Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

परिपत्र आरएनए का विश्लेषण करने के लिए मिनीजीन युक्त एलु तत्व का उपयोग

doi: 10.3791/59760 Published: March 10, 2020

Summary

हम परिपत्र आरएनए पैदा करने वाले रिपोर्टर जीन का क्लोन और विश्लेषण करते हैं। ये रिपोर्टर जीन रैखिक स्प्लिसिंग का विश्लेषण करने और अलु तत्वों को नियंत्रित करने के लिए निर्माण से बड़े होते हैं। परिपत्र आरएनए की जांच करने के लिए, निर्माण कोशिकाओं में ट्रांस्फ होते हैं और जिसके परिणामस्वरूप आरएनए का विश्लेषण रैखिक आरएनए को हटाने के बाद आरटी-पीसीआर का उपयोग करके किया जाता है।

Abstract

रैखिक mRNAs के अलावा, कई यूकेरियोटिक जीन परिपत्र आरएनए उत्पन्न करते हैं। अधिकांश परिपत्र आरएनए एक प्री-एमआरएनए के भीतर एक अपस्ट्रीम 3 ' स्प्लिस साइट के साथ 5 ' स्प्लिस साइट में शामिल होने से उत्पन्न होते हैं, जो बैक-स्प्लिसिंग नामक प्रक्रिया है। यह परिपत्रीकरण पूर्व-एमआरएनए में माध्यमिक संरचनाओं द्वारा सहायता प्राप्त है जो स्प्लिस साइटों को निकट निकटता में लाते हैं। मानव जीन में, Alu तत्वों को इन माध्यमिक आरएनए संरचनाओं को बढ़ावा देने के लिए सोचा जाता है, क्योंकि Alu तत्व प्रचुर मात्रा में होते हैं और पूर्व-एमआरएनए में विपरीत दिशाओं में मौजूद होने पर एक दूसरे के साथ आधार पूरकता प्रदर्शित करते हैं। यहां, हम बड़े, Alu तत्व है कि परिपत्र RNAs फार्म युक्त की पीढ़ी और विश्लेषण का वर्णन । क्लोनिंग प्रोटोकॉल के अनुकूलन के माध्यम से, 20 केबी डालने की लंबाई के साथ रिपोर्टर जीन उत्पन्न किया जा सकता है। सह-ट्रांसफेक्शन प्रयोगों में उनका विश्लेषण नियामक कारकों की पहचान की अनुमति देता है। इस प्रकार, यह विधि परिपत्र आरएनए गठन में शामिल आरएनए दृश्यों और सेलुलर घटकों की पहचान कर सकती है।

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

सर्कुलर आरएनए
परिपत्र आरएनए (सीआईआरसीआरएनए) को सहसंयोजक रूप से बंद कर दिया जाता है जो अधिकांश जीवों में व्यक्त किए जाते हैं। वे एक अपस्ट्रीम 5 ' स्प्लिस साइट में शामिल होने से उत्पन्न होते हैं, जो बैक-स्प्लिसिंग(चित्रा 1ए)1नामक प्रक्रिया है। पूर्व-एमआरएनए में दृश्य जो 30-40 एनटी के रूप में आधार पूरक प्रदर्शन करते हैं, सिरआरएनए गठन2के लिए उचित संरेखण में वापस आते हैं। मनुष्यों में, एलू तत्व1,जीनोम3के लगभग 11% का प्रतिनिधित्व करते हैं, अपने स्वयं-पूरकता4,5 के कारण प्री-एमआरएनए में व्यापक डबल फंसे आरएनए संरचनाएं बनाते हैं और इस प्रकार सर्क्रैना1के गठन को बढ़ावा देते हैं।

वर्तमान में, सर्करना के तीन प्रमुख कार्यों का वर्णन किया गया है। कुछ सर्करनास माइक्रोआरएनए (मिरना) को बांधते हैं और मिआरएनए स्पंज6की तरह ज़ब्ती अधिनियम के माध्यम से। सर्क्रोनास को ट्रांसक्रिप्शनल और पोस्ट ट्रांसक्रिप्शनल रेगुलेशन में फंसाया गया है, जो रैखिक स्प्लिसिंग7 या ट्रांसक्रिप्शन फैक्टर एक्टिविटी8के मॉड्यूलेशन के साथ प्रतिस्पर्धा के माध्यम से है । अंत में, सर्कर्न में कम खुले पढ़ने के फ्रेम होते हैं और सिद्धांत अध्ययनों का प्रमाण बताता है कि उनका अनुवाद9,10किया जा सकता है। हालांकि, सबसे सर्करों का कार्य रहस्यपूर्ण बना हुआ है। परिपत्र RNAs के बहुमत अगली पीढ़ी अनुक्रमण तरीकों11का उपयोग कर पता लगाया गया है । लक्षित आरटी-पीसीआर दृष्टिकोणों का उपयोग करके व्यक्तिगत जीन के विस्तृत विश्लेषण से पता चलता है कि बड़ी संख्या में परिपत्र आरएनए की खोजकीजानी बाकी है ।

पूर्व-एमआरएनए प्रसंस्करण का विश्लेषण करने के लिए रिपोर्टर जीन का उपयोग
डीएनए रिपोर्टर से प्राप्त एमआरएनए का विश्लेषण कोशिकाओं में ट्रांससंक्रमित निर्माण वैकल्पिक पूर्व-एमआरएनए स्प्लिसिंग का अध्ययन करने के लिए एक अच्छी तरह से स्थापित विधि है, जिसे परिपत्र आरएनए पर लागू किया जा सकता है। सामान्य तौर पर, वैकल्पिक एक्सोन, इसके आसपास के इंट्रोन, और संविलियन एक्सोन को परिलक्षित किया जाता है और एक यूकेरियोटिक अभिव्यक्ति वेक्टर में क्लोन किया जाता है। अक्सर, इंट्रोन छोटा हो जाता है। निर्माण यूकेरियोटिक कोशिकाओं में ट्रांस्पर होते हैं और आमतौर पर आरटी-पीसीआर13,14द्वारा विश्लेषण किया जाता है । इस दृष्टिकोण का बड़े पैमाने पर उपयोग नियामक स्थलों और सह -ट्रांसफेक्शन प्रयोगों 13,15,16,17,18में ट्रांस-एक्टिंग कारकों को मैप करने के लिए किया गया है । इसके अलावा, प्रोटीन व्यक्त करने वाले मिनीजीन की पीढ़ी को उन पदार्थों की स्क्रीनिंग के लिए अनुमति दी गई जो वैकल्पिक स्प्लिसिंग19,20को बदलते हैं।

विधि परिपत्र आरएनए पर लागू किया गया है। वर्तमान में, साहित्य में कम से कम 12 मिनीजीन बैकबोन का वर्णन किया गया है और तालिका 1में संक्षेप में शामिल किया गया है। टीआरएनए आधारित अभिव्यक्ति प्रणाली21,22के अपवाद के साथ, वे सभी बहुलक द्वितीय प्रमोटरों पर निर्भर हैं। यहां, हम परिपत्र आरएनए की पीढ़ी में शामिल सीआईएस और ट्रांस-एक्टिंग कारकों को निर्धारित करने के लिए मानव रिपोर्टर मिनीजीन उत्पन्न करने की एक विधि का वर्णन करते हैं। प्रकाशित रिपोर्टर जीन23 के दृश्यों का उपयोग करने वाली विधि का अवलोकन चित्रा 1में दिखाया गया है ।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. निर्माण का डिजाइन

  1. परिपत्र आरएनए गठन के लिए आवश्यक दोहराव वाले तत्वों की पहचान करने और उन्हें निर्माण में शामिल करने के लिए यूएससी जीनोम ब्राउज़र24 का उपयोग करें। महत्वपूर्ण बात, प्रवर्धन के लिए प्राइमर दोहराव तत्वों के बाहर होने की जरूरत है ।
  2. https://genome.ucsc.edu/cgi-bin/hgBlat?command=start में गोलाकार आरएनए अनुक्रम(पूरक चित्रा 1 एक परीक्षण अनुक्रम है) को चिपकाएं और सही जीव का चयन करें। अनुक्रम सबमिट करें और ब्राउज़र व्यू पर जाएं, 1.5x या उपयुक्त(चित्रा 2ए)का ज़ूम करें।
    नोट: खोज अनुक्रम शीर्ष पंक्ति में दिखाई देता है(चित्रा 2ए, 1)। सर्कुलर आरएनए में एक्सॉन के ऑर्डर के आधार पर ब्लैट सभी एक्सॉन को कनेक्ट नहीं करेगा । इस उदाहरण में, एक्सोन 12(चित्रा 2ए, 4)11(चित्रा 2ए, 2, 3)से जुड़ा नहीं है, क्योंकि एक्सोन 12 परिपत्र आरएनए अनुक्रम(पूरक चित्रा 1)में एक्सोन 11 का अपस्ट्रीम है। दोहराव वाले तत्व 'रिपीट मास्कर' ट्रैक में हैं, जो बक्से द्वारा इंगित किया गया है, जहां काला से ग्रे रंग विकासवादी संरक्षण(चित्रा 2ए, 5)को इंगित करता है।
  3. एक फ्लोटिंग विंडो में अपने उपप्रकार की पहचान करने के लिए दोहराव वाले तत्वों पर माउस। Alu तत्वों SINE (लघु interspersed परमाणु तत्व) लाइन में हैं । यदि चित्रा 2 से अलग तस्वीर प्राप्त की जाती है तो ब्राउज़र को रीसेट करने के लिए खिड़की के नीचे 'डिफ़ॉल्ट ट्रैक' बटन का उपयोग करें।
    नोट: जीन डिस्प्ले में एक्सोन पर मोयूज करने से एक्सोन नंबर ों के साथ एक खिड़की उत्पन्न होती है जो कंप्यूटर जनित होती है। ये संख्या साहित्य में स्थापित एक्सोन नंबरिंग के अनुरूप नहीं है और आइसोफॉर्म के बीच भी बदलती है।

2. अभिव्यक्ति वेक्टर में क्लोन किए जाने वाले अनुक्रम का चयन करें

  1. यूएससी जीनोम ब्राउज़र की शीर्ष पंक्ति पर → डीएनए देखने के लिए जा रहा द्वारा खिड़की में दिखाए गए डीएनए अनुक्रम को डाउनलोड करें। अनुक्रमण प्रारूपिंग विकल्पमें, विस्तारित मामले/रंग विकल्पोंका चयन करें ।
  2. एनसीबीआई रिफ़सेकके लिए डिफ़ॉल्ट मामले को लोअर और सेलेक्ट टॉगल केस के रूप में चुनें . रिपीट मास्करके लिए रेखांकित, और बोल्ड, और इटैलिक चुनें। सबमिटपर क्लिक करें . छोटे अक्षरों के रूप में पूंजी पत्र और इंट्रोन के रूप में एक्सोन होंगे। एक्सोन/इंट्रॉन सीमाओं की जांच करें ।
  3. इस उदाहरण में एक 'सीसीसीटीसीटीटीटीटी' अनुक्रम है, जो यह दर्शाता है कि ब्राउज़र रिवर्स पूरक दिखाता है। यदि यह मामला है, तो वापस जाएं और सही एक्सॉन इंट्रॉन सीमाओं (agEXONgt) को देखने तक रिवर्स पूरक बॉक्स का चयन करें, इस उदाहरण में AAAAAGgtaagaggg।
  4. सही अभिविन्यास के साथ फ़ाइल की प्रतिलिपि (आंतरिक exons अंतर्घातक एजी से घिरे हुए हैं ... gt) एक शब्द प्रसंस्करण दस्तावेज़ में और exons(पूरक चित्रा 2)पर प्रकाश डाला ।
    नोट: इस उदाहरण में, जीनोमिक टुकड़ा exons 9-12 शामिल 24 केबी के आसपास है और इस तरह भी जीनोमिक डीएनए से परिलक्षित होने के लिए बड़ा है । इसलिए, लगभग 1 केबी अंतर्निक क्षेत्र से घिरा प्रत्येक एक्सोन व्यक्तिगत रूप से परिलक्षित होता है और इन चार टुकड़ों को क्लोनिंग वेक्टर में इकट्ठा किया जाता है।
  5. प्रवर्धित होने के लिए टुकड़ों का चयन करें (एक्सोन ± 500 nt intron)। सुनिश्चित करें कि इंट्रॉन एक दोहराव क्षेत्र में शुरू या अंत नहीं है, क्योंकि इन क्षेत्रों में प्राइमर विशिष्ट दृश्यों को बढ़ाना नहीं होगा। चयनित क्षेत्रों को चित्रा 2बीमें दिखाया गया है और उनके दृश्यों को पूरक चित्रा 3में दिखाया गया है ।
    नोट: सामान्य तौर पर, निर्माण जितना बड़ा होगा, क्लोनिंग उतनी ही कठिन होगी। टुकड़ों को या तो कदम बुद्धिमान (यानी, एक्सोन 9 को वेक्टर के साथ जोड़ा जाता है और अगले चरण में एक्सन 10 को क्लोनिंग के माध्यम से इस निर्माण में तब तक पेश किया जाता है जब तक कि सभी एक्सन जगह पर नहीं हो जाते), या वैकल्पिक रूप से, सभी टुकड़ों को एक साथ इकट्ठा किया जाता है। एक चरणवार दृष्टिकोण हमेशा काम करता है लेकिन अधिक समय की आवश्यकता होती है। एक साथ विधानसभा हमेशा काम नहीं करती है और इस बात पर निर्भर करती है कि व्यक्तिगत टुकड़ों को जीनोमिक डीएनए से और निर्माण के समग्र आकार पर कितनी अच्छी तरह परिलक्षित किया जा सकता है। इसलिए हम आमतौर पर दोनों दृष्टिकोणों के साथ एक साथ शुरू करते हैं।

3. क्लोनिंग के लिए डिजाइन प्राइमर

  1. क्लोनिंग के लिए प्राइमर डिजाइन करने के लिए एक वेब टूल(https://nebuilder.neb.com/#!/)का उपयोग करें। उदाहरण के लिए, इस उपकरण में 9, 10, 11 और 12 और वेक्टर अनुक्रम(पूरक चित्रा 3)दर्ज करें।
  2. वेक्टर अनुक्रम के लिए, प्रविष्टि साइट को अंतिम न्यूक्लियोटाइड के रूप में जोड़ें और बाद में टुकड़े जोड़ें। चूंकि वेक्टर नंबरिंग किसी दिए गए प्रविष्टि स्थल के साथ शुरू नहीं होती है, इसलिए वेक्टर में प्रविष्टि की साइट स्थित है और डाउनस्ट्रीम भाग को अपस्ट्रीम अनुक्रम के सामने रखा जाता है। इस उदाहरण में आवेषण हिंडIII [AAGCTT] साइट के बाद सीधे शुरू होते हैं और पीसीडीएनए3.1 की PmeI [GTTTAAAC] साइट के बाद सीधे समाप्त होता है। सीसीसीटीगेटकैग से अनुक्रम ... ccgtaaaaaggccccpc pcDNA3.1 अनुक्रम (gttgctggcgttttcc में स्थिति 1 के सामने चिपकाया है...) ।
  3. प्राइमर को समायोजित करें यदि उनके पिघलने के अंक 4 डिग्री सेल्सियस से अधिक हैं, क्योंकि वे प्रवर्धन में काम नहीं करेंगे। डिजाइन किए गए टुकड़ों और प्राइमर दृश्यों की असेंबली पूरक चित्रा 4में दिखाई गई है । क्लोनिंग के लिए प्राइमर को मैन्युअल रूप से25भी डिजाइन किया जा सकता है ।

4. पीसीआर और एम्पलिकन डिटेक्शन

  1. मानक पीसीआर प्रतिक्रिया: प्रति प्रतिक्रिया 50 माइक्रोन की कुल मात्रा के लिए एक प्रतिक्रिया मिश्रण करें। नीचे पॉलीमरेज 1 का उपयोग करके एक प्रतिक्रिया का नुस्खा है:
    5x रिएक्शन बफर के 10 माइक्रोन
    10 एमएम डीएनटीपी का 1 माइक्रोन
    10 माइक्रोन फॉरवर्ड प्राइमर के 2.5 माइक्रोन
    10 माइक्रोन रिवर्स प्राइमर के 2.5 μL
    0.5 माइक्रोन ऑफ पॉलीमरेज़ 1
    32.5 माइक्रोन ऑफ न्यूलीज फ्री एच2
    1. वैकल्पिक रूप से, यदि उत्पाद में उच्च जीसी सामग्री है तो 5x जीसी एन्हांसर के 10 माइक्रोन जोड़ें; पीसीआर प्रतिक्रिया का परीक्षण करने के लिए जीसी एन्हांसर युक्त एक अलग मिश्रण बनाएं।
  2. प्रति प्रतिक्रिया नमूने पीसीआर ट्यूबों में मिश्रण के 49 μl Aliquot।
  3. पीसीआर में डीएनए के 1 माइक्रोन जोड़ें, यह राशि 10 पीजी से लेकर 1 एनजी तक है।
  4. अवशेषों को साइडों से हटाने और उन्हें पीसीआर मशीन में रखने के लिए नमूनों को नीचे स्पिन करें। पीसीआर की शर्तों को अनुकूलित करते समय मशीन में एक ही मशीन के साथ-साथ समान स्पॉट का उपयोग करें।

5. विभिन्न बहुलकों के उपयोग के लिए लंबे समय तक डीएनए टुकड़ों के लिए अनुकूलन

  1. तापमान
    1. लंबी दूरी की बहुलक 2 को अनुकूलित करते हैं।
      1. कम डेनाटुरिशन तापमान (पॉलीमरेज 1: 98 डिग्री सेल्सियस, पॉलीमरेज 2: 94 डिग्री सेल्सियस) का उपयोग करें।
      2. लंबे समय तक डेनाटुरिशन समय का उपयोग करें (पॉलीमेराज़ 1: 10 एस, पॉलीमरेज़ 2: 30 एस)।
      3. लंबे समय तक एनीलिंग समय का उपयोग करें (पॉलीमेराज़ 1: 30 एस, पॉलीमरेज़ 2: 60 एस)।
      4. एक लंबे विस्तार समय का उपयोग करें (पॉलीमेराज़ 1: 30 s/kb, पॉलीमरेज 2: 50 s/kb)।
      5. कम एक्सटेंशन तापमान (पॉलीमरेज 1: 72 डिग्री सेल्सियस, पॉलीमरेज 2: 65 डिग्री सेल्सियस) का उपयोग करें।
      6. प्राइमर के टीएम से 5 डिग्री सेल्सियस नीचे एक एनियलिंग तापमान का उपयोग करें।
    2. प्राइमर सांद्रता (मूल प्राइमर एकाग्रता से 5x कम से 5x) का अनुकूलन करें। 10 पीजी से 50 पीजी, 100 पीजी, 1 एनजी, 5 एनजी, 10 एनजी से डीएनए सांद्रता का अनुकूलन करें।
    3. पॉलीमरेज 2 का उपयोग करके 15 केबी उत्पाद आकार को बढ़ाने के लिए पीसीआर कार्यक्रम के उदाहरण के रूप में, 30 एस के लिए 94 डिग्री सेल्सियस पर एक प्रारंभिक निंदा करते हैं, 30 एस के लिए 94 डिग्री सेल्सियस पर डीएनए डेन्टुजन और 30 एस के लिए 58 डिग्री सेल्सियस पर एनीलिंग और डीएनए एक्सटेंशन 12 00 एस के लिए 65 डिग्री सेल्सियस पर। अंतिम 4 डिग्री सेल्सियस होल्ड के साथ 10 मिन के लिए 65 डिग्री सेल्सियस पर अंतिम विस्तार प्रदर्शन करें।
      नोट: वेब आधारित तापमान गणना है कि प्रत्येक बहुलक के लिए विशिष्ट है द्वारा निर्धारित प्राइमर के लिए विशिष्ट annealing तापमान (टीए) । यदि टुकड़े 10 केबी से बड़े हैं तो एक्सटेंशन समय भिन्न हो सकते हैं और उन्हें अनुकूलित करने की आवश्यकता हो सकती है।
  2. विस्तार समय और डीएनए सांद्रता
    1. 6 केबी से अधिक डीएनए टुकड़ों के लिए लंबे समय तक विस्तार समय का उपयोग करें: 1 प्रति 1 किलोमीटर प्रति 1 मिन। अब टुकड़े कम डीएनए का उपयोग करना चाहिए।
    2. प्रवर्धन के लिए इष्टतम डीएनए एकाग्रता खोजने के लिए डीएनए के कमजोर प्रदर्शन करें, आमतौर पर प्लाज्मिड ्स के लिए 1 एनजी से 1 एनजी या जीनोमिक डीएनए के लिए 1 एनजी से 1 एनजी।
      नोट: अधिकांश क्लोनिंग उपयोग पॉलीमरेज 1 के लिए, सो7डी डीएनए बाध्यकारी डोमेन को मालिकाना थर्मोस्टेबल डीएनए पॉलीमरेज26में फ्यूज करके इंजीनियर किया गया है। बहुलक में कम त्रुटि दर होती है और सो7डी डोमेन के कारण एक उच्च प्रक्रियाता होती है, जो बड़े (10-15 केबी) जीनोमिक टुकड़ों को बढ़ाने के लिए आवश्यक होती है। इस बड़े टुकड़े के आकार के कारण, डीएनए अणुओं की एंजाइमीय असेंबली27 का उपयोग वेक्टर में सम्मिलन के लिए किया जाता है, क्योंकि इस विधि में प्रतिबंध एंजाइमों की आवश्यकता नहीं होती है। 15 केबी से अधिक समय तक टुकड़ों का प्रवर्धन पॉलीमरेज 1 के साथ तेजी से मुश्किल हो जाता है। बड़े टुकड़े प्रवर्धन के लिए पॉलीमरेज 2 का उपयोग करें जो पायरोकोकससे बना है - जैसे प्रूफरीडिंग पॉलीमरेज सो7डी या लंबी दूरी की पीसीआर किट जो उच्च त्रुटि दरदेता है।

6. क्लोनिंग के लिए पीसीआर उत्पादों का शुद्धिकरण

  1. 1% अगारोज जैल पर पीसीआर उत्पादों का आधा हिस्सा चलाएं जिसमें एक इंटरकलिंग न्यूक्लिक एसिड दाग (जैसे, 1x जेलग्रीन)। एक अंधेरे पाठक ट्रांसलिमिनर पर दाग जैल कल्पना। यह दाग डीएनए आकार के लिए सही नहीं चलता है ।
    नोट: GelGreen डीएनए में intercalates, ethidium ब्रोमाइड के समान है, लेकिन यह ५०० एनएम (सियान) के आसपास प्रकाश से उत्साहित है, एक तरंगदैर्ध्य है कि डीएनए को नुकसान नहीं है, जो अत्यधिक क्लोनिंग में सुधार ।
  2. समानांतर में, 1% जेल पर पीसीआर उत्पादों का आधा हिस्सा चलाएं जो एहिडियम ब्रोमाइड(चित्रा 3ए, बी)के साथ चलने के बाद दाग दिया जाता है।
  3. दाग जेल (चरण 6.1) से सही आकार के उत्पाद शुल्क बैंड और एक जेल और पीसीआर सफाई किट का उपयोग कर डीएनए अलग। अपने मानक प्रोटोकॉल से विचलन में, डबल आसुत पानी के केवल 20 μL में डीएनए elute, के रूप में आम तौर पर डीएनए सांद्रता कम कर रहे हैं ।
  4. क्लोनिंग से पहले, एकाग्रता और अखंडता के लिए एक अगारोज जेल पर अलग डीएनए की जांच करें(चित्रा 3बी)। वेक्टर अनुपात में 2:1 मोलर डालने का लक्ष्य रखें। कई आवेषण का उपयोग करते समय, अनुपात 2:2:2:1 है।

7. डीएनए असेंबली और क्लोन डिटेक्शन

नोट: क्लोनिंग मामूली संशोधनों के साथ, एक एंजाइमैटिक डीएनए असेंबली किट का उपयोग करके किया जाता है। विधानसभा 50 डिग्री सेल्सियस पर 60 मिन के लिए किया जाता है और आम तौर पर डीएनए की निचली रेंज का उपयोग असेंबली (20-100 एफमोल/20 माइक्रोन रिएक्शन) के लिए किया जाता है। पूरी प्रतिक्रिया मिश्रण रासायनिक सक्षम कोशिकाओं और पूरी कोशिकाओं को 6 सेमी आगर प्लेट पर चढ़ाया जाता है।

  1. वेक्टर को मिलाएं और पानी के 10 माइक्रोन में 1:2 मोलर अनुपात (20-500 एफमोल प्रत्येक) में डालें।
  2. डीएनए असेंबली मास्टर मिक्स के 10 माइक्रोन जोड़ें।
  3. 50 डिग्री सेल्सियस पर 60 मिनट के लिए इनक्यूबेट नमूने।
  4. इसके बाद, कुल असेंबली प्रतिक्रिया के साथ सक्षम कोशिकाओं को बदलें। यहां, लंबे या अस्थिर निर्माण के लिए कम निर्माण या ई. कोलाई तनाव 2 कोशिकाओं के लिए ई कोलाई तनाव 1 कोशिकाओं का उपयोग करें। कोशिकाएं 50 माइक्रोन वॉल्यूम में होनी चाहिए।
  5. बर्फ पर गल कोशिकाओं और सक्षम कोशिकाओं के लिए ठंडा इकट्ठे उत्पाद के 2 μL जोड़ें । ट्यूब को धीरे-धीरे 4-5 बार फ्लिकिंग करके मिलाएं। भंवर मत करो।
  6. मिश्रण को 30 मिन के लिए बर्फ पर बैठने दें।
  7. 30 एस के लिए 42 डिग्री सेल्सियस पर हीट शॉक। मिलाएं नहीं।
  8. ट्यूब को 2 मिन के लिए बर्फ में वापस स्थानांतरित करें।
  9. ट्यूब के लिए कमरे के तापमान SOC मीडिया के ९५० μL जोड़ें ।
  10. रिएक्शन ट्यूब को 60 मिन के लिए 37 डिग्री सेल्सियस पर इनक्यूबेट करें।
  11. 37 डिग्री सेल्सियस पर ऊष्मायन के दौरान उपयुक्त एंटीबायोटिक के साथ गर्म चयन प्लेटें।
  12. सेंट्रलाइज्ड (10,000 x g,30 s) के माध्यम से कोशिकाओं को गोली मार ें और प्लेट आउट 1/4 और 3/4 कोशिकाओं की दो चयन प्लेटों पर और रात भर 37 डिग्री सेल्सियस पर इनक्यूबेट करें।

8. क्लोन का सत्यापन

  1. कॉलोनी पीसीआर का उपयोग करें, पता लगाने के लिए विधानसभा स्थलों में फैले पीसीआर प्राइमर(चित्रा 1सी)को नियोजित करें।
  2. बाँझ टूथपिक लें और एक भी बैक्टीरियल कॉलोनी को टच करें।
  3. टूथपिक के साथ पीसीआर ट्यूब के नीचे स्पर्श करें जिसमें कॉलोनी है और फिर एंटीबायोटिक आगर प्लेट पर टूथपिक को लकीर, रात भर संवेदनशील निर्माण के लिए 37 डिग्री सेल्सियस या कमरे के तापमान पर लकीर प्लेट को इनक्यूबेट करें।
  4. पीसीआर ट्यूब को ओवरले करने से पता लगाने वाले प्राइमर वाले पीसीआर मिक्स के साथ कॉलोनी के साथ छुआ गया । ये प्राइमर 3(http://bioinfo.ut.ee/primer3-0.4.0/)का उपयोग करके डिज़ाइन किए गए हैं। कार्यक्रम में असेंबली जंक्शन पर प्राइमर का चयन करने के लिए "[सीसीसी] संकेतों का उपयोग करके एक परिभाषित अनुक्रम में प्राइमर डिजाइन को मजबूर करने का विकल्प है। सकारात्मक उपभेदों से डीएनए अलग और अनुक्रमण द्वारा सत्यापित किया जाता है ।

9. परिपत्र आरएनए का विश्लेषण रिपोर्टर जीन व्यक्त

  1. विश्लेषण के लिए, ट्रांसफेट रिपोर्टर जीन यूकेरियोटिक कोशिकाओं में। यहां, HEK293 कोशिकाओं (एटीटीसी #CRL-1573) का उपयोग करें क्योंकि वे उच्च ट्रांसफेक्शन दक्षता देते हैं। लागत बचाने के लिए, पी (पॉलीथीन) समाधान का उपयोग करें।
  2. पी समाधान के लिए, कम पीएच, पीएच 2 पर पानी में 1 मिलीग्राम/एमएल पर रैखिक पॉलीथीनीनीन हाइड्रोक्लोराइड (पी) को भंग करें। NaOH के साथ 7 करने के लिए पीएच लाओ । 0.22 माइक्रोन फिल्टर के साथ बाँझ फिल्टर और 4 डिग्री सेल्सियस पर स्टोर करें।
  3. छह कुओं में कोशिकाओं को विभाजित (लगभग 150,000 कोशिकाओं प्रति अच्छी तरह से) और उन्हें DMEM मीडिया में 10% FBS में रातोंरात बढ़ने दें।
  4. एक बाँझ ट्यूब में रिपोर्टर जीन के Aliquot 1 μg और बाँझ फ़िल्टर १५० mM NaCl के २०० μL जोड़ें । भंवर द्वारा डीएनए के साथ मिलाएं।
  5. इस मिश्रण और भंवर के लिए पी समाधान जोड़ें, संक्षेप में अपकेंद्री ट्यूब के तल पर नमूने इकट्ठा करने के लिए । पी के प्रति 3 माइक्रोन डीएनए के 1 μg के अनुपात का उपयोग करें।
  6. 10 न्यूनतम के लिए कमरे के तापमान पर इनक्यूबेट और फिर एचईसी 293 कोशिकाओं में सीधे जोड़ें।
  7. इनक्यूबेट HEK293 कोशिकाओं पर 37 डिग्री सेल्सियस, 5% सीओ2,रातोंरात।
  8. आरएनए आइसोलेशन किट के माध्यम से आरटी-पीसीआर के लिए आरएनए को अलग करें।

10. रैस आर उपचार रैखिक आरएनए को हटाने के लिए

  1. एक RNase मुक्त ट्यूब में कुल आरएनए के 10 μg का उपयोग करें।
  2. आरएनए में 10x RNase R बफर (0.2 M Tris-HCl (पीएच 8.0), 1 एम केसीएल, 1 एमएम एमजीसीएल2)के 10 माइक्रोनल जोड़ें।
  3. आरएनए (1 μl = 20U) में RNase आर जोड़ें।
  4. आरएनए में ग्लाइकोल ब्लू का 1 माइक्रोन जोड़ें और बाँझ पानी के साथ वॉल्यूम को 100 माइक्रोन तक लाएं।
  5. 30 मिन के लिए 37 डिग्री सेल्सियस पर इनक्यूबेट सैंपल।
  6. 1 मिन के लिए फिनॉल/क्लोरोफॉर्म और भंवर के 100 माइक्रोन जोड़ें।
  7. अलग चरणों के लिए 1 मिन के लिए 21,000 x ग्राम पर अपकेंद्रित्र।
  8. अधिनेत (जलीय चरण) लें और 1 वॉल्यूम (क्लोरोफॉर्म के लगभग 80 माइक्रोन) जोड़ें।
  9. 1 मिन के लिए भंवर, और फिर 1 मिन के लिए अलग चरणों के लिए अपकेंद्रित्र ।
  10. सुपरनेट लें, 1:10 वोल केएसी और 2.5 वोल इथेनॉल जोड़ें, और 1-4 घंटे के लिए -20 डिग्री सेल्सियस पर उपजी करें । पूरी गति से 30 मीटर के लिए 4 डिग्री सेल्सियस पर सेंट्रलाइज (21,000 x g)। नीचे एक छोटा सा नीला गोली होगी।
  11. अधिनेता निकालें, और 80% इथेनॉल के साथ धोलें। कमरे के तापमान पर 5 न्यूनतम के लिए हवा सूखी चलो, और 10 μL पानी में भंग ।

11. आरटी-पीसीआर विश्लेषण

  1. आरटी प्रतिक्रिया प्रति आरएनए के 1 μg का उपयोग करें।
  2. प्रति प्रतिक्रिया 20 μL की अंतिम कुल मात्रा के लिए प्रतिक्रिया मिश्रण करें। एक प्रतिक्रिया के लिए, 10 एमएम डीएनटीपी के 1 माइक्रोन, 0.1 एम डिथियोथ्रेइटॉल (डीटीटी) के 1 माइक्रोन, 5x फर्स्ट-स्ट्रैंड बफर के 4 माइक्रोन और रिवर्स ट्रांसक्रिप्टेज़ के 0.5 माइक्रोन का उपयोग करें।
  3. अलीकोट 6.5 माइक्रोन रिएक्शन मिक्स नई पीसीआर ट्यूबों में मिलाएं।
  4. एक मिश्रण में 5 प्राइमर तक मिलाएं। हालांकि, कुछ प्राइमर पीसीआर(चित्रा 5)में अन्य प्राइमर के साथ गलत जोड़ी हो सकती है । प्राइमर सीक्वेंस टेबल 2में हैं । हम नियमित रूप से जीन-विशिष्ट एक्सोन-जंक्शन प्राइमर का उपयोग करते हैं लेकिन यादृच्छिक hexamers के साथ भड़काना भी संभव है।
  5. वांछित आरटी रिएक्शन ट्यूब में 10 माइक्रोएम रिवर्स प्राइमर के 1 माइक्रोन जोड़ें।
  6. पीसीआर रिएक्शन ट्यूब में आरएनए के 1 μg जोड़ें।
  7. 20 μL की कुल मात्रा तक RNase-मुक्त एच2O जोड़ें।
  8. ट्यूब ों के किनारे पर अवशेषों को हटाने के लिए स्पिन ट्यूब नीचे और थर्मोसाइकिलर में जगह है।
  9. थर्मोसाइकिलर में आरटी रिएक्शन को 50 मिनट तक 50 डिग्री सेल्सियस पर चलाएं।
  10. -20 डिग्री सेल्सियस पर आरटी सीडीएनए स्टोर करें या पीसीआर रिएक्शन के लिए आगे बढ़ें।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

रिपोर्टर जीन नियामक कारकों के निर्धारण की अनुमति देते हैं जो परिपत्र आरएनए गठन को प्रभावित करते हैं। हालांकि, ये रिपोर्टर जीन बड़े होते हैं और इसमें दोहराव वाले तत्व होते हैं जो अक्सर डीएनए को अस्थिर बनाते हैं । उनके बड़े आकार के कारण, अक्सर इंट्रॉन के कुछ हिस्सों को हटाना आवश्यक होता है, जो एक्सॉन और छोटे फ्लैंकिंग अंतर्निक भागों वाले जीनोमिक टुकड़ों को बढ़ाना द्वारा प्राप्त किया जाता है। इन डीएनए टुकड़ों को एंजाइमों द्वारा इकट्ठा किया जाता है, जिससे बिना प्रतिबंध एंजाइमों के निर्माण की अनुमति होती है।

माइक्रोट्यूबुल से जुड़े प्रोटीन ताऊ (एमएपीटी) से उत्पन्न एक परिपत्र आरएनए का उदाहरण परिपत्र आरएनए का विश्लेषण करने के लिए मिनीजीन दृष्टिकोण का एक आवेदन दिखाता है। इस उदाहरण में उपयोग किए जाने वाले ताऊ 9 → 12 मिनीजीन को विभिन्न स्प्लिसिंग कारकों से सह-संक्रमित किया गया था और इन स्प्लिसिंग कारकों के प्रभाव का पता आरटी-पीसीआर(चित्रा 6)द्वारा लगाया गया था। विभिन्न ट्रांस-एक्टिंग कारक परिपत्र आरएनए और रैखिक पूर्व-एमआरएनए गठन दोनों को प्रभावित करते हैं। प्रयोग से यह भी पता चलता है कि परिपत्र आरएनए गठन के लिए आवश्यक सभी अनुक्रम तत्वों को क्लोन टुकड़े में स्थानीयकृत किया जाता है।

Figure 1
चित्रा 1: तकनीक का अवलोकन। (क)एक काल्पनिक जीन दिखाया गया है। इंट्रॉन लाइनें हैं, एक्सॉन बक्से हैं, एलू तत्व छोटे धारीदार बक्से हैं। एक्सोन सी से ए तक बैकस्प्लीचिंग एक गोलाकार आरएनए बनाता है। इस परिपत्र आरएनए की संरचना पैनल(ई)में दिखाई गई है। (ख)एक रिपोर्टर जीन बनाने के लिए, exons और आसपास के इंट्रोन (हर तरफ कम से ५०० nt) परिलक्षित कर रहे हैं । निर्माण में दोहराव वाले तत्व होने चाहिए, जो आमतौर पर मनुष्यों में अलू तत्व होते हैं। एक अतिरिक्त Alu तत्व प्रदान करने के लिए एक ्स ए के अपस्ट्रीम अपस्ट्रीम शामिल किया गया था । जीनोमिक टुकड़े अपने पार्श्व 25 एनट्स के साथ ओवरलैप होंगे । (ग)टुकड़ों को सीएमवी प्रमोटर द्वारा संचालित अभिव्यक्ति वेक्टर में क्लोन किया जाता है । सफल पुनर्संयोजन का पता लगाने प्राइमर द्वारा पता लगाया जाता है और अनुक्रमण द्वारा मान्य किया जाता है। (घ)कोशिकाएं इस निर्माण से ट्रांसट्रा होती हैं। (ई)परिपत्र आरएनए अलग है और(एफ)परिपत्र आरएनए विशिष्ट प्राइमर, बेहतर एक्सोन जंक्शन प्राइमर का उपयोग करपरिलक्षित होता है। पीसीआर प्रवर्धन के दौरान, रैखिक आरएनए को भी परिलक्षित किया जा सकता है(जी)। (जी)परिपत्र आरएनए का पता लगाने के लिए उपयोग किए जाने वाले प्राइमर का अभिविन्यास। फॉरवर्ड प्राइमर अर्थ ओरिएंटेशन में है (यानी, आरएनए के समान अनुक्रम है) और रिवर्स प्राइमर एंटीसेंस ओरिएंटेशन में है (यानी, आरएनए का रिवर्स पूरक है)। ध्यान दें कि रैखिक mRNAs के लिए आरटी-पीसीआर से अलग, रिवर्स प्राइमर फॉरवर्ड प्राइमर के ऊपर है। कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें ।

Figure 2
चित्रा 2: मिनीजीन निर्माण के लिए अनुक्रम का चयन। (ए) पूरक चित्रा 1 में दिखाए गए अनुक्रम के बाद ब्राउज़र डिस्प्ले को बीसैट का उपयोग करके मानव जीनोमिक डेटाबेस के खिलाफ चलाया जाता है। साहित्य एक्सीन संख्या36 जीन डिस्प्ले में दर्शाई गई है, वे ब्राउज़र द्वारा दिए गए नंबरों से अलग हैं।
1. गठबंधन दृश्यों को 'YourSeq' के तहत दिखाया गया है
2-4. ध्यान दें कि आरएनए की परिपत्रता के कारण, ब्लैट सभी एक्सोन को लाइनों से कनेक्ट नहीं करता है जैसा कि रैखिक आरएनए में करता है। Exons 10 और 11 (2 और 3 के अनुरूप) जुड़े हुए हैं, लेकिन एक्सोन 12 (4 के अनुरूप) एक्सॉन 11 से जुड़ा नहीं है ।
5. एलू तत्व दोहराव तत्व ट्रैक में दिखाए जाते हैं।
(ख)नियोजित निर्माण और जीनोमिक डीएनए के बीच अनुक्रम संरेखण ।
6. नियोजित निर्माण BLAT का उपयोग कर डेटाबेस के खिलाफ चलाया गया था ।
7. निर्माण में कई Alu तत्वों के शामिल किए जाने पर ध्यान दें। कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें ।

Figure 3
चित्रा 3: क्लोनिंग से पहले एम्प्लिस का उदाहरण। (A)अनुकूलित पीसीआर उत्पाद 1x जेलग्रीन वाले 1% अगारोज जेल पर अलग हो गए। व्यक्तिगत बैंड पीसीआर उत्पादों का प्रतिनिधित्व करते हैं जिनका उपयोग एंजाइमैटिक डीएनए असेंबली में किया जाएगा। (ख)से बैंड(ए)को जेल से काटकर शुद्ध किया गया । शुद्ध पीसीआर उत्पादों को 1% अगारोज जेल पर अलग किया गया था, जिसे बाद में एहिडियम ब्रोमाइड से दाग दिया गया था। कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें ।

Figure 4
चित्रा 4: रिपोर्टर जीन के प्रतिबंध विश्लेषण । एक उदाहरण के रूप में इस्तेमाल किया ताऊ 9-12 minigene प्रतिबंध एंजाइमों के साथ काटा गया था प्रमुख पुनर्संयोजन बाहर शासन करने का संकेत दिया । लेन 1: NcoI के साथ कटौती की उंमीद आकार ७३५ बीपी, 3345 बीपी, 6266 बीपी, लेन 2 कट विद एक्सबायी अपेक्षित आकार 10346 बीपी, लेन 3 कट विद हिंडIII अपेक्षित आकार 3951 बीपी, 6395 बीपी, लेन 4 कट विद स्मालाई अपेक्षित आकार 1168 बीपी, 1688 बीपी, 2708 बीपी, 4782 बीपी।

Figure 5
चित्रा 5: परिपत्र आरएनए का पता लगाने पर प्राइमर मल्टीप्लेक्सिंग और RNase आर उपचार का प्रभाव। (ए)मानव मस्तिष्क के ऊतकों से प्राप्त नमूनों ए और बी से सीडीएनए को गोलाकार आरएनए प्राइमर सर्टाउ exon12_10 रिवर्स और सिराटाउ exon10_11 फॉरवर्ड के साथ परिलक्षित किया गया था । सीडीएनए के लिए रिवर्स ट्रांसक्रिप्शन रैखिक और परिपत्र ताऊ आरएनए के लिए प्राइमर के साथ किया गया था। ताऊ परिपत्र आरएनए के अनुरूप अपेक्षित बैंड एक त्रिकोण द्वारा दिखाया गया है। अन्य मजबूत बैंड ऐसी कलाकृतियां हैं जो मानव जीनोम से मेल नहीं खाती थीं । (ख)प्रयोग समान पीसीआर शर्तों के साथ दोहराया गया था, लेकिन रिवर्स ट्रांसक्रिप्शन केवल circTau exon12_10 रिवर्स प्राइमर के साथ किया गया था । केवल अपेक्षित बैंड को अनुक्रमण के माध्यम से परिलक्षित और मान्य किया गया था। (ग)आरएनए का इलाज रनासे आर के साथ किया गया जो रैखिक आरएनए को हटाता है । परिपत्र आरएनए उपचार (बाएं) के बाद पता लगाने योग्य है, जबकि रैखिक आरएनए अब एक पता लगाने योग्य संकेत देता है (दाएं) कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें ।

Figure 6
चित्रा 6: एक सर्आरएनए रिपोर्टर जीन के विश्लेषण का उदाहरण। ताऊ के 1 μg 9 → 1237 रिपोर्टर जीन संकेत के 1 μg से ट्रांससंक्रमित किया गया था। आरएनए को 24 घंटे पोस्ट ट्रांसफेक्शन अलग किया गया और आरटी-पीसीआर द्वारा विश्लेषण किया गया । (A)रैखिक ताऊ एमआरएनए का प्रवर्धन। एक्सोन के वैकल्पिक स्प्लिसिंग के कारण 10 दो बैंड देखे जाते हैं। 38,39के अतिअभिव्यक्ति के कारण उनका अनुपात बदलता है . (B)परिपत्र का प्रवर्धन 12 → 10 ताऊ आरएनए23। कुछ splicing कारकों की अभिव्यक्ति पर ताऊ सर्क्रोना अभिव्यक्ति की निर्भरता पर ध्यान दें, विशेष रूप से kinase clk2 और एसआर प्रोटीन 9G8 की तरह cdc2 । (ग)HIPK3 के परिपत्र आरएनए का उपयोग समान लोडिंग का संकेत देने वाले सकारात्मक नियंत्रण के रूप में किया गया था। कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें ।

तालिका 1: परिपत्र आरएनए व्यक्त करते हुए वर्तमान मिनीजीन की सूची। कृपया इस फ़ाइल को डाउनलोड करने के लिए यहां क्लिक करें।

सर्कुलर HIPK3 कंट्रोल प्राइमर
HIPK3 रिवर्स
HIPK3 आगे
TGCTTGGCTCTCTTTTTTTTC
टीसीजीसीकैगटीकैटगटाएटाएए
लीनियर प्राइमर
ताऊ एक्सॉन 12 रिवर्स
ताऊ एक्सॉन 9 फॉरवर्ड
सीसीकाएटीसीटीसीजीसीटीजीसीजीसी
TGTCAAGTCCAAGATCCT
सर्कुलर प्राइमर
सर्ताऊ exon12_10 रिवर्स
सर्क्टऊ exon10_11 फॉरवर्ड
CAGCTTCTTATATATCTGCACCTTटीटी
GAGGCGGCAGTGTGCAA

तालिका 2: प्राइमर की सूची।

Supplemental Figure 1
पूरक चित्रा 1: ताऊ परिपत्र आरएनए परीक्षण अनुक्रम। MAPT लोकस से एक परिपत्र आरएनए के अनुरूप परीक्षण अनुक्रम। विभिन्न एक्सॉन को रेखांकित, छोटी टोपियां और बड़ी टोपियां इंगित किया जाता है। कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें ।

Supplemental Figure 2
पूरक चित्रा 2: नियोजित मिनीजीन युक्त जीनोमिक अनुक्रम। एक्सोन रंग में हाइलाइट किए जाते हैं और दोहराव वाले तत्वों को रेखांकित किया जाता है, इटैलिक और बोल्ड। ग्रे छायांकन कम जटिलता के क्षेत्रों को इंगित करता है जिसका उपयोग प्राइमर उत्पन्न करने के लिए किया जा सकता है। कृपया इस फ़ाइल को डाउनलोड करने के लिए यहां क्लिक करें।

Supplemental Figure 3
पूरक चित्रा 3: नियोजित रिपोर्टर जीन के दृश्य । वेक्टर अनुक्रम और नियोजित जीनोमिक टुकड़े दिखाए जाते हैं। कृपया इस फ़ाइल को डाउनलोड करने के लिए यहां क्लिक करें।

Supplemental Figure 4
पूरक चित्रा 4: असेंबली के लिए प्राइमर डिजाइन। पूरक चित्रा 3 से अनुक्रम बिल्डर उपकरण में प्रवेश किया गया था। कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें ।

Supplemental Figure 5
पूरक चित्रा 5: ताऊ 9 का अनुक्रम->12 रिपोर्टर जीन एक उदाहरण के रूप में इस्तेमाल किया । कृपया इस फ़ाइल को डाउनलोड करने के लिए यहां क्लिक करें।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

सामान्य तौर पर, परिपत्र आरएनए कम प्रचुर मात्रा मेंहोतेहैं, जो उनके कार्य और गठन के अध्ययन को जटिल बनाता है। रैखिक आरएनए13के समान, रिपोर्टर मिनीजीन का उपयोग सीआईएस और ट्रांस-एक्टिंग कारकों की पहचान की अनुमति देता है जो परिपत्र आरएनए के गठन को विनियमित करते हैं। इस प्रकार, यह दृष्टिकोण उन परिकल्पनाओं को उत्पन्न करता है जिन्हें एंडोजेनस जीन का उपयोग करके आगे परीक्षण किया जा सकता है।

सबसे महत्वपूर्ण कदम रिपोर्टर जीन का डिजाइन है । डीएनए टुकड़ों की एंजाइमैटिक विधानसभा ("गिब्सन क्लोनिंग"27)इस डिजाइन की सुविधा है, क्योंकि यह प्रतिबंध साइटों से स्वतंत्र बड़े रिपोर्टर जीन के निर्माण की अनुमति देता है ।

बैक-स्प्लिसिंग साइटों को फ्लैंकिंग उल्टे दोहराता के माध्यम से एक साथ लाया जाता है, जिसे रिपोर्टर जीन निर्माण में ध्यान में रखा जाना चाहिए । दोहराता जीनोम ब्राउज़र 'दोहराने ट्रैक' में एनोटेट किया जाता है और उनका चयन उनके अभिविन्यास को दर्शाता है। ध्यान रखें कि प्रोटीन बैक-स्प्लिसिंग साइटों को परिपत्र आरएनए अभिव्यक्ति28 के लिए आवश्यक माध्यमिक संरचना में भी मजबूर कर सकता है और निष्पक्ष विश्लेषण के लिए 1-2 केबी फ्लैंकिंग अंतर्निक क्षेत्रों की जांच की जानी चाहिए।

निर्माण ों की स्थिरता सुनिश्चित करने के लिए, एक महत्वपूर्ण विचार बैक्टीरियल उपभेदों का प्रकार और उनकी विकास की स्थिति है। छोटे के लिए, सरल निर्माण मानक क्लोनिंग बैक्टीरिया का उपयोग किया जाता है, जो DH5-अल्फा (huA2(argF-lacZ) U169 phoA glnV44180 (lacZ) M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17 के समान हैं। लंबे टुकड़ों के लिए, 6 से अधिक Alu तत्वों युक्त, "स्थिर" सक्षम कोशिकाओं का उपयोग किया जाता है जिसमें एक पुनर्संयोजन (रीका) और एंनोटुकलीज (एंडए1) (एफ ' प्रोए + बी + लैक्आईक्यू की कमी होती है ।(lacZ) M15 zzf:: Tn10 (TETR)(आरा-leu) ७६९७ araD1 39 fhuA ‧lacX74 galK16 galE15 e14- Τ80dlacZ ,M15 recA1 relA1 endA1 nupG rpsL(एसटीआरआर) आरपीएच spoT1 ‧(mrr-hsdRMS-mcrBC) । यदि समस्याएं पुनर्संयोजन के साथ दिखाई देती हैं, तो कम परिवर्तन की गिनती द्वारा इंगित किया जाता है, तो दो प्लेटों पर परिवर्तित बैक्टीरिया को प्लेट करें और उन्हें क्रमशः 30 ºC और 37 ºC पर बढ़ने दें। मिनीजीन में कई दोहराव वाले तत्वों की उपस्थिति के कारण, उन्हें अगली पीढ़ी अनुक्रमण का उपयोग करके पूरी तरह से अनुक्रमित होने की आवश्यकता है, जो 2019 दरों पर लगभग $ 150 प्रति प्लाज्मिड के लिए व्यावसायिक रूप से उपलब्ध है। उदाहरण के अनुक्रम को पूरक चित्रा 5में दिखाया गया है । इसके अलावा, निर्माण की नई बड़ी तैयारी के लिए प्रतिबंध खंड लंबाई बहुरूपता विश्लेषण नियमित रूप से किया जाता है। उदाहरण के लिए, 1-4 गुना कटौती करने वाली साइटों का उपयोग करने से एक विशिष्ट बैंड पैटर्न होता है जो पुनर्संयोजन(चित्र4)से नियम बनाता है। एंजाइमों का चयन किया जाना चाहिए जो टुकड़ों का एक विशिष्ट बैंड पैटर्न देते हैं जिन्हें अगारोज जेल पर अलग किया जा सकता है।

परिपत्र RNAs आरटी-पीसीआर के साथ एक्सोन जंक्शन प्राइमर का उपयोग कर के विश्लेषण किया जाता है जो बैकस्प्लीजिंग इवेंट(चित्रा 1एफ)के साथ ओवरलैप होता है। आरएनए की गोलाकार प्रकृति के कारण, रिवर्स (यानी एंटीसेंस) प्राइमर फॉरवर्ड (यानी सेंस) प्राइमर(चित्रा 1जी)का ऊपर है। बहुतायत से व्यक्त होमोडोमेन-इंटरैटिंग प्रोटीन किनेज 3 (HIPK3) परिपत्र आरएनए1 का पता लगाने वाले प्राइमर का उपयोग सकारात्मक नियंत्रण के रूप में किया जाता है। HIPK3 और मिनीजीन विशिष्ट रिवर्स प्राइमर एक ही ट्यूब में रिवर्स लिखित हैं, जो उनकी तुलना की अनुमति देता है। पीसीआर प्रतिक्रियाओं को परिपत्र और रैखिक पूर्व-mRNAs के प्रसंस्करण पैटर्न की तुलना करने के लिए रैखिक mRNAs को बढ़ाने वाले प्राइमर के साथ किया जाता है। जब रैखिक और परिपत्र आरएनए के लिए प्राइमर मिश्रित होते थेतोहम अक्सर अपपथन बैंड मनाते थे और इस प्रकार इन नमूनों के रिवर्स ट्रांसक्रिप्शन को अलग रखते थे।

परिपत्र आरएनए का आरटी-पीसीआर विश्लेषण चुनौतीपूर्ण है और इसे सावधानीपूर्वक नियंत्रित करने की आवश्यकता है। जबकि संवेदनशील और सुविधाजनक, यह परिपत्र RNAs29के लिए अद्वितीय कलाकृतियों का उत्पादन कर सकते हैं । रिवर्स ट्रांसक्रिप्टेज़ आरएनए सर्कल के आसपास कई बार स्थानांतरित हो सकता है, जो कॉन्सेटेमर उत्पन्न करता है। अधिकांश परिपत्र आरएनए रिपोर्टर जीन परिपत्र और रैखिक आरएनए दोनों उत्पन्न करते हैं, जो क्रॉस-हाइब्रिडाइज कर सकते हैं, जिससे पीसीआर कलाकृतियों21,30,31अधिक हो सकते हैं। इस प्रकार पीसीआर उत्पादों को अनुक्रमित करना और उत्तरी धब्बों32 या आरएनसे सुरक्षा23का उपयोग करके विभिन्न तकनीकों का उपयोग करके निष्कर्षों को मान्य करना अनिवार्य है ।

असमझाया बैंड भी रैखिक आरएनए के गुमराह प्रवर्धन से उत्पन्न हो सकते हैं। रैखिक आरएनए को एक्सोनलीज आरएनएएस आर का उपयोग करके हटाया जा सकता है, जो परिपत्र आरएनए33 (चित्रा 5सी)को समृद्ध करता है। RNase R उपचार पता लगाने प्राइमर के प्रारंभिक अनुकूलन में मदद करता है और अक्सर एक बार प्राइमर अनुकूलित कर रहे है लोप किया जा सकता है ।

वैकल्पिक बैक-स्प्लिसिंग भी अस्पष्टीकृत बैंड में योगदान दे सकता है क्योंकि जीनोमिक लोकस34से कई परिपत्र आरएनए बनाए जा सकते हैं। यह वैकल्पिक बैक-स्प्लिसिंग अक्सर दो से अधिक उल्टे दोहराने वाले तत्वों द्वारा गठित पूर्व-एमआरएनए संरचनाओं को प्रतिस्पर्धी बनाने का परिणाम होता है। इसके अलावा, गुप्त बैक-स्प्लिस साइटें32,35हो सकती हैं। प्रयोगात्मक लक्ष्य के आधार पर, एलू तत्वों को बार-बार किया जा सकता है या निर्माण में जोड़ा जा सकता है। वापस-स्प्लिसिंग साइटों को फ्लैंकिंग करने वाले पूरक क्षेत्र 30-40 एनटी35 के रूप में कम हो सकते हैं और छोटे पूरक क्षेत्रों वाले अलु तत्वों का प्रतिस्थापन परिपत्र आरएनए गठन2में वृद्धि कर सकता है, जिसे परिपत्र आरएनए गठन में सुधार करने के लिए परीक्षण किया जा सकता है। एक बार जब प्री-एमआरएनए दृश्यों की पहचान की गई है, तो इस प्रकार परिपत्र आरएनए को कम करना संभव है, जो कुछ मामलों में ट्रांसफेक्शन दक्षता में सुधार कर सकता है।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

खुलासा करने के लिए कुछ भी नहीं।

Acknowledgments

इस काम को रक्षा विभाग डीओडी ग्रांट AZ180075 द्वारा समर्थित किया गया था। स्टीफन पुंटम धन्यवाद जैकलिन नोआन एंडोमेंट । अन्ना Pawluchin DAAD, जर्मन अकादमिक विनिमय कार्यक्रम द्वारा समर्थित था, जस्टिन आर वेल्डन केंटकी मैक्स स्टेकलर पुरस्कार के विश्वविद्यालय के एक प्राप्तकर्ता था ।

Materials

Name Company Catalog Number Comments
(PEI) Hydrochloride Polysciences 24765-1
Builder tool NEB https://nebuilder.neb.com/#!/
Dark Reader Transilluminator. Clare Chemical Research
Enzymatic DNA assembly kit NEB E2621S
Gel and PCR cleanup kit Promega A9282
Glyco Blue Thermo Fisher AM9516
pcDNA3.1 cloning site Polycloning site https://assets.thermofisher.com/TFS-Assets/LSG/manuals/pcdna3_1_man.pdf
Polymerase 1 NEB M0491L Q5 DNA polymerase
Polymerase 2 Biorad 1725310 Long range polymerase (NEB), iproof (BioRad)
Polymerase 2 Qiagen 206402 Qiagen long range polymerase kit
Reverse Transcriptase Thermo Fisher 18080044
RNA isolation kit Life Technologies 12183025 Ambion by Life Technologies
RNAse R Lucigen RNR07250 Epicenter/Lucigen
Stable competent cells NEB C3040H NEB stable cells
Standard cloning bacteria NEB C2988J NEB5-alpha competent
Web tool to design primers NEB https://nebuilder.neb.com/#!/
Web-based temperature calculations NEB https://tmcalculator.neb.com/#!/main

DOWNLOAD MATERIALS LIST

References

  1. Jeck, W. R., et al. Circular RNAs are abundant, conserved, and associated with ALU repeats. RNA. 19, (2), 141-157 (2013).
  2. Zhang, X. O., et al. Complementary sequence-mediated exon circularization. Cell. 159, (1), 134-147 (2014).
  3. Deininger, P. Alu elements: know the SINEs. Genome Biology. 12, (12), 236 (2011).
  4. Bazak, L., Levanon, E. Y., Eisenberg, E. Genome-wide analysis of Alu editability. Nucleic Acids Research. 42, (11), 6876-6884 (2014).
  5. Levanon, E. Y., et al. Systematic identification of abundant A-to-I editing sites in the human transcriptome. Nature Biotechnology. 22, (8), 1001-1005 (2004).
  6. Hansen, T. B., et al. Natural RNA circles function as efficient microRNA sponges. Nature. 495, (7441), 384-388 (2013).
  7. Kelly, S., Greenman, C., Cook, P. R., Papantonis, A. Exon Skipping Is Correlated with Exon Circularization. Journal of Molecular Biology. 427, (15), 2414-2417 (2015).
  8. Li, Z., et al. Exon-intron circular RNAs regulate transcription in the nucleus. Nature Structural & Molecular Biology. 22, (3), 256-264 (2015).
  9. Yang, Y., et al. Extensive translation of circular RNAs driven by N(6)-methyladenosine. Cell Research. 27, (6), 626-641 (2017).
  10. Abe, N., et al. Rolling Circle Translation of Circular RNA in Living Human Cells. Scientific Reports. 5, 16435 (2015).
  11. Salzman, J., Chen, R. E., Olsen, M. N., Wang, P. L., Brown, P. O. Cell-type specific features of circular RNA expression. PLOS Genetics. 9, (9), 1003777 (2013).
  12. Ottesen, E. W., Luo, D., Seo, J., Singh, N. N., Singh, R. N. Human Survival Motor Neuron genes generate a vast repertoire of circular RNAs. Nucleic Acids Research. 47, (6), 2884-2905 (2019).
  13. Stoss, O., Stoilov, P., Hartmann, A. M., Nayler, O., Stamm, S. The in vivo minigene approach to analyze tissue-specific splicing. Brain Research Protocols. 4, 383-394 (1999).
  14. Mardon, H. J., Sebastio, G., Baralle, F. E. A role for exon sequences in alternative splicing of the human fibronectin gene. Nucleic Acids Research. 15, 7725-7733 (1987).
  15. Gaildrat, P., et al. Use of splicing reporter minigene assay to evaluate the effect on splicing of unclassified genetic variants. Methods in Molecular Biology. 653, 249-257 (2010).
  16. Cooper, T. A. Use of minigene systems to dissect alternative splicing elements. Methods. 37, (4), 331-340 (2005).
  17. Baralle, D., Baralle, M. Splicing in action: assessing disease causing sequence changes. Journal of Medical Genetics. 42, (10), 737-748 (2005).
  18. Percifield, R., Murphy, D., Stoilov, P. Medium throughput analysis of alternative splicing by fluorescently labeled RT-PCR. Methods in Molecular Biology. 1126, 299-313 (2014).
  19. Stoilov, P., Lin, C. H., Damoiseaux, R., Nikolic, J., Black, D. L. A high-throughput screening strategy identifies cardiotonic steroids as alternative splicing modulators. Proceedings of the National Academy of Sciences of the United States of America. 105, (32), 11218-11223 (2008).
  20. Shen, M., et al. Pyrvinium pamoate changes alternative splicing of the serotonin receptor 2C by influencing its RNA structure. Nucleic Acids Research. 41, (6), 3819-3832 (2013).
  21. Noto, J. J., Schmidt, C. A., Matera, A. G. Engineering and expressing circular RNAs via tRNA splicing. RNA Biology. 1-7 (2017).
  22. Schmidt, C. A., Noto, J. J., Filonov, G. S., Matera, A. G. A Method for Expressing and Imaging Abundant, Stable, Circular RNAs In Vivo Using tRNA Splicing. Methods in Enzymology. 572, 215-236 (2016).
  23. Welden, J. R., van Doorn, J., Nelson, P. T., Stamm, S. The human MAPT locus generates circular RNAs. Biochimica et Biophysica Acta - Molecular Basis of Disease. 2753-2760 (2018).
  24. Casper, J., et al. The UCSC Genome Browser database: 2018 update. Nucleic Acids Research. 46, 762-769 (2018).
  25. Grozdanov, P. N., MacDonald, C. C. Generation of plasmid vectors expressing FLAG-tagged proteins under the regulation of human elongation factor-1alpha promoter using Gibson assembly. Journal of Visualized Experiments. (96), (2015).
  26. Wang, Y., et al. A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Research. 32, (3), 1197-1207 (2004).
  27. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  28. Conn, S. J., et al. The RNA binding protein quaking regulates formation of circRNAs. Cell. 160, (6), 1125-1134 (2015).
  29. Jeck, W. R., Sharpless, N. E. Detecting and characterizing circular RNAs. Nature Biotechnology. 32, (5), 453-461 (2014).
  30. Pamudurti, N. R., et al. Translation of CircRNAs. Molecular Cell. 66, (1), 9-21 (2017).
  31. Kramer, M. C., et al. Combinatorial control of Drosophila circular RNA expression by intronic repeats, hnRNPs, and SR proteins. Genes & Development. 29, (20), 2168-2182 (2015).
  32. Starke, S., et al. Exon circularization requires canonical splice signals. Cell Reports. 10, (1), 103-111 (2015).
  33. Suzuki, H., Tsukahara, T. A view of pre-mRNA splicing from RNase R resistant RNAs. International Journal of Molecular Sciences. 15, (6), 9331-9342 (2014).
  34. Zhang, X. O., et al. Diverse alternative back-splicing and alternative splicing landscape of circular RNAs. Genome Research. 26, (9), 1277-1287 (2016).
  35. Liang, D., Wilusz, J. E. Short intronic repeat sequences facilitate circular RNA production. Genes & Development. 28, (20), 2233-2247 (2014).
  36. Wang, Y., Mandelkow, E. Tau in physiology and pathology. Nature Reviews Neuroscience. 17, (1), 5-21 (2016).
  37. Fejes-Toth, K., et al. Post-transcriptional processing generates a diversity of 5'-modified long and short RNAs. Nature. 457, (7232), 1028-1032 (2009).
  38. Gao, Q. S., et al. Complex regulation of tau exon 10, whose missplicing causes frontotemporal dementia. Journal of Neurochemistry. 74, (2), 490-500 (2000).
  39. Hartmann, A. M., et al. Regulation of alternative splicing of human tau exon 10 by phosphorylation of splicing factors. Molecular and Cellular Neuroscience. 18, (1), 80-90 (2001).
  40. Wang, Y., Wang, Z. Efficient backsplicing produces translatable circular mRNAs. RNA. 21, (2), 172-179 (2015).
  41. Yang, Y., Wang, Z. Constructing GFP-Based Reporter to Study Back Splicing and Translation of Circular RNA. Methods in Molecular Biology. 1724, 107-118 (2018).
  42. Zheng, Q., et al. Circular RNA profiling reveals an abundant circHIPK3 that regulates cell growth by sponging multiple miRNAs. Nature Communications. 7, 11215 (2016).
  43. Jia, W., Xu, B., Wu, J. Circular RNA expression profiles of mouse ovaries during postnatal development and the function of circular RNA epidermal growth factor receptor in granulosa cells. Metabolism. 85, 192-204 (2018).
  44. Liang, D., et al. The Output of Protein-Coding Genes Shifts to Circular RNAs When the Pre-mRNA Processing Machinery Is Limiting. Molecular Cell. 68, (5), 940-954 (2017).
  45. Legnini, I., et al. Circ-ZNF609 Is a Circular RNA that Can Be Translated and Functions in Myogenesis. Molecular Cell. 66, (1), 22-37 (2017).
  46. Li, X., et al. Coordinated circRNA Biogenesis and Function with NF90/NF110 in Viral Infection. Molecular Cell. 67, (2), 214-227 (2017).
  47. Zhang, Y., et al. The Biogenesis of Nascent Circular RNAs. Cell Reports. 15, (3), 611-624 (2016).
परिपत्र आरएनए का विश्लेषण करने के लिए मिनीजीन युक्त <em>एलु</em> तत्व का उपयोग
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Welden, J. R., Pawluchin, A., van Doorn, J., Stamm, S. Use of Alu Element Containing Minigenes to Analyze Circular RNAs. J. Vis. Exp. (157), e59760, doi:10.3791/59760 (2020).More

Welden, J. R., Pawluchin, A., van Doorn, J., Stamm, S. Use of Alu Element Containing Minigenes to Analyze Circular RNAs. J. Vis. Exp. (157), e59760, doi:10.3791/59760 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter