Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Bioengineering

Mänskliga neurala Organoider för att studera hjärn cancer och neurodegenerativa sjukdomar

doi: 10.3791/59682 Published: June 28, 2019
* These authors contributed equally

Summary

Denna studie introducerar och beskriver protokoll för att härleda två specifika mänskliga neurala organoider som en relevant och korrekt modell för att studera 1) mänskliga glioblastoma utveckling inom mänskliga neurala organoider uteslutande hos människor och 2) neuron dopaminerga differentiering generera en tredimensionell Organoid.

Abstract

Avsaknaden av relevanta in vitro-neurala modeller är ett viktigt hinder för medicinska framsteg för neuropatier. Etablering av relevanta cellulära modeller är avgörande både för att bättre förstå de patologiska mekanismerna för dessa sjukdomar och identifiera nya terapeutiska mål och strategier. För att vara relevant, en in vitro-modell måste reproducera de patologiska egenskaper hos en mänsklig sjukdom. Emellertid, i samband med neurodegenerativa sjukdomar, en relevant in vitro-modell bör ge neurala cell Replacement som en värdefull terapeutisk möjlighet.

En sådan modell skulle inte bara tillåta screening av terapeutiska molekyler utan också kan användas för att optimera neurala protokollet differentiering [till exempel, i samband med transplantation vid Parkinsons sjukdom (PD)]. Denna studie beskriver två in vitro-protokoll av 1) mänskliga glioblastoma utveckling inom en mänsklig neurala organoider (NO) och 2) neuron dopaminerga (DA) differentiering generera en tredimensionell (3D) Organoid. För detta ändamål, ett väl standardiserat protokoll inrättades som gör att produktionen av storleks-kalibrerade neurospheres härrör från mänskliga embryonala stamceller (hESC) differentiering. Den första modellen kan användas för att avslöja molekylära och cellulära händelser som inträffar under i glioblastoma utveckling inom neurala Organoid, medan DA Organoid inte bara representerar en lämplig källa till DA neuroner för cellterapi vid Parkinsons sjukdom men också kan användas för drogtester.

Introduction

Världshälsoorganisationen (WHO) klassificerar astrocytom som låggradig (grad I till II) eller hög grad (grad III och IV). Glioblastoma multiforme (GBM) är en astrocytom grad IV, den mest dödliga av primära hjärntumörer, som är resistent mot alla nuvarande former av behandlingar1. Trots standard-of-Care terapi inklusive neurokirurgi, kemoterapi, och strålbehandling, GBM förblir dödlig och den 15-månaders total överlevnad har inte förändrats dramatiskt under de senaste 15 åren2. För att göra betydande framsteg i förståelsen av GBM-patogenesen är det viktigt att använda relevanta modeller. Hittills har studien av GBM förlitat sig på cellinjer, gnagare organotypic skivor, och xenotransplantation av patient-härledda celler till möss eller transgena möss utveckla spontana tumörer3,4. Även om dessa modeller har varit användbara för att studera hjärnmetastaser och tumör aggressivitet, de begränsas av skillnader mellan arter, och resulterande slutsatser kan vara felaktigt översättas till mänskliga vävnader. Dessutom, befintliga modeller med mänskliga celler är också begränsade av frånvaron av värd vävnad/tumörinteraktioner3,4. Experimentella modeller är avgörande för översättningen från grundläggande vetenskap till terapeutiska mål. Därför, beskriver ett protokoll för att producera in vitro humana neurala organoider Co-odlade med GBM-initierande celler (GICs) kan ge ett relevant system som härmar morfologiska och funktionella egenskaper hos GBM utveckling. Detta system återger några in vivo funktioner i GBM developmentsåsom diffus migration av invaderande celler och nekros områden, och det belyser genuttryck som är relevanta för tumörbiologi. Som tidigare avslöjat, vissa kritiska mikroRNAs induceras under GIC utveckling inom 3D nervvävnad5,6.

PD är en stor neurodegenerativ sjukdom och i samband med degeneration av flera neuronala subtyper7. Även om en progressiv debut av symtom (t. ex., bradykinit, asymmetrisk vila tremor, stelhet och hållning instabilitet) karakteriserar sjukdomen, dess exakta etiologi är inte klart etablerad. Faktum är att många studier har belyst belägg för att stora riskfaktorer kan bero på en kombination av genetiska och miljömässiga faktorer. Parkinsonian symtom är förknippade med den bilaterala degeneration av dopaminerga neuroner i substancia Nigra (SN), vilket leder till försvinnandet av dopaminerga (da) axoner projicerar till striatum8,9. Därför, minskningen av striatala dopaminnivåer är korrelerad med progression av motorisk dysfunktion hos PD-patienter. Dopaminerga neuroner innehåller tyrosin hydroxylas (TH), ett nyckel enzym i syntesen av katekolaminerga signalsubstanser som omvandlar aminosyran L-tyrosin till L-3, 4-dihydroxyfenylalanin (L-DOPA, en dopamin föregångare) till dopamin10. Tidig förlust av TH aktivitet följt av en nedgång i TH proteinuttryck är ett kännetecken för PD.

Denna studie beskriver två protokoll med hjälp av mänskliga neurala organoider, med en särskilt inriktad mot en midbrain-liknande fenotyp berikad med TH-positiva celler.

Protocol

Detta protokoll följer riktlinjerna från University of Genèves mänskliga forskningsetiska kommitté.

1. underhåll och kultur av odifferentierade mänskliga embryonala stamceller (hESCs)

  1. Utför underhåll och utbyggnad av hSECs på Feeder-fria förhållanden genom pre-Coating rätter med en specifik extracellulär matris.
    1. Tina 300 μL av extracellulär matris vid 4 ° c (typisk intervall koncentration 18-22 mg/mL, håll på is) och blanda försiktigt med 15 mL kallt DMEM medium för att undvika en för tidig gelation av den extracellulära matrisen. Tillsätt 7,5 mL av den extracellulära Matric till båda T150 kolvar.
    2. Inkubera rätterna belagda med extracellulär matris vid 37 ° c i minst 1 h (max över natten).
    3. Ta bort mediet och frö hESCs till en densitet av 6,5 x 104 cell/cm2.
  2. Upprätthålla H1 (hESC cell Line) i hESC medium och 1% penicillin/streptomycin.
  3. Passera cellerna med enzymatisk procedur: Tillsätt 7,5 mL enzymatisk lösning till en T75 cm2 kolv under en period av 1-2 min vid 37 ° c. När cellerna är helt lossnar, tillsätt 7,5 mL DMEM-F12 och centrifugera sedan i 5 min vid 300 x g. För att möjliggöra bättre överlevnad, re-plattan celler på önskad densitet på extracellulära matrix-belagda rätter, i samma medium som innehåller Rho-associerad proteinkinas (ROCK) hämmare (10 μM) för 24 h.

2. hESC-härledda neurala organoider för GBM studier

  1. 24 h innan du börjar 3D-kulturen, ersätta hESC mediet med ett serumfritt medium kompletterat med 10 μm rock inhibitor (båda komponenterna är nödvändiga för att stödja cellöverlevnad och spontan neurosphere bildas under sammansättnings fasen i en mikrobrunn plattan). Cellerna bör vara på 60% confluency. Nästa dag (dag 0), lossa hESC kolonier som enskilda celler: ta bort mediet, skölj sedan med PBS utan ca2 +/mg2 +, tillsätt 5 ml enzymatisk upplösning lösning, och inkubera vid 37 ° c för 1-2 min.
  2. Samla in cellerna i serumfritt medium med 10 μM av sten hämmare och centrifugera cellerna vid 300 x g i 5 min. ta bort supernatanten och räkna cellerna i 10 ml serumfritt medium kompletterat med 10 ΜM av sten hämmare.
  3. Parallellt, skölj mikrobrunn plattan med 2 ml serumfritt medium per brunn och centrifugera plattan vid 1200 x g i 5 min för att ta bort alla bubblor, vilket kan förhindra neurosphere formation.
  4. Bered 28,2 x 106 av celler i 12,5 ml serumfritt medium kompletterat med 10 μm berg hämmare. Fördela 1000 celler/mikrobrunn. Centrifugera cellerna vid 300 x g i 5 min och placera plattan i inkubatorn vid 37 ° c över natten (max 36 h). Till exempel: för att få 30 humana neurala organoider, Använd en T150 kolv vid 70%-80% av sammanflödet (om 30 000 000 celler).
  5. Nästa dag (dag 1), samla in sfärerna (med en P1000) och placera dem i en 6 väl tallrik. I varje brunn, tillsätt 2 mL B27 medium och DMEM-F12 GlutaMAX och Neurobasal medium (blanda på 1:1), kompletterat med 1% B27 kosttillskott och 1% icke-essentiella aminosyror (NEAA). För att främja snabb neurala induktion, komplettera mediet med Dual-SMAD hämning cocktail, sammansatt av 10 μm tgfβ/Activin/nodal hämmare och 0,5 μm Bone morfogena protein (bmp) hämmare. Från detta steg framåt, kulorna odlas i rotation (60 rpm, orbital shaker). Rotationen är kritisk för att förhindra att sfärerna fastnar tillsammans eller på plattan.
  6. Ändra mediet varje 2-3 dagar: böj plattan och låt sfärerna falla ner i 5 min, ta bort hälften av mediet (2 mL), och tillsätt 2 mL färskt B27 medium kompletterat med tillväxtfaktorer och hämmare. Centrifugera inte sfärerna.
  7. Utför neural induktion enligt följande tidsförlopp:
    1. Från dagar 1-4, kultur sfärerna i B27 medel kompletterat med Dual-SMAD. Den Dual-SMAD hämning cocktail (10 μM TGFβ/Activin/nodal hämmare och 0,5 μM BMP-hämmare) främja neurala induktion.
    2. Från dagar 4-11, främja spridningen av hESC-härledda neurala rosetter (i sfärerna), genom att lägga till 10 ng/mL Epidermal tillväxtfaktor (EGF) och 10 ng/mL grundläggande fibroblast Factor (bFGF) till B27 medium kompletteras med Dual-SMAD cocktail.
      Obs: på dag 11 bör de flesta av cellerna vara positiva för Nestin.
    3. Från dagar 11-13, kultur sfärerna i B27 medium kompletteras med 0,5 μM BMP-hämmare.
    4. Från dagar 13-21, kultur sfärerna i B27 medium kompletteras med 10 ng/mL gliaceller härledd neurotrofa Factor (GDNF), 10 ng/mL hjärna härledd neurotrofa Factor (BDNF) och 1 μM av γ-secretase inhibitor. GDNF och BDNF främjar neuronala och gliaceller differentiering. Den γ-secretase hämmare möjliggör större neural mognad.
    5. På dag 21, platta sfärerna (om 1 000 sfärer) på en hydrofila polytetrafluoreten (PTFE) membran (6 mm diameter, 0,4 μm) deponeras på en kultur tallrik infoga avsedd för 6 väl tallrik. Stoppa all rotation från det här steget. Närvaron av rosetter, observerade med en ljus-fält Mikroskop, indikerar initiering av neurala differentiering. Den neurala rosetter kan observeras 2-3 dagar efter plätering sfärer på PTFE-membranet.
    6. Tillsätt 1 mL B27-medium kompletterat med tillväxtfaktorer och hämmare (som följd) till varje brunn under membranet insatsen, varje 2-3 dagar (vanligtvis på måndag, onsdag och fredag), för en följande 3 veckors differentiering.
    7. Från dagar 21-25, odla mänskliga neurala organoider i samma neurala mognade medium (jfr steg 2.7.4).
    8. Från dagar 25-28, endast komplement B27 medium med 1 μM γ-secretase hämmare.
    9. Från dagar 28-39, sluta lägga till γ-secretase hämmare och fortsätta mänskliga neurala Organoid kultur i B27 medium endast.
      Obs: efter 3 veckor, neurala organoider är redo att använda för GIC implantation. Längs den neurala mogningen, en minskning av neurala omogen markör Nestin och ökning av mogna neurala markörer β3-tubulin och GFAP observerades.

3. isolering och odling av glioblastoma-initierande celler (GICs)

  1. Isolera GICs genom att fragmentera en hög grad mänsklig GBM biopsi. Överför bit av tumören i en bägare som innehåller 0,25% trypsin i 0,1 mM EDTA (4:1) och sakta rör vid 37 ° c för 30-60 min (beroende på tumörstorlek).
  2. Platta de separerade cellerna i 75 cm2 vävnads odlingsflaskor pläterade på 2500-5000 celler per cm2 i GIC medium: DMEM/F-12 medium (1:1) som innehåller 1% N2, 1% B27 och 1% G5-tillskott (för att gynna GIC Survival), kompletterat med bFGF och EGF (båda vid 10 ng/ml, för att främja stemness) och 1% av penicillin/streptomycin.
  3. När GIC är väl etablerad och växande, ta bort N2 och G5 kosttillskott från GIC mediet.
  4. En dag innan du lägger cellerna på Organoid, separera GICs och räkna dem.
  5. Skölj mikrobrunn plattan med 2 ml GIC medium och centrifugera plattan med maximal hastighet för att avlägsna bubblor (1000 x g). Placera GICs på 1 000 celler för att få en gliomasphere per microwell. Inkubera över natten vid 37 ° c (figur 1c). Detta steg är nyckeln och möjliggör väl kalibrerad GICs (ett exempel på nekrotiska och överdimensionerade GICs visas i figur 2A,C).
  6. För att initiera GBM invasion, tillsätt en gliomasphere ovanpå den neurala vävnaden med en stor bar Pipettera spets (figur 1f). Placera försiktigt 6-brunnen plattan tillbaka i inkubatorn.

4. hESC-härledda dopaminerga organoider för PD-studier

  1. Dag 0: Amplify hESCs i 2D-kulturen upp till 60% confluency (dag 0), sedan ersätta stamceller som används för att bibehålla pluripotensen funktioner av hESCs med ett serumfritt medium. Starta neural induktion genom att komplettera kultur medium med 0,5 μM BMP-hämmare och 10 μM TGFβ/Activin/nodal hämmare (Dual-SMAD hämning cocktail), tillsätt sedan 10 μM ROCK inhibitor för 24 h att öka överlevnaden av celler under passagen.
  2. Dag 1: Förbered mikrobrunn plattan med 2,5 ml per brunn av serumfritt medium kompletterat med 0,5 μm BMP-hämmare, 10 μm tgfβ/Activin/nodal hämmare, och 10 μm rock inhibitor. Att ange celler mot ventrala mönstret av neuraltub, tillsätt 100 ng/mL Sonic Hedgehog (SHH), 100 ng/mL fibroblast tillväxtfaktor 8 (FGF8), och 2 μM utjämnade agonist. Centrifugera plattan (endast med medium och utan celler) vid 1200 x g i 5 min för att avlägsna luftbubblor från mikrobrunnarna.
    1. Efter 1 dag av neurala induktion i 2D, ta bort mediet och snabbt tvätta med PBS utan ca2 +/Mgcl2 +. Separera kolonierna i encells suspension genom att tillsätta 7,5 mL rekombinant enzymatisk lösning i en T75 cm2 kolv. Inkubera i 2 min vid 37 ° c och fyll sedan med 7,5 mL DMEM-F12.
    2. Samla cellsuspensionen och centrifugera vid 300 x g i 5 min. ta bort supernatanten och räkna cellerna i samma medium som används för att förbereda mikrobrunn plattan.
    3. Justera Medelvolymen för att få en cellsuspension gör det möjligt att bilda neurosfärer som innehåller 1000 celler per mikrobrunn (till exempel, den mikrobrunn plattan som används här innehåller 4 700 mikrobrunnar per brunn). Så, Förbered 4 700 000 celler i 2,5 mL medium och tillsätt den till föregående 2,5 mL av medel som redan placerats i plattan.
    4. För att korrekt fördela cellerna i varje mikrobrunn, försiktigt skaka plattan, och centrifugera mikrobrunn plattan 300 x g för 5 min. Inkubera plattan vid 37 ° c för 24 h för att generera sfärer.
  3. Dag 2: spola försiktigt mikrobrunnarna med mediet och samla sedan överföra sfärerna i vävnadsbehandlade sex-well plattan. Ersätt medium med Neurobasal medium kompletterat med 1% B27, 1x NEAA, 2 mM L-glutamin, och 1% av penicillin/streptomycin. Lägg dessutom till regionaliserings faktorer SHH, FGF8, utjämnade agonist och Dual-SMAD hämning små molekyler.
    1. Placera sfärer i rotation vid 37 ° c (60 rpm, orbital shaker) och ändra halv-medium nykompletterade varje 2-3 dagar.
  4. Dag 3: att förbättra neurala induktion och konvertera till neurala stamceller med en mellanhjärnan identitet, komplettera mediet med 3 μm GSK-3 β-hämmare, som aktiverar WNT/β-catenin väg. Behåll GSK-3 β-hämmare på mediet upp till dag 13. Uppdelad i två nya vävnadsbehandlade 6 väl plattor för att minska både sfär täthet per brunn och undvika sfär aggregering.
    Obs: vid dag 8 bör de flesta av cellerna vara positiva för Nestin.
  5. Dag 8: starta neural mognad: Ersätt regionaliserings faktorer SHH, FGF8, utjämnade agonist, och Dual-SMAD hämning cocktail med 0,5 mM dibutyryl läger (att gynna mognad), 20 nM hämmare av histondeacetylase (för cellcykelns utgång), 1 μM γ-secretase hämmare och tillväxtfaktorer, 10 ng/mL GDNF, 10 ng/mL BDNF, 1 ng/mL omvandla tillväxtfaktor β3 (TGFβ3), och 5 ng/mL FGF20 (båda gynnar DA progenitorceller överlevnad). Ändra mediet var 2-3 dag.
  6. Dag 21: generera neurala Organoid: utsäde runt 100 neurospheres under luft-flytande gränssnitt villkor på PTFE membran (6 mm diameter). Överför membranet till en kultur tallrik Infoga (0,4 mm) och tillsätt 1,2 mL neural mogning medium som används för neurosphere differentiering som tidigare beskrivits.
    1. Stoppa all rotation från det här steget. Ändra mediet varje 2-3 dagar tills önskad differentierings tid punkt uppnås.
      Anmärkning: när det gäller neurala mognad, en minskning av neurala omogen markör Nestin och ökning av mogna neurala markörer β3-tubulin och GFAP observerades. Hög TH och NURR1 uttryck observerades (figur 3c) och bekräfta neurala Organoid mognad11.

5. kvantifiering av TH och Nurr1 genuttryck för validering av dopaminerg differentiering

  1. RNA-extraktion: på indikerad dag för differentiering, lyse 40 neurospheres med 350 μL av RLT buffert (tillhandahålls i RNA Extraction Kit) kompletteras med 3,5 μL av 2-merkaptoetanol. Extrahera RNA från de lyserade neurosfärerna med hjälp av ett RNA-extraktionssats enligt tillverkarens anvisningar.
  2. Kvantifiera totala RNA-koncentrationer.
  3. Utför omvänd Transkription av 300 ng av den totala RNA-extraktionen med omvänd Transkription kit för kvantitativ realtid polymeras kedjereaktion (qPCR) och följ tillverkarens anvisningar.
  4. Utför qPCR-analys på realtids PCR-detekteringssystem, baserat på asymmetrisk cyanine Dye-detektion. Normalisera data med Housekeeping gener: glyceraldehyd-3-fosfatdehydrogenas (GAPDH) och tsträckning faktor 1-alfa (EF1). Sekvenser av primers beskrivs i tabell 1.

6. detektion av högtrycksvätskekromatografi (HPLC)

  1. Använd vätskekromatografi med hög tryck (HPLC) med elektrokemisk detektion för att detektera närvaron av dopamin. Dopamin extraherades genom lyseringslösning neurala organoider i 100 ml av 0,1 N perklorsyra (HClO4) för 15 min vid 4 ° c med en kraftig vortexa var 5 min. Efter centrifugering, samla in och förvara supernatanten vid-20 ° c för dopamin dosering.
  2. Använd en C-18-kolonn (5 μm, 4,6 mm x 150 mm) för att separera analyterna genom omvänd fas HPLC i isokratiskt läge med en flödeshastighet på 1 mL/minut. Detektion av dopamin bör utföras med hjälp av en coulometrisk detektor med konditioneringscellen inställd på en potential av + 200 mV.

7. RAW-datainspelning med microelectode array (MEA) plattform

  1. Använd en dissektion Mikroskop för att överföra neurospheres till mitten av en porös MEA enhet.
  2. Använd en förstärkare och datainsamlingssystem för elektrofysiologiska inspelningar. Mätsignal-brus-förhållande (SNR) som standardavvikelsen för spänningen under en 5 min inspelning, med hjälp av signalen som den genomsnittliga topp-till-topp spänning av spikar registreras i samma 5 min perioder.

Representative Results

De kritiska stegen i detta protokoll måste vara väl identifierade och hanteras på rätt sätt. Därför illustreras ett diagram över odlingsförhållanden som anger tidsfördröjning för varje steg samt de föreningar som används för differentierings protokollet i figur 1a och figur 3a för No plus GBM-och da neural organoider. Figur 1b, C, D, E, F illustrerar cellerna, SFÄRERNA och nej och visar den typiska morfologin för varje steg. Figur 1G, H, jag illustrerar immunofluorescensfärgning med några neurala markörer.

Figure 1
Figur 1 : Mänskliga neurala Organoid (Nej) differentierings protokoll. (A) standardiserat protokoll för generering av inga härledda från mänskliga embryonala stamceller (hESC). (B) hESCs bibehålls på extracellulär matris i hESC medium. C) microwell-plattor användes för att generera kalibrerade neurosfärer. Vid 2 veckor, var neurospheres pläterade på insatsen som innehåller ett PTFE-membran (Scale bar = 50 μm). Dmakroskopisk bild av nej i skäret i en brunn på en 6-välsplattan. Under de första dagarna, rosetter observerades (svart pil) (E). Fmakroskopisk bild av en no plus GIC-sfär högst upp. (G-I) Immunofluorescensanalys av NO plus GIC Sphere (EGFR-positiv; Scale bar = 50 μm) (G) och ingen ensam, som visade immun reaktivitet för den neuronala markören βiii-tubulin och något positivt för nestin; emellertid, synapsin 1 visade en svag signal (H, I) (skala barer = 100 μm och 50 μm, respektive). Vänligen klicka här för att se en större version av denna siffra. 

Figure 2
Figur 2 : Illustration av nekrotiska sfärer och omogen No. Den neurospheres (A) och No (B) kan genomgå nekros när de är för många i brunnen eller överdimensionerade (C) (skala bar = 10 μm). (D) en GIC infekterad med en tomat reporter hjälpa till att spåra tumör cell invasion i No, Scale bar, 10 μm. exempel på omogen No med neurala rör (E) och inga neurala rör (F) (Scale bar = 50 μm). Vänligen klicka här för att se en större version av denna siffra.

Figure 3
Figur 3 : Standardiserat protokoll för generering av da neural Organoid och Elektrofysiologisk och Morfologisk analys. (A) standardiserat protokoll för generering av da neurala organoider. (B) immunofluorescensanalys av da neurala Organoid; Th-immunoreaktiva celler Co-uttrycker Nurr1, en mellanhjärnan specifik markör (Scale bar = 50 μm). Data representeras som medelvärde ± SEM (n = 3). (C) grafer representerar kinetik av Th och Nurr1 genuttryck utvärderas av QRT-PCR. (D) representativa HPLC: dopamin Peak (pil) upptäcktes av HPLC från da neural Organoid lysate. E) exempel på rådata som registrerats med MEA-plattformen. Varje insamling visas med en lodrät linje (tidsstämplar), medan den återstående spårningen är brus. Fbild som representerar en neurosfär som DEPONERAS på MEA. (G) superposition av typiska spikar (blå och röda kurvor) som upptäckts från rådata. Den svarta, djärva kurvan anger medelvärdet av de motsvarande röda kurvorna. (H) raster handling som visar tidsstämplar som är associerade med varje Spike upptäckt. De olika färgerna belyser de olika elektroderna. Vänligen klicka här för att se en större version av denna siffra. 

Gen Fram emot Omvänd
Nurr1 GGCTGAAGCCATGCCTTGT GTGAGGTCCATGCTAAACTTGACA
Th GCACCTTCGCGCAGTTCT CCCGAACTCCACCGTGAA
EEF1 AGCAAAAATGACCCACCAATG GCCTGGATGGTTCAGGATA
GAPDH GCACAAGAGGAAAGAGAGAGAACC AGGGGAGATTCAGTGTGGGT

Tabell 1: primers som används i detta protokoll.

Discussion

En av de mest kritiska aspekterna av detta protokoll omfattar underhåll av hESC pluripotensen under cellodling och noggrann övervakning av sfärerna och neurala Organoid morfologi. hESCs är mycket känsliga, och varje manipulation kan leda till tidig okontrollerad differentiering och celldöd. För att öka experimentell reproducerbarhet och undvika förekomsten av onormala karyotyp händelser, det rekommenderas att frysa flera partier av hESCs vid den lägsta passagen efter validering av deras kromosom stabilitet. Dessutom, det rekommenderas att Tina en ny injektionsflaska för varje experiment och kontrollera beteendet hos cellerna varje dag. Om sfärerna är mindre refraktiv med onormal högre storlek, kommer de sannolikt att börja aggregera och dö.

En förbättring på detta system är antingen perfusion eller genomföra ett vaskulariserad system (genom att tillsätta endotelceller eller inom en 3D fluidic microchip)12,13. Men att kontrollera tjockleken på neurala Organoid (≤ 300 μm) möjliggör effektiv passiv perfusion av syre och näringsämnen och förebygger nekros. En annan förbättring är införandet av immunceller (microglia). Med dessa begränsningar i åtanke, neurala organoider plus ett GIC-system kan vara ett relevant verktyg av flera skäl. Först, detta system tillåter Drug screening för att övervaka hur en terapeutisk förening kan påverka en Organoid eller tumör cell. För det andra, cell-till-cell interaktioner kan studeras, och mikro-miljö bestämningsfaktorer underliggande enskilda och kollektiva invasionerna kan visualiseras och utforskas5,6,13.

I samband med Parkinsons sjukdom, en neural Organoid berikad i DA nervceller kan representera en relevant och korrekt 3D-modell för att studera sjukdomsutveckling. I tidigare studier har Parkinsons patient-derived inducerade pluripotenta stamceller differentierat mot DA neuroner har använts för att studera de drabbade neuronala subtyper. Notera, vissa sjukdomsrelaterade fenotyper såsom ansamling av α-Synuclein och känslighet för oxidativ stress har observerats14,15. Dessutom kan den neurala Organoid användas som ett verktyg för att avskärma terapeutiska molekyler. Emellertid, specifika och relevanta utläsningar bör inrättas för att utvärdera da neuron överlevnad och funktionalitet, såsom dopamin produktion och elektrofysiologiska aktivitet. Sammantaget ger detta protokoll två standardiserade och korrekta Stem cell-baserade metoder för att generera neurala organoider.

Disclosures

Författarna förklarar inga konkurrerande ekonomiska intressen.

Acknowledgments

Författarna tackar La Ligue genevoise contre le cancer (Genève, Schweiz), ISREC Foundation (Lausanne, Schweiz), och Clayton Foundation for Research (Houston, TX, USA) för ekonomiskt stöd. Dessutom författarna tackar HES-HO och Wyss Center för ekonomiskt stöd. Vi tackar Krauses labb för hjälpsamma diskussioner och stöd och Dr Halah Kutaish för korrekturläsning.

Materials

Name Company Catalog Number Comments
6-well plate (6-well plate) Falcon / Corning 07-201-588
ABI Prism 7900 HT detection system  (Real-Time PCR detection systems) Applied Biosystems Discontinued
Aggrewell 400 (Microwell culture plates ) StemCell Technologies 34421
Amplifier (W2100-HS32)  (Amplifier) Multi Channel Systems
Anti-EGFR (phospho Y1101) antibody Abcam ab76195 1/100 dilution
Anti-GFAP Antibody Dako  Z334  1/1000 dilution
Anti-Nestin, Human Antibody Millipore  ABD69  1/400 dilution
Anti-Synapsin I Antibody Chemicon  AB1543P  1/500 dilution
B27 supplements (B27) Life Technologies / Invitrogen 1238 For both protocol, stock solution 100x, final solution 1x
Brain-derived neurotrophic factor  (BDNF) Cell Guidance GFH1-2 For both protocol,  stock solution 100 µg/mL in pure H2O, final solution 20 ng/mL
CHIR-99021 (GSK-3β inhibitor ) Axon Medchem ct99021 For Dopaminergic protocol,  stock solution 7.5 mM in DMSO, final solution 3 µM
Compound E a γ–secretase inhibitor (γ–secretase inhibitor) Calbiochem CAS 209986-17-4 For both protocol (gamma-secretase inhibitor XXI),  stock solution 5 mM in DMSO, final solution 1 µM
Coulochem III  (Coulometric detector parameters) Thermo scientific
Dibutyryl cyclic-AMP (Dibutyryl cAMP) Sigma D0627 For Dopaminergic protocol,  stock solution 0.5 M in DMSO, final solution 0.5 mM
Dimethyl Sulfoxide Pure (DMSO) Sigma-Aldrich C6164 Compounds solvent, ready to use
Dulbecco's Modified Eagle Medium (DMEM) Life Technologies 12491-015 For cell culture, ready to use
Dulbecco's Modified Eagle Medium Mixture F-12 (DMEM-F12) Gibco 11320033 For cell culture, ready to use
EDTA 0.1 mM (EDTA) Life Technologies AM9912 For cell culture, ready to use
Epidermal Growth Factor (EGF) Gibco PHG0313 For GIC culture,  stock solution 100 µg/mL in pure H2O, final solution 10 ng/mL
Fibroblast Growth Factor 20 (FGF20) Peprotech 100-41 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 5 ng/mL
fibroblast growth factor 8  (FGF8) Peprotech GFH176-5 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 100 ng/mL
Fibroblast growth factor-basic (bFGF) Gibco PHG0024 For GIC culture,  stock solution 100 µg/mL in pure H2O, final solution 10 ng/mL
G5 supplements (G5) Invitrogen 17503012 For GIC culture, stock solution 100x, final solution 1x
Glial cell-derived neurotrophic factor (GDNF) Cell Guidance GFH2-2 For both protocol,  stock solution 100 µg/mL in pure H2O, final solution 20 ng/mL
Hydrophilic polytetrafluoroethylene  membrane (PTFE membrane) BioCell-Interface Discontinued
LDN-193189 (BMP inhibitor) Axon Medchem /Stemgen 04-0072-02 /1509 Dual/Smad,  stock solution 5 mM in DMSO, final solution 0.5 µM
L-glutamine (L-glutamine) Gibco 25030081 L-Glutamine (200 mM), stock solution 200 mM, final solution 2 mM
Matrigel (extracellular matrix) BD Biosciences 354277 hESC-qualified Matrix, stock solution 18-22 mg/mL, final solution 180-220 µg/mL
Millicell-CM Culture plate insert  (0.4 µm) (Culture plate insert) Millipore PICM03050
Monoclonal Anti-β-Tubulin III antibody Sigma  T8660  1/1000 dilution
MS Orbital Shaker, MS-NOR-30 (Orbital shaker) Major Science MS-NRC-30
N2 supplements (N2) Invitrogen 17502-048 For GIC culture, stock solution 100x, final solution 1x
Nanodrop (Nanodrop) Thermo Fisher Scientific Discontinued
Neurobasal (Neurobasal) Life Technologies / Gibco 21103049 Maintenance and maturation embryonic neuronal cell populations , ready to use
Non-Essential Amino Acids  (NEAA) Gibco 11140 Non-essential Amino Acids 100X, stock solution 100x, final solution 1x
Nurr1 Antibody (M-196) Santa Cruz Sc-5568 1/100 dilution
Nutristem  (hESC medium ) Biological Industries 05-100-1A Stem cell media, ready to use
Penicilin / Streptomycin  (Penicilin / Streptomycin ) Life Technologies / Gibco 15140122 For cell culture, stock solution 5 mg/mL, final solution 50 µg/mL 
Perchloric acid 0.1N (HCLO4) Merck 100519 For HPLC, ready to use
Phosphate Buffered Saline without Ca2+/Mg2+  (PBS without Ca2+/Mg2+ ) Life Technologies 14190250 For cell culture, ready to use
PrimeScript RT-PCR Kit (Reverse transcription kit) Takara RR014A
Purmorphamin (smoothened agonist) Calbiochem SML0868 For Dopaminergic protocol,  stock solution 10 mM in DMSO, final solution 2 µM
Rho-associated Kinase Y-27632 (ROCK) Abcam Biochemicals ab120129-1 Rock Inhibitor,  stock solution 50 mM in DMSO, final solution 10 µM
RNeasy mini kit (RNA extraction kit ) Qiagen 74104
SB-431542 (TGFβ/Activin/Nodal inhibitor ) Ascent Asc- 163 Dual-Smad,  stock solution 50 mM in DMSO, final solution 10 µM
Sonic Hedgehog (SHH) Cell Guidance GFH168-5 For Dopaminergic protocol,  stock solution 100 µg/mL in pure H2O, final solution 100 ng/mL
StemPro Accutase (hESC enzymatic solution) Gibco A11105-01 hESC enzymatic solution, ready to use
Symmetry C-18,5 mm (4.6 150mm2)  (Reversed-phase column) Waters Corporation
T150 flask (T150 flask) Falcon 08-772-1F
TH Antibody (F-11) Santa Cruz Sc-25269 1/200 dilution
Transforming Growth Factors beta 3 (TGFβ3) Cell Guidance GFH109-2 For Dopaminergic protocol,  stock solution 100 µg/mL in pure ethanol , final solution 1 ng/mL
Trichostatine A (inhibitor of histone deacetylase ) Sigma T8552 For Dopaminergic protocol,  stock solution 100 µM in DMSO, final solution 20 nM
TrypLE (recombinant enzymatic solution) Invitrogen 12604021 recombinant enzymatic solution, ready to use
Trypsin 0.25% (enzymatic solution) Life Technologies 15050065 enzymatic solution, ready to use
W2100, Multi Channel Systems (Data acquisition system ) WAT045905
X-vivo (serum free medium) Lonza BE04-743Q serum free medium, ready to use

DOWNLOAD MATERIALS LIST

References

  1. Louis, D. N., et al. The 2016 World Health Organization Classification of Tumors of the Central Nervous System: a summary. Acta Neuropathologica. 131, (6), 803-820 (2016).
  2. Stupp, R., et al. Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. New England Journal of Medicine. 352, (10), 987-996 (2005).
  3. Daphu, I., et al. In vivo animal models for studying brain metastasis: value and limitations. Clinical and Experimental Metastasis. 30, (5), 695-710 (2013).
  4. Huszthy, P. C., et al. In vivo models of primary brain tumors: pitfalls and perspectives. Neuro Oncology. 14, (8), 979-993 (2012).
  5. Nayernia, Z., et al. The relationship between brain tumor cell invasion of engineered neural tissues and in vivo features of glioblastoma. Biomaterials. 34, (33), 8279-8290 (2013).
  6. Cosset, E., et al. Human tissue engineering allows the identification of active miRNA regulators of glioblastoma aggressiveness. Biomaterials. 107, 74-87 (2016).
  7. Pringsheim, T., Jette, N., Frolkis, A., Steeves, T. D. The prevalence of Parkinson's's disease: a systematic review and meta-analysis. Movement Disorders. 29, (13), 1583-1590 (2014).
  8. Rajput, A. H., et al. Globus pallidus dopamine and Parkinson's motor subtypes: clinical and brain biochemical correlation. Neurology. 70, (16 Pt 2), 1403-1410 (2008).
  9. Jellinger, K. A. Pathology of Parkinson's's disease. Changes other than the nigrostriatal pathway. Molecular and Chemical Neuropathology. 14, (3), 153-197 (1991).
  10. Bernheimer, H., Birkmayer, W., Hornykiewicz, O., Jellinger, K., Seitelberger, F. Brain dopamine and the syndromes of Parkinson’s and Huntington. Clinical, morphological and neurochemical correlations. Journal of Neurological Science. 20, (4), 415-455 (1973).
  11. Tieng, V., et al. Engineering of midbrain organoids containing long-lived dopaminergic neurons. Stem Cells and Development. 23, (13), 1535-1547 (2014).
  12. Chen, C. S. 3D Biomimetic Cultures: The Next Platform for Cell Biology. Trends in Cell Biology. 26, (11), 798-800 (2016).
  13. Friedl, P., Sahai, E., Weiss, S., Yamada, K. M. New dimensions in cell migration. Nature Reviews Molecular Cell Biology. 13, (11), 743-747 (2012).
  14. Byers, B., et al. SNCA triplication Parkinson's's patient's iPSC-derived DA neurons accumulate alpha-synuclein and are susceptible to oxidative stress. PLoS ONE. 6, (11), e26159 (2011).
  15. Flierl, A., et al. Higher vulnerability and stress sensitivity of neuronal precursor cells carrying an alpha-synuclein gene triplication. PLoS ONE. 9, (11), e112413 (2014).
Mänskliga neurala Organoider för att studera hjärn cancer och neurodegenerativa sjukdomar
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Cosset, E., Locatelli, M., Marteyn, A., Lescuyer, P., Dall Antonia, F., Mor, F. M., Preynat-Seauve, O., Stoppini, L., Tieng, V. Human Neural Organoids for Studying Brain Cancer and Neurodegenerative Diseases. J. Vis. Exp. (148), e59682, doi:10.3791/59682 (2019).More

Cosset, E., Locatelli, M., Marteyn, A., Lescuyer, P., Dall Antonia, F., Mor, F. M., Preynat-Seauve, O., Stoppini, L., Tieng, V. Human Neural Organoids for Studying Brain Cancer and Neurodegenerative Diseases. J. Vis. Exp. (148), e59682, doi:10.3791/59682 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter