) amplifiering25,26. Emellertid, effektiviteten i Intramolekylär cirkularisering är relativt låg. Även äldre CLIP-protokoll behöver märkning av tvär bunden RNA med en radio isotop, ultraviolett tvär bindning och affinitet rening (uvCLAP), med en process av stränga tandem affinitet rening, inte förlita sig på radio aktivitet27. Icke desto mindre, uvclap är begränsad till odlade celler som måste transfekterade med uttrycket vektor bär 3x Flag-HBH tagg för tandem affinitet rening.

I eclip, var adaptrar liga turer först vid 3 ' extremiteterna av RNA följt av RT, och nästa vid 3 ' extremiteten av cdnas i ett intermolekylärt läge. Sålunda, eCLIP är köpa duktig ta till fånga all stympat och läsa-igenom cDNA28. Dessutom är det varken begränsat till radioaktivt märkning, eller att använda cellinjer baserat på dess princip, samtidigt som en enda-nukleotid upplösning.

Här ger vi en steg-för-steg-beskrivning av ett eCLIP-protokoll anpassat för mus testis. Kortfattat, detta eCLIP protokollet börjar med UV-crosslinking av testikeltubuli, följt av partiell RNase mat smältning och immunonederbörd med hjälp av en proteinspecifik anti kropp. Nästa, proteinet-bundet RNA är defosforylated, och adaptern är liga turer till dess 3 '. Efter protein gel elektrofores och gel-till-membran överföring, RNA isoleras genom att skära membranet området i en förväntad storleks intervall. Efter RT, DNA-adapter är liga turer till 3 ' slutet av cDNA följt av PCR amplifiering. Screening av subkloner före hög genom strömning sekvensering tas som ett bibliotek kvalitets kontroll. Detta protokoll är effektivt på att identifiera viktiga arter av protein-bundet RNA av RBPs, exemplifieras av de två testis-uttrycker RNA Helikas MOV10L1 och MOV10.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alla utförda djur försök har godkänts av Nanjing Medical University kommitté. Manliga C57BL/6 möss hölls under kontrollerade foto period förhållanden och levererades med mat och vatten.

1. vävnads skörd och UV-crosslinking

  1. Euthanize 2 vuxna möss som använder koldioxid (CO2) för 1-2 min eller tills andningen avbryts. Därefter utför cervikal störningen på varje mus.
  2. Skörd ca 100 mg av testiklarna från möss i lämplig ålder (en vuxen vittnar i denna studie) för varje immunprecipitationexperiment, och placera vävnaderna i iskalla fosfatbuffrad saltlösning (PBS).
  3. Ta bort Tunica albuginea försiktigt med ett par fintippade pincetter.
  4. Tillsätt 3 mL iskaffe PBS i en vävnadsslip och triturate vävnaden med mild mekanisk kraft med hjälp av en lös glas mortelstöt (typ A glas mortelstöt).
    Anmärkning: Syftet med detta steg är inte att lysera celler, men att dra isär vävnaden. Bevarandet av cellernas livs kraft och integritet är viktigt.
  5. Överför vävnads SUS pensionen till en cell kultur mat rätt (10 cm i diameter) och tillsätt iskalla PBS upp till 6 mL.
  6. Skaka plattan snabbt så att vätskan täcker botten av skålen jämnt. Om vävnaden mals ordentligt, kommer jämnt fördelade sädeskanaler att synas, medan förekomsten av vävnads klumpar indikerar att vävnads spridningen är suboptimal.
  7. Crosslink SUS pensionen tre gånger med 400 mJ/cm2 vid 254 nm på is. Blanda SUS pensionen mellan varje bestrålning.
    Anmärkning: Crosslinking bör optimeras för varje nytt experiment.
  8. Samla upp SUS pensionen i en 15 mL konisk tub och pellet vid 1 200 x g i 5 min vid 4 ° c. Avlägsna supernatanten, omsuspendera pelleten i 1 mL PBS och överför sedan SUS pensionen till ett 1,5 mL centrifugerör. Snurra vid 4 ° c och 1 000 x g i 2 min, och ta bort supernatanten.
  9. Vid denna punkt, omedelbart fortsätta med resten av protokollet, eller Snap frysa pellets i flytande kväve och förvara vid-80 ° c tills användning.

2. pärlor beredning

  1. Tillsätt 125 μL protein A magnetiska pärlor per prov (pellet) till ett friskt centrifugerör.
    Anmärkning: Använd magnet kulor av protein G för mus anti kroppar.
  2. Placera röret på magneten för att separera pärlorna från lösningen. Efter 10 s, ta bort supernatanten. Tvätta pärlor två gånger med 1 mL iskalla lyseringsbuffert.
    Anmärkning: Efterföljande separation av protein en magnetisk pärlor följer detta steg. Lyseringsbuffertsammansättningen är 50 mM Tris-HCl, pH 7,5; 100 mM NaCl; 1% NP-40; 0,1% SDS; 0,5% natriumdeoxycholat; 1/50 etylendiamintetraättiksyra (EDTA)-fri proteashämmare cocktail (tillsätt färsk).
  3. Omsuspendera pärlor i 100 μL kalllyseringsbuffert med 10 μg eCLIP-antikropp. Rotera rören i rums temperatur för 45 min.
    Anmärkning: Den slutliga anti kropps koncentrationen för immunnederbörden är 10 μg/mL. Om anti kropps koncentrationen är okänd ska mängden anti kroppar optimeras.
  4. Tvätta pärlor två gånger med 1 mL iskalla lyseringsbuffert.

3. vävnads lys och partiell RNA-nedbrytning

  1. Omsuspendera vävnads pellets i 1 mL kalllyseringsbuffert (tillsätt 22 μL 50x (EDTA)-fri protein inhibitor cocktail och 11 μL RNase-hämmare till 1 mL lyseringsbuffert).
    1. Omsuspendera två UV-crosslinked pellets och två icke-crosslinked pellets per grupp av experiment: UV-crosslinked-1 pellets för eCLIP Library (UV-1); UV-crosslinked-2 pellets för eCLIP bibliotek (UV-2); icke-crosslinked-1 pellets för eCLIP bibliotek som en kontroll (icke-UV); icke-crosslinked-2 pellets för IgG-IP för att påvisa specificiteten hos anti kroppar.
      Anmärkning: den idealiska kontrollen för eCLIP biblioteket av UV-crosslinked bred-typ testiklarna är att den UV-crosslinked knockout testiklarna från möss i samma kull.
  2. Håll lyseringslösning proverna på is i 15 min (för att förhindra nedbrytning av protein och RNA).
  3. Sonikera i en digital sonikator på 10% amplitud för 5 min, vid 30 s på/30 s off. Placera alltid provet på is och rengör sonden med nukleasfritt vatten mellan varje prov.
  4. Tillsätt 4 μL DNase till varje tub och blanda väl. Inkubera i 10 min vid 37 ° c, skaka vid 1 200 RPM.
  5. Tillsätt 10 μL utspätt RNase i (4 U/μL RNase i i PBS) och blanda väl. Inkubera i 5 min vid 37 ° c, skaka vid 1 200 RPM.
  6. Rensa lysatet genom centrifugering vid 15 000 x g i 20 min (vid 4 ° c).
  7. Samla försiktigt supernatanten. Lämna 50 μL lysat och kassera pelleten med den.
  8. Spara ingångar prover som RWB (kör för Western blot) och RRI (kör för RNA-isolering). Spara 20 μL (2%) av UV-1, UV-2, icke-UV-och IgG-prover som ingångar för RWB gel lastning. Spara 20 μL (2%) UV-1-eller UV-2-prover som ingångar för RRI-gellastning.

4. immunutfällning

  1. Tillsätt 1 mL av lysatet (från steg 3,7) till pärlorna (preparerade i avsnitt 2) och rotera proverna vid 4 ° c i 2 timmar eller över natten.
  2. Samla pärlor med ett magnetiskt stativ och Kassera supernatanten. Tvätta pärlorna två gånger med 900 μL hög saltbuffert (50 mM Tris-HCl, pH-värde 7,5; 1 M NaCl; 1 mM EDTA; 1% NP-40; 0,1% SDS; 0,5% natriumdeoxycholat) och tvätta sedan pärlor två gånger med 900 μL tvättbuffert (20 mM Tris-HCl, pH 7,5; 10 mM MgCl2; 0,2% Tween-20).
    Anmärkning: För IgG-provet, pausa proceduren här och förvara på isen i tvättbuffert.
  3. Tvätta pärlor en gång med 500 μL 1x defosforylationbuffert (10 mM Tris-HCl, pH 7,5; 5 mM MgCl2; 100 mm KCl; 0,02% Triton X-100).

5. defosforylering av RNA 3 ' ändar

  1. Samla pärlor med ett magnetiskt stativ och Kassera supernatanten. Avlägsna kvarvarande vätska med hjälp av fina pipettspetsar. Tillsätt 100 μL defosforylering Master Mix (10 μL 10x defosforyleringsbuffert [100 mM Tris-HCl, pH 8,0; 50 mM MgCl2; 1 M kcl; 0,2% Triton X-100; 1 mg/ml bovint serumalbumin (BSA)]; 78 μl nukleasfritt vatten; 2 μl RNase-hämmare; 2 μl av DNase; 8 μl av Al kalinfosfatas) till varje prov och inkubera i 15 min vid 37 ° c, skakas vid 1 200 RPM.
  2. Tillsätt 300 μL polynukleotidkinas (PNK) mastermix (60 μL 5x PNK pH 6,5 buffert [350 mM Tris-HCl, pH 6,5; 50 mM MgCl2]; 223 μl nukleasfritt vatten; 5 μl RNase-hämmare; 2 μl DNase; 7 ΜL pnk-enzym; 3 μl 0,1 M ditiothreitol) till varje prov , Inkubera i 20 min vid 37 ° c, skaka vid 1 200 RPM.
  3. Samla pärlor med ett magnetiskt stativ och Kassera supernatanten. Tvätta pärlor en gång med 500 μL kallt tvättbuffert. Tvätta sedan pärlor en gång med 500 μL kall hög saltbuffert. Upprepa dessa tvättar ännu en gång i denna ordning.
  4. Tvätta pärlor en gång med 500 μL kallt tvättbuffert och sedan två gånger med 300 μL kallt 1x ligationsbuffert (ingen ditiothreitol, 50 mM Tris-HCl, pH 7,5; 10 mM MgCl2).

6. RNA-adapter ligation till RNA 3 ' ändar

  1. Kassera supernatanten och avlägsna resterande vätska med fina pipettspetsar. Tillsätt 25 μl 3 ' ligering Master mix till varje prov. Blanda försiktigt genom att Pipettera. Detta steg är benägna att producera bubblor.
    Anmärkning: Ligering Master mix innehåller 3 μl av 10x ligationsbuffert [500 mm Tris-HCl, pH 7,5; 100 mm mgcl2]; 9 μL nukleasfritt vatten. 0,4 μL av RNase-hämmare; 0,3 μL av 0,1 M ATP; 0,8 μL dimetylsulfoxid (DMSO); 9 μL 50% polyetylenglykol (PEG) 8000; 2,5 μL RNA-Ligas [30 U/μL].
  2. Tillsätt 2,5 μL RNA-adapter X1A (tabell 1) och 2,5 μl RNA-adapter X1B (tabell 1) till varje prov. Blanda försiktigt genom att Pipettera eller snärta, och inkubera i 75 min vid 25 ° c, bläddra för att blanda var 10 min.
  3. Tvätta pärlor en gång med 500 μL kalltvättbuffert (återuppta IgG-provet här).
  4. Tvätta pärlor en gång med 500 μL kall hög saltbuffert och sedan med 500 μL kall tvättbuffert. Upprepa dessa tvättar ännu en gång.
  5. Magnetiskt separata pärlor, och ta bort resterande vätska med fina pipettspetsar.
  6. Omsuspendera pärlorna i 100 μL kallt tvättbuffert (pausa IgG-provet här och förvara på is i tvättbuffert). Flytta 20 μL till nya rör som RWB prover. Separera återstående 80 μL som RRI-prover magnetiskt. Ta bort RRI-proverna från supernatanten och omsuspendera pärlorna i 20 μL tvättbuffert.
  7. Tillsätt 37,5 μL 4x litiumdodecylsulfat (LDS) provbuffert och 15 μL 10x prov reducerande medel till IgG-provet. Tillsätt 7,5 μL 4x LDS-provbuffert och 3 μL 10x prov Reduktions medel till de (återstående) proverna. (Blanda inte med pipettering). Inkubera i 10 min vid 70 ° c, skaka vid 1 200 RPM. Kyl på is i 1 min, och centrifugera vid 1 000 x g i 1 min vid 4 ° c.

7. SDS-sida och membran överföring

  1. Ladda geler.
    1. För RRI gel (4-12% BIS-tris protein gel, 10-well, 1,5 mm) placeras rören på en magnet och separat proteineluat från pärlorna. Fyll på 30 μL av provet per brunn. Proverna är fördelade på pre-färgade protein storleks markör.
    2. För RWB gel (4-12% BIS-tris protein gel, 10-well, 1,5 mm) placeras rör på en magnet och separat proteineluat från pärlorna. Fyll på 15 μL prov per brunn. Spara resterande prover vid-20 ° c som säkerhets kopior.
  2. Tillsätt 500 μL antioxidant till 500 mL 1x SDS löpbuffert. Kör på 200 V i 1x SDS kör buffert för 50 min eller tills färgen fronten är längst ner.
    Anmärkning: Antioxidant innehåller N, N-dimetylformamid, natriumbisulfit, som migrerar med reducerade proteiner för att förhindra reoxidation av känsliga aminosyror såsom metionin och tryptofan.
  3. Överför protein-RNA-komplex från gelen till ett nitrocellulosamembran vid 10 V för 70 min i 1xöverföringbuffert med 10% metanol (Vol/Vol). Skölj RRI-membranet i kallt PBS, Linda in det i plastfolie och förvara vid-80 ° c.
  4. Blockera RWB-membranet i 5% mjölk i TBST vid rums temperatur under 1 h. Skölj membranet i TBST. Inkubera med primär anti kropp i TBST vid 4 ° c över natten. Tvätta två gånger med TBST i 5 min. Inkubera med sekundär anti kropp (1:5000 HRP get anti-kanin IgG) i TBST vid rums temperatur under 1 h. tvätta tre gånger med TBST i 5 min, 10 min respektive 15 min.
  5. Blanda lika stora volymer elektrokemiluminescens (ECL) buffert A och buffert B, tillsätt till membran och inkubera i 1 min. Täck membranet med plastfolie, och exponera den till en röntgen film i rums temperatur för 2-3 min. Sedan utveckla filmen.
    Anmärkning: Filmen med överexponering kommer tydligt att Visa formen på membranets kanter, genom vilken filmen kan justeras tillbaka till RWB membranet. Sedan, anpassa RWB och RRI membran baserat på positionerna av markörer däri. Layered i ordning från botten till toppen är filmen, RWB membranet och RRI membranet i sekvens.

8. RNA-isolering

  1. Skär regionen från proteinet band till 75 kDa (om 220 NT av RNA) ovanför den, med hjälp av RWB membran och film som guider.
    Anmärkning: Som en proteinskyddad RNA-molekyl kan ha en maximal längd på 225 baser, med cirka 340 da per bas, är det rimligt att skära regionen om 75 kDa ovanför RBP bandet för att hämta alla protein-RNA-komplex.
  2. Skär den exciserade bit av membranet i flera små skivor, och placera dem i en fräsch 1,5 mL centrifug röret. Tillsätt 200 μL proteinas K (PK) buffert (100 mM Tris-HCl pH 7,5; 50 mM NaCl; 10 mM EDTA) med 40 μL PK till membran bitarna. Blanda och inkubera i 20 min vid 37 ° c, skaka vid 1 200 RPM.
  3. Tillsätt 200 μL PK-ureabuffert (100 mM Tris-HCl pH 7,4; 50 mM NaCl; 10 mM EDTA; 7 M urea) till varje prov. Inkubera i 20 min vid 37 ° c, skaka vid 1 200 RPM.
  4. Tillsätt 400 μL syra fenol/kloroform/isoamylalkohol (25:24:1), blanda väl och inkubera i 5 min vid 37 ° c, skaka vid 1 200 RPM.
  5. Placera 2 mL fas lås gel (PLG) tung slang i centrifugen och snurra på 15 000 x g för 25 s.
  6. Överför allt innehåll utom membran skivor till PLG Heavy Tube. Inkubera i 5 min vid 37 ° c, skaka vid 1 200 RPM.
  7. Snurra i rums temperatur och 15 000 x g i 15 min. överför vatten skiktet till ett nytt 15 ml koniskt rör.
  8. Använd RNA rening och koncentrations kolumner för att extrahera RNA.
    1. Tillsätt 2 volymer (800 μL) RNA-bindningsbuffert till varje prov (från steg 8,7) och blanda. Tillsätt en lika stor volym (1200 μL) av 100% etanol och blanda.
    2. Överför 750 μL prov (från steg 8.8.1) till RNA-renings-och koncentrations kolumnerna i ett samlings rör och centrifugera vid 15 000 x g i 30 s. Kassera genomflöde.
    3. Upprepa steg 8.8.2 tills alla samplingar har passerat genom kolumnen. Tillsätt 400 μL av RNA-prep-bufferten i kolonnen och centrifugera vid 15 000 x g i 30 s. Kassera genomflöde, applicera 700 ΜL av RNA-tvättbuffert och centrifugera kolonnen vid 15 000 x g i 30 s. Kassera genomflöde.
    4. Tillsätt 400 μL RNA-tvättbuffert i kolonnen och centrifugera vid 15 000 x g i 2 min. överför kolonnen försiktigt till ett nytt 1,5 ml-rör. Tillsätt 10 μL nukleasfritt vatten till kolonnmatrisen, Låt sitta i 2 min och centrifugera vid 15 000 x g i 30 s. Förvara eclip prover vid-80 ° c till RT (steg 11,1).

9. defosforylering av input-RNA 3 ' ändar

  1. Tillsätt 15 μL defosforylering Master Mix (2,5 μL av 10x defosforylationbuffert [100 mM Tris-HCl, pH-värde 8,0; 50 mM MgCl2; 1 M KCl; 0,2% Triton X-100; 1 mg/ml BSA]; 9,5 μl nukleasfritt vatten, 0,5 μl RNase-hämmare; 2,5 μl alkaliskt fosfatas) till 10 μl ingångs samplingar (från steg 8.8.4). Inkubera i 15 min vid 37 ° c, skaka vid 1 200 RPM.
  2. Tillsätt 75 μL PNK Master Mix (20 μL 5x PNK PH 6,5 buffert [350 mM Tris-HCl, pH 6,5; 50 mM MgCl2]; 44 μl nukleasfritt vatten; 1 μl RNase-hämmare; 2 μl DNase; 7 ΜL pnk-enzym; 1 μl 0,1 M ditiothreitol) till prover. Inkubera i 20 min vid 37 ° c, skaka vid 1 200 RPM.
  3. Rensning av ingångs-RNA
    1. Återsuspendera thenucleic syror extraktion magnetisk beadsin flaskan (virvel för mer än 30 s). Tillsätt 20 μL nukleärt syror extraktion magnetiska pärlor för varje prov till nya rör. Samla pärlor med ett magnetiskt stativ och Kassera supernatanten.
    2. Tvätta pärlor en gång med 1 mL RNA rening lysis buffert (RLT buffert). Placera röret på en magnet i 30 s och Kassera supernatanten.
      Anmärkning: Efterföljande separation av nukleinsyror extraktion magnetiska pärlor följde detta steg.
    3. Omsuspendera pärlor med 300 μL RLT buffert och tillsätt i provet. Tillsätt 10 μL 5 M NaCl och 615 μL 100% etylalkohol (EtOH) och blanda med pipettering. Rotera i rums temperatur i 15 min. magnetiskt separera pärlorna och ta bort supernatanten.
    4. Omsuspendera pärlor i 1 mL 75% EtOH och överföring till en ny tub. Efter 30 s, samla pärlor med ett magnetiskt stativ och Kassera supernatanten. Tvätta två gånger med 75% EtOH, magnetiskt separera pärlorna och kassera resterande vätska med fina pipettspetsar. Lufttorka i 5 minuter (Undvik överdriven torkning).
    5. Omsuspendera pärlorna med 10 μl nukleasfritt vatten och inkubera det i 5 min. magnetiskt åtskilda pärlor, och flytta 5 μl supernatanten till en ny tub (för 3 ' adapter ligering nedan). Resterande RNA kan förvaras vid-80 ° c som säkerhets kopior.

10. RNA-adapter ligation till input RNA 3 ' ändar

  1. Tillsätt 1,5 μL av DMSO och 0,5 μL RiL19-adapter (tabell 1) till 5 μl av INGÅNGS-RNA (från steg 9.3.5), Inkubera i 2 min vid 65 ° c och placera på is i mer än 1 min. Tillsätt 13,5 μl 3-ligationshanterblandning till varje prov , blanda genom pipettering och inkubera i 75 min vid 25 ° c, med snärtning för att blanda var 15: eminut.
    Anmärkning: Ligering Master mix innehåller 2 μl 10x ligationsbuffert [500 mm Tris-HCl, pH 7,5; 100 mm mgcl2; 10 mm ditiothreitol]; 1,5 μL nukleasfritt vatten. 0,2 μL av RNase-hämmare; 0,2 μL av 0,1 M ATP; 0,3 μL av DMSO; 8 μL 50% PEG8000; 1,3 μL RNA-Ligas [30 U/μL].
  2. Rensning av liga turer indata-RNA
    1. Magnetiskt separera 20 μL av nukleinsyror extraktion magnetiska pärlor för varje prov, och ta bort supernatanten. Tvätta pärlor en gång med 1 mL RLT buffert.
    2. Omsuspendera pärlor i 61,6 μL RLT-buffert och överförings SUS pension till varje prov. Tillsätt 61,6 μL 100% EtOH. Använd pipetten för att blanda i 15 min var 5 min. magnetiskt åtskilda pärlor, och ta bort supernatanten.
    3. Upprepa steg 9.3.4.
    4. Omsuspendera pärlor med 10 μL nukleasfritt vatten, och låt det sitta i 5 min. magnetiskt separera pärlorna och överföra 10 μL av supernatanten till en ny tub.
      Anmärkning: Detta är en möjlig stopp punkt (ingångs prov kan förvaras vid-80 ° c till nästa dag).

11. omvänd transkription, DNA adapter ligation till cDNA 3 ' ändar

  1. Tillsätt 0,5 μL av RT-primern (tabell 1) till 10 μl av INGÅNGS-RNA (från steg 10.2.4) och 10 ΜL av Clip RNA (från steg 8.8.4), Inkubera i 2 min i FÖRVÄRMD PCR-block vid 65 ° c, placera på is i mer än 1 min.
  2. Tillsätt 10 μL RT mastermix (2 μL RT-buffert [500 mM Tris-HCl, pH 8,3; 750 mM KCl; 30 mM MgCl2]; 4 μl nukleasfritt vatten; 0,3 μl RNase-hämmare; 2 μl 0,1 m Ditiotreitol; 0,2 μl 0,1 m datp; 0,2 μl av 0,1 m dctp; 0,2 μl 0,1 M dGTP; 0,2 μL av 0,1 M dTTP; 0,9 μL omvänt transkriptas) till varje prov, blanda, inkubera vid 55 ° c i 45 min på ett förvärmt PCR-block.
  3. Blanda 20 μL RT reaktions produkt med 3,5 μL av PCR produkt rensning reagens. Inkubera i 15 min vid 37 ° c.
  4. Tillsätt 1 μL 0,5 M EDTA, blanda med pipettering. Tillsätt 3 μL 1 M NaOH, blanda genom pipettering och inkubera i 12 min vid 70 ° c på ett PCR-block för att hydrolysera mallrna.
  5. Tillsätt 3 μL 1 M HCl, pipettblandning för att neutralisera bufferten.
  6. Rensning av cDNA
    1. Magnetiskt separera 10 μL av nukleinsyra extraktion magnetiska pärlor för varje prov, ta bort supernatanten. Tvätta en gång med 500 μL RLT-buffert.
    2. Omsuspendera pärlor i 93 μL RLT-buffert och överförings SUS pension till provet. Tillsätt 111,6 μL 100% EtOH, Inkubera det i 5 min och Pipettera blandningen var 2 min. samla ihop pärlorna med ett magnetiskt stativ och Kassera supernatanten. Omsuspendera pärlor med 1 mL 80% EtOH och flytta till en ny tub.
    3. Efter 30 s, samla pärlor med ett magnetiskt stativ och Kassera supernatanten. Tvätta två gånger med 80% EtOH. Separera och kassera kvarvarande vätska magnetiskt med fin spets. Lufttorka i 5 minuter (Undvik överdriven torkning). Omsuspendera pärlor i 5 μL 5 mM Tris-HCl och inkubera det i 5 min.
  7. Tillsätt 0,8 μL DNA-adapter (tabell 1) och 1 ΜL av DMSO till pärlorna, Inkubera i 2 min vid 75 ° c. Placera på isen i mer än 1 min.
  8. Förbered 12,8 μL ligationshanterblandning (2 μL 10x ligationsbuffert [500 mM Tris-HCl; 100 mM MgCl2; 10 mm ditiothreitol]; 1,1 μl nukleasfritt vatten. 0,2 μl av 0,1 M ATP; 9 μl 50% PEG8000; 0,5 μl RNA-Ligas [30 U/μl]) , svep för att blanda, snurra kort i en centrifug och tillsätt det till varje prov, rör om provet med pipettspetsen långsamt.
  9. Tillsätt ytterligare 1 μL RNA-Ligas [30 U/μL] till varje prov och svep för att blanda. Inkubera i 30 s vid 25 ° c, skaka vid 1 200 RPM. Inkubera vid 25 ° c över natten. Svep för att blanda lätt 5 till 6 gånger, en gång per timme.
  10. Rensning av liga turer cDNA
    1. Magnetiskt separera 5 μL av nukleinsyror extraktion magnetiska pärlor för varje prov, och ta bort supernatant.
    2. Tvätta en gång med 500 μL RLT-buffert.
    3. Omsuspendera pärlor i 60 μL RLT buffert till pärlor och överföring SUS pension till varje prov. Tillsätt 60 μL 100% EtOH, Inkubera det i 5 min och pipettblandningen var 2 min. magnetiskt åtskilda, Kassera supernatanten.
    4. Upprepa steg 9.3.4.
    5. Omsuspendera pärlor med 27 μL 10 mM Tris-HCl, Inkubera den i 5 min. magnetiskt åtskilda och flytta 25 μL av provet till ett nytt rör. Späd ut 1 μl liga turer cDNA med 9 μl nukleasfritt vatten i ett nytt rör. Förvara resterande prover vid-20 ° c till steg 13,1.

12. kvantifiering av cDNA med kvantitativ realtids-PCR (qPCR)

  1. Tillsätt 9 μL av qPCR mastermix (5 μL 2x mastermix; 3,6 μL nukleasfritt vatten; 0,4 μL av primer-blandningen [10 μM PCR-F-D50X och 10 μM PCR-R-D70X]) till en 96-väl qPCR-platta. Tillsätt 1 μL 1:10 utspätt (i H2O) cDNA (från steg 11.10.5), täta och blanda.
  2. Kör qPCR-programmet i en termocykler: 2 min vid 50 ° c; 2 min vid 95 ° c; 3 s vid 95 ° c följt av 30 s vid 68 ° c för 40 cykler; 15 s vid 95 ° c följt av 60 s vid 68 ° c följt av 15 s vid 95 ° c under 1 cykel. Värde för CT (cykel tröskel).

13. PCR-amplifiering av cDNA

  1. Dispensera 35 μL PCR-masterblandning (25 μL 2x PCR-masterblandning; 5 μL nukleasfritt vatten; 5 μL primer-blandning [20 μM PCR-F-D50X och 20 μM PCR-R-D70X]) i 8-well-remsor. För CLIP-gruppen, tillsätt 12,5 μL CLIP-prov + 2,5 μL H2O; för insats grupp, tillsätt 10 μL av ingångarna + 5 μL H2O. blanda väl och snurra kort i centrifug.
  2. Kör PCR-programmet: 30 s vid 98 ° c; 15 s vid 98 ° c följt av 30 s vid 68 ° c följt av 40 s vid 72 ° c under 6 cykler, 15 s vid 98 ° c följt av 60 s vid 72 ° c för N Cycles = (qPCR CT-värden-3)-6; 60 s vid 72 ° c; 4 ° c håll.
    Anmärkning: Det är bättre att utföra 1 till 2 extra PCR cykler för de första par klipp.

14. gel rening

  1. Ladda prover på en 3% hög upplöst AGA ros gel. Lämnar 1 tomma väl mellan proverna, och använda en stege på båda sidor av gelen. Kör på 100 V för 75 min i 1x tris-borate-EDTA (TBE) buffert.
  2. Under blått ljus belysning, skära gel skivor 175-350 BP med färska rakblad för varje prov. Placera dem i 15 mL koniska rör.
    1. Väg gel skiva, och eluera gelen med hjälp av en gel extraktion kit.
    2. Tillsätt 6x volymer av gel upplösning buffert för att smälta gelen (100 mg gel = 600 μL av gel upplösning buffert). Lös upp gelen vid rums temperatur. (Skaka för att blanda var 15 min tills gelen skiva har helt upplöst). Tillsätt 1 gel volym på 100% isopropanol och blanda väl.
    3. Överför 750 μL av provet (från steg 14.2.2) till kolonnen i ett samlings rör och centrifugera vid 17 900 x g i 1 min. Kassera genomflöde.
    4. Upprepa steg 14.2.3 tills alla prover har passerat genom kolonnen, tvätta en gång med 500 μL gel upplösning buffert.
    5. Tillsätt 750 μL tvättbuffert (från gel extraktionssats) till kolonnen och centrifugera vid 17 900 x g i 1 min. Kassera genomflöde, snurra på 17 900 x g i 2 min. Placera kolonnen i ett nytt 1,5 ml-rör.
    6. Ta bort alla kvarvarande tvättbuffert från den plast lila kanten av kolonnen. Lufttorka i 2 min. Tillsätt 12,5 μL nukleasfritt vatten till membranets mitt. Låt kolonnen stå i 2 min vid rums temperatur, och snurra på 17 900 x g i 1 min (för en förbättrad Yield, upprepa elutionssteget).

15. TOPO klon av PCR-produkt

  1. Bered blandningen av TOPO-klonings reaktion (1 μL PCR-produkt från steg 14.2.6; 1 μL klonings blandning; 3 μL sterilt vatten). Blanda varsamt och inkubera i 5 min vid 20-37 ° c. Kyla på isen.
  2. Tina kemiskt kompetenta E. coli-bakterier på isen. Tillsätt 5 μL av TOPO-klonings produkten till 100 μL av kompetenta bakterier29. Blanda försiktigt väl. Inkubera på is i 30 min.
  3. Värme chock för 60 s vid 42 ° c. Sedan svalna på is i 2 min. Tillsätt 900 μL av lysogeniska buljong (LB) medium, inkubera vid 37 ° c i 1 h, skaka vid 225 RPM. Snurra på 1 000 x g i 1 min, och ta sedan bort 900 μl supernatant. Omsuspendera resten av lösningen.
  4. Platta omvandlade bakterier på 1,5% LB agar plattor som innehåller ampicillin (100 μg/mL), och inkubera över natten vid 37 ° c.
  5. Bered minst 20 1,5 mL centrifugrör för varje konstruktion. Fyll ett set med 500 μL LB-medium innehåll ande 100 μg/mL ampicillin. Använd en steril pipettspets för att skrapa bort en bakteriell koloni slumpmässigt och blanda (genom pipettering) med 500 μL av LB-mediet. Inkubera vid 37 ° c i 5 timmar, skaka vid 225 RPM.
  6. Sekvensera infoga fragmentet med hjälp av M13 Reverse primer: CAGGAAACAGCTATGAC av sanger ordningsföljd30.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Eclip-förfarandet och resultaten illustreras i figur 1, figur 2, figur 3, figur 4. Möss var euthanized med koldioxid och ett litet snitt gjordes i nedre delen av buken med hjälp av kirurgiska saxar (figur 2A,B). Mus testiklarna togs bort, detunicated och sedan UV-crosslinked efter slipning (figur 2C-I). Representativa eclip resultat av att använda två kända RNA-bindande Helikas i testiklarna vävnader avbildas i figur 3 och 4. Vi utförde MOV10 eCLIP i testiklarna från vuxna vild-typ möss, med gemensam koncentration av 40 U/mL RNase jag behandla tvär bunden lysate. Den övre panelen i figur 3a visar att mål proteinet storlek om 114 kDa var framgångs rikt berikat. Western blot av de immunoprecipiterade MOV10L1-proteinerna utfördes med två koncentrationer (5 eller 40 U/mL) av RNase I under eCLIP-processen (figur 3a). Figur 3b visar QPCR med 1:10 utspädd cDNA (redan liga turer med DNA-adapter) från MOV10 och MOV10L1 UV-crosslinked, icke-crosslinked, och Parade storlek matchade input (sminput) prov. Icke-crosslinked prover visar minskad RNA återhämtning. Vi observerade att CT-värdena för den icke-tvär bunden grupp var i allmänhet 5 gånger mer än UV-crosslinked grupp. Figur 4a visar PCR-amplifiering och storleks val via AGA ros gelelektrofores (snitt 175-350 BP). Primer-dimer produkt visas på ca 140 BP. figur 4b visar webbläsarvyn för ucsc-genomvisning av två representativa subkloningssekvenser. MOV10-Bound eCLIP Taggar upptäcks vara placerade inom 3 ' UTR av genen FTO; Den ungefärliga andelen 3 ' UTR mål står för 75% (figur 4c), i enlighet med de flesta MOV10 mål i HEK293-cellerna10 och i testiklarna (data visas inte). Däremot finns MOV10L1-bundna eCLIP-Taggar placerade inom ett piRNA-kluster som visar MOV10L1 mål för piRNA-prekursorer. Den ungefärliga frekvensen av piRNA-prekursorer motsvarar 42% (figur 4e), vilket återspeglar en trend från vårt tidigare konventionella Clip-experiment20. MOV10L1 eCLIP med 40 U/mL RNase I mat smältningen ger relativt fler sekvenser med mindre än 20 BP (figur 4D).

Figure 1
Figur 1 : Schematisk representation av eCLIP. UV-crosslinked mus seminifera tubuli (steg 1) lyserat i eclip lysis buffert och sonicated (steg 2). Lysate behandlas med RNase I för att fragmentera RNA, varefter protein-RNA-komplex är immunutfällda med anti-RBP-antikroppen (steg 3-4). Defosforylering av RNA fragment och ligering av 3 ′ RNA-adapter utförs (steg 5-6). Protein-RNA-komplex körs på en SDS-PAGE gel och överförs till nitrocellulosamembran (steg 7). RNA återvinns från membranet genom att smälta proteinet med proteinas K och urea som lämnar en kort polypeptid kvar på Crosslink platsen. Defosforylering av RNA fragment av ingående prover och ligering av 3 ′ RNA-adapter utförs (steg 8). Utför RT av RNA och ligering av 3 ′ DNA-adapter (steg 9-10). Utför PCR-förstärkning av cDNA-bibliotek, gel utvinning och trubbig PCR-kloning för preliminär biblioteks kvalitets kontroll (steg 11). Slutligen utför hög genom strömning sekvensering (steg 12). Vänligen klicka här för att se en större version av denna siffra.

Figure 2
Figur 2 : Testis vävnads skörd och UV tvär bindning. (A) exponeringen av musens mage. (B) en 0,5 cm snitt i buk väggen utsätta bukhinnan. (C) ett par testiklarna tas ut genom att dra ut fett kuddarna. Dtestikelvävnad avlägsnas och placeras i en liten skål som innehåller ISKALLA PBS. (E) Ta försiktigt bort Tunica albuginea. (F) Tryck på lös mortelstöt för att triturate vävnaden i en vävnad kvarn dounce. G) distribuerade sädeskanaler i en 10 cm plåt. (H) UV tvär bindning med 400 MJ/cm2 energi. I) de tvär bundna proverna samlas upp i 1,5 ml centrifugrör. Vänligen klicka här för att se en större version av denna siffra.

Figure 3
Figur 3 : Representativa resultat av MOV10 och MOV10L1 eCLIP. (A) Western blot-validering av MOV10 och MOV10L1 immunprecipitater. (B) QPCR på 1:10 spädda eclip bibliotek av MOV10 och MOV10L1, med replikat för UV, icke-UV och ihopkopplade sminput prover. Vänligen klicka här för att se en större version av denna siffra.

Figure 4
Figur 4 : Eclip biblioteks beredning och kvalitets bedömning. (A) gel bilderna av PCR-amplifiering visas. Asterisk indikerar primer dimer. Röd prickad linje visar regioner censurerade för PCR-produkt av cDNA, någonstans mellan 175 och 350 BP. (B) ucsc genomwebbläsarvy av två representativa subklon sekvenser31. (C) småskalig subklon sekvenserings analys av MOV10. (D) MOV10L1-bundna Taggar uppvisar distinkta mönster av längd fördelning vid bearbetning av två olika RNase koncentrationer. (E) småskalig subklon sekvenserings analys av MOV10L1. Vänligen klicka här för att se en större version av denna siffra.

Sekvensnamn Information om sekvens Beskrivning
RNA-adaptrar
RNA X1A /5Phos/AUAUAGGNNNNNAGAUCGGAAGAGCGUCGUGUAG/3SpC3/ lager vid 200 μM; arbetar vid 20 μM
RNA X1B /5Phos/AAUAGCANNNNNAGAUCGGAAGAGCGUCGUGUAG/3SpC3/ lager vid 200 μM; arbetar vid 20 μM
RiL19 /5phos/AGAUCGGAAGAGCGUCGUG/3SpC3/ lager vid 200 μM; arbetar på 40 μM
DNA-adapter
Rand103tr3 /5Phos/NNNNNNNNNNAGATCGGAAGAGCACACGTCTG/3SpC3/ lager vid 200 μM; arbetar på 80 μM
RT-primer
AR17 Mer från ACACGACGCTCTTCCGA lager vid 200 μM; arbetar vid 20 μM
PCR-primers

PCR-F-D 501
AATGATACGGCGACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACGACGCTCTTCCGATCT lager vid 100 μM; arbetar vid 20 μM
PCR-R-D 701 CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC lager vid 100 μM; arbetar vid 20 μM
(Se Illumina kund tjänst brev för D502-508, D702-712)

Tabell 1: adapter-och primer-sekvenser. Adaptern innehåller en in-line slump-mer (antingen N5 eller N10) för att avgöra om två identiska sekvenserade läsningar indikerar två unika RNA-fragment eller PCR-dubbletter av samma RNA-fragment. "5 Phos" står för 5 ' fosforylering, vilket behövs om en oligo används som substrat för DNA/RNA-Ligas. "3spc3" står för 3 ' C3 spacer, vilket kan förhindra ligering mellan adaptrar.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Med ökad förståelse för den universella roll RBPs under både biologiska och patologiska sammanhang, har klippet metoder använts i stor utsträckning för att avslöja den molekyl ära funktionen av RBPs20,32,33, 34,35. Protokollet som beskrivs här representerar en anpassad tillämpning av eCLIP metod för att musen testis.

En utmaning att utföra eCLIP i testiklarna är att bibehålla livs kraft och integritet av färska testikelceller, vilket också är viktigt för effektiv tvär bindning. Klippning testiklarna med mild mekanisk kraft med hjälp av lös mortelstöt kan förhindra cell lysis32,36. Korrekt nedbrytning av RNA är också avgörande för framgångs rika eCLIP-analyser. RNA-fragment kan vara mer konvergent efter mat smältningen, men längden mindre än 20 BP kan tas bort via förbehandling av biblioteket läser. För att anta en ideal RNase dosering för en RBP kandidat, föreslår vi ett preliminärt test baserat på resultaten av subklon sekvensering av eCLIP bibliotek som kan förberedas genom RNase behandling med koncentrationer som sträcker sig från 0 du till 40 U (per milliliter lysate). Den småskaliga subklon sekvenserings analys är ett rekommenderat steg för en tillförlitlig granskning av bibliotekets kvalitet i vår eCLIP metod. För det första, den procentuella andelen skär kortare än 20 BP bör inte vara för hög, eller, den efterföljande förbehandling av eCLIP biblioteket kommer att orsaka en kostsam förlust av läsningar. För det andra bör effektiviteten i korrekt ligering av båda adaptrarna kontrol leras. Substandard prover kan elimineras utan djup sekvensering för att säkerställa lyckad djup sekvensering, vars resultat i allmänhet tar mycket längre tid att analysera.

Även om genomförbarheten av eclip i mus testiklarna är fortfarande begränsad av specificiteten av anti kroppen för steget av immunnederbörden, eclip är fördelaktigt jämfört med konventionella Clip metoder i flera aspekter. För det första är det en icke-radioaktiv metod. Genom eCLIP, RNA mål av RBPs fångas direkt in vivo utan att behöva tillgripa arbets intensiva tekniker med hjälp av radioaktiva ämnen. För det andra är metoden mindre tids krävande. Hela proceduren tar bara 4 dagar genom eCLIP bibliotek förberedelse. För det tredje, sekvens mångfald. Jämfört med den konventionella enhetliga amplifiering cykel av 25-35 cykler, eclip hänvisar till CT-värden för QPCR att ställa in antalet PCR cykler specifikt. Slutligen ger det starkare signal-brus-förhållande. Den storlek matchade indata fungerar som en lämplig bakgrund för autentiska mål.

Sammanfattnings vis, våra eCLIP resultat konsolidera satserna att MOV10 och MOV10L1 har en bindande preferens för mRNA 3 UTR och piRNA prekursorer, respektive. Det protokoll som vi beskrev häri representerar den första anställningen av eCLIP metod i reproduktion, ett område där RNA-RBP interaktion kunskap är ganska otillräcklig, även om genetiska studier har gett gott om information om de biologiska rollerna för RBPs. visualisering av detta eCLIP-protokoll kan hjälpa till att vägleda dess utbredda tillämpningar i bredare områden.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har inget att avslöja.

Acknowledgments

Vi tackar Eric L van Nostrand och Gene W Yeo för användbar vägledning med det ursprungliga protokollet. K.Z. stöddes av den nationella nyckeln R & D-programmet i Kina (2016YFA0500902, 2018YFC1003500) och Kinas nationella Naturvetenskaps stiftelse (31771653). L.Y. stöddes av National Natural Science Foundation i Kina (81471502, 31871503) och innovativa och entreprenörs program i Jiangsu-provinsen.

Materials

Name Company Catalog Number Comments
Antibodies
Anti-mouse MOV10  antibody Proteintech, China 10370-1-AP
Anti-mouse MOV10L1 antibody Zheng et al.20109 polyclonal antisera UP2175 provided by P. Jeremy Wang lab, University of Pennsylvania
HRP Goat Anti-Rabbit IgG  ABclonal AS014
Rabbit IgG Beyotime, China A7016
Equipment
Centrifuge Eppendorf, Hamburg, Germany 5242R
Digital sonifier BRANSON,USA BBV12081048A 450 Watts; 50/60 Hz
DynaMag-2 Magnet Invitrogen,USA 12321D
Mini Blot Module Invitrogen,USA B1000
Mini Gel Tank Invitrogen,USA A25977
Shaking incubator Eppendorf, Hamburg, Germany Thermomixer comfort 
Tissue Grinder, Dounce PYREX, USA 1234F35 only  the "loose" pestle is used in this protocol
TProfessional standard 96 Gradient Biometra, Germany serial no.: 2604323
Tube Revolver  Crystal, USA serial no.: 3406051
UV-light cross-linker UVP, USA CL-1000
Materials
TC-treated Culture Dish Corning, USA 430167 100 mm 
Tubes Corning, USA 430791 15 mL
Microtubes tubes AXYGEN , USA MCT-150-C 1.5 mL 
Reagents 
Acid phenol/chloroform/isoamyl alcohol  Solarbio, China P1011 25:24:01
AffinityScript Enzyme Agilent, USA 600107
Antioxidant Invitrogen,USA NP0005
DH5α competent bacteria Thermo Scientific, USA 18265017 these economical cells yield >1 x 106 transformants/µg control DNA per 50 µL reaction.
DMSO Sigma-Aldrich, USA D8418
DNA Ladder Invitrogen, USA 10416014
dNTP Sigma-Aldrich, USA DNTP100-1KT
Dynabeads Protein A  Invitrogen, USA 10002D
ECL reagent Vazyme, China E411-04
EDTA Invitrogen, USA AM9260G
EDTA free protease inhibitor cocktail Roche, USA 04693132001 add fresh
Exo-SAP-IT Affymetrix, USA 78201 PCR Product Cleanup Reagent 
FastAP enzyme Thermo Scientific, USA EF0652
LDS Sample Buffer Thermo Scientific, USA NP0007
MetaPhor Agarose  lonza, Switzerland 50180
MgCl2 Invitrogen, USA AM9530G
MiniElute gel Extraction QIAGEN, Germany 28604 column store at 4 ?; buffer QG=gel dissolving buffer; buffer PE= wash buffer(for step 14)
MyONE Silane beads Thermo Scientific, USA 37002D nucleic acids extraction magnetic beads
NaCl Invitrogen,USA AM9759
 
NP-40 Amresco, USA M158-500ML
NuPAGE Bis-Tris Protein Gels Invitrogen, USA NP0336BOX 4%–12%,1.5 mm, 15-well
NuPAGE MOPS SDS Buffer Kit  Invitrogen, USA NP0050
PBS Gibco, USA 10010023
Phase-Locked Gel (PLG) heavy tube   TIANGEN, China WM5-2302831
PowerUp SYBR Green Master Mix Applied Biosystems, USA A25742
Proteinase K NEB, New England  P8107S
Q5 PCR master mix  NEB, New England  M0492L
RLT buffer QIAGEN, Germany 79216 RNA purification lysis buffer 
RNA Clean & Concentrator-5 columns  ZYMO RESEARCH, USA R1016 RNA purification and concentration columns
RNase I  Invitrogen, USA AM2295
RNase Inhibitor Promega, USA N251B
RQ1 DNase Promega,USA M610A
Sample Reducing Agent Invitrogen,USA NP0009
SDS Solution Invitrogen, USA 15553027 10%
Sodium deoxycholate Sigma-Aldrich, USA 30970 protect from light
T4 PNK enzyme NEB, New England  M0201L
T4 RNA ligase 1 high conc NEB, New England  M0437M
TA/Blunt-Zero Cloning Mix Vazyme, China C601-01
TBE Invitrogen,USA AM9863
Tris-HCI Buffer Invitrogen, USA 15567027
Triton X-100 Sangon Biotech, China A600198 
Tween-20 Sangon Biotech, China A600560
Urea Sigma-Aldrich, USA U5378
X-ray Films Caresteam, Canada 6535876

DOWNLOAD MATERIALS LIST

References

  1. Turner, J. M., Mahadevaiah, S. K., Ellis, P. J., Mitchell, M. J., Burgoyne, P. S. Pachytene asynapsis drives meiotic sex chromosome inactivation and leads to substantial postmeiotic repression in spermatids. Developmental Cell. 10, (4), 521-529 (2006).
  2. Turner, J. M. A. Meiotic sex chromosome inactivation. Development. 134, (10), 1823-1831 (2007).
  3. Kimmins, S., Sassone-Corsi, P. Chromatin remodelling and epigenetic features of germ cells. Nature. 434, (7033), 583-589 (2005).
  4. Ule, J., et al. CLIP identifies Nova-regulated RNA networks in the brain. Science. 302, (5648), 1212-1215 (2003).
  5. Ule, J., Jensen, K., Mele, A., Darnell, R. B. CLIP: a method for identifying protein-RNA interaction sites in living cells. Methods. 37, (4), 376-386 (2005).
  6. Trifillis, P., Day, N., Kiledjian, M. Finding the right RNA: identification of cellular mRNA substrates for RNA-binding proteins. RNA. 5, (8), 1071-1082 (1999).
  7. Tenenbaum, S. A., Carson, C. C., Lager, P. J., Keene, J. D. Identifying mRNA subsets in messenger ribonucleoprotein complexes by using cDNA arrays. Proceedings of National Acadamy of Sciences U S A. 97, (26), 14085-14090 (2000).
  8. Chi, S. W., Zang, J. B., Mele, A., Darnell, R. B. Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 460, (7254), 479-486 (2009).
  9. Zheng, K., et al. Mouse MOV10L1 associates with Piwi proteins and is an essential component of the Piwi-interacting RNA (piRNA) pathway. Proceedings of National Acadamy of Sciences U S A. 107, (26), 11841-11846 (2010).
  10. Gregersen, L. H., et al. MOV10 Is a 5' to 3' RNA helicase contributing to UPF1 mRNA target degradation by translocation along 3' UTRs. Molecular Cell. 54, (4), 573-585 (2014).
  11. Banerjee, S., Neveu, P., Kosik, K. S. A coordinated local translational control point at the synapse involving relief from silencing and MOV10 degradation. Neuron. 64, (6), 871-884 (2009).
  12. Choi, J., Hwang, S. Y., Ahn, K. Interplay between RNASEH2 and MOV10 controls LINE-1 retrotransposition. Nucleic Acids Research. 46, (4), 1912-1926 (2018).
  13. Goodier, J. L., Cheung, L. E., Kazazian, H. H. Jr MOV10 RNA helicase is a potent inhibitor of retrotransposition in cells. PLoS Genetics. 8, (10), e1002941 (2012).
  14. Haussecker, D., et al. Capped small RNAs and MOV10 in human hepatitis delta virus replication. Nature Structural & Molecular Biology. 15, (7), 714-721 (2008).
  15. Kenny, P. J., et al. MOV10 and FMRP regulate AGO2 association with microRNA recognition elements. Cell Reports. 9, (5), 1729-1741 (2014).
  16. Messaoudi-Aubert, S. E., et al. Role for the MOV10 RNA helicase in Polycomb-mediated repression of the INK4a tumor suppressor. Nature Structural & Molecular Biology. 17, (7), 862-868 (2010).
  17. Sievers, C., Schlumpf, T., Sawarkar, R., Comoglio, F., Paro, R. Mixture models and wavelet transforms reveal high confidence RNA-protein interaction sites in MOV10 PAR-CLIP data. Nucleic Acids Research. 40, (20), e160 (2012).
  18. Skariah, G., et al. Mov10 suppresses retroelements and regulates neuronal development and function in the developing brain. BMC Biology. 15, (1), 54 (2017).
  19. Zheng, K., Wang, P. J. Blockade of pachytene piRNA biogenesis reveals a novel requirement for maintaining post-meiotic germline genome integrity. PLoS Genetics. 8, (11), e1003038 (2012).
  20. Vourekas, A., et al. The RNA helicase MOV10L1 binds piRNA precursors to initiate piRNA processing. Genes & Development. 29, (6), 617-629 (2015).
  21. Hocq, R., Paternina, J., Alasseur, Q., Genovesio, A., Le Hir, H. Monitored eCLIP: high accuracy mapping of RNA-protein interactions. Nucleic Acids Research. 46, (21), 11553-11565 (2018).
  22. Huppertz, I., et al. iCLIP: protein-RNA interactions at nucleotide resolution. Methods. 65, (3), 274-287 (2014).
  23. Hafner, M., et al. Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 141, (1), 129-141 (2010).
  24. Hafner, M., et al. PAR-CliP--a method to identify transcriptome-wide the binding sites of RNA binding proteins. Journal of Visualized Experiments. (41), (2010).
  25. Konig, J., et al. iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nature Structural & Molecular Biology. 17, (7), 909-915 (2010).
  26. Konig, J., et al. iCLIP--transcriptome-wide mapping of protein-RNA interactions with individual nucleotide resolution. Journal of Visualized Experiments. (50), (2011).
  27. Maticzka, D., Ilik, I. A., Aktas, T., Backofen, R., Akhtar, A. uvCLAP is a fast and non-radioactive method to identify in vivo targets of RNA-binding proteins. Nature Communications. 9, (1), 1142 (2018).
  28. Van Nostrand, E. L., et al. Robust transcriptome-wide discovery of RNA-binding protein binding sites with enhanced CLIP (eCLIP). Nature Methods. 13, (6), 508-514 (2016).
  29. Radulovich, N., Leung, L., Tsao, M. S. Modified gateway system for double shRNA expression and Cre/lox based gene expression. BMC Biotechnology. 11, 24 (2011).
  30. Breunig, C. T., et al. A Customizable Protocol for String Assembly gRNA Cloning (STAgR). Journal of Visualized Experiments. (142), (2018).
  31. Kuhn, R. M., Haussler, D., Kent, W. J. The UCSC genome browser and associated tools. Briefings in Bioinformatics. 14, (2), 144-161 (2013).
  32. Vourekas, A., et al. Mili and Miwi target RNA repertoire reveals piRNA biogenesis and function of Miwi in spermiogenesis. Nature Structural & Molecular Biology. 19, (8), 773-781 (2012).
  33. Preitner, N., et al. APC is an RNA-binding protein, and its interactome provides a link to neural development and microtubule assembly. Cell. 158, (2), 368-382 (2014).
  34. Meyer, C., et al. The TIA1 RNA-Binding Protein Family Regulates EIF2AK2-Mediated Stress Response and Cell Cycle Progression. Molecular Cell. 69, (4), 622-635 (2018).
  35. Gerstberger, S., Hafner, M., Tuschl, T. A census of human RNA-binding proteins. Nature Reviews Genetics. 15, (12), 829-845 (2014).
  36. Vourekas, A., Mourelatos, Z. HITS-CLIP (CLIP-Seq) for mouse Piwi proteins. Methods in Molecular Biology. 1093, 73-95 (2014).
Förbättrad crosslinking Immunutfällning (eCLIP) metod för effektiv identifiering av protein-bundet RNA i mus testis
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Xu, Q., Wang, C., Ling, L., Yue, Q., Liu, M., Zhang, S., Fu, K., Ye, L., Zheng, K. Enhanced Crosslinking Immunoprecipitation (eCLIP) Method for Efficient Identification of Protein-bound RNA in Mouse Testis. J. Vis. Exp. (147), e59681, doi:10.3791/59681 (2019).More

Xu, Q., Wang, C., Ling, L., Yue, Q., Liu, M., Zhang, S., Fu, K., Ye, L., Zheng, K. Enhanced Crosslinking Immunoprecipitation (eCLIP) Method for Efficient Identification of Protein-bound RNA in Mouse Testis. J. Vis. Exp. (147), e59681, doi:10.3791/59681 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter