Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

שימוש באלמנט Alu המכיל מיני-גנים לניתוח Rnas מעגלית

doi: 10.3791/59760 Published: March 10, 2020

Summary

אנחנו לשכפל ולנתח גנים עיתונאי יצירת RNAs מעגלית. גנים כתבת אלה גדולים יותר מאשר בנייה כדי לנתח שחבור ליניארי ולהכיל Alu אלמנטס. כדי לחקור את RNAs מעגלית, המבנים הם מנותחים לתוך תאים וכתוצאה מכך RNA מנותח באמצעות RT-PCR לאחר הסרת RNA ליניארי.

Abstract

בנוסף mrnas ליניארי, הרבה גנים איקריוטית ליצור rnas מעגלית. מרבית ה-RNAs המעגלי מופקים על-ידי הצטרפות לאתר של 5 ' אחוי עם אתר אחוי במעלה 3 ' בתוך מקדם-mRNA, תהליך הנקרא שחבור חזרה. מעגליות זה עשוי לסייע על ידי מבנים משניים ב-pre-mRNA המביאים את האחוטים לקרבת מקומות. בגנים האנושיים, alu אלמנטס נחשבים לקידום אלה מבנים RNA משני, כמו alu אלמנטס הם שופע בסיס התצוגה משלימה אחד עם השני כאשר נוכח הכיוונים הנגדיים ב pre-mrna. כאן, אנו מתארים את הדור ואת הניתוח של גדול, Alu אלמנט המכיל גנים עיתונאי היוצרים rnas מעגלית. באמצעות אופטימיזציה של פרוטוקולי שיבוט, גנים עיתונאי עם עד 20 kb אורך להוסיף ניתן ליצור. הניתוח שלהם בניסויים מאפשר זיהוי של גורמי רגולציה. כך, שיטה זו יכולה לזהות רצפי RNA ורכיבים סלולריים המעורבים במערך RNA מעגלי.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

RNAs מעגלית
RNAs מעגלית (circRNAs) הם סגורים בודד שנתקע יחיד RNAs אשר מבוטא ברוב האורגניזמים. הם מופקים על ידי הצטרפות במטה 5 ' אחוי אתר לאתר במעלה 3 ' אחוי, תהליך הנקרא שחבור חזרה (איור 1א)1. רצפים של pre-mRNA כי התערוכה בסיס משלימה קצר כמו 30-40 nt להביא החזרה האתר ליישור הנכון עבור מערך circRNA2. בבני אדם, Alu אלמנטס1, המייצג כ -11% של הגנום3, טופס נרחב כפול תקוע מבנים RNA ב pre-mrna בשל העצמיות העצמית שלהם4,5 ובכך לקדם את היווצרות circrnas1.

כיום תוארו שלוש פונקציות עיקריות של circRNAs. חלק מהמעגלי האיגוד מסוג circRNAs (miRNAs) ובאמצעות קיבוע על לפעול כמו ספוגים Mirnas6. באמצעות תחרות עם שחבור ליניארי7 או אפנון של פעילות שעתוק8, היתה מעורב ביניהם מעורבים. לבסוף, מכילים circrnas מסגרות קריאה פתוחות קצרות והוכחת מחקרים עקרוניים מראים כי ניתן לתרגמו9,10. עם זאת, התפקוד של רוב הcircrnas נשאר באופן חידתי. רוב RNAs מעגלית זוהו באמצעות שיטות רצף הדור הבא11. ניתוחים מפורטים של גנים בודדים באמצעות ממוקדות RT-PCR גישות לגלות כי מספר גדול של RNAs מעגלית נשאר להתגלות12.

שימוש בגנים של כתבת לניתוח עיבוד טרום-mRNA
ניתוח mRNA נגזר המבנה כתב DNA בנייה לתוך תאים היא שיטה מבוססת היטב כדי ללמוד אלטרנטיבה טרום mRNA שחבור, אשר ניתן להחיל על RNAs מעגלית. באופן כללי, האקסוקה החלופית, האינטרוטונים המקיפים אותה, והרחבות הקונסטיטוטיביות מושוכגות לתוך וקטור ביטוי של איקריוטית. לעתים קרובות, האינטרונים מקוצרים. המבנים מנותחים לתאי איקריוטית ומנותח בדרך כלל על ידי RT-PCR13,14. גישה זו הייתה בשימוש נרחב כדי למפות את האזורים הרגולטורים וגורמי משחק בניסויים שיתוף פעולה13,15,16,17,18. בנוסף, הדור של ביטוי חלבון מיני גנים מותר להקרנה של חומרים המשנים שחבור חלופיים19,20.

השיטה הוחלה על RNAs מעגלית. כיום, לפחות 12 מיניגנים לאחור תוארו בספרות ומסוכמים בטבלה 1. למעט מערכת trna ביטוי מבוסס21,22, הם כולם תלויים פולימראז השני היזמים. כאן, אנו מתארים שיטה ליצור מיני העיתונאי האנושי כדי לקבוע את הגורמים העמים והטרנס משחק מעורב בדור של RNAs מעגלית. מבט כולל על השיטה באמצעות רצפים של העיתונאי שפורסם גן23 מוצג באיור 1.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. עיצוב המבנים

  1. השתמש בדפדפן UCSC הגנום24 לזהות אלמנטים חוזרים הדרושים עבור היווצרות RNA מעגלי ולשלב אותם במבנים. חשוב ביותר, התחל הגברה של הצורך להיות מחוץ ליסודות החוזרים.
  2. הדבקת רצף ה-RNA המעגלי (איור משלים 1 הוא רצף מבחנים) לתוך https://genome.ucsc.edu/cgi-bin/hgBlat?command=start ובחר את האורגניזם הנכון. שלח את הרצף ועבור לתצוגת דפדפן, הקטן את המרחק של 1.5 x או מתאים (איור 2א).
    הערה: רצף החיפוש מופיע בשורה העליונה (איור 2א, 1). בהתאם לסדר הexons ב-RNA המעגלי, הבלט לא יחבר את כל ההרחבות. בדוגמה זו, אקסון 12 (איור 2a, 4) אינו מחובר 11 (איור 2a, 2, 3), כי אקסון 12 הוא במעלה הזרם של אקסון 11 ברצף RNA מעגלי (איור משלים 1). האלמנטים החוזרים הם במסלול ' חזור על משקר ', המצוין בתיבות, כאשר צבע שחור לאפור מציין את השימור האבולוציוני (איור 2א, 5).
  3. עכבר מעל הרכיבים החוזרים כדי לזהות את סוג המשנה שלהם בחלון צף. Alu אלמנטס נמצאים בתוך הסינוס (האלמנט הגרעיני הקצר ביניהם). השתמש בלחצן ' רצועות ברירת מחדל ' מתחת לחלון כדי לאפס את הדפדפן אם תמונה שונה מאשר איור 2 מתקבל.
    הערה: ממושר מעל ההרחבות בתצוגת הגן יוצרת חלון עם מספרי exons הנוצרים במחשב. מספרים אלה אינם תואמים את מספור אקסון שנקבעו בספרות וגם לשנות בין האיזוטפסים.

2. בחר את הרצף שישוכפל בווקטור ביטוי

  1. הורד את רצף ה-DNA המוצג בחלון על ידי הולך לצפות → ה-dna בשורה העליונה של הדפדפן ucsc הגנום. באפשרות ' עיצוב ברצף', בחרו ' אפשרויות צבע מורחבות/צבעים'.
  2. בחר את המקרה המוגדר כברירת מחדל כנמוך יותר ובחר רישיות דו-מצביים עבור מסדר הפעלה ncbi. בחר קו תחתון ומודגש ונטוי כדי לחזור על מאסקר. לחץ על שלח. יהיו הרחבות כאותיות רישיות ו-introns כאותיות קטנות. בדוק את גבולות האקסון/intron.
  3. בדוגמה זו קיים ' ccctttacCTTTTT ', המציין שהדפדפן מציג את ההשלמה ההפוכה. אם זהו המקרה, חזור אחורה ובחר את התיבה המשלים לאחור עד שתראה את הגבולות אקסון אינטרון הנכון (agexongt), בדוגמה זו אאאגגליג '.
  4. העתק את הקובץ בכיוון הנכון (הרחבות פנימיות מוקפות בנוטרואג... gt) לתוך מסמך עיבוד תמלילים ולהדגיש את ההרחבות (איור משלים 2).
    הערה: בדוגמה זו, הקטע גנומי המקיף exons 9-12 הוא סביב 24 kb ולכן גדול מדי כדי להיות מוגבר מ-DNA גנומית. לכן, כל מיקום מוקף בערך של 1 kb באזור הוא מוגבר באופן אינדיבידואלי וארבעת הקטעים האלה מורכבים בוקטור שיבוט.
  5. שברי בחר להיות מוגבר (exon ± 500 nt intron). ודא כי אינטרון אינו מתחיל או מסתיים באזור חוזר, כמו התחל באזורים אלה לא להגביר רצפים ספציפיים. האזורים שנבחרו מוצגים באיור 2B, והרצפים שלהם מוצגים באיור המשלים 3.
    הערה: באופן כללי, ככל שהמבנים גדולים יותר, כך השכפול יהיה קשה יותר. את השברים ניתן לשלב בין צעד חכם (כלומר, אקסון 9 משולב עם וקטור בשלב הבא אקסון 10 הוא הציג במבנה זה דרך שיבוט עד כל אקסון נמצאים במקום), או לחילופין, כל השברים מקובצים בו זמנית. גישה חורגת תמיד עובדת אבל דורשת זמן נוסף. הרכבה בו זמנית לא תמיד עובד תלוי כמה טוב שברי בודדים ניתן הוגבר מ-DNA גנומית ועל הגודל הכולל של המבנה. לכן בדרך כלל אנו מתחילים בשתי הגישות בו זמנית.

3. עיצוב בצבעי שיבוט

  1. השתמש בכלי אינטרנט (https://nebuilder.neb.com/#!/) כדי לעצב את צבעי היסוד לשכפול. לדוגמה, הזן קטעים 9, 10, 11 ו-12 והרצף הווקטורי (איור משלים 3) לכלי זה.
  2. לרצף הווקטור, הוסף את אתר ההכנסה כנוקלאוטיד האחרון ולאחר מכן הוסף את השברים. מאז מספור וקטורי לא מתחיל עם אתר ההכנסה נתונה, האתר של הכניסה בווקטור ממוקם וחלק במורד הזרם מכניסים לפני הרצף של המעלה במעלה. בדוגמה זו הוסיף מתחיל ישירות לאחר האתר HindIII [AAGCTT] ומסתיים ישירות לאחר PmeI [GTTTAAAC] האתר של pcDNA 3.1. הרצף מcccgctgatcag... מודבק לפני מיקום 1 ברצף pcDNA 3.1 (gttgctggcgtttttcc...).
  3. התאימו את התחל אם נקודות ההיתוך שלהם הן יותר מ -4 ° c, מכיוון שהם לא יעבדו בהגברה. ההרכבה של הקטעים והרצפים הפריימר המתוכננים מוצגים באיור המשלים 4. התחל לשכפול יכול להיות גם מעוצב באופן ידני25.

4. PCR ו אמפליקון זיהוי

  1. התגובה הסטנדרטית PCR: לבצע תערובת התגובה עבור הנפח הכולל של 50 μL לכל תגובה. להלן המתכון לתגובה אחת באמצעות פולימראז 1:
    10 μL של מאגר התגובות 5x
    1 μL של 10 ממ מ מסוג Dntps
    2.5 μL של 10 μM פריימר קדימה
    2.5 μL של 10 מטרים לאחור פריימר הפוכה
    0.5 μL של פולימראז 1
    32.5 μL של Nuclease חינם H2O
    1. באופן אופציונלי, להוסיף 10 μL של 5x GC משפר אם למוצר יש תוכן בגובה GC; לבצע שילוב נפרד המכיל GC משפר לבדוק את תגובת ה-PCR.
  2. Aliquot 49 μL של התערובת לתוך צינורות PCR לכל מדגם התגובה.
  3. הוסף 1 μL של ה-DNA ל-PCR, הסכום נע בין 10 pg ל-1 ng.
  4. מוציאים את הדגימות כדי להסיר שאריות מהצדדים ולמקם אותם במכונת PCR. השתמש באותו מחשב כמו גם נקודות זהות במחשב בעת אופטימיזציה של תנאי PCR.

5. אופטימיזציה לקטעי דנ א ארוכים יותר לשימוש בפולימסים שונים

  1. טמפרטורה
    1. מטב את הטווח הארוך של פולימראז 2.
      1. השתמש בטמפרטורת דנטורציה נמוכה יותר (פלאז 1:98 ° c, פולימראז 2:94 ° c).
      2. השתמש זמן ארוך יותר (פולימראז 1:10 s, פולימראז 2:30 s).
      3. להשתמש בזמן ריפוי ארוך יותר (פולימראז 1:30 s, פולימראז 2:60 s).
      4. השתמש בזמן הארכה ארוך יותר (פולימראז 1:30 s/kb, פולימראז 2:50 s/kb).
      5. השתמש בטמפרטורת הרחבה נמוכה יותר (פולימראז 1:72 ° c, פולימרואז 2:65 ° c).
      6. השתמש בטמפרטורת ריפוי 5 ° c מתחת Tm של התחל.
    2. מיטוב ריכוזי פריימר (5x פחות כדי 5x יותר מאשר הריכוז פריימר המקורי). מיטוב ריכוזי DNA מ 10 pg עד 50 עמ', 100 pg, 1 ng, 5 ng, 10 ng.
    3. כדוגמה לתוכנית ה-PCR כדי להגביר את גודל המוצר 15 kb באמצעות פולימראז 2, בצע הדנטורציה ראשונית ב 94 ° c עבור 30 s, דנאטציה DNA ב 94 ° c עבור 30 s ואחריו חישול ב 58 ° צ' עבור 30 s, ו-DNA הארכה ב 65 ° c עבור 12 דקות 30 s. בצע הארכה סופית ב-65 ° c במשך 10 דקות עם החזקת 4 ° c סופית.
      הערה: טמפרטורת הריפוי (Ta) המסוימת הנקבעת באמצעות חישובי טמפרטורה מבוססי-אינטרנט הספציפיים לכל פולימראז. זמני הארכה עשויים להשתנות וצריכים להיות ממוטבים אם שברים גדולים מ-10 kb.
  2. זמני הארכה וריכוזי דנ א
    1. השתמש בזמני הארכה ארוכים יותר עבור שברי DNA על 6 kb: 1 דקות לכל 1 kb. שברים ארוכים יותר צריך להשתמש פחות DNA.
    2. לבצע דילול של ה-DNA כדי למצוא את הריכוז האופטימלי DNA עבור הגברה, בדרך כלל 1 pg כדי 1 ng עבור פלמידים או 1 ng כדי 1 μg עבור DNA גנומית.
      הערה: עבור רוב שיבוט שימוש פולימראז 1, הנדסה על ידי החדרת התחום איגוד ה-DNA Sso7d ל-DNA קנייני התרמוטאז26. הפולימראז יש שיעור שגיאה נמוכה, בשל התחום Sso7d מעבד גבוה, צורך להגביר גדול (10-15 kb) שברי גנומית. בשל גודל זה קטע גדול, הרכבה אנזימטית של מולקולות DNA27 משמש להוספה לתוך וקטורים, כמו שיטה זו אינה דורשת אנזימים הגבלה. הגברה של שברים יותר מ 15 kb מקבל קשה יותר ויותר עם פולימראז 1. עבור הגברה רסיס גדול להשתמש פולימראז 2 עשוי פירוקוקסכמו הגהה פולימראז התמזגו ל Sso7d או ערכת ה-PCR טווח ארוך שנותן, עם זאת, שיעורי שגיאה גבוהה יותר.

6. טיהור מוצרי ה-PCR לשכפול

  1. הפעל מחצית מהמוצרים ה-PCR על 1% ג ' לים המכילים כתם חומצה גרעין intercalating (g., 1x GelGreen). המחש את הכתמים על הקורא האפל. ה-DNA המוכתם הזה לא מופעל נכון לגודל.
    הערה: מפרידים GelGreen לתוך דנ א, דומה לאתידיום ברומיד, אבל הוא נרגש על ידי אור סביב 500 ננומטר (ציאן), אורך גל שאינו פוגע DNA, אשר משפר במידה רבה שיבוט.
  2. במקביל, הפעל מחצית ממוצרי ה-PCR ב-1% ג'ל המוכתם לאחר הריצה עם אתידיום ברומיד (איור 3א, ב).
  3. להקות בלו בגודל הנכון מהג המוכתמת (שלב 6.1) ובידוד דנ א באמצעות ג'ל וערכת ניקוי PCR. בסטייה מן הפרוטוקול הסטנדרטי שלה, elute DNA ב רק 20 μL של מים מזוקקים כפולים, כמו בדרך כלל ריכוזי ה-DNA נמוכים.
  4. לפני שיבוט, לבדוק את ה-DNA בודד על ג'ל agarose עבור ריכוז ויושר (איור 3ב). המטרה עבור 2:1 להוסיף שן טוחנת ליחס וקטורי. בעת שימוש במספר מוספות, היחס הוא 2:2:2:1.

7. הרכבת DNA וזיהוי שיבוט

הערה: שיבוט מתבצע באמצעות ערכת ה-DNA אנזימטית הרכבה, עם שינויים קלים. ההרכבה מבוצעת עבור 60 דקות ב 50 ° צ' ובדרך כלל הטווח התחתון של ה-DNA משמש הרכבה (20-100 fmol/20 μL תגובה). תערובת התגובה כולה מתווסף לתאים המוסמכים כימיים התאים כולו מצופה על צלחת 6 ס מ אגר.

  1. לשלב את הווקטור ולהוסיף ביחס 1:2 טוחנת (20-500 fmol כל אחד) ב 10 μL של מים.
  2. הוסף 10 μL של מיקס בסיס להרכבת דנ א.
  3. הדגימות של הדגירה 60 דקות ב-50 ° c.
  4. לאחר מכן, הפוך תאים מוכשרים לבין תגובת ההרכבה הכוללת. כאן, השתמש בחיידק e. coli 1 תאים עבור בנייה קצרה או e. coli זן 2 תאים עבור מבנים ארוכים או לא יציב. התאים צריכים להיות באמצעי אחסון מ50 μL.
  5. הפשרת תאים על קרח ולהוסיף 2 μL של המוצר המורכב מקורר לתאים המוסמכים. מערבבים על ידי בעדינות מצליף את הצינור 4-5 פעמים. . אל תעשה מערבולת
  6. תנו לתערובת לשבת על הקרח במשך 30 דקות.
  7. הלם חום ב 42 ° c עבור 30 s. אל תערבב.
  8. להעביר את הצינור בחזרה לקרח עבור 2 דקות.
  9. הוסף 950 μL של טמפרטורת החדר SOC מדיה לתוך השפופרת.
  10. דגירה את צינור התגובה ב 37 ° c עבור 60 דקות. לנער במרץ (300 rpm).
  11. לוחות בחירה חמה עם האנטיביוטיקה המתאימה במהלך הדגירה ב 37 ° c.
  12. גלולה את התאים באמצעות צנטריפוגה (10,000 x g, 30 s) ו צלחת החוצה 1/4 ו3/4 של תאים על שני לוחיות בחירה ו-דגירה ב 37 ° c לילה.

8. ואלידציה של שיבוטים

  1. השתמש ב-pcr המושבה, העסקת את ה-pcr בתחל באתרי ההרכבה (איור 1ג) לאיתור.
  2. קחו קיסם שיניים סטרילי. ותגעו במושבת חיידקים אחת
  3. לגעת בחלק התחתון של צינור ה-PCR עם קיסם כי יש את המושבה ולאחר מכן פס קיסם על צלחת לאנטיביוטיקה אגר, מודקת את הצלחת ברצף ב 37 ° צ' או טמפרטורת החדר עבור מבנים רגישים לילה.
  4. כיסוי צינור ה-PCR נגע במושבה עם שילוב ה-PCR המכיל את התחל האיתור. אלה תוכננו באמצעות פריימר 3 (http://bioinfo.ut.ee/primer3-0.4.0/). התוכנית כוללת את האפשרות לכפות עיצוב מחודש לאורך רצף מוגדר באמצעות השלטים "[ccc]" כדי לבחור התחל מעבר לצומת ההרכבה. דנ א מזנים חיוביים מבודד ומאומת על ידי רצף.

9. ניתוח מעגלי RNA המבטא גנים כתבת

  1. לניתוח, שינוי גנים של כתב. כאן, השתמש בHEK293 תאים (ATTC #CRL-1573) כשהם מעניקים יעילות גבוהה לזיהום. כדי לחסוך בעלויות, השתמש בפתרונות פיי (פוליאתילן).
  2. עבור הפתרון פיי, התמוססות פוליאתילן ליניארי הידרוכלוריד (פיי) ב 1 מ"ג/mL במים ב-pH נמוך, pH 2. . תעלה את ה-pH ל -7 עם נאאה מסנן סטרילי עם מסנני 0.22 יקרומטר וחנות ב-4 ° c.
  3. לפצל את התאים לשישה בארות (כ 150,000 תאים לכל טוב) ולתת להם לגדול לילה ב 10% FBS במדיה DMEM.
  4. Aliquot 1 μg של הגן העיתונאי בצינור סטרילי ולהוסיף 200 μL של מסוננים סטרילי 150 מ"מ הנאל. מערבבים עם ה-DNA על ידי וורטקנג.
  5. הוספת הפתרון פיי לערבב זה מערבולת, בקצרה צנטריפוגה לאסוף דגימות בתחתית הצינור. השתמש ביחס של 1 μg של DNA לכל 3 μL של פיי.
  6. דגירה בטמפרטורת החדר עבור 10 דקות ולאחר מכן להוסיף ישירות HEK 293 תאים.
  7. מודטה HEK293 תאים ב 37 ° c, 5% CO2, לילה.
  8. בידוד RNA עבור RT-PCR באמצעות ערכת בידוד RNA.

10. RNase R טיפול כדי להסיר RNAs ליניארי

  1. השתמש 10 μg של RNA כולל בשפופרת RNase-free.
  2. הוסף 10 μL של מאגר 10x RNase R (0.2 M Tris-HCl (pH 8.0), 1 M KCl, 1 מ"מ MgCl2) ל-RNA.
  3. הוסף RNase R ל-RNA (1 μl = 20U).
  4. הוסף 1 μL של גליקול כחול ל-RNA והבא את הנפח עד 100 μL עם מים סטריליים.
  5. מודטה דגימות ב 37 ° c עבור 30 דקות.
  6. הוסף 100 μL של פנול/כלורופורם ומערבולת עבור 1 דקות.
  7. צנטריפוגה ב 21,000 x g עבור 1 דקות עד שלבים נפרדים.
  8. קח את supernatant (שלב מימית) ולהוסיף אמצעי אחסון 1 (סביב 80 μL של כלורופורם).
  9. מערבולת עבור 1 דקות ולאחר מכן צנטריפוגה עבור 1 דקות עד שלבים נפרדים.
  10. לקחת supernatant, להוסיף 1:10 vol KAc ו 2.5 vol האתנול, ומזרז ב-20 ° c עבור 1-4 h. צנטריפוגה ב 4 ° צ' עבור 30 דקות במהירות מלאה (21,000 x g). . תהיה פה גלולה כחולה קטנה בתחתית
  11. , תסיר את הסופרנטאנט. ותשטוף עם 80% אתנול ניתן לאוויר להתייבש 5 דקות בטמפרטורת החדר, ולפזר 10 מיים μL.

11. מחקר בדיקות-PCR

  1. השתמש 1 μg של RNA לכל תגובת RT.
  2. לעשות תערובת התגובה עבור הנפח הכולל הסופי של 20 μL לכל תגובה. עבור תגובה אחת, השתמש 1 μL של 10 מ"מ dNTPs, 1 μL של 0.1 M Dithioitol (DTT), 4 μL של מאגר הגדיל 5x הראשון, ו 0.5 μL של היפוך טרנסקריפטאז.
  3. Aliquot 6.5 μL של ערבוב התגובה לתוך צינורות PCR חדשים.
  4. מערבבים עד 5 התחל בתמהיל אחד. עם זאת, מספר התחל מסוים עשוי להיות לא-משני עם צבעי יסוד אחרים ב-PCR (איור 5). רצפים פריימר נמצאים בשולחן 2. אנו משתמשים באופן שוטף בצבעי היסוד הספציפיים של הגן, אבל הטרמה עם הבוחנים אקראיים אפשרית גם כן.
  5. הוסף 1 μL של 10 μM הפוך פריימר לצינור התגובה הרצוי RT.
  6. הוסף 1 μg של RNA לצינור התגובה PCR.
  7. הוספת RNase-H ללא תשלום2O עד נפח כולל של 20 μl.
  8. לסובב את הצינורות למטה כדי להסיר שאריות בצד של צינורות ומקום בתוך התרמוציקלer.
  9. הפעל את תגובת ה-RT ב-50 ° c עבור 50 דקות.
  10. לאחסן RT cDNA ב-20 ° c או להמשיך לתגובת ה-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

גנים עיתונאי לאפשר נחישות של גורמים הרגולציה המשפיעים על היווצרות RNA מעגלי. עם זאת, גנים כתבת אלה הם גדולים ומכילים אלמנטים חוזרים כי לעתים קרובות לעשות בנייה DNA לא יציב. בשל גודלם הגדול, לעתים קרובות יש צורך למחוק חלקים של introns, אשר מושגת על ידי הגברה של חתיכות גנומית המכילה exons וחלקים קטנים האגפים. אלה יצירות DNA התאספו באמצעות אנזימטי, המאפשר בנייה ללא אנזימים הגבלה.

הדוגמה של RNA מעגלי שנוצר מתוך מיקרוכדורית טאו החלבון המשויך (MAPT) מראה יישום של הגישה minigene לנתח RNAs מעגלית. הטאו 9 → מיניגנים בשימוש בדוגמה זו היה שיתוף פעולה עם גורמים שונים וההשפעה של גורמים אלה שחבור הבחין ב-RT-PCR (איור 6). גורמי טרנס משחק שונים להשפיע על RNA מעגלי ו-mRNA ליניארי היווצרות. הניסוי גם מראה כי כל רכיבי הרצף הדרושים עבור היווצרות RNA מעגלי מותאמים לרסיס משוכפל.

Figure 1
איור 1: מבט כולל על הטכניקה. (א) גן היפותטי מוצג. Introns הם קווים, exons הם תיבות, Alu אלמנטס הם תיבות מפוצל קטן יותר. שחבור לאחור מתוך האקסון C to A יוצרת RNA מעגלי. המבנה של רנ א זה מעגלית מוצג פאנל (E). (ב) כדי ליצור גן עיתונאי, exons ו-introns שמסביב (לפחות 500 nt בכל צד) הם הוגדל. המבנים צריכים להכיל אלמנטים חוזרים, אשר בדרך כלל Alu אלמנטים בבני אדם. במעלה הזרם של אקסון A היה כלול כדי לספק אלמנט Alu נוסף. שברי גנומית יחפפו. עם האגפים 25 nts (ג) קטעים משוכפלות לווקטור ביטוי, המונע על ידי מקדם cmv. שילוב חוזר מוצלח מזוהה על ידי זיהוי התחל ומאומת על-ידי רצף. (ד) תאים מזוהמים במבנה זה. (ה) רנ א מעגלית הוא מבודד ו (F) הוגדל באמצעות מעגלי rna ספציפיים התחל, עדיף אקסון הצומת התחל. במהלך הגברה PCR, RNA ליניארי יכול גם להיות מוגבר (G). (G) כיוון התחל המשמש לזיהוי מעגלי rnas. ההילוך הקדמי הוא בכיוון ההיגיון (כלומר, יש את אותו רצף כמו RNA) ואת ההילוך ההפוך הוא בכיוון אנטי-sense (כלומר, הוא המשלים הפוכה של RNA). שימו לב כי שונה מ-RT-PCR עבור mRNAs ליניארי, ההילוך ההפוך הוא במעלה הזרם של ההילוך הקדמי. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 2
איור 2: בחירת הרצף לבניית מיניגנים. (א) התצוגה הדפדפן לאחר הרצף המוצג באיור המשלים 1 מופעל מול מסד הנתונים הגנומית האנושית באמצעות הבלט. ספרות אקסון מספרים36 מצוינים בתצוגת הגן, הם שונים מן המספרים הניתנים על ידי הדפדפן.
1. הרצפים המיושרים מוצגים תחת ' הסדר שלך '
2-4. שים לב כי בשל המעגל של RNA, בבלט אינו מתחבר כל exons עם קווים כפי שהוא עושה ב-RNA ליניארי. Exons 10 ו -11 (המתאימים 2 ו-3) מחוברים, אבל exons 12 (המקבילה 4) אינו מחובר exons 11.
5. Alu אלמנטים מוצגים במסלול האלמנט החוזר ונשנה.
(ב) התאמת רצף בין המבנה המתוכנן לבין דנ א גנומית.
6. המבנה המתוכנן הופעל כנגד מסד הנתונים באמצעות הבלט.
7. שים לב להכללה של מספר רכיבי Alu במבנה. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 3
איור 3: דוגמה של הגברה לפני שיבוט. מוצרי PCR ממוטביםמופרדים ב-1% ג'ל המכיל את 1X gelgreen. הלהקות הבודדות מייצגות את מוצרי ה-PCR שישמשו בהרכבת DNA אנזימטית. (ב) הלהקות מתוך (א) נחתכו מהג ומטוהר. מוצרי ה-PCR המטוהרים הופרדו ב-1% ג'ל שהוכתם לאחר מכן עם אתידיום ברומיד. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 4
איור 4: ניתוח הגבלה של גנים כתבת. ה-9-12 minigene של הטאו המשמש כדוגמה נחתך עם אנזימי הגבלה המצוין כדי לשלול שילובים מרכזיים. ליין 1: לחתוך עם NcoI צפוי בגדלים 735 bp, 3345 bp, 6266 bp, ליין 2 לחתוך עם XbaI צפוי גודל 10346 bp, ליין 3 לחתוך עם HindIII צפוי גדלים 3951 bp, 6395 bp, ליין 4 לחתוך עם SmaI בגדלים צפויים 1168 bp, 1688 bp, 2708 bp, 4782 bp. אנא לחץ כאן כדי ל

Figure 5
איור 5: השפעת ריבוב פריימר ו RNase R טיפול על זיהוי RNA מעגלי. (א) cdna מתוך דגימות A ו-B נגזר מרקמות המוח האנושי הוגדל עם מעגלי RNA התחל מעגלית Exon12_10 הפוך ו-circtau exon10_11 קדימה. התעתיק ההפוך ל-cDNA בוצעה עם התחל של ה-RNA ליניארי ומעגלי של הטאו. הלהקה הצפויה מתאימה ל-RNA העגול של הטאו מוצג על ידי משולש. הלהקות החזקות האחרות הן פריטים שאינם תואמים לגנום האנושי. (ב) הניסוי חזר על עצמו עם תנאי PCR זהים, אך התמלול ההפוכה בוצעה רק באמצעות החוגה Exon12_10 הפוכה. רק הלהקה הצפויה היתה מוגברת ומאומתת באמצעות רצף. (ג) RNA טופל עם RNase R זה מסיר RNA ליניארי. RNA מעגלי הוא לזיהוי לאחר הטיפול (משמאל), ואילו RNA ליניארי אינו נותן עוד אות לזיהוי (מימין) אנא לחץ כאן כדי לצפות בגירסה גדולה יותר של איור זה.

Figure 6
איור 6: דוגמה לניתוח של גן כתבת circRNA. 1 μg של הטאו 9 → 1237 גן עיתונאי היה מנוכר עם 1 μg של גורמים החדרת שצוין. RNA היה מבודד 24 שעות הצבה לאחר ניתוח RT-PCR. (א) הגברה של ה-mrna הליניארי של הטאו. בשל שחבור חלופיים של אקסון 10 2 להקות נצפו. היחס שלהם משתנה בשל הבעת היתר של החדרת גורמים38,39. (ב) הגברה של המעגל העגול 12 ← 10 טאו RNA23. שימו לב לתלות של ביטוי הסיקרונה של הטאו על ביטוי של כמה גורמים הcdc2, במיוחד את ה-clk2 קינאז והחלבון SR 9G8. (ג) ה-RNA המעגלי של HIPK3 שימש כפקד חיובי המציין טעינה שווה. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

טבלה 1: רשימת המיניגנים הנוכחיים המבטא RNAs מעגלית. אנא לחץ כאן כדי להוריד קובץ זה.

מעגלי HIPK3 הבקרה התחל
HIPK3 הפוך
HIPK3 פורוורד
כמוסות מגנט
מוזיאון האחים ברונטה
תחל ליניארי
טאו Exon 12 הפוך
טאו אקסון 9 קדימה
CCCAATCTTCGACTGGACTC
מיכל ברקת
תחל מעגלי
קירקיטאו exon12_10 הפוך
circTau exon10_11 פורוורד
מדריך כמוסות מוסקט
מוזיאון ה, הגותי

שולחן 2: רשימת התחל

Supplemental Figure 1
משלימה איור 1: הטאו מעגלית ברצף הניסוי של RNA. רצף מבחן המתאים RNA מעגלי מ- Mapt לוקוס. הרחבות שונות מסומנות באמצעות קו תחתון, אותיות קטנות ואותיות גדולות. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Supplemental Figure 2
איור משלים 2: רצף גנומית המכיל minigene מתוכננת. הרחבות מודגשות בצבע ורכיבים חוזרים מסומנים בקו תחתון, נטוי ומודגש. הצללה אפורה מציינת אזורים מאגפים של מורכבות נמוכה שניתן להשתמש בהם כדי ליצור תחל. אנא לחץ כאן כדי להוריד קובץ זה.

Supplemental Figure 3
איור משלים 3: רצפים של הגן העיתונאי המתוכנן. הרצף הווקטורי והקטעים הגנומית המתוכננים מוצגים. אנא לחץ כאן כדי להוריד קובץ זה.

Supplemental Figure 4
איור משלים 4: עיצוב כתחל להרכבה. הרצף מתוך האיור המשלים 3 הוזן לתוך הכלי בונה. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Supplemental Figure 5
משלים איור 5: הרצף של ה-> 12 הגנים העיתונאי המשמש לדוגמה. אנא לחץ כאן כדי להוריד קובץ זה.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

באופן כללי, RNAs מעגלית נמוך1שופע, אשר מסבך את המחקר של התפקוד שלהם ואת המבנה. בדומה RNAs ליניארי13, השימוש של מיניגנים הכתב מאפשר זיהוי של העמים וגורמים טרנס משחק המסדירים את היווצרות rnas מעגלית. לפיכך, גישה זו יוצרת השערות שניתן לבחון עוד יותר באמצעות הגנים האנדוגניים.

הצעד הקריטי ביותר הוא העיצוב של הגן של העיתונאי. ההרכבה האנזימטית של שברי הדנ א ("שיבוט גיבסון"27) מקלה על עיצוב זה, שכן היא מאפשרת בנייה של גנים כתבת גדולים ללא תלות באתרי הגבלה.

האתרים החוזרים מתחברים באמצעות מאגף חוזר הפוך, אשר יש לקחת בחשבון בבניית גנים כתבת. חוזר הם מבוארים בדפדפן הגנום ' מעקב חוזר ' ובחירה בהם מראה את הכיוון שלהם. זכור כי חלבונים יכולים גם לאלץ את המקומות האחורי החדרת לתוך מבנה משני הדרוש עבור ביטוי RNA מעוגל28 ועבור ניתוח משוחדת 1-2 kb של האזורים האגפים יש לחקור.

כדי להבטיח יציבות של המבנים, שיקול חשוב הוא סוג של זנים חיידקיים ותנאי הצמיחה שלהם. לקבלת קצר יותר, מבנים פשוטים שיבוט חיידקים סטנדרטיים משמשים, אשר כמעט זהה ל-DH5 אלפא (huA2 Δ (ארגף-lacZ) U169 phoA glnV44 φ 80 Δ (lacZ) M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17). עבור שברים ארוכים יותר, המכיל יותר מ 6 האלמנטים Alu , "יציב" תאים מוכשרים משמשים כי חוסר Recombinase (reca) ו endonuclease (endA1) (F ' Proa + B + לlaciq ∆ (laci) M15 Zzf:: Tn10 (טר) ∆ (Ara-leu) 7697 AraD139 fhua ∆ lacX74 GalK16 galE15 E14-Φ80dlacZ ∆ M15 recA1 RelA1 EndA1 nupg rpsL (StrR) Rph SpoT1 ∆ (Mrr-hsdrms-mcrbc). אם מופיעות בעיות עם שילוב מחדש, המצוין על-ידי ספירות שינוי נמוכות, הצלחת החיידקים המשתנים על שתי צלחות ולתת להם לצמוח ב-30 º C ו-37 º C, בהתאמה. בשל נוכחותם של גורמים חוזרים רבים במיניגנים, הם צריכים להיות רצף מלא באמצעות רצף הדור הבא, אשר זמין מסחרית עבור סביב $150 לפלבאמצע ב 2019 שיעורי. רצף הדוגמה מוצג באיור המשלים 5. בנוסף, באורך קטע ההגבלה ניתוח פולימורפיזם להכנה חדשה יותר של המבנה מבוצעת באופן שגרתי. לדוגמה, שימוש באתרים שחתוכים 1-4 פעמים מביא לדפוס אופייני של הלהקה הקובע שילובים מחדש (איור 4). יש לבחור באנזימים הנותנים דפוס אופייני ללהקה של קטעים שניתן להפריד באמצעות ג'ל שנוצר.

RNAs מעגלית מנותח עם RT-PCR באמצעות התחל של הצומת לאחר החפיפה עם האירוע שחבור לרקע (איור 1F). בשל טבעו המעגלי של ה-RNA, ההילוך ההפוך (כלומר אנטי-היגיון) הוא במעלה הזרם של ההילוך הקדמי (למשל) (איור 1G). כיצד לזהות את הבית המבוטא בשפע-האינטראקציה חלבון קינאז 3 (HIPK3) מעגלי RNA1 משמשים כשליטה חיובית. HIPK3 ו-minigene כיתה הפוכה ספציפית הפוכה משועתק לאחור באותה צינורית, המאפשרת השוואה. תגובות ה-PCR מתבצעות עם הגברה התחל של mRNAs הליניארי כדי להשוות דפוסי עיבוד של pre-mRNAs מעגלי וליניארי. לעתים קרובות הבחנו בלהקות מסוימות כאשר התחל לעבור RNAs ליניארי ומעגלית היו מעורבים (איור 5), ובכך לשמור את התעתיק ההפוך של דגימות אלה בנפרד.

הניתוח RT-PCR של RNAs מעגלית הוא מאתגר צריך להיות נשלט בקפידה. בעוד רגיש ונוח, זה יכול לייצר פריטים ייחודיים עבור RNAs29עגול. הטרנסקריפטאז הפוכה יכולה לנוע מספר פעמים סביב מעגל ה-RNA, המייצר קונקטרים. הגנים העגולים ביותר כתבת rna לייצר הן RNA מעגלי ו ליניארי, אשר יכול cross-hybridize, המוביל ליותר PCR ממצאים21,30,31. זה הכרחי ולכן רצף את מוצרי ה-PCR ולאמת ממצאים באמצעות טכניקות שונות באמצעות הצפון הכלים32 או rnase הגנות23.

להקות לא מוסברות יכולות גם לנבוע מהגברה חריגה של רנ א ליניארי. RNA ליניארי ניתן להסיר באמצעות RNase החכירה, אשר מעשיר RNAs33 מעגלי (איור 5ג). הטיפול RNase R מסייע במיטוב הראשוני של גילוי התחל ולעתים קרובות ניתן להשמיט לאחר התחל ממוטבת.

חלופה חלופית שחבור יכול גם לתרום להקות מוסברים כמו RNAs מעגלי מרובים ניתן ליצור מתוך לוקוס גנומית34. החדרת החזרה חלופית זו היא לעתים קרובות תוצאה של מבנים pre-mRNA מתחרה שנוצרו על-ידי יותר משני רכיבים חוזרים הפוכים. בנוסף, אתרי החזרה הסודי יכול להתרחש32,35. בהתאם למטרה הניסיונית, Alu אלמנטים ניתן לחזור או להוסיף את המבנים. האזורים המשלימים מאגף האחורי אתרים יכול להיות קצר כמו 30-40 nt35 והחלפה של Alu אלמנטים עם אזורים משלימים קצר יותר יכול להגדיל את היווצרות rna מעגלי2, אשר ניתן לבחון כדי לשפר את היווצרות rna מעגלי. לאחר רצפי pre-mRNA הגורם השחבור האחורי זוהו, כך ניתן לקצר את מבנה RNA ביטוי מעגלי, אשר יכול לשפר את היעילות של התרגום במקרים מסוימים.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

. אין מה לגלות

Acknowledgments

עבודה זו נתמכת על ידי משרד ההגנה משרד הביטחון מענק AZ180075. סטפן סטאם, תודה לז של ז'קלין נונן אנה פאולוצ'ין נתמכת על ידי ה-DAAD, התוכנית האקדמית הגרמנית, ג'סטין R. Welden היה מקבל את הפרס של אוניברסיטת קנטקי מקס סטקלר.

Materials

Name Company Catalog Number Comments
(PEI) Hydrochloride Polysciences 24765-1
Builder tool NEB https://nebuilder.neb.com/#!/
Dark Reader Transilluminator. Clare Chemical Research
Enzymatic DNA assembly kit NEB E2621S
Gel and PCR cleanup kit Promega A9282
Glyco Blue Thermo Fisher AM9516
pcDNA3.1 cloning site Polycloning site https://assets.thermofisher.com/TFS-Assets/LSG/manuals/pcdna3_1_man.pdf
Polymerase 1 NEB M0491L Q5 DNA polymerase
Polymerase 2 Biorad 1725310 Long range polymerase (NEB), iproof (BioRad)
Polymerase 2 Qiagen 206402 Qiagen long range polymerase kit
Reverse Transcriptase Thermo Fisher 18080044
RNA isolation kit Life Technologies 12183025 Ambion by Life Technologies
RNAse R Lucigen RNR07250 Epicenter/Lucigen
Stable competent cells NEB C3040H NEB stable cells
Standard cloning bacteria NEB C2988J NEB5-alpha competent
Web tool to design primers NEB https://nebuilder.neb.com/#!/
Web-based temperature calculations NEB https://tmcalculator.neb.com/#!/main

DOWNLOAD MATERIALS LIST

References

  1. Jeck, W. R., et al. Circular RNAs are abundant, conserved, and associated with ALU repeats. RNA. 19, (2), 141-157 (2013).
  2. Zhang, X. O., et al. Complementary sequence-mediated exon circularization. Cell. 159, (1), 134-147 (2014).
  3. Deininger, P. Alu elements: know the SINEs. Genome Biology. 12, (12), 236 (2011).
  4. Bazak, L., Levanon, E. Y., Eisenberg, E. Genome-wide analysis of Alu editability. Nucleic Acids Research. 42, (11), 6876-6884 (2014).
  5. Levanon, E. Y., et al. Systematic identification of abundant A-to-I editing sites in the human transcriptome. Nature Biotechnology. 22, (8), 1001-1005 (2004).
  6. Hansen, T. B., et al. Natural RNA circles function as efficient microRNA sponges. Nature. 495, (7441), 384-388 (2013).
  7. Kelly, S., Greenman, C., Cook, P. R., Papantonis, A. Exon Skipping Is Correlated with Exon Circularization. Journal of Molecular Biology. 427, (15), 2414-2417 (2015).
  8. Li, Z., et al. Exon-intron circular RNAs regulate transcription in the nucleus. Nature Structural & Molecular Biology. 22, (3), 256-264 (2015).
  9. Yang, Y., et al. Extensive translation of circular RNAs driven by N(6)-methyladenosine. Cell Research. 27, (6), 626-641 (2017).
  10. Abe, N., et al. Rolling Circle Translation of Circular RNA in Living Human Cells. Scientific Reports. 5, 16435 (2015).
  11. Salzman, J., Chen, R. E., Olsen, M. N., Wang, P. L., Brown, P. O. Cell-type specific features of circular RNA expression. PLOS Genetics. 9, (9), 1003777 (2013).
  12. Ottesen, E. W., Luo, D., Seo, J., Singh, N. N., Singh, R. N. Human Survival Motor Neuron genes generate a vast repertoire of circular RNAs. Nucleic Acids Research. 47, (6), 2884-2905 (2019).
  13. Stoss, O., Stoilov, P., Hartmann, A. M., Nayler, O., Stamm, S. The in vivo minigene approach to analyze tissue-specific splicing. Brain Research Protocols. 4, 383-394 (1999).
  14. Mardon, H. J., Sebastio, G., Baralle, F. E. A role for exon sequences in alternative splicing of the human fibronectin gene. Nucleic Acids Research. 15, 7725-7733 (1987).
  15. Gaildrat, P., et al. Use of splicing reporter minigene assay to evaluate the effect on splicing of unclassified genetic variants. Methods in Molecular Biology. 653, 249-257 (2010).
  16. Cooper, T. A. Use of minigene systems to dissect alternative splicing elements. Methods. 37, (4), 331-340 (2005).
  17. Baralle, D., Baralle, M. Splicing in action: assessing disease causing sequence changes. Journal of Medical Genetics. 42, (10), 737-748 (2005).
  18. Percifield, R., Murphy, D., Stoilov, P. Medium throughput analysis of alternative splicing by fluorescently labeled RT-PCR. Methods in Molecular Biology. 1126, 299-313 (2014).
  19. Stoilov, P., Lin, C. H., Damoiseaux, R., Nikolic, J., Black, D. L. A high-throughput screening strategy identifies cardiotonic steroids as alternative splicing modulators. Proceedings of the National Academy of Sciences of the United States of America. 105, (32), 11218-11223 (2008).
  20. Shen, M., et al. Pyrvinium pamoate changes alternative splicing of the serotonin receptor 2C by influencing its RNA structure. Nucleic Acids Research. 41, (6), 3819-3832 (2013).
  21. Noto, J. J., Schmidt, C. A., Matera, A. G. Engineering and expressing circular RNAs via tRNA splicing. RNA Biology. 1-7 (2017).
  22. Schmidt, C. A., Noto, J. J., Filonov, G. S., Matera, A. G. A Method for Expressing and Imaging Abundant, Stable, Circular RNAs In Vivo Using tRNA Splicing. Methods in Enzymology. 572, 215-236 (2016).
  23. Welden, J. R., van Doorn, J., Nelson, P. T., Stamm, S. The human MAPT locus generates circular RNAs. Biochimica et Biophysica Acta - Molecular Basis of Disease. 2753-2760 (2018).
  24. Casper, J., et al. The UCSC Genome Browser database: 2018 update. Nucleic Acids Research. 46, 762-769 (2018).
  25. Grozdanov, P. N., MacDonald, C. C. Generation of plasmid vectors expressing FLAG-tagged proteins under the regulation of human elongation factor-1alpha promoter using Gibson assembly. Journal of Visualized Experiments. (96), (2015).
  26. Wang, Y., et al. A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Research. 32, (3), 1197-1207 (2004).
  27. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  28. Conn, S. J., et al. The RNA binding protein quaking regulates formation of circRNAs. Cell. 160, (6), 1125-1134 (2015).
  29. Jeck, W. R., Sharpless, N. E. Detecting and characterizing circular RNAs. Nature Biotechnology. 32, (5), 453-461 (2014).
  30. Pamudurti, N. R., et al. Translation of CircRNAs. Molecular Cell. 66, (1), 9-21 (2017).
  31. Kramer, M. C., et al. Combinatorial control of Drosophila circular RNA expression by intronic repeats, hnRNPs, and SR proteins. Genes & Development. 29, (20), 2168-2182 (2015).
  32. Starke, S., et al. Exon circularization requires canonical splice signals. Cell Reports. 10, (1), 103-111 (2015).
  33. Suzuki, H., Tsukahara, T. A view of pre-mRNA splicing from RNase R resistant RNAs. International Journal of Molecular Sciences. 15, (6), 9331-9342 (2014).
  34. Zhang, X. O., et al. Diverse alternative back-splicing and alternative splicing landscape of circular RNAs. Genome Research. 26, (9), 1277-1287 (2016).
  35. Liang, D., Wilusz, J. E. Short intronic repeat sequences facilitate circular RNA production. Genes & Development. 28, (20), 2233-2247 (2014).
  36. Wang, Y., Mandelkow, E. Tau in physiology and pathology. Nature Reviews Neuroscience. 17, (1), 5-21 (2016).
  37. Fejes-Toth, K., et al. Post-transcriptional processing generates a diversity of 5'-modified long and short RNAs. Nature. 457, (7232), 1028-1032 (2009).
  38. Gao, Q. S., et al. Complex regulation of tau exon 10, whose missplicing causes frontotemporal dementia. Journal of Neurochemistry. 74, (2), 490-500 (2000).
  39. Hartmann, A. M., et al. Regulation of alternative splicing of human tau exon 10 by phosphorylation of splicing factors. Molecular and Cellular Neuroscience. 18, (1), 80-90 (2001).
  40. Wang, Y., Wang, Z. Efficient backsplicing produces translatable circular mRNAs. RNA. 21, (2), 172-179 (2015).
  41. Yang, Y., Wang, Z. Constructing GFP-Based Reporter to Study Back Splicing and Translation of Circular RNA. Methods in Molecular Biology. 1724, 107-118 (2018).
  42. Zheng, Q., et al. Circular RNA profiling reveals an abundant circHIPK3 that regulates cell growth by sponging multiple miRNAs. Nature Communications. 7, 11215 (2016).
  43. Jia, W., Xu, B., Wu, J. Circular RNA expression profiles of mouse ovaries during postnatal development and the function of circular RNA epidermal growth factor receptor in granulosa cells. Metabolism. 85, 192-204 (2018).
  44. Liang, D., et al. The Output of Protein-Coding Genes Shifts to Circular RNAs When the Pre-mRNA Processing Machinery Is Limiting. Molecular Cell. 68, (5), 940-954 (2017).
  45. Legnini, I., et al. Circ-ZNF609 Is a Circular RNA that Can Be Translated and Functions in Myogenesis. Molecular Cell. 66, (1), 22-37 (2017).
  46. Li, X., et al. Coordinated circRNA Biogenesis and Function with NF90/NF110 in Viral Infection. Molecular Cell. 67, (2), 214-227 (2017).
  47. Zhang, Y., et al. The Biogenesis of Nascent Circular RNAs. Cell Reports. 15, (3), 611-624 (2016).
שימוש באלמנט <em>Alu</em> המכיל מיני-גנים לניתוח Rnas מעגלית
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Welden, J. R., Pawluchin, A., van Doorn, J., Stamm, S. Use of Alu Element Containing Minigenes to Analyze Circular RNAs. J. Vis. Exp. (157), e59760, doi:10.3791/59760 (2020).More

Welden, J. R., Pawluchin, A., van Doorn, J., Stamm, S. Use of Alu Element Containing Minigenes to Analyze Circular RNAs. J. Vis. Exp. (157), e59760, doi:10.3791/59760 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter