Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

Utilisation d’un élément Alu contenant des minigènes pour analyser les ARN circulaires

doi: 10.3791/59760 Published: March 10, 2020

Summary

Nous cloner et analyser les gènes des reporters générant des ARN circulaires. Ces gènes reporter sont plus grands que les constructions pour analyser l’épissage linéaire et contenir des éléments Alu. Pour étudier les ARN circulaires, les constructions sont transfected dans les cellules et l’ARN résultant est analysé à l’aide de RT-PCR après l’élimination de l’ARN linéaire.

Abstract

En plus des ARM linéaires, de nombreux gènes eucaryotes génèrent des ARN circulaires. La plupart des ARN circulaires sont générés en rejoignant un site d’épissage 5' avec un site d’épissage en amont 3' dans un pré-mRNA, un processus appelé back-splicing. Cette circularisation est probablement facilitée par des structures secondaires dans le pré-mRNA qui amènent les sites d’épissage à proximité. Dans les gènes humains, les éléments Alu sont pensés pour promouvoir ces structures secondaires d’ARN, car les éléments d’Alu sont abondants et présentent des complémentarités de base les unes avec les autres lorsqu’ils sont présents dans des directions opposées dans l’ARN pré-m. Ici, nous décrivons la génération et l’analyse de grand élément Alu contenant des gènes de reporter qui forment des ARN circulaires. Grâce à l’optimisation des protocoles de clonage, des gènes reporter avec jusqu’à 20 kb de longueur d’insertion peuvent être générés. Leur analyse dans les expériences de co-transfection permet d’identifier les facteurs réglementaires. Ainsi, cette méthode peut identifier les séquences d’ARN et les composants cellulaires impliqués dans la formation circulaire d’ARN.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Arn circulaires
Les ARN circulaires (circRNAs) sont des ARN échoués isolés fermés covalentement qui sont exprimés dans la plupart des organismes. Ils sont générés en rejoignant un site d’épissage en aval 5' à un site d’épissage en amont 3', un processus appelé back-splicing (Figure 1A)1. Les séquences de l’ARNM pré-mRNA qui présentent une base complémentaire aussi courte que 30-40 nt apportent des sites d’attelle arrière dans un alignement approprié pour la formation d’ARN2. Chez l’homme, les éléments Alu 1, représentant environ 11% du génome3, forment de vastes structures d’ARN double brin dans l’ARN pré-mRNA en raison de leur auto-complémentarité4,5 et favorisent ainsi la formation de circRNAs1.

À l’heure actuelle, trois fonctions principales des circARN ont été décrites. Certains circRNAs lient microARN (miRNAs) et par la séquestration agissent comme des éponges miRNA6. Les CircRNAs ont été impliqués dans la régulation transcriptionnelle et post-transcriptionnelle, par la concurrence avec l’épissage linéaire7 ou la modulation de l’activité du facteur de transcription8. Enfin, les circARN contiennent de courts cadres de lecture ouverts et des études de preuve de principe montrent qu’ils peuvent être traduits9,10. Cependant, la fonction de la plupart des circRNAs reste énigmatique. La majorité des ARN circulaires ont été détectés à l’aide de méthodes de séquençage de nouvelle génération11. Des analyses détaillées des gènes individuels à l’aide d’approches ciblées RT-PCR révèlent qu’un grand nombre d’ARN circulaires reste à découvrir12.

Utilisation de gènes reporter pour analyser le traitement pré-mRNA
L’analyse de l’ARNm dérivée des constructions de reporter d’ADN transfected dans des cellules est une méthode bien établie pour étudier l’épissage alternatif d’ARNm, qui peut être appliqué aux ARN circulaires. En général, l’exon alternatif, ses introns environnants, et les exons constitutifs sont amplifiés et clonés dans un vecteur d’expression eucaryote. Fréquemment, les introns sont raccourcis. Les constructions sont transfected dans des cellules eucaryotes et généralement analysés par RT-PCR13,14. Cette approche a été largement utilisée pour cartographier les sites d’épissage réglementaire et les facteurs trans-acteurs dans les expériences de co-transfection13,15,16,17,18. En outre, la génération de minigènes exprimant des protéines a permis le dépistage des substances qui changent l’épissage alternatif19,20.

La méthode a été appliquée aux ARN circulaires. À l’heure actuelle, au moins 12 épines dorsales minigène ont été décrites dans la littérature et sont résumées dans le tableau 1. À l’exception du système d’expression basé sur l’ARN TRNA21,22, ils sont tous dépendants des promoteurs de polymérase II. Ici, nous décrivons une méthode pour générer des minigènes de reporter humain pour déterminer les cis et les facteurs trans-agissant impliqués dans la génération des ARN circulaires. Un aperçu de la méthode à l’aide de séquences d’un gène reporter publié23 est montré dans la figure 1.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Conception des constructions

  1. Utilisez le navigateur24 du génome de l’UCSC pour identifier les éléments répétitifs nécessaires à la formation circulaire d’ARN et les incorporer dans les constructions. Fait important, les amorces pour l’amplification doivent être en dehors des éléments répétitifs.
  2. Coller la séquence circulaire d’ARN(figure supplémentaire 1 est une séquence d’essai) en https://genome.ucsc.edu/cgi-bin/hgBlat?command=start et sélectionnez le bon organisme. Soumettez la séquence et rendez-vous sur la vue du navigateur, zoomez sur 1.5x ou le cas(figure 2A).
    REMARQUE : La séquence de recherche apparaît dans la ligne supérieure(figure 2A, 1). Selon l’ordre des exons dans l’ARN circulaire, BLAT ne reliera pas tous les exons. Dans cet exemple, exon 12(figure 2A, 4) n’est pas relié à 11(figure 2A, 2, 3), parce que l’exon 12 est en amont de l’exon 11 dans la séquence circulaire d’ARN(figure supplémentaire 1). Les éléments répétitifs se trouvent sur la piste du « masque à répétition », indiquée par les boîtes, où la couleur noir à gris indique la conservation évolutive(figure 2A, 5).
  3. Souris sur les éléments répétitifs pour identifier leur sous-type dans une fenêtre flottante. Les éléments Alu sont dans la ligne SINE (élément nucléaire entrecoupé court). Utilisez le bouton « pistes par défaut » sous la fenêtre pour réinitialiser le navigateur si une image différente de la figure 2 est obtenue.
    REMARQUE : Le moussage sur les exons dans l’affichage de gène génère une fenêtre avec des nombres d’exon qui sont générés par ordinateur. Ces chiffres ne correspondent pas à la numérotation exon établie dans la littérature et changent également entre les isoformes.

2. Sélectionnez la séquence à cloner dans un vecteur d’expression

  1. Téléchargez la séquence d’ADN montrée dans la fenêtre en allant voir l’ADN sur la ligne supérieure du navigateur du génome de l’UCSC. Dans l’option de mise en forme de séquençage, sélectionnez des options de cas/couleur étendues.
  2. Sélectionnez le cas par défaut comme inférieur et sélectionnez le cas de basculement pour NCBI refseq. Sélectionnez souligner, et audacieux, et italique pour Repeat Masker. Cliquez sur Soumettre. Il y aura des exons comme majuscules et introns comme de petites lettres. Vérifiez les frontières exon/intron.
  3. Dans cet exemple, il existe une séquence 'ccctttacCTTTTT', indiquant que le navigateur affiche le complément inverse. Si c’est le cas, revenez en arrière et sélectionnez la boîte de complément inversée jusqu’à ce que vous voyez les frontières intrones exon correctes (agEXONgt), dans cet exemple AAAAAGgtaaaggg.
  4. Copiez le fichier avec la bonne orientation (les exons internes sont entourés d’ag introniques... gt) dans un document de traitement de texte et mettre en évidence les exons(figure supplémentaire 2).
    REMARQUE : Dans cet exemple, le fragment génomique qui englobe les exons 9-12 est d’environ 24 kb et donc trop grand pour être amplifié à partir de l’ADN génomique. Par conséquent, chaque exon entouré d’environ 1 kb région intronique est individuellement amplifié et ces quatre fragments sont assemblés dans un vecteur de clonage.
  5. Sélectionnez des fragments à amplifier (exon 500 nt intron). Assurez-vous que l’intron ne commence pas ou ne se termine pas dans une région répétitive, car les amorces dans ces régions n’amplifieront pas des séquences spécifiques. Les régions sélectionnées sont indiquées dans la figure 2B, et leurs séquences sont affichées dans la figure supplémentaire 3.
    REMARQUE : En général, plus les constructions sont grandes, plus le clonage sera difficile. Les fragments peuvent être assemblés soit étape sage (c.-à-d., exon 9 est combiné avec le vecteur et dans l’étape suivante exon 10 est introduit dans cette construction via le clonage jusqu’à ce que tous les exons sont en place), ou alternativement, tous les fragments sont assemblés simultanément. Une approche progressive fonctionne toujours mais demande plus de temps. Un assemblage simultané ne fonctionne pas toujours et dépend de la façon dont les fragments individuels peuvent être amplifiés à partir de l’ADN génomique et de la taille globale de la construction. Nous commençons donc généralement par les deux approches simultanément.

3. Amorce de conception pour le clonage

  1. Utilisez un outil web (https://nebuilder.neb.com/#!/) pour concevoir les amorces pour le clonage. Par exemple, entrez les fragments 9, 10, 11 et 12 et la séquence vectorielle(figure supplémentaire 3) à cet outil.
  2. Pour la séquence vectorielle, ajoutez le site d’insertion comme dernier nucléotide et ajoutez ensuite les fragments. Comme la numérotation vectorielle ne commence pas par un site d’insertion donné, le site d’insertion dans le vecteur est situé et la partie en aval est mise en face de la séquence en amont. Dans cet exemple, les encarts commencent directement après le site HindIII [AAGCTT] et se terminent directement après le site PmeI [GTTTAAAC] de pcDNA3.1. La séquence de cccgctgatcag ... ccgtaaaaaggccgc est collé devant la position 1 dans la séquence pcDNA3.1 (gttgctggcgtttttcc...).
  3. Ajuster les amorces si leurs points de fusion sont à plus de 4 oC d’intervalle, car ils ne fonctionneront pas dans l’amplification. L’assemblage des fragments et des séquences d’amorce conçus sont indiqués dans la figure supplémentaire 4. Les amorces pour le clonage peuvent également être conçues manuellement25.

4. Détection PCR et amplicon

  1. Réaction PCR standard : Faites un mélange de réaction pour un volume total de 50 l par réaction. Voici la recette d’une réaction à l’aide de polymérase 1:
    10 l de 5x Reaction Buffer
    1 L de 10 mM dNTPs
    2.5 L de 10 'M Forward Primer
    2.5 L de 10 'M Reverse Primer
    0.5 L de Polymérase 1
    32.5 L de Nuclease libre H2O
    1. Optionnellement, ajoutez 10 L de 5x GC Enhancer si le produit a une teneur élevée en GC; faire un mélange séparé contenant GC Enhancer pour tester la réaction PCR.
  2. Aliquot 49 L du mélange dans des tubes PCR par échantillon de réaction.
  3. Ajoutez 1 L d’ADN au PCR, la quantité varie de 10 pg à 1 ng.
  4. Faites tourner les échantillons pour enlever les résidus sur les côtés et les placer dans une machine PCR. Utilisez la même machine ainsi que les mêmes taches dans la machine lors de l’optimisation des conditions PCR.

5. Optimisation pour des fragments d’ADN plus longs pour l’utilisation de différentes polymérases

  1. Température
    1. Optimisez la polymérase 2 à longue portée.
      1. Utilisez une température de dénaturation plus basse (Polymérase 1 : 98 oC, Polymérase 2 : 94 oC).
      2. Utilisez un temps de dénaturation plus long (Polymérase 1: 10 s, Polymérase 2: 30 s).
      3. Utilisez un temps d’annealing plus long (Polymérase 1: 30 s, Polymérase 2: 60 s).
      4. Utilisez un temps de prolongation plus long (Polymérase 1: 30 s/kb, Polymerase 2: 50 s/kb).
      5. Utilisez une température d’extension plus basse (Polymérase 1 : 72 oC, Polymérase 2 : 65 oC).
      6. Utilisez une température d’annealing de 5 oC sous le Tm des amorces.
    2. Optimisez les concentrations d’amorce (5x de moins à 5x de plus que la concentration d’apprêt d’origine). Optimiser les concentrations d’ADN de 10 pg à 50 pg, 100 pg, 1 ng, 5 ng, 10 ng.
    3. À titre d’exemple d’un programme DE PCR visant à amplifier une taille de produit de 15 kb à l’aide de polymérase 2, effectuer une dénaturation initiale à 94 oC pour 30 s, la dénaturation de l’ADN à 94 k.-O pour 30 s, suivie de l’annealing à 58 oC pour 30 s, et une extension de l’ADN à 65 oC pour 12 min 30 s. Effectuer une extension finale à 65 oC pendant 10 min avec une dernière cale de 4 oC.
      REMARQUE : La température d’annealing (Ta) spécifique pour les amorces déterminées par des calculs de température web qui sont spécifiques pour chaque polymérase. Les délais d’extension peuvent varier et doivent être optimisés si les fragments sont plus grands que 10 kb.
  2. Temps d’extension et concentrations d’ADN
    1. Utiliser des délais d’extension plus longs pour les fragments d’ADN de plus de 6 kb : 1 min par 1 kb. Les fragments plus longs devraient utiliser moins d’ADN.
    2. Effectuez des dilutions de l’ADN pour trouver la concentration optimale d’ADN pour l’amplification, habituellement 1 pg à 1 ng pour les plasmides ou 1 ng à 1 g pour l’ADN génomique.
      REMARQUE : Pour la plupart des clonage emploient la polymérase 1, conçu en fusionnant le domaine de liaison d’ADN Sso7d à une polymérase thermostable propriétaire de polymérase26. La polymérase a un faible taux d’erreur et en raison du domaine Sso7d une haute processivité, nécessaire pour amplifier de grands fragments génomiques (10-15 kb). En raison de cette grande taille de fragment, l’assemblage enzymatique des molécules d’ADN27 est utilisé pour l’insertion dans les vecteurs, car cette méthode ne nécessite pas d’enzymes de restriction. L’amplification des fragments de plus de 15 kb devient de plus en plus difficile avec la polymérase 1. Pour une grande amplification des fragments, utilisez la polymérase 2 à partir de pyrocoque-commela polymérase relectrée fusionnée à Sso7d ou le kit PCR à longue portée qui donne, cependant, des taux d’erreur plus élevés.

6. Purification des produits PCR pour le clonage

  1. Exécuter la moitié des produits PCR sur 1% gels d’agarose contenant une tache d’acide nucléique intercalante (par exemple, 1x GelGreen). Visualisez les gels tachés sur un transilluminateur de lecteur foncé. Cet ADN taché ne fonctionne pas fidèle à la taille.
    REMARQUE : GelGreen s’intercale dans l’ADN, semblable au bromure d’éthédé, mais il est excité par la lumière autour de 500 nm (cyan), une longueur d’onde qui n’endommage pas l’ADN, ce qui améliore fortement le clonage.
  2. En parallèle, exécuter la moitié des produits PCR sur un gel de 1% qui est taché après l’exécution avec du bromure d’éthidium (figure 3A,B).
  3. Accisez les bandes de la bonne taille du gel taché (étape 6.1) et isolez l’ADN à l’aide d’un gel et d’un kit de nettoyage PCR. En écartant son protocole standard, elute l’ADN dans seulement 20 L d’eau distillée double, comme habituellement les concentrations d’ADN sont faibles.
  4. Avant le clonage, vérifiez l’ADN isolé sur un gel d’agarose pour la concentration et l’intégrité(figure 3B). Visez un rapport d’insertion de 2:1 molaire/vecteur. Lors de l’utilisation de plusieurs inserts, le rapport est de 2:2:2:1.

7. Détection d’assemblage d’ADN et de clone

REMARQUE : Le clonage se fait à l’aide d’une trousse d’assemblage d’ADN enzymatique, avec des modifications mineures. L’assemblage est effectué pendant 60 min à 50 oC et généralement la gamme inférieure d’ADN est utilisée pour l’assemblage (20-100 fmol/20 'L réaction). Le mélange de réaction entier est ajouté aux cellules chimiques compétentes et les cellules entières plaquées sur une plaque d’agar de 6 cm.

  1. Mélanger le vecteur et insérer dans un rapport de 1:2 molaire (20-500 fmol chacun) dans 10 L d’eau.
  2. Ajouter 10 L de mélange maître d’assemblage d’ADN.
  3. Incuber des échantillons pendant 60 minutes à 50 oC.
  4. Ensuite, transformer les cellules compétentes avec la réaction totale d’assemblage. Ici, utilisez la souche E. coli 1 cellules pour des constructions plus courtes ou la souche E. coli 2 cellules pour des constructions plus longues ou instables. Les cellules doivent être dans un volume de 50 L.
  5. Décongeler les cellules sur la glace et ajouter 2 l de produit assemblé réfrigéré aux cellules compétentes. Mélanger en clignotant doucement le tube 4-5 fois. Ne pas vortex.
  6. Laisser reposer le mélange sur la glace pendant 30 min.
  7. Choc thermique à 42 oC pour 30 s. Ne mélangez pas.
  8. Transférer le tube dans la glace pendant 2 min.
  9. Ajouter 950 L de SOC Media à température ambiante dans le tube.
  10. Incuber le tube de réaction à 37 oC pendant 60 min. Shake vigoureusement (300 tr/min).
  11. Plaques de sélection chaudes avec l’antibiotique approprié pendant l’incubation à 37 oC.
  12. Pelletez les cellules par centrifugation (10 000 x g,30 s) et plaquez 1/4 et 3/4 des cellules sur deux plaques de sélection et incuber à 37 oC pendant la nuit.

8. Validation des clones

  1. Utilisez la colonie PCR, en utilisant des amorces PCR couvrant les sites d’assemblage (figure 1C) pour la détection.
  2. Prenez un cure-dent stérile et touchez une seule colonie bactérienne.
  3. Touchez le fond d’un tube PCR avec le cure-dent qui a la colonie, puis strez le cure-dent sur une plaque d’agar antibiotique, incuber la plaque strié à 37 oC ou température ambiante pour les constructions sensibles pendant la nuit.
  4. Superposer le tube PCR touché par la colonie avec un mélange PCR contenant les amorces de détection. Ceux-ci sont conçus à l’aide de l’amorce 3 (http://bioinfo.ut.ee/primer3-0.4.0/). Le programme a la possibilité de forcer la conception d’apprêt à travers une séquence définie en utilisant les panneaux « [ccc] » pour sélectionner les amorces à travers la jonction d’assemblage. L’ADN des souches positives est isolé et vérifié par séquençage.

9. Analyse de l’ARN circulaire exprimant les gènes des journalistes

  1. Pour l’analyse, transfect gènes de reporter dans les cellules eucaryotes. Ici, utilisez les cellules HEK293 (ATTC #CRL-1573) car elles donnent une efficacité transfection élevée. Pour économiser des coûts, utilisez des solutions PEI (polyéthylèneimine).
  2. Pour la solution de l’Ile-du-Prince-Édouard, dissoudre l’hydrochlorure linéaire de polyéthylèneimine (PEI) à 1 mg/mL dans l’eau à faible pH, pH 2. Apportez le pH à 7 avec NaOH. Filtre stérile avec filtres de 0,22 m et stockez à 4 oC.
  3. Diviser les cellules en six puits (environ 150 000 cellules par puits) et les laisser se développer du jour au lendemain en 10 % de FBS dans les médias DMEM.
  4. Aliquot 1 g du gène reporter dans un tube stérile et ajouter 200 lil de 150 mM filtré stérile NaCl. Mélanger avec l’ADN par vortexing.
  5. Ajoutez la solution de l’Ile-du-Prince-Édouard à ce mélange et au vortex, brièvement centrifugeuse pour prélever des échantillons au fond du tube. Utilisez un rapport de 1 g d’ADN par 3 lil de l’Ile-du-Prince-Édouard.
  6. Incuber à température ambiante pendant 10 min, puis ajouter directement aux cellules HEK 293.
  7. Incuber les cellules HEK293 à 37 oC, 5% de CO2, du jour au lendemain.
  8. Isolez l’ARN pour RT-PCR via un kit d’isolation d’ARN.

10. Traitement RNase R pour enlever les ARN linéaires

  1. Utilisez 10 g d’ARN total dans un tube sans RNase.
  2. Ajouter 10 L de tampon RNase R (0,2 M Tris-HCl (pH 8.0), 1 M KCl, 1 mM MgCl2) à l’ARN.
  3. Ajouter RNase R à l’ARN (1 l à 20U).
  4. Ajouter 1 l de bleu glycol à l’ARN et porter le volume jusqu’à 100 ll avec de l’eau stérile.
  5. Incuber les échantillons à 37 oC pendant 30 min.
  6. Ajouter 100 L de phénol/chloroforme et le vortex pendant 1 min.
  7. Centrifugeuse à 21 000 x g pendant 1 min pour séparer les phases.
  8. Prenez le supernatant (phase aqueuse) et ajoutez 1 volume (environ 80 l de chloroforme).
  9. Vortex pendant 1 min, puis centrifugeuse pendant 1 min pour séparer les phases.
  10. Prenez supernatant, ajoutez 1:10 vol KAc et 2.5 vol d’éthanol, et précipitez à -20 'C pour 1-4 h. Centrifugeuse à 4 'C pour 30 minutes à pleine vitesse (21.000 x g). Il y aura une petite boulette bleue au fond.
  11. Retirer le supernatant et laver avec 80% d’éthanol. Laisser sécher l’air pendant 5 min à température ambiante et dissoudre dans l’eau de 10 l.

11. Analyse RT-PCR

  1. Utilisez 1 g d’ARN par réaction RT.
  2. Faites un mélange de réaction pour un volume total final de 20 l par réaction. Pour une réaction, utilisez 1 l de 10 dNTP de 10 mM, 1 L de 0,1 M Dithiothreitol (DTT), 4 L de 5x First-Strand Buffer, et 0,5 l de Reverse Transcriptase.
  3. Aliquot 6.5 'L de mélange de réaction dans de nouveaux tubes PCR.
  4. Mélanger jusqu’à 5 amorces dans un mélange. Cependant, certaines amorces peuvent mal jumeler avec d’autres amorces dans le PCR(figure 5). Les séquences d’apprêt sont dans le tableau 2. Nous utilisons régulièrement des amorces exon-jonction spécifiques aux gènes, mais l’amorçage avec des hexamers aléatoires est également possible.
  5. Ajouter 1 L de l’amorce inverse de 10 M au tube de réaction RT désiré.
  6. Ajouter 1 g d’ARN au tube de réaction PCR.
  7. Ajouter le H2O sans RNase jusqu’à un volume total de 20 L.
  8. Tourner les tubes vers le bas pour enlever les résidus sur le côté des tubes et placer dans le thermocycler.
  9. Exécuter la réaction RT en thermocycler à 50 oC pendant 50 minutes.
  10. Stockez l’ADNC de RT à -20 oC ou procédez à la réaction du PCR.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Les gènes de reporter permettent la détermination des facteurs réglementaires qui influencent la formation circulaire d’ARN. Cependant, ces gènes de reporter sont grands et contiennent des éléments répétitifs qui rendent souvent les constructions d’ADN instables. En raison de leur grande taille, il est souvent nécessaire de supprimer des parties des introns, qui est atteint en amplifiant les pièces génomiques contenant les exons et les parties introniques flanquantes plus petites. Ces morceaux d’ADN sont assemblés enzymatiquement, permettant la construction sans enzymes de restriction.

L’exemple d’un ARN circulaire généré à partir de la protéine tau associée aux microtubules (MAPT) montre une application de l’approche minigogène pour analyser les ARN circulaires. Le minig tau 9-12 utilisé dans cet exemple a été co-transfected avec différents facteurs d’épissage et l’effet de ces facteurs d’épissage a été détecté par RT-PCR (figure 6). Différents facteurs trans-acteurs influencent à la fois l’ARN circulaire et la formation linéaire pré-mRNA. L’expérience montre également que tous les éléments de séquence nécessaires à la formation circulaire d’ARN sont localisés dans le fragment cloné.

Figure 1
Figure 1 : Aperçu de la technique. (A) Un gène hypothétique est montré. Les introns sont des lignes, les exons sont des boîtes, les éléments Alu sont de plus petites boîtes rayées. Le rétro-échange de l’exon C à A crée un ARN circulaire. La structure de cet ARN circulaire est indiquée en panneau (E). (B) Pour créer un gène reporter, exons et introns environnants (au moins 500 nt de chaque côté) sont amplifiés. Les constructions devraient contenir des éléments répétitifs, qui sont généralement des éléments Alu chez l’homme. Un exon en amont de l’exon A a été inclus pour fournir un élément Alu supplémentaire. Les fragments génomiques se chevaucheront avec leurs 25 nts flanquants. (C) Les fragments sont clonés dans un vecteur d’expression, piloté par un promoteur CMV. La recombinaison réussie est détectée par des amorçages de détection et validée par séquençage. (D) Les cellules sont transfectedes avec cette construction. (E) L’ARN circulaire est isolé et (F) amplifié à l’aide d’amorces spécifiques à l’ARN circulaire, des amorces de jonction exon préférables. Pendant l’amplification de PCR, l’ARN linéaire peut également être amplifié (G). (G) Orientation des amorces utilisées pour détecter les ARN circulaires. L’amorce avant est en sens aigu (c.-à-d. a la même séquence que l’ARN) et l’amorce inverse est dans l’orientation antisense (c.-à-d., est le complément inverse de l’ARN). Notez que différent de RT-PCR pour les MARN linéaires, l’amorce inverse est en amont de l’amorce avant. S’il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Figure 2
Figure 2 : Sélection de la séquence pour la construction de minigogènes. (A) L’affichage du navigateur après la séquence montrée dans la figure supplémentaire 1 est exécuté contre la base de données génomique humaine à l’aide de BLAT. Les numéros d’exon de littérature36 sont indiqués dans l’affichage de gène, ils sont différents des nombres donnés par le navigateur.
1. Les séquences alignées sont affichées sous 'YourSeq'
2-4. Notez qu’en raison de la circularité de l’ARN, BLAT ne relie pas tous les exons avec les lignes comme il le fait dans l’ARN linéaire. Les exons 10 et 11 (correspondant à 2 et 3) sont connectés, mais exon 12 (correspondant à 4) n’est pas connecté à exon 11.
5. Les éléments Alu sont indiqués dans la piste répétitive de l’élément.
(B) Alignement de séquence entre la construction prévue et l’ADN génomique.
6. La construction prévue a été exécutée contre la base de données à l’aide de BLAT.
7. Notez l’inclusion de plusieurs éléments Alu dans la construction. S’il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Figure 3
Figure 3 : Exemple des amplicons avant le clonage. (A) Produits PCR optimisés séparés sur un gel agarose de 1% contenant 1x GelGreen. Les bandes individuelles représentent les produits PCR qui seront utilisés dans l’assemblage d’ADN enzymatique. (B) Les bandes de (A) ont été découpées du gel et purifiées. Les produits PCR purifiés ont été séparés sur un gel d’agarose de 1 %, qui a ensuite été taché de bromure d’éthidium. S’il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Figure 4
Figure 4 : Analyse de restriction des gènes des journalistes. Le tau 9-12 minigene utilisé comme exemple a été coupé avec des enzymes de restriction indiquées pour exclure les recombinaisons majeures. Lane 1: couper avec NcoI tailles attendues 735 bp, 3345 bp, 6266 bp, lane 2 cut with XbaI expected size 10346 bp, lane 3 cut with HindIII expected sizes 3951 bp, 6395 bp, lane 4 cut with SmaI expected sizes 1168 bp, 1688 bp, 2708 bp, 4782 bp.

Figure 5
Figure 5 : Effet du multiplexe d’apprêt et du traitement RNase R sur la détection circulaire d’ARN. (A) cDNA des échantillons A et B dérivés des tissus du cerveau humain a été amplifié avec des amorces circulaires d’ARN circTau exon12_10 inverse et circTau exon10_11 en avant. La transcription inverse pour le cDNA a été exécutée avec les amorces pour l’ARN de tau linéaire et circulaire. La bande attendue correspondant à l’ARN circulaire tau est montrée par un triangle. Les autres bandes fortes sont des artefacts qui ne correspondaient pas au génome humain. (B) L’expérience a été répétée avec des conditions identiques de PCR, mais la transcription inverse a été exécutée seulement avec l’apprêt inverse de circTau exon12_10. Seul le groupe attendu a été amplifié et validé par le séquençage. (C) L’ARN a été traité avec RNase R qui enlève l’ARN linéaire. L’ARN circulaire est détectable après le traitement (à gauche), tandis que l’ARN linéaire ne donne plus de signal détectable (à droite) Veuillez cliquer ici pour voir une version plus grande de cette figure.

Figure 6
Figure 6 : Exemple d’analyse d’un gène de reporter de circRNA. 1 g du gène de reporter de tau 9-1237 a été transfected avec 1 g de facteurs d’épissage indiqués. L’ARN a été isolé 24 h post transfection et analysé par RT-PCR. (A) Amplification de l’ARNm linéaire tau. En raison de l’épissage alternatif de l’exon 10 deux bandes sont observées. Leur rapport change en raison de la surexpression des facteurs d’épissage38,39. (B) Amplification de l’ARN circulaire 12-10 tau23. Notez la dépendance de l’expression tau circRNA sur l’expression de certains facteurs d’épissage, en particulier les cdc2 comme kinase clk2 et la protéine SR 9G8. (C) L’ARN circulaire de HIPK3 a été utilisé comme un contrôle positif indiquant une charge égale. S’il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Tableau 1 : Liste des minigènes actuels exprimant des ARN circulaires. S’il vous plaît cliquez ici pour télécharger ce fichier.

Apprêts circulaires de contrôle HIPK3
HIPK3 Reverse
HIPK3 Vers l’avant
TGCTTGGCTCTACTTTGAGTTTC
TCGGCCAGTCATGTATCAAA
Apprêts linéaires
Tau Exon 12 Revers
Tau Exon 9 Attaquant
CCCAATCTTCGACTGGACTC
TGTCAAGTCCAAGATCGGCT
Apprêts circulaires
circTau exon12_10 inverse
circTau exon10_11 vers l’avant
CAGCTTCTTATTATCTGCACCTT
GAGGCGGCAGTGTGCAA

Tableau 2 : Liste des primeurs.

Supplemental Figure 1
Figure supplémentaire 1 : Séquence d’essai circulaire d’ARN de Tau. Séquence d’essai correspondant à un ARN circulaire du locus MAPT. Différents exons sont indiqués par le soulignement, les petits bouchons et les grands bouchons. S’il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Supplemental Figure 2
Figure 2 supplémentaire : Séquence génomique contenant le minig prévu. Exons sont mis en évidence dans la couleur et les éléments répétitifs sont soulignés, italiques et audacieux. L’ombrage gris indique des régions de faible complexité qui peuvent être utilisées pour générer des amorces. S’il vous plaît cliquez ici pour télécharger ce fichier.

Supplemental Figure 3
Figure supplémentaire 3 : Séquences du gène reporter prévu. La séquence vectorielle et les fragments génomiques prévus sont montrés. S’il vous plaît cliquez ici pour télécharger ce fichier.

Supplemental Figure 4
Figure supplémentaire 4 : Conception d’apprêt pour l’assemblage. La séquence de la figure supplémentaire 3 a été inscrite dans l’outil du constructeur. S’il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Supplemental Figure 5
Figure supplémentaire 5 : Séquence du gène de reporter tau 9-gt;12 utilisé à titre d’exemple. S’il vous plaît cliquez ici pour télécharger ce fichier.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

En général, les ARN circulaires sont faibles abondants1, ce qui complique l’étude de leur fonction et de leur formation. Semblable aux ARN linéaires13, l’utilisation de minigènes reporter permet l’identification des cis et des facteurs trans-acteurs qui régulent la formation d’ARN circulaires. Ainsi, cette approche génère des hypothèses qui peuvent être testées plus en utilisant les gènes endogènes.

L’étape la plus critique est la conception du gène reporter. L’assemblage enzymatique de fragments d’ADN ("Gibson clonage"27) facilite cette conception, car elle permet la construction de grands gènes de reporter indépendants des sites de restriction.

Les sites d’épissage arrière sont réunis par des répétitions inversées de flanc, qui devraient être prises en compte dans la construction de gènes de reporter. Les répétitions sont annotées dans le navigateur du génome «répéter la piste» et de les sélectionner montre leur orientation. Gardez à l’esprit que les protéines peuvent également forcer les sites d’épissage arrière dans une structure secondaire nécessaire pour l’expression circulaire de l’ARN28 et pour une analyse impartiale 1-2 kb de régions introniques de flanc devrait être étudiée.

Pour assurer la stabilité des constructions, une considération importante est le type de souches bactériennes et leurs conditions de croissance. Pour des constructions plus courtes et simples, des bactéries de clonage standard sont utilisées, qui sont presque identiques à DH5-alpha (huA2 (argF-lacZ)U169 phoA glnV44 80 (lacZ)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17). Pour des fragments plus longs, contenant plus de 6 éléments Alu, Des cellules compétentes "stables" sont utilisées qui n’ont pas de recombinase (recA) et d’endonuclease (endA1) (F' proA-B 'lacIq 'M15 zzf::Tn10 (TetR) (ara-leu) 7697 araD139 fhuA 'lacX74 galK16 galE15 e14- '80dlacZ’M15 recA1 relA1 nupG rpsL (StrR) rph spoT1 '(mrr-hsdRMS-mcrBC). Si des problèmes apparaissent avec la recombinaison, indiquée par un faible nombre de transformations, plaquez les bactéries transformées sur deux plaques et laissez-les se développer à 30 oC et 37 oC, respectivement. En raison de la présence de nombreux éléments répétitifs dans les minigènes, ils doivent être entièrement séquencés à l’aide du séquençage de prochaine génération, qui est disponible dans le commerce pour environ 150 $ par plasmide aux taux de 2019. La séquence de l’exemple est montrée dans la figure supplémentaire 5. En outre, l’analyse polymorphism de longueur de fragment de restriction pour la nouvelle préparation plus grande des constructions est régulièrement exécutée. Par exemple, l’utilisation de sites qui coupent 1 à 4 fois donne lieu à un modèle de bande caractéristique qui exclut les recombinaisons(figure 4). Les enzymes doivent être sélectionnées qui donnent un modèle caractéristique de bande de fragments qui peuvent être séparés sur un gel d’agarose.

Les ARN circulaires sont analysés avec RT-PCR à l’aide d’amorces de jonction exon qui se chevauchent avec l’événement rétro-pli(figure 1F). En raison de la nature circulaire de l’ARN, l’amorce inverse (c’est-à-dire antisense) est en amont de l’amorce avant (c.-à-d. le sens)(figure 1G). Les amorces détectant l’ARN 1 circulaire de protéine abondamment exprimée d’homodomaine 3 (HIPK3) sont utilisées comme contrôle positif. HIPK3 et minigene amorce inverse spécifique sont rétrocrits dans le même tube, ce qui permet leur comparaison. Les réactions de PCR sont exécutées avec des amorces amplifiant les ARNm linéaires pour comparer des modèles de traitement des ARNN circulaires et linéaires de pré-mARN. Nous avons souvent observé des bandes aberrantes lorsque les amorces pour les ARN linéaires et circulaires étaient mélangées(figure 5), et ainsi garder la transcription inverse de ces échantillons séparées.

L’analyse RT-PCR des ARN circulaires est difficile et doit être soigneusement contrôlée. Bien que sensible et pratique, il peut produire des artefacts uniques pour les ARN circulaires29. La transcriptase inverse peut se déplacer plusieurs fois autour du cercle d’ARN, qui génère des concatemers. La plupart des gènes circulaires de reporter d’ARN génèrent l’ARN circulaire et linéaire, qui peut re-hybrider, menant à plus d’artefacts DE PCR21,30,31. Il est donc impératif de séquencer les produits PCR et de valider les résultats à l’aide de différentes techniques utilisant les taches du Nord32 ou les protections RNase23.

Les bandes inexpliquées peuvent également provenir d’une amplification aberrante de l’ARN linéaire. L’ARN linéaire peut être retiré à l’aide de l’exonuclease RNase R, qui enrichit les ARN circulaires33 (figure 5C). Le traitement RNase R aide à optimiser les amorces de détection et peut souvent être omis une fois que les amorces sont optimisées.

L’épissage alternatif peut également contribuer à des bandes inexpliquées car plusieurs ARN circulaires peuvent être formés à partir d’un locus génomique34. Cette épissage inverse alternative est souvent le résultat de structures concurrentes avant l’ARNm formées par plus de deux éléments répétés inversés. En outre, les sites cryptiques back-splice peuvent se produire32,35. Selon l’objectif expérimental, les éléments Alu peuvent être répétés ou ajoutés aux constructions. Les régions complémentaires flanquant des sites d’épissage arrière peuvent être aussi courtes que 30-40 nt35 et le remplacement des éléments Alu avec des régions complémentaires plus courtes peut augmenter la formation circulaire d’ARN2, qui peut être testée pour améliorer la formation circulaire d’ARN. Une fois que les séquences pré-mRNA qui causent l’épissage du dos ont été identifiées, il est donc possible de raccourcir les constructions circulaires d’arn, ce qui peut améliorer l’efficacité transfection dans certains cas.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Rien à divulguer.

Acknowledgments

Ce travail a été soutenu par le ministère de la Défense DoD subvention AZ180075. Stefan Stamm remercie Jacqueline Noonan Endowment. Anna Pawluchin a été soutenue par le DAAD, programme allemand d’échange académique, Justin R. Welden a été récipiendaire de l’Université du Kentucky Max Steckler Award.

Materials

Name Company Catalog Number Comments
(PEI) Hydrochloride Polysciences 24765-1
Builder tool NEB https://nebuilder.neb.com/#!/
Dark Reader Transilluminator. Clare Chemical Research
Enzymatic DNA assembly kit NEB E2621S
Gel and PCR cleanup kit Promega A9282
Glyco Blue Thermo Fisher AM9516
pcDNA3.1 cloning site Polycloning site https://assets.thermofisher.com/TFS-Assets/LSG/manuals/pcdna3_1_man.pdf
Polymerase 1 NEB M0491L Q5 DNA polymerase
Polymerase 2 Biorad 1725310 Long range polymerase (NEB), iproof (BioRad)
Polymerase 2 Qiagen 206402 Qiagen long range polymerase kit
Reverse Transcriptase Thermo Fisher 18080044
RNA isolation kit Life Technologies 12183025 Ambion by Life Technologies
RNAse R Lucigen RNR07250 Epicenter/Lucigen
Stable competent cells NEB C3040H NEB stable cells
Standard cloning bacteria NEB C2988J NEB5-alpha competent
Web tool to design primers NEB https://nebuilder.neb.com/#!/
Web-based temperature calculations NEB https://tmcalculator.neb.com/#!/main

DOWNLOAD MATERIALS LIST

References

  1. Jeck, W. R., et al. Circular RNAs are abundant, conserved, and associated with ALU repeats. RNA. 19, (2), 141-157 (2013).
  2. Zhang, X. O., et al. Complementary sequence-mediated exon circularization. Cell. 159, (1), 134-147 (2014).
  3. Deininger, P. Alu elements: know the SINEs. Genome Biology. 12, (12), 236 (2011).
  4. Bazak, L., Levanon, E. Y., Eisenberg, E. Genome-wide analysis of Alu editability. Nucleic Acids Research. 42, (11), 6876-6884 (2014).
  5. Levanon, E. Y., et al. Systematic identification of abundant A-to-I editing sites in the human transcriptome. Nature Biotechnology. 22, (8), 1001-1005 (2004).
  6. Hansen, T. B., et al. Natural RNA circles function as efficient microRNA sponges. Nature. 495, (7441), 384-388 (2013).
  7. Kelly, S., Greenman, C., Cook, P. R., Papantonis, A. Exon Skipping Is Correlated with Exon Circularization. Journal of Molecular Biology. 427, (15), 2414-2417 (2015).
  8. Li, Z., et al. Exon-intron circular RNAs regulate transcription in the nucleus. Nature Structural & Molecular Biology. 22, (3), 256-264 (2015).
  9. Yang, Y., et al. Extensive translation of circular RNAs driven by N(6)-methyladenosine. Cell Research. 27, (6), 626-641 (2017).
  10. Abe, N., et al. Rolling Circle Translation of Circular RNA in Living Human Cells. Scientific Reports. 5, 16435 (2015).
  11. Salzman, J., Chen, R. E., Olsen, M. N., Wang, P. L., Brown, P. O. Cell-type specific features of circular RNA expression. PLOS Genetics. 9, (9), 1003777 (2013).
  12. Ottesen, E. W., Luo, D., Seo, J., Singh, N. N., Singh, R. N. Human Survival Motor Neuron genes generate a vast repertoire of circular RNAs. Nucleic Acids Research. 47, (6), 2884-2905 (2019).
  13. Stoss, O., Stoilov, P., Hartmann, A. M., Nayler, O., Stamm, S. The in vivo minigene approach to analyze tissue-specific splicing. Brain Research Protocols. 4, 383-394 (1999).
  14. Mardon, H. J., Sebastio, G., Baralle, F. E. A role for exon sequences in alternative splicing of the human fibronectin gene. Nucleic Acids Research. 15, 7725-7733 (1987).
  15. Gaildrat, P., et al. Use of splicing reporter minigene assay to evaluate the effect on splicing of unclassified genetic variants. Methods in Molecular Biology. 653, 249-257 (2010).
  16. Cooper, T. A. Use of minigene systems to dissect alternative splicing elements. Methods. 37, (4), 331-340 (2005).
  17. Baralle, D., Baralle, M. Splicing in action: assessing disease causing sequence changes. Journal of Medical Genetics. 42, (10), 737-748 (2005).
  18. Percifield, R., Murphy, D., Stoilov, P. Medium throughput analysis of alternative splicing by fluorescently labeled RT-PCR. Methods in Molecular Biology. 1126, 299-313 (2014).
  19. Stoilov, P., Lin, C. H., Damoiseaux, R., Nikolic, J., Black, D. L. A high-throughput screening strategy identifies cardiotonic steroids as alternative splicing modulators. Proceedings of the National Academy of Sciences of the United States of America. 105, (32), 11218-11223 (2008).
  20. Shen, M., et al. Pyrvinium pamoate changes alternative splicing of the serotonin receptor 2C by influencing its RNA structure. Nucleic Acids Research. 41, (6), 3819-3832 (2013).
  21. Noto, J. J., Schmidt, C. A., Matera, A. G. Engineering and expressing circular RNAs via tRNA splicing. RNA Biology. 1-7 (2017).
  22. Schmidt, C. A., Noto, J. J., Filonov, G. S., Matera, A. G. A Method for Expressing and Imaging Abundant, Stable, Circular RNAs In Vivo Using tRNA Splicing. Methods in Enzymology. 572, 215-236 (2016).
  23. Welden, J. R., van Doorn, J., Nelson, P. T., Stamm, S. The human MAPT locus generates circular RNAs. Biochimica et Biophysica Acta - Molecular Basis of Disease. 2753-2760 (2018).
  24. Casper, J., et al. The UCSC Genome Browser database: 2018 update. Nucleic Acids Research. 46, 762-769 (2018).
  25. Grozdanov, P. N., MacDonald, C. C. Generation of plasmid vectors expressing FLAG-tagged proteins under the regulation of human elongation factor-1alpha promoter using Gibson assembly. Journal of Visualized Experiments. (96), (2015).
  26. Wang, Y., et al. A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Research. 32, (3), 1197-1207 (2004).
  27. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  28. Conn, S. J., et al. The RNA binding protein quaking regulates formation of circRNAs. Cell. 160, (6), 1125-1134 (2015).
  29. Jeck, W. R., Sharpless, N. E. Detecting and characterizing circular RNAs. Nature Biotechnology. 32, (5), 453-461 (2014).
  30. Pamudurti, N. R., et al. Translation of CircRNAs. Molecular Cell. 66, (1), 9-21 (2017).
  31. Kramer, M. C., et al. Combinatorial control of Drosophila circular RNA expression by intronic repeats, hnRNPs, and SR proteins. Genes & Development. 29, (20), 2168-2182 (2015).
  32. Starke, S., et al. Exon circularization requires canonical splice signals. Cell Reports. 10, (1), 103-111 (2015).
  33. Suzuki, H., Tsukahara, T. A view of pre-mRNA splicing from RNase R resistant RNAs. International Journal of Molecular Sciences. 15, (6), 9331-9342 (2014).
  34. Zhang, X. O., et al. Diverse alternative back-splicing and alternative splicing landscape of circular RNAs. Genome Research. 26, (9), 1277-1287 (2016).
  35. Liang, D., Wilusz, J. E. Short intronic repeat sequences facilitate circular RNA production. Genes & Development. 28, (20), 2233-2247 (2014).
  36. Wang, Y., Mandelkow, E. Tau in physiology and pathology. Nature Reviews Neuroscience. 17, (1), 5-21 (2016).
  37. Fejes-Toth, K., et al. Post-transcriptional processing generates a diversity of 5'-modified long and short RNAs. Nature. 457, (7232), 1028-1032 (2009).
  38. Gao, Q. S., et al. Complex regulation of tau exon 10, whose missplicing causes frontotemporal dementia. Journal of Neurochemistry. 74, (2), 490-500 (2000).
  39. Hartmann, A. M., et al. Regulation of alternative splicing of human tau exon 10 by phosphorylation of splicing factors. Molecular and Cellular Neuroscience. 18, (1), 80-90 (2001).
  40. Wang, Y., Wang, Z. Efficient backsplicing produces translatable circular mRNAs. RNA. 21, (2), 172-179 (2015).
  41. Yang, Y., Wang, Z. Constructing GFP-Based Reporter to Study Back Splicing and Translation of Circular RNA. Methods in Molecular Biology. 1724, 107-118 (2018).
  42. Zheng, Q., et al. Circular RNA profiling reveals an abundant circHIPK3 that regulates cell growth by sponging multiple miRNAs. Nature Communications. 7, 11215 (2016).
  43. Jia, W., Xu, B., Wu, J. Circular RNA expression profiles of mouse ovaries during postnatal development and the function of circular RNA epidermal growth factor receptor in granulosa cells. Metabolism. 85, 192-204 (2018).
  44. Liang, D., et al. The Output of Protein-Coding Genes Shifts to Circular RNAs When the Pre-mRNA Processing Machinery Is Limiting. Molecular Cell. 68, (5), 940-954 (2017).
  45. Legnini, I., et al. Circ-ZNF609 Is a Circular RNA that Can Be Translated and Functions in Myogenesis. Molecular Cell. 66, (1), 22-37 (2017).
  46. Li, X., et al. Coordinated circRNA Biogenesis and Function with NF90/NF110 in Viral Infection. Molecular Cell. 67, (2), 214-227 (2017).
  47. Zhang, Y., et al. The Biogenesis of Nascent Circular RNAs. Cell Reports. 15, (3), 611-624 (2016).
Utilisation d’un élément <em>Alu</em> contenant des minigènes pour analyser les ARN circulaires
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Welden, J. R., Pawluchin, A., van Doorn, J., Stamm, S. Use of Alu Element Containing Minigenes to Analyze Circular RNAs. J. Vis. Exp. (157), e59760, doi:10.3791/59760 (2020).More

Welden, J. R., Pawluchin, A., van Doorn, J., Stamm, S. Use of Alu Element Containing Minigenes to Analyze Circular RNAs. J. Vis. Exp. (157), e59760, doi:10.3791/59760 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter