Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

Uso do elemento Alu contendo Minigenes para analisar RNAs circulares

doi: 10.3791/59760 Published: March 10, 2020

Summary

Clonamos e analisamos genes de repórteres gerando RNAs circulares. Esses genes de repórter são maiores do que construções para analisar emendas lineares e conter elementos Alu. Para investigar os RNAs circulares, os construtos são transfeccionados em células e o RNA resultante é analisado usando RT-PCR após a remoção do RNA linear.

Abstract

Além de mRNAs lineares, muitos genes eucaticos geram RNAs circulares. A maioria das RNAs circulares são geradas juntando-se a um site de emenda de 5' com um site de emenda upstream 3' dentro de um pré-mRNA, um processo chamado back-splicing. Essa circularização é provavelmente auxiliada por estruturas secundárias no pré-mRNA que aproximam os locais de junção. Nos genes humanos, os elementos alu são pensados para promover essas estruturas secundárias de RNA, pois os elementos alu são abundantes e exibem complementaridades de base uns com os outros quando presentes em direções opostas no pré-mRNA. Aqui, descrevemos a geração e análise de grandes elementos Alu contendo genes de repórteres que formam RNAs circulares. Através da otimização dos protocolos de clonagem, genes de repórter com comprimento de inserção de até 20 kb podem ser gerados. Sua análise em experimentos de cofecção permite a identificação de fatores regulatórios. Assim, este método pode identificar seqüências de RNA e componentes celulares envolvidos na formação de RNA circular.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

RNAs Circulares
As RNAs circulares (circRNAs) são RNAs univalentemente fechadas que são expressas na maioria dos organismos. Eles são gerados juntando um site de emenda downstream 5' a um site de emendas upstream 3', um processo chamado back-splicing(Figura 1A)1. Seqüências no pré-mRNA que exibem base complementar tão curta quanto 30-40 nt trazem locais de back-splice em alinhamento adequado para formação de cirrna2. Em humanos, os elementos Alu 1, representando cerca de 11% do genoma3, formam extensas estruturas de RNA duplamente encalhadas em pré-mRNA devido à sua auto-complementaridade4,5 e, assim, promovem a formação de cirrnas1.

Atualmente, três principais funções de cirrnas foram descritas. Algumas circRNAs ligam microRNAs (miRNAs) e através de atos de sequestro como esponjas miRNA6. CircRNAs foram implicadas na regulação transcricional e pós-transcricional, por meio de competição com emenda linear7 ou modulação da atividade do fator de transcrição8. Por fim, as cirrnas contêm quadros curtos de leitura abertas e a prova de estudos de princípio mostram que podem ser traduzidos9,10. No entanto, a função da maioria das cirrnas permanece enigmática. A maioria das RNAs circulares foram detectadas usando métodos de seqüenciamento de última geração11. Análises detalhadas de genes individuais usando abordagens RT-PCR direcionadas revelam que um grande número de RNAs circulares continua a ser descoberto12.

Uso de genes de repórteres para analisar o processamento pré-mRNA
A análise do mRNA derivado do DNA que o repórter constrói transfeccionado em células é um método bem estabelecido para estudar emendas alternativas pré-mRNA, que podem ser aplicadas a RNAs circulares. Em geral, o éon alternativo, seus íntrons circundantes e exons constitutivos são amplificados e clonados em um vetor de expressão eucariótica. Freqüentemente, os íntrons são encurtados. Os construtos são transfeccionados em células eucarióticas e geralmente analisados por RT-PCR13,14. Esta abordagem tem sido amplamente utilizada para mapear sites de emendas regulatórias e fatores transadores em experimentos de cofecção13,15,16,17,18. Além disso, a geração de minigenes que expressam proteínas permitiu a triagem de substâncias que alteram emendas alternativas19,20.

O método foi aplicado a RNAs circulares. Atualmente, pelo menos 12 backbones minigenes foram descritos na literatura e estão resumidos na Tabela 1. Com exceção do sistema de expressão baseado em tRNA21,22, todos eles são dependentes de promotores de polimerase II. Aqui, descrevemos um método para gerar minigenes de repórteres humanos para determinar fatores cis e transativos envolvidos na geração de RNAs circulares. Uma visão geral do método usando seqüências de um gene de repórter publicado23 é mostrada na Figura 1.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Projeto das construções

  1. Use o navegador de genoma UCSC24 para identificar elementos repetitivos necessários para a formação de RNA circular e incorporá-los nos construtos. É importante ressaltar que os primers para amplificação precisam estar fora dos elementos repetitivos.
  2. Cole a seqüência circular de RNA(Figura Suplementar 1 é uma seqüência de teste) em https://genome.ucsc.edu/cgi-bin/hgBlat?command=start e selecione o organismo certo. Envie a seqüência e vá para a visualização do navegador, diminua o zoom de 1,5x ou conforme apropriado(Figura 2A).
    NOTA: A seqüência de pesquisa aparece na linha superior(Figura 2A, 1). Dependendo da ordem dos éons no RNA circular, blat não ligará todos os éons. Neste exemplo, o exon 12 (Figura 2A, 4) não está ligado ao 11(Figura 2A, 2, 3),porque o exon 12 é a montante do exon 11 na seqüência circular de RNA(Figura Suplementar 1). Os elementos repetitivos estão na faixa 'repetir masker', indicada por caixas, onde a cor preta a cinza indica a conservação evolutiva(Figura 2A, 5).
  3. Passe sobre os elementos repetitivos para identificar seu subtipo em uma janela flutuante. Os elementos alu estão na linha SINE (elemento nuclear intercalado curto). Use o botão 'faixas padrão' a janela para redefinir o navegador se uma imagem diferente da Figura 2 for obtida.
    NOTA: A mousing sobre os éons no visor genético gera uma janela com números de exon que são gerados por computador. Esses números não correspondem à numeração de íons estabelecida na literatura e também mudam entre isoformas.

2. Selecione a seqüência a ser clonada em um vetor de expressão

  1. Baixe a seqüência de DNA mostrada na janela indo para Ver → DNA na linha superior do navegador de genoma UCSC. Na opção de formatação de seqüenciamento,selecione Opções de maiúsculas e cores estendidas.
  2. Selecione o caso padrão como Inferior e selecione o estojo alternar para NCBI refseq. Selecione sublinhado e negrito e itálico para Repeat Masker. Clique em Enviar. Haverá éons como letras maiúsculas e introns como letras pequenas. Verifique as fronteiras exon/intron.
  3. Neste exemplo há uma seqüência 'ccctttacCTTTTt', indicando que o navegador mostra o complemento reverso. Se este for o caso, volte e selecione a caixa de complemento reverso até ver as bordas intron corretas (agEXONgt), neste exemplo AAAAAAGgtaaggg.
  4. Copie o arquivo com a orientação correta (os éons internos são cercados por ag intronic... gt) em um documento de processamento de texto e destacar os éons(Figura Suplementar 2).
    NOTA: Neste exemplo, o fragmento genômico que abrange os exons 9-12 é em torno de 24 kb e, portanto, muito grande para ser amplificado a partir do DNA genômico. Portanto, cada íon cercado por cerca de 1 kb de região intrônica é amplificado individualmente e esses quatro fragmentos são montados em um vetor de clonagem.
  5. Selecione fragmentos a serem amplificados (exon ± 500 nt intron). Certifique-se de que o intron não comece ou termine em uma região repetitiva, pois os primers nessas regiões não amplificarão seqüências específicas. As regiões selecionadas são mostradas na Figura 2B, e suas seqüências são mostradas na Figura Suplementar 3.
    NOTA: Em geral, quanto maiores as construções, mais difícil será a clonagem. Os fragmentos podem ser montados em sentido de passo (ou seja, exon 9 é combinado com o vetor e no próximo passo exon 10 é introduzido nesta construção através da clonagem até que todos os éons estejam no lugar), ou, alternativamente, todos os fragmentos são montados simultaneamente. Uma abordagem stepwise sempre funciona, mas requer mais tempo. Uma montagem simultânea nem sempre funciona e depende de quão bem os fragmentos individuais podem ser amplificados a partir do DNA genômico e do tamanho geral da construção. Portanto, geralmente começamos com ambas as abordagens simultaneamente.

3. Projete primers para clonagem

  1. Use uma ferramenta web(https://nebuilder.neb.com/#!/)para projetar os primers para clonagem. Por exemplo, digite os fragmentos 9, 10, 11 e 12 e a seqüência vetorial(Figura Suplementar 3)para esta ferramenta.
  2. Para a seqüência vetorial, adicione o local de inserção como o último nucleotídeo e, posteriormente, adicione os fragmentos. Uma vez que a numeração vetorial não começa com um determinado local de inserção, o local de inserção no vetor está localizado e a parte a jusante é colocada na frente da seqüência upstream. Neste exemplo, as inserções começam diretamente após o site HindIII [AAGCTT] e terminam logo após o site PmeI [GTTTAAAC] do pcDNA3.1. A seqüência de cccgctgatcag ... ccgtaaaaaaggccgc é colado na frente da posição 1 na seqüência pcDNA3.1 (gttgctggcgttttttcc ...).
  3. Ajuste os primers se seus pontos de fusão estiverem com mais de 4 °C de distância, pois eles não funcionarão na amplificação. A montagem dos fragmentos e das seqüências de primer projetadas são mostradas na Figura Suplementar 4. Os primers para clonagem também podem ser projetados manualmente25.

4. Detecção de PCR e amplicon

  1. Reação PCR padrão: Faça uma mistura de reação para o volume total de 50 μL por reação. Abaixo está a receita para uma reação usando polimerase 1:
    10 μL de buffer de reação de 5x
    1 μL de 10 mM dNTPs
    2,5 μL de 10 μM Primer avançado
    2,5 μL de 10 μM Primer reverso
    0,5 μL de Polimerase 1
    32,5 μL de Nuclease grátis H2O
    1. Opcionalmente, adicione 10 μL de 5x GC Enhancer se o produto tiver alto teor de GC; fazer uma mistura separada contendo GC Enhancer para testar a reação do PCR.
  2. Alíquota 49 μL da mistura em tubos PCR por amostra de reação.
  3. Adicione 1 μL de DNA ao PCR, a quantidade varia de 10 pg a 1 ng.
  4. Gire as amostras para remover o resíduo dos lados e coloque-as em uma máquina de PCR. Use a mesma máquina, bem como os mesmos pontos na máquina ao otimizar as condições do PCR.

5. Otimização para fragmentos de DNA mais longos para uso de diferentes polimerases

  1. Temperatura
    1. Otimize a Polimerase de longo alcance 2.
      1. Use uma temperatura de desnaturação mais baixa (Polimerase 1: 98 °C, Polimerase 2: 94 °C).
      2. Use um tempo de desnaturação mais longo (Polymerase 1: 10 s, Polymerase 2: 30 s).
      3. Use um tempo de recozimento mais longo (Polymerase 1: 30 s, Polymerase 2: 60 s).
      4. Use um tempo de extensão mais longo (Polymerase 1: 30 s/kb, Polymerase 2: 50 s/kb).
      5. Use uma temperatura de extensão mais baixa (Polimerase 1: 72 °C, Polimerase 2: 65 °C).
      6. Use uma temperatura de recozimento 5 °C abaixo do Tm dos primers.
    2. Otimize as concentrações de primer (5x menos a 5x mais do que a concentração original do primer). Otimizar as concentrações de DNA de 10 pg a 50 pg, 100 pg, 1 ng, 5 ng, 10 ng.
    3. Como exemplo de um programa PCR para amplificar um tamanho de produto de 15 kb usando Polimerase 2, realizar uma desnaturação inicial a 94 °C para 30 s, desnaturação do DNA a 94 °C para 30 s seguido de recozimento a 58 °C para 30 s, e extensão de DNA a 65 °C para 12 min 30 s. Realize uma extensão final a 65 °C por 10 min com uma espera final de 4 °C.
      NOTA: A temperatura de recozimento (Ta) específica para os primers determinados por cálculos de temperatura baseados na web que são específicos para cada polimerase. Os tempos de extensão podem variar e precisam ser otimizados se os fragmentos forem maiores que 10 kb.
  2. Tempos de extensão e concentrações de DNA
    1. Use tempos de extensão mais longos para fragmentos de DNA acima de 6 kb: 1 min por 1 kb. Fragmentos mais longos devem usar menos DNA.
    2. Realizar diluições de DNA para encontrar a concentração ideal de DNA para amplificação, geralmente de 1 pg a 1 ng para plasmídeos ou 1 ng a 1 μg para DNA genômico.
      NOTA: Para a maioria dos usos de clonagem 1, projetada pela fusão do domínio de ligação de DNA Sso7d a um DNA termoestável proprietário polimerase26. A polimerase tem uma baixa taxa de erro e devido ao domínio Sso7d uma alta processividade, necessária para amplificar grandes (10-15 kb) fragmentos genômicos. Devido a este grande tamanho de fragmento, a montagem enzimática das moléculas de DNA27 é usada para inserção em vetores, pois este método não requer enzimas de restrição. A amplificação de fragmentos com mais de 15 kb fica cada vez mais difícil com a polimerase 1. Para amplificação de fragmentos de grande porte use polimerase 2 feita de polimerase de revisão semelhante a pirocóccusfundida a Sso7d ou ao kit PCR de longo alcance que dá, no entanto, taxas de erro mais altas.

6. Purificação de produtos PCR para clonagem

  1. Executar metade dos produtos PCR em géis de agarose de 1% contendo uma mancha de ácido nucleico intercalado (por exemplo, 1x GelGreen). Visualize os géis manchados em um transiluminador de leitores escuros. Este DNA manchado não é fiel ao tamanho.
    NOTA: GelGreen intercatos no DNA, semelhante ao brometo de etídio, mas é animado pela luz em torno de 500 nm (ciano), um comprimento de onda que não danifica o DNA, o que melhora muito a clonagem.
  2. Paralelamente, execute metade dos produtos PCR em um gel de 1% que está manchado após a execução com brometo de etídio(Figura 3A,B).
  3. Excise bandas do tamanho certo do gel manchado (etapa 6.1) e isolar dna usando um gel e kit de limpeza PCR. Em desvio de seu protocolo padrão, eluir o DNA em apenas 20 μL de água destilada dupla, como geralmente as concentrações de DNA são baixas.
  4. Antes da clonagem, verifique o DNA isolado em um gel de agarose para concentração e integridade (Figura 3B). Aponte para uma inserção molar 2:1 para a razão vetorial. Ao utilizar várias pastilhas, a razão é 2:2:2:1.

7. Montagem de DNA e detecção de clones

NOTA: A clonagem é feita utilizando um kit de montagem de DNA enzimático, com pequenas modificações. O conjunto é realizado por 60 min a 50 °C e geralmente a faixa inferior de DNA é usada para montagem (20-100 fmol/20 μL reação). Toda a mistura de reação é adicionada a células químicas competentes e as células inteiras banhadas em uma placa de ágar de 6 cm.

  1. Combine o vetor e insira em uma razão molar de 1:2 (20-500 fmol cada) em 10 μL de água.
  2. Adicione 10 μL de Mistura Mestre de Montagem de DNA.
  3. Incubar amostras por 60 minutos a 50 °C.
  4. Em seguida, transforme células competentes com a reação total de montagem. Aqui, use estirpe e etenta e 1 células para construções mais curtas ou estirpe e estirpe de E. coli 2 células para construções mais longas ou instáveis. As células devem estar em um volume de 50 μL.
  5. Descongele as células no gelo e adicione 2 μL do produto refrigerado montado às células competentes. Misture apertando suavemente o tubo 4-5 vezes. Não vórtice.
  6. Deixe a mistura no gelo por 30 min.
  7. Choque térmico a 42 °C para 30 s. Não misture.
  8. Transfira o tubo de volta para o gelo por 2 min.
  9. Adicione 950 μL de mídia SOC de temperatura ambiente ao tubo.
  10. Incubar o tubo de reação a 37 °C por 60 min. Agite vigorosamente (300 rpm).
  11. Placas de seleção quentes com o antibiótico apropriado durante a incubação a 37 °C.
  12. Pelotas as células através da centrifugação (10.000 x g, 30 s) e placa fora 1/4 e 3/4 de células em duas placas de seleção e incubar a 37 °C durante a noite.

8. Validação de clones

  1. Use pcr colônia, empregando primers PCR abrangendo os locais de montagem (Figura 1C) para detecção.
  2. Pegue um palito estéril e toque em uma única colônia bacteriana.
  3. Toque na parte inferior de um tubo PCR com o palito que tem a colônia e, em seguida, estique o palito em uma placa de ágar antibiótico, incubar a placa linada a 37 °C ou temperatura ambiente para construções sensíveis durante a noite.
  4. Sobreponha o tubo PCR tocado com a colônia com uma mistura de PCR contendo os primers de detecção. Estes são projetados usando primer 3(http://bioinfo.ut.ee/primer3-0.4.0/). O programa tem a opção de forçar o design do primer através de uma seqüência definida usando os sinais "[ccc]" para selecionar primers através da junção de montagem. O DNA de cepas positivas é isolado e verificado pelo sequenciamento.

9. Análise do RNA circular expressando genes de repórteres

  1. Para análise, transfect genes repórter em células eucarióticas. Aqui, use células HEK293 (ATTC #CRL-1573) pois elas dão alta eficiência de transfecção. Para economizar custos, use soluções PEI (polietilenoimina).
  2. Para a solução PEI, dissolva o cloridrato de polietilenoimina linear (PEI) a 1 mg/mL em água a um pH baixo, pH 2. Leve o pH para 7 com NaOH. Filtro estéril com filtros de 0,22 μm e armazenar a 4 °C.
  3. Divida as células em seis poços (aproximadamente 150.000 células por poço) e deixe-as crescer durante a noite em 10% de FBS em mídia DMEM.
  4. Aliquot 1 μg do gene do repórter em um tubo estéril e adicione 200 μL de NaCl estéril filtrado de 150 mM. Misture com o DNA por vórtice.
  5. Adicione a solução PEI a esta mistura e vórtice, centrífuga brevemente para coletar amostras na parte inferior do tubo. Use uma razão de 1 μg de DNA por 3 μL de PEI.
  6. Incubar em temperatura ambiente por 10 min e, em seguida, adicionar diretamente às células HEK 293.
  7. Incubar células HEK293 a 37 °C, 5% CO2, durante a noite.
  8. Isole o RNA para RT-PCR através de um kit de isolamento de RNA.

10. Tratamento RNase R para remover RNAs lineares

  1. Use 10 μg de RNA total em um tubo livre de RNase.
  2. Adicione 10 μL de tampão RNase R 10x (0,2 M Tris-HCl (pH 8.0), 1 M KCl, 1 mM MgCl2) ao RNA.
  3. Adicionar RNase R ao RNA (1 μl = 20U).
  4. Adicione 1 μL de azul glicol ao RNA e leve o volume até 100 μL com água estéril.
  5. Incubar amostras a 37 °C por 30 min.
  6. Adicione 100 μL de fenol/clorofórmio e vórtice por 1 min.
  7. Centrífuga a 21.000 x g por 1 min para separar fases.
  8. Pegue o sobrenadante (fase aquosa) e adicione 1 volume (cerca de 80 μL de clorofórmio).
  9. Vórtice por 1 min, e depois centrífuga por 1 min para fases separadas.
  10. Tome sobrenadante, adicione 1:10 vol KAc e 2,5 vol etanol, e precipite a -20 °C por 1-4 h. Centrifugagem a 4 °C por 30 min a velocidade máxima (21.000 x g). Haverá uma pequena pelota azul na parte inferior.
  11. Retire o sobrenadante e lave com 80% de etanol. Deixe o ar secar por 5 min em temperatura ambiente e dissolva em água de 10 μL.

11. Análise RT-PCR

  1. Use 1 μg de RNA por reação RT.
  2. Faça uma mistura de reação para um volume total final de 20 μL por reação. Para uma reação, use 1 μL de 10 mM dNTPs, 1 μL de 0,1 M Dithiothreitol (DTT), 4 μL de 5x First-Strand Buffer e 0,5 μL de Transcriptase Reversa.
  3. Alíquota 6,5 μL de mistura de reação em novos tubos PCR.
  4. Misture até 5 primers em uma mistura. No entanto, alguns primers podem fazer um par inversacom outros primers no PCR (Figura 5). As seqüências do primer estão na Tabela 2. Nós rotineiramente usamos primers de junção de exon-junção específicos de genes, mas priming com hexamers aleatórios também é possível.
  5. Adicione 1 μL de 10 μM Primer reverso ao tubo de reação RT desejado.
  6. Adicione 1 μg de RNA ao tubo de reação PCR.
  7. Adicione H2O sem RNase até um volume total de 20 μL.
  8. Gire os tubos para baixo para remover o resíduo no lado dos tubos e coloque no termociclador.
  9. Execute a reação RT no termociclador a 50 °C por 50 minutos.
  10. Armazene o cDNA RT a -20 °C ou proceda para a reação pcr.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Os genes dos repórteres permitem determinar fatores regulatórios que influenciam a formação circular de RNA. No entanto, esses genes de repórteres são grandes e contêm elementos repetitivos que muitas vezes tornam construções de DNA instáveis. Devido ao seu grande tamanho, muitas vezes é necessário excluir partes dos íntrons, o que é conseguido amplificando peças genômicas contendo os éons e partes menores de flanqueamento intrônico. Essas peças de DNA são montadas enzimáticamente, permitindo a construção sem enzimas de restrição.

O exemplo de um RNA circular gerado a partir do microtúbulo associado à proteína tau (MAPT) mostra uma aplicação da abordagem minigene para analisar RNAs circulares. O minigene tau 9→12 utilizado neste exemplo foi co-transfeclado com diferentes fatores de emenda e o efeito desses fatores de emenda foi detectado por RT-PCR (Figura 6). Diferentes fatores de transação influenciam tanto o RNA circular quanto a formação linear pré-mRNA. O experimento também mostra que todos os elementos de seqüência necessários para a formação de RNA circular são localizados no fragmento clonado.

Figure 1
Figura 1: Visão geral da técnica. (A)Um gene hipotético é mostrado. Introns são linhas, éons são caixas, elementos Alu são caixas listradas menores. Backsplicing de exon C para A cria um RNA circular. A estrutura deste RNA circular é mostrada no painel(E). (B)Para criar um gene repórter, os éons e os íntrons circundantes (pelo menos 500 nt de cada lado) são amplificados. Os construtos devem conter elementos repetitivos, que geralmente são elementos alu em humanos. Um exon a montante de exon A foi incluído para fornecer um elemento Alu adicional. Os fragmentos genômicos se sobreporão com seus 25 nts. (C) Os fragmentos são clonados em um vetor de expressão, conduzido por um promotor do CMV. A recombinação bem sucedida é detectada por primers de detecção e validada por seqüenciamento. (D) As células são transfeccionadas com esta construção. (E) O RNA circular é isolado e(F) amplificado utilizando primers específicos de RNA circular, primers de junção de exon preferíveis. Durante a amplificação do PCR, o RNA linear também pode ser amplificado(G). (G) Orientação dos primers utilizados para detectar RNAs circulares. O primer dianteiro está na orientação de sentido (ou seja, tem a mesma sequência do RNA) e o primer reverso está na orientação antisentido (ou seja, é o complemento reverso do RNA). Observe que diferente do RT-PCR para mRNAs lineares, o primer reverso é a montante do primer dianteiro. Clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2: Seleção da seqüência para construção de minigenes. (A) A exibição do navegador após a seqüência mostrada na Figura Suplementar 1 é executada contra o banco de dados genômico humano usando BLAT. Os números de exonde literatura 36 são indicados na exibição genética, são diferentes dos números dados pelo navegador.
1. As seqüências alinhadas são mostradas em 'YourSeq'
2-4. Observe que devido à circularidade do RNA, blat não conecta todos os éons com linhas como faz no RNA linear. Os éons 10 e 11 (correspondentes a 2 e 3) estão conectados, mas o exon 12 (correspondente a 4) não está ligado ao exon 11.
5. Os elementos alu são mostrados na faixa de elemento repetitivo.
(B)Alinhamento de seqüência entre a construção planejada e o DNA genômico.
6. A construção planejada foi executada contra o banco de dados usando BLAT.
7. Observe a inclusão de vários elementos alu na construção. Clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3: Exemplo dos amplicons antes da clonagem. (A) Produtos PCR otimizados separados em um gel de agarose de 1% contendo 1x GelGreen. As bandas individuais representam os produtos PCR que serão usados na montagem de DNA enzimático. (B) As bandas de(A) foram cortadas do gel e purificadas. Os produtos pcr purificados foram separados em um gel de agarose de 1%, que foi posteriormente manchado com brometo de etídio. Clique aqui para ver uma versão maior desta figura.

Figure 4
Figura 4: Análise de restrição de genes de repórteres. O minigene tau 9-12 usado como exemplo foi cortado com enzimas de restrição indicadas para descartar grandes recombinações. Faixa 1: corte com tamanhos esperados de NcoI 735 bp, 3345 bp, 6266 bp, faixa 2 cortada com XbaI tamanho esperado 10346 bp, faixa 3 cortada com hindIII tamanhos esperados 3951 bp, 6395 bp, faixa 4 corte com Tamanhos esperados SmaI 1168 bp, 1688 bp, 2708 bp, 4782 bp. Por favor clique aqui para ver uma versão maior deste número.

Figure 5
Figura 5: Efeito do multiplexação do primer e tratamento RNase R na detecção de RNA circular. (A) cDNA das amostras A e B derivadas de tecidos cerebrais humanos foi amplificado com primers de RNA circulares circTau exon12_10 Reverso e circTau exon10_11 Forward. A transcrição reversa do CDNA foi realizada com os primers para RNA tau linear e circular. A faixa esperada correspondente ao RNA circular tau é mostrada por um triângulo. As outras bandas fortes são artefatos que não correspondem ao genoma humano. (B) O experimento foi repetido com condições de PCR idênticas, mas a transcrição reversa foi realizada apenas com o circuntau exon12_10 primer reverso. Apenas a banda esperada foi amplificada e validada através de sequenciamento. (C) O RNA foi tratado com RNase R que remove O RNA linear. O RNA circular é detectável após o tratamento (à esquerda), enquanto o RNA linear não dá mais um sinal detectável (à direita) Clique aqui para ver uma versão maior desta figura.

Figure 6
Figura 6: Exemplo de uma análise de um gene de repórter circRNA. 1 μg do gene tau 9→1237 repórter foi transfeccionado com 1 μg de fatores de emenda indicados. O RNA foi isolado 24h após a transfecção e analisado pelo RT-PCR. (A)Amplificação do tau linear mRNA. Devido ao splicing alternativo de exon 10 duas bandas são observadas. Sua razão muda devido à superexpressão dos fatores de emenda38,39. (B) Amplificação da circular 12→10 tau RNA23. Observe a dependência da expressão tau circRNA na expressão de alguns fatores de emenda, especialmente o cdc2 como o kinase clk2 e a proteína SR 9G8. (C) O RNA circular de HIPK3 foi utilizado como um controle positivo indicando carga igual. Clique aqui para ver uma versão maior desta figura.

Tabela 1: Lista de minigenes atuais expressando RNAs circulares. Clique aqui para baixar este arquivo.

Primers de controle CIRCULAR HIPK3
Hipk3 Reverso
HIPK3 Para frente
TGCTTCTCTTTTGAGTTTC
TCGGCCAGTCATATCAAA
Primers lineares
Tau Exon 12 Reverso
Tau Exon 9 Frente
CCCAATCTCTCGACTACTC
TGTCAAGTCCAGATCGGCT
Primers circulares
circTau exon12_10 Reverter
circTau exon10_11 Forward
CAGCTTCTTAATTATCTGCTTTTTT
GAGGCGGCAGTGTGCAA

Tabela 2: Lista de Primers.

Supplemental Figure 1
Figura suplementar 1: Sequência de teste de RNA circular tau. Seqüência de teste correspondente a um RNA circular do lócus MAPT. Diferentes éons são indicados por sublinhado, small caps e grandes tampas. Clique aqui para ver uma versão maior desta figura.

Supplemental Figure 2
Figura suplementar 2: Seqüência genômica contendo o minigene planejado. Exons são destacados em cores e elementos repetitivos são sublinhados, itálicos e ousados. Sombreamento cinza indica regiões de flanco de baixa complexidade que podem ser usadas para gerar primers. Clique aqui para baixar este arquivo.

Supplemental Figure 3
Figura suplementar 3: Seqüências do gene do repórter planejado. A seqüência vetorial e os fragmentos genômicos planejados são mostrados. Clique aqui para baixar este arquivo.

Supplemental Figure 4
Figura suplementar 4: Projeto de primers para montagem. A seqüência da Figura Suplementar 3 foi inserida na ferramenta de construção. Clique aqui para ver uma versão maior desta figura.

Supplemental Figure 5
Figura suplementar 5: Seqüência do gene tau 9->12 repórter usado como exemplo. Clique aqui para baixar este arquivo.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Em geral, as RNAs circulares são baixas abundantes1, o que complica o estudo de sua função e formação. Semelhante às RNAs lineares13, o uso de minigenes repórter permite a identificação de fatores cis e trans-atuação que regulam a formação de RNAs circulares. Assim, essa abordagem gera hipóteses que podem ser ainda mais testadas usando os genes endógenos.

O passo mais crítico é o design do gene do repórter. A montagem enzimática de fragmentos de DNA ("Clonagem Gibson"27) facilita esse projeto, pois permite a construção de grandes genes de repórteres independentes de locais de restrição.

Os locais de splicing são reunidos através de repetições invertidas, que devem ser levadas em conta na construção de genes de repórteres. As repetições são anotadas no navegador de genoma 'repetir faixa' e selecioná-las mostra sua orientação. Tenha em mente que as proteínas também podem forçar os locais de splicing em uma estrutura secundária necessária para a expressão circular de RNA28 e para uma análise imparcial 1-2 kb de regiões intrônicas flanqueando deve ser investigado.

Para garantir a estabilidade dos construtos, uma consideração importante é o tipo de cepas bacterianas e suas condições de crescimento. Para bactérias de clonagem padrão de construções mais curtas e simples são usadas, que são quase idênticas ao DH5-alfa (huA2 Δ(argF-lacZ)U169 phoA glnV44 Φ80 Δ(lacZ)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17). Para fragmentos mais longos, contendo mais de 6 elementos Alu, Células competentes "estáveis" são utilizadas que carecem de recombinase (recA) e endonuclease (endA1) (F' proA+B+ lacIq ¥(lacZ)M15 zzf::Tn10 (TetR) ¥(ara-leu) 7697 araD1 39 fhuA ¥lacX74 galK16 galE15 e14- Φ80dlacZ⁄M15 recA1 relA1 endA1 nupG rpsL (StrR) rph spoT1 ・(mrr-hsdRMS-mcrBC). Se os problemas aparecerem com a recombinação, indicada por baixas contagens de transformação, emplacem as bactérias transformadas em duas placas e deixem-nas crescer a 30 ºC e 37 ºC, respectivamente. Devido à presença de inúmeros elementos repetitivos nos minigenes, eles precisam ser totalmente sequenciados usando o sequenciamento da próxima geração, que está comercialmente disponível por cerca de US $ 150 por plasmídeo a taxas de 2019. A seqüência do exemplo é mostrada na Figura Suplementar 5. Além disso, a análise de polimorfismo do comprimento do fragmento de restrição para nova preparação maior dos construtos é realizada rotineiramente. Por exemplo, o uso de sites que cortam 1-4 vezes resulta em um padrão de banda característico que exclui recombinações(Figura 4). Enzimas devem ser selecionadas que dão um padrão de banda característico de fragmentos que podem ser separados em um gel de agarose.

As RNAs circulares são analisadas com RT-PCR usando primers de junção de exon que se sobrepõem ao evento de backsplicing(Figura 1F). Devido à natureza circular do RNA, o primer inverso (ou seja, antisentido) é a montante da cartilha dianteira (ou seja, sentido)(Figura 1G). Primers detectando o RNA circular de proteína cominteração homeodomain abundantemente expressa com kinase3 (HIPK3) circular são usados como um controle positivo. Os primers reversos específicos de HIPK3 e minigenes são transcritos inversamente no mesmo tubo, o que permite sua comparação. As reações de PCR são realizadas com primers amplificando os mRNAs lineares para comparar padrões de processamento de pré-mRNAs circulares e lineares. Frequentemente observamos bandas aberrantes quando os primers para RNAs lineares e circulares foram misturados (Figura 5), e assim mantêm separada a transcrição reversa dessas amostras.

A análise RT-PCR de RNAs circulares é desafiadora e precisa ser cuidadosamente controlada. Embora sensível e conveniente, pode produzir artefatos exclusivos para RNAs circulares29. A transcrição reversa pode se mover várias vezes ao redor do círculo rna, o que gera concatemers. A maioria dos genes de repórter de RNA circular geram RNA circular e linear, que pode inter-hibridizar, levando a mais artefatos PCR21,30,31. Assim, é imprescindível sequenciar os produtos PCR e validar os achados utilizando diferentes técnicas utilizando as blots norte32 ou proteções RNase23.

Bandas inexplicáveis também podem se originar da amplificação aberrante do RNA linear. O RNA linear pode ser removido usando o RNase R de exonuclease R, que enriquece rnas circulares33 (Figura 5C). O tratamento RNase R ajuda na otimização inicial dos primers de detecção e muitas vezes pode ser omitido uma vez que os primers são otimizados.

Os back-splicingalternativos alternativos também podem contribuir para bandas inexplicáveis, pois vários RNAs circulares podem ser formados a partir de um lócus genômico34. Este back-splicing alternativo é muitas vezes o resultado de estruturas pré-mRNA concorrentes formadas por mais de dois elementos de repetição invertidos. Além disso, podem ocorrer32,35. Dependendo do objetivo experimental, os elementos Alu podem ser repetidos ou adicionados às construções. As regiões complementares que flanqueiam os locais de splicing podem ser tão curtas quanto 30-40 nt35 e a substituição de elementos de Alu por regiões complementares mais curtas pode aumentar a formação de RNA circular2, que pode ser testada para melhorar a formação de RNA circular. Uma vez identificadas as seqüências pré-mRNA que causam o back-splicing, é possível assim encurtar os construtos de RNA circular, o que pode melhorar a eficiência da transfecção em alguns casos.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Nada para revelar.

Acknowledgments

Este trabalho foi apoiado pelo Departamento de Defesa DoD conceder AZ180075. Stefan Stamm agradece jacqueline Noonan Endowment. Anna Pawluchin foi apoiada pelo DAAD, programa alemão de intercâmbio acadêmico, Justin R. Welden recebeu o Prêmio Da Universidade de Kentucky Max Steckler.

Materials

Name Company Catalog Number Comments
(PEI) Hydrochloride Polysciences 24765-1
Builder tool NEB https://nebuilder.neb.com/#!/
Dark Reader Transilluminator. Clare Chemical Research
Enzymatic DNA assembly kit NEB E2621S
Gel and PCR cleanup kit Promega A9282
Glyco Blue Thermo Fisher AM9516
pcDNA3.1 cloning site Polycloning site https://assets.thermofisher.com/TFS-Assets/LSG/manuals/pcdna3_1_man.pdf
Polymerase 1 NEB M0491L Q5 DNA polymerase
Polymerase 2 Biorad 1725310 Long range polymerase (NEB), iproof (BioRad)
Polymerase 2 Qiagen 206402 Qiagen long range polymerase kit
Reverse Transcriptase Thermo Fisher 18080044
RNA isolation kit Life Technologies 12183025 Ambion by Life Technologies
RNAse R Lucigen RNR07250 Epicenter/Lucigen
Stable competent cells NEB C3040H NEB stable cells
Standard cloning bacteria NEB C2988J NEB5-alpha competent
Web tool to design primers NEB https://nebuilder.neb.com/#!/
Web-based temperature calculations NEB https://tmcalculator.neb.com/#!/main

DOWNLOAD MATERIALS LIST

References

  1. Jeck, W. R., et al. Circular RNAs are abundant, conserved, and associated with ALU repeats. RNA. 19, (2), 141-157 (2013).
  2. Zhang, X. O., et al. Complementary sequence-mediated exon circularization. Cell. 159, (1), 134-147 (2014).
  3. Deininger, P. Alu elements: know the SINEs. Genome Biology. 12, (12), 236 (2011).
  4. Bazak, L., Levanon, E. Y., Eisenberg, E. Genome-wide analysis of Alu editability. Nucleic Acids Research. 42, (11), 6876-6884 (2014).
  5. Levanon, E. Y., et al. Systematic identification of abundant A-to-I editing sites in the human transcriptome. Nature Biotechnology. 22, (8), 1001-1005 (2004).
  6. Hansen, T. B., et al. Natural RNA circles function as efficient microRNA sponges. Nature. 495, (7441), 384-388 (2013).
  7. Kelly, S., Greenman, C., Cook, P. R., Papantonis, A. Exon Skipping Is Correlated with Exon Circularization. Journal of Molecular Biology. 427, (15), 2414-2417 (2015).
  8. Li, Z., et al. Exon-intron circular RNAs regulate transcription in the nucleus. Nature Structural & Molecular Biology. 22, (3), 256-264 (2015).
  9. Yang, Y., et al. Extensive translation of circular RNAs driven by N(6)-methyladenosine. Cell Research. 27, (6), 626-641 (2017).
  10. Abe, N., et al. Rolling Circle Translation of Circular RNA in Living Human Cells. Scientific Reports. 5, 16435 (2015).
  11. Salzman, J., Chen, R. E., Olsen, M. N., Wang, P. L., Brown, P. O. Cell-type specific features of circular RNA expression. PLOS Genetics. 9, (9), 1003777 (2013).
  12. Ottesen, E. W., Luo, D., Seo, J., Singh, N. N., Singh, R. N. Human Survival Motor Neuron genes generate a vast repertoire of circular RNAs. Nucleic Acids Research. 47, (6), 2884-2905 (2019).
  13. Stoss, O., Stoilov, P., Hartmann, A. M., Nayler, O., Stamm, S. The in vivo minigene approach to analyze tissue-specific splicing. Brain Research Protocols. 4, 383-394 (1999).
  14. Mardon, H. J., Sebastio, G., Baralle, F. E. A role for exon sequences in alternative splicing of the human fibronectin gene. Nucleic Acids Research. 15, 7725-7733 (1987).
  15. Gaildrat, P., et al. Use of splicing reporter minigene assay to evaluate the effect on splicing of unclassified genetic variants. Methods in Molecular Biology. 653, 249-257 (2010).
  16. Cooper, T. A. Use of minigene systems to dissect alternative splicing elements. Methods. 37, (4), 331-340 (2005).
  17. Baralle, D., Baralle, M. Splicing in action: assessing disease causing sequence changes. Journal of Medical Genetics. 42, (10), 737-748 (2005).
  18. Percifield, R., Murphy, D., Stoilov, P. Medium throughput analysis of alternative splicing by fluorescently labeled RT-PCR. Methods in Molecular Biology. 1126, 299-313 (2014).
  19. Stoilov, P., Lin, C. H., Damoiseaux, R., Nikolic, J., Black, D. L. A high-throughput screening strategy identifies cardiotonic steroids as alternative splicing modulators. Proceedings of the National Academy of Sciences of the United States of America. 105, (32), 11218-11223 (2008).
  20. Shen, M., et al. Pyrvinium pamoate changes alternative splicing of the serotonin receptor 2C by influencing its RNA structure. Nucleic Acids Research. 41, (6), 3819-3832 (2013).
  21. Noto, J. J., Schmidt, C. A., Matera, A. G. Engineering and expressing circular RNAs via tRNA splicing. RNA Biology. 1-7 (2017).
  22. Schmidt, C. A., Noto, J. J., Filonov, G. S., Matera, A. G. A Method for Expressing and Imaging Abundant, Stable, Circular RNAs In Vivo Using tRNA Splicing. Methods in Enzymology. 572, 215-236 (2016).
  23. Welden, J. R., van Doorn, J., Nelson, P. T., Stamm, S. The human MAPT locus generates circular RNAs. Biochimica et Biophysica Acta - Molecular Basis of Disease. 2753-2760 (2018).
  24. Casper, J., et al. The UCSC Genome Browser database: 2018 update. Nucleic Acids Research. 46, 762-769 (2018).
  25. Grozdanov, P. N., MacDonald, C. C. Generation of plasmid vectors expressing FLAG-tagged proteins under the regulation of human elongation factor-1alpha promoter using Gibson assembly. Journal of Visualized Experiments. (96), (2015).
  26. Wang, Y., et al. A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Research. 32, (3), 1197-1207 (2004).
  27. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  28. Conn, S. J., et al. The RNA binding protein quaking regulates formation of circRNAs. Cell. 160, (6), 1125-1134 (2015).
  29. Jeck, W. R., Sharpless, N. E. Detecting and characterizing circular RNAs. Nature Biotechnology. 32, (5), 453-461 (2014).
  30. Pamudurti, N. R., et al. Translation of CircRNAs. Molecular Cell. 66, (1), 9-21 (2017).
  31. Kramer, M. C., et al. Combinatorial control of Drosophila circular RNA expression by intronic repeats, hnRNPs, and SR proteins. Genes & Development. 29, (20), 2168-2182 (2015).
  32. Starke, S., et al. Exon circularization requires canonical splice signals. Cell Reports. 10, (1), 103-111 (2015).
  33. Suzuki, H., Tsukahara, T. A view of pre-mRNA splicing from RNase R resistant RNAs. International Journal of Molecular Sciences. 15, (6), 9331-9342 (2014).
  34. Zhang, X. O., et al. Diverse alternative back-splicing and alternative splicing landscape of circular RNAs. Genome Research. 26, (9), 1277-1287 (2016).
  35. Liang, D., Wilusz, J. E. Short intronic repeat sequences facilitate circular RNA production. Genes & Development. 28, (20), 2233-2247 (2014).
  36. Wang, Y., Mandelkow, E. Tau in physiology and pathology. Nature Reviews Neuroscience. 17, (1), 5-21 (2016).
  37. Fejes-Toth, K., et al. Post-transcriptional processing generates a diversity of 5'-modified long and short RNAs. Nature. 457, (7232), 1028-1032 (2009).
  38. Gao, Q. S., et al. Complex regulation of tau exon 10, whose missplicing causes frontotemporal dementia. Journal of Neurochemistry. 74, (2), 490-500 (2000).
  39. Hartmann, A. M., et al. Regulation of alternative splicing of human tau exon 10 by phosphorylation of splicing factors. Molecular and Cellular Neuroscience. 18, (1), 80-90 (2001).
  40. Wang, Y., Wang, Z. Efficient backsplicing produces translatable circular mRNAs. RNA. 21, (2), 172-179 (2015).
  41. Yang, Y., Wang, Z. Constructing GFP-Based Reporter to Study Back Splicing and Translation of Circular RNA. Methods in Molecular Biology. 1724, 107-118 (2018).
  42. Zheng, Q., et al. Circular RNA profiling reveals an abundant circHIPK3 that regulates cell growth by sponging multiple miRNAs. Nature Communications. 7, 11215 (2016).
  43. Jia, W., Xu, B., Wu, J. Circular RNA expression profiles of mouse ovaries during postnatal development and the function of circular RNA epidermal growth factor receptor in granulosa cells. Metabolism. 85, 192-204 (2018).
  44. Liang, D., et al. The Output of Protein-Coding Genes Shifts to Circular RNAs When the Pre-mRNA Processing Machinery Is Limiting. Molecular Cell. 68, (5), 940-954 (2017).
  45. Legnini, I., et al. Circ-ZNF609 Is a Circular RNA that Can Be Translated and Functions in Myogenesis. Molecular Cell. 66, (1), 22-37 (2017).
  46. Li, X., et al. Coordinated circRNA Biogenesis and Function with NF90/NF110 in Viral Infection. Molecular Cell. 67, (2), 214-227 (2017).
  47. Zhang, Y., et al. The Biogenesis of Nascent Circular RNAs. Cell Reports. 15, (3), 611-624 (2016).
Uso do <em>elemento Alu</em> contendo Minigenes para analisar RNAs circulares
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Welden, J. R., Pawluchin, A., van Doorn, J., Stamm, S. Use of Alu Element Containing Minigenes to Analyze Circular RNAs. J. Vis. Exp. (157), e59760, doi:10.3791/59760 (2020).More

Welden, J. R., Pawluchin, A., van Doorn, J., Stamm, S. Use of Alu Element Containing Minigenes to Analyze Circular RNAs. J. Vis. Exp. (157), e59760, doi:10.3791/59760 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter