Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

Bruk av Alu Element som inneholder minigenes å analysere sirkulære RNAs

doi: 10.3791/59760 Published: March 10, 2020

Summary

Vi klone og analyserer reportergener som genererer sirkulære RNAer. Disse reportergenene er større enn konstruksjoner for å analysere lineær spleising og inneholder Alu-elementer. For å undersøke de sirkulære Rna-ene blir konstruksjonene overført til celler, og resulterende RNA analyseres ved hjelp av RT-PCR etter fjerning av lineær RNA.

Abstract

I tillegg til lineære mRNAs genererer mange eukaryotiske gener sirkulære RNAer. De fleste sirkulære RNAer genereres ved å bli med på et 5's skjøtested med et oppstrøms 3's skjøtested i en pre-mRNA, en prosess som kalles tilbakesplening. Denne sirkulæriseringen er sannsynligvis hjulpet av sekundære strukturer i pre-mRNA som bringer skjøteområdene i umiddelbar nærhet. I menneskelige gener antas Alu-elementer å fremme disse sekundære RNA-strukturene, da Alu-elementer er rikelig og viser grunnleggende komplementæriteter med hverandre når de er tilstede i motsatte retninger i pre-mRNA. Her beskriver vi generering og analyse av store Alu-element som inneholder reportergener som danner sirkulære RNAer. Gjennom optimalisering av kloning protokoller, reporter gener med opptil 20 kb insert lengde kan genereres. Deres analyse i co-transfection eksperimenter tillater identifisering av regulatoriske faktorer. Dermed kan denne metoden identifisere RNA-sekvenser og cellulære komponenter som er involvert i sirkulær RNA-dannelse.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Sirkulære RNAs
Sirkulære RNAer (circRNAs) er kovalent lukket enkelt strandet RNAs som uttrykkes i de fleste organismer. De genereres ved å bli med i et nedstrøms 5's skjøtested til et oppstrøms 3's skjøtested, en prosess som kalles tilbakesplening (Figur 1A)1. Sekvenser i pre-mRNA som viser base komplementære så kort som 30-40 nt bringe tilbake-skjøte steder i riktig justering for circRNA formasjon2. Hos mennesker danner Alu-elementer 1, som representerer ca 11% av genomet3, omfattende dobbeltstrandede RNA-strukturer i pre-mRNA på grunn av deres selvkomplementaritet4,5 og dermed fremmer dannelsen av circRNAs1.

For tiden er tre hovedfunksjoner i circRNAs beskrevet. Noen circRNAs binde microRNAs (miRNAs) og gjennom sekvestrasjon fungere som miRNA svamper6. CircRNAs har vært innblandet i transkripsjonelle og post transkripsjonelle regulering, gjennom konkurranse med lineær spleising7 eller modulering av transkripsjonfaktoraktivitet8. Til slutt inneholder circRNAs korte åpne leserammer og bevis på prinsippstudier viser at de kan oversettes9,10. Funksjonen til de fleste circRNAs forblir imidlertid gåtefull. De fleste sirkulære RNAer er påvist ved hjelp av neste generasjons sekvenseringsmetoder11. Detaljerte analyser av individuelle gener ved hjelp av målrettede RT-PCR-tilnærminger viser at et stort antall sirkulære RNAer gjenstår å bli oppdaget12.

Bruk av reportergener for å analysere pre-mRNA-behandling
Analysen av mRNA avledet fra DNA-reporter konstruerer transfected til celler er en veletablert metode for å studere alternativ pre-mRNA spleising, som kan brukes på sirkulære Rna. Generelt forsterkes og klonet den alternative eksonen, dens omkringliggende introner og konstituerende exons og klonet inn i en eukaryotisk uttrykksvektor. Ofte forkortes intronene. Konstruksjonene er transfected i eukaryyotiske celler og vanligvis analysert av RT-PCR13,14. Denne tilnærmingen har blitt mye brukt til å kartlegge regulatoriske skjøtesteder og trans-fungerende faktorer i co-transfection eksperimenter13,15,16,17,18. I tillegg er genereringen av proteinuttrykkende minigenes tillatt for screening av stoffer som endrer alternativ spleising19,20.

Metoden er brukt på sirkulære RNAer. Foreløpig har minst 12 minigene ryggbein blitt beskrevet i litteraturen og er oppsummert i tabell 1. Med unntak av tRNA-basert uttrykkssystem21,22, er de alle avhengige av polymerase II-arrangører. Her beskriver vi en metode for å generere menneskelige reporterminigenes for å bestemme cis og trans-fungerende faktorer involvert i generering av sirkulære RNAer. En oversikt over metoden ved hjelp av sekvenser av et publisert reportergen23 vises i figur 1.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Design av konstruksjoner

  1. Bruk UCSC genom nettleser24 for å identifisere repeterende elementer som er nødvendige for sirkulær RNA-dannelse og innlemme dem i konstruksjonene. Viktigere, primere for forsterkning må være utenfor de repeterende elementene.
  2. Lim inn den sirkulære RNA-sekvensen (Tilleggsfigur 1 er en testsekvens) i https://genome.ucsc.edu/cgi-bin/hgBlat?command=start og velg riktig organisme. Send inn sekvensen og gå til nettleservisning, zoom ut 1,5 x eller etter behov (Figur 2A).
    MERK: Søkesekvensen vises i den øverste linjen (Figur 2A, 1). Avhengig av rekkefølgen på exons i sirkulære RNA, vil BLAT ikke koble alle exons. I dette eksemplet er exon 12 (Figur 2A, 4) ikke koblet til 11 ( Figur2A, 2, 3), fordi exon 12 er oppstrøms av exon 11 i den sirkulære RNA-sekvensen (Tilleggsfigur 1). De repeterende elementene er i "gjenta masker" sporet, angitt av bokser, hvor svart til grå farge indikerer evolusjonær bevaring (Figur 2A, 5).
  3. Hold musepekerne over de repeterende elementene for å identifisere undertypen i et flytende vindu. Alu elementer er i SINE (kort interspersed kjernefysisk element) linje. Bruk 'standard spor'-knappen under vinduet for å tilbakestille nettleseren hvis et annet bilde enn figur 2 er hentet.
    MERK: Mousing over exons i gendisplayet genererer et vindu med exon tall som genereres av datamaskinen. Disse tallene samsvarer ikke med eksonnummereringen som er etablert i litteraturen og endres også mellom isoformer.

2. Velg sekvensen som skal klones i en uttrykksvektor

  1. Last ned DNA-sekvensen som vises i vinduet ved å gå til Vis → DNA på topplinjen i UCSC genomnettleseren. Velg Alternativer for utvidet sak/fargei alternativet Sekvenseringsformatering.
  2. Velg standardtilfellet som Nedre, og velg vekslesak for NCBI refseq. Velg understreking og fet skrift, og kursiv for Gjenta Masker. Klikk send. Det vil være exons som store bokstaver og introner som små bokstaver. Kontroller ekson/intron-grensene.
  3. I dette eksemplet er det en 'ccctttacCTTTTT'-sekvens, noe som indikerer at nettleseren viser omvendt komplement. Hvis dette er tilfelle, gå tilbake og velg omvendt komplementboks til du ser de riktige exon introngrenser (agEXONgt), i dette eksemplet AAAAGgtaaaggg.
  4. Kopier filen med riktig retning (interne exons er omgitt av intronic ag... gt) inn i et tekstbehandlingsdokument og utheve eksonene (Supplerende figur 2).
    MERK: I dette eksemplet er det genomiske fragmentet som omfatter exons 9-12 rundt 24 kb og dermed for stor til å bli forsterket fra genomisk DNA. Derfor er hver exon omgitt av ca 1 kb intronic regionen individuelt forsterket og disse fire fragmentene er montert i en kloning vektor.
  5. Velg fragmenter som skal forsterkes (exon ± 500 nt intron). Pass på at intron ikke begynner eller slutter i en repeterende region, da primere i disse regionene ikke vil forsterke bestemte sekvenser. De valgte områdene vises i figur 2B, og sekvensene vises i tilleggsfigur 3.
    MERK: Generelt, jo større konstruksjoner, jo vanskeligere kloning vil være. Fragmentene kan monteres enten trinnklok (dvs. exon 9 kombineres med vektoren og i neste trinn blir exon 10 introdusert i denne konstruksjonen via kloning til alle exons er på plass), eller alternativt er alle fragmenter montert samtidig. En trinnvis tilnærming fungerer alltid, men krever mer tid. En samtidig montering fungerer ikke alltid, og avhenger av hvor godt de enkelte fragmentene kan forsterkes fra genomisk DNA og på den totale størrelsen på konstruksjonen. Vi starter derfor vanligvis med begge tilnærmingene samtidig.

3. Design primere for kloning

  1. Bruk et webverktøy (https://nebuilder.neb.com/#!/) til å designe primere for kloning. Angi for eksempel fragmenter 9, 10, 11 og 12 og vektorsekvensen (Tilleggsfigur 3) til dette verktøyet.
  2. For vektorsekvensen legger du til innsettingsstedet som siste nukleotid og legger deretter til fragmentene. Siden vektornummereringen ikke starter med et gitt innsettingssted, er stedet for innsetting i vektoren plassert og nedstrømsdelen settes foran oppstrømssekvensen. I dette eksemplet starter innsatsene rett etter HindIII [AAGCTT]-nettstedet og slutter rett etter PmeI [GTTTAAAC]-nettstedet til pcDNA3.1. Sekvensen fra cccgctgatcag ... ccgtaaaaaggccgc limes inn foran posisjon 1 i pcDNA3.1-sekvensen (gttgctggcgtttttcc ...).
  3. Juster primere hvis smeltepunktene er mer enn 4 °C fra hverandre, da de ikke vil fungere i forsterkning. Monteringen av fragmenter og primer sekvenser designet er vist i supplerende figur 4. Primere for kloning kan også utformes manuelt25.

4. PCR- og amplicondeteksjon

  1. Standard PCR-reaksjon: Lag en reaksjonsblanding for totalt volum på 50 μL per reaksjon. Nedenfor er oppskriften på en reaksjon ved hjelp av polymerase 1:
    10 μL 5x reaksjonsbuffer
    1 μL av 10 mM dNTPs
    2,5 μL av 10 μM primer fremover
    2,5 μL av 10 μM omvendt primer
    0,5 μL polymerase 1
    32,5 μL Nuclease fri H2O
    1. Du kan eventuelt legge til 10 μL 5x GC Enhancer hvis produktet har høyt GC-innhold. lage en separat blanding som inneholder GC Enhancer for å teste PCR-reaksjonen.
  2. Aliquot 49 μL av blandingen i PCR-rør per reaksjonsprøve.
  3. Tilsett 1 μL DNA til PCR, mengden varierer fra 10 pg til 1 ng.
  4. Snurr ned prøvene for å fjerne rester fra sidene og plasser dem i en PCR-maskin. Bruk samme maskin samt samme flekker i maskinen når du optimaliserer PCR-forholdene.

5. Optimalisering for lengre DNA-fragmenter for bruk av forskjellige polymeraser

  1. Temperatur
    1. Optimaliser den lange polymerase 2.
      1. Bruk en lavere avnatureringstemperatur (Polymerase 1: 98 °C, Polymerase 2: 94 °C).
      2. Bruk en lengre avnatureringstid (Polymerase 1: 10 s, Polymerase 2: 30 s).
      3. Bruk en lengre glødetid (Polymerase 1: 30 s, Polymerase 2: 60 s).
      4. Bruk lengre forlengelsestid (Polymerase 1: 30 s/kb, Polymerase 2: 50 s/kb).
      5. Bruk en lavere forlengelsestemperatur (Polymerase 1: 72 °C, Polymerase 2: 65 °C).
      6. Bruk en glødetemperatur 5 °C under Tm av primere.
    2. Optimaliser primerkonsentrasjonene (5x mindre til 5x mer enn den opprinnelige primerkonsentrasjonen). Optimaliser DNA-konsentrasjoner fra 10 pg til 50 pg, 100 pg, 1 ng, 5 ng, 10 ng.
    3. Som et eksempel på et PCR-program for å forsterke en 15 kb produktstørrelse ved hjelp av Polymerase 2, utføre en innledende avnaturring ved 94 °C i 30 s, DNA-denaturering ved 94 °C i 30 s etterfulgt av glødved 58 °C i 30 s, og DNA-forlengelse ved 65 °C i 12 min 30 s. Utfør en endelig forlengelse ved 65 °C i 10 min med et siste 4 °C-hold.
      MERK: Glødetemperaturen (Ta) som er spesifikk for primere som bestemmes av nettbaserte temperaturberegninger som er spesifikke for hver polymerase. Forlengelsestidene kan variere og må optimaliseres hvis fragmenter er større enn 10 kb.
  2. Forlengelsestider og DNA-konsentrasjoner
    1. Bruk lengre forlengelsestider for DNA-fragmenter over 6 kb: 1 min per 1 kb. Lengre fragmenter bør bruke mindre DNA.
    2. Utfør fortynninger av DNA for å finne optimal DNA-konsentrasjon for forsterkning, vanligvis 1 pg til 1 ng for plasmider eller 1 ng til 1 μg for genomisk DNA.
      MERK: For de fleste kloning bruk polymerase 1, konstruert ved å fusjonere Sso7d DNA bindende domene til en proprietær termostabil DNA polymerase26. Polymerasen har en lav feilhastighet og på grunn av Sso7d-domenet en høy prosessivitet, som trengs for å forsterke store (10-15 kb) genomiske fragmenter. På grunn av denne store fragmentstørrelsen brukes enzymatisk montering av DNA-molekyler27 til innsetting i vektorer, da denne metoden ikke krever begrensningsenzymer. Forsterkningen av fragmenter lenger enn 15 kb blir stadig vanskeligere med polymerase 1. For stor fragment forsterkning bruk polymerase 2 laget av pyrokokker-som proofreading polymerase smeltet til Sso7d eller lang rekkevidde PCR kit som gir, men høyere feilfrekvenser.

6. Rensing av PCR-produkter for kloning

  1. Kjør halvparten av PCR-produktene på 1% agarosegeler som inneholder en intercalating nukleinsyreflekk (f.eks. 1x GelGreen). Visualiser de fargede gelene på en mørk lesertransilluminator. Dette beisede DNA går ikke tro mot størrelse.
    MERK: GelGreen intercalates i DNA, ligner ethidium bromid, men det er begeistret av lys rundt 500 nm (cyan), en bølgelengde som ikke skader DNA, som forbedrer kloning.
  2. Parallelt kjører du halvparten av PCR-produktene på en 1% gel som er farget etter kjøring med ethidiumbromid (Figur 3A,B).
  3. Avgiftsbånd av riktig størrelse fra den beisede gelen (trinn 6.1) og isolere DNA ved hjelp av et gel- og PCR-oppryddingssett. I avvik fra standardprotokollen elute DNA i bare 20 μL dobbelt destillert vann, som vanligvis DNA-konsentrasjonene er lave.
  4. Før kloning, sjekk det isolerte DNA på en agarose gel for konsentrasjon og integritet (Figur 3B). Sikt på en 2:1 molar innsats til vektor forhold. Når du bruker flere innsatser, er forholdet 2:2:2:1.

7. DNA-montering og klonedeteksjon

MERK: Kloning gjøres ved hjelp av et enzymatisk DNA-monteringssett, med mindre modifikasjoner. Monteringen utføres i 60 min ved 50 °C og generelt brukes det nedre DNA-området til montering (20-100 fmol/20 μL reaksjon). Hele reaksjonsblandingen legges til kjemiske kompetente celler og hele cellene belagt ut på en 6 cm agarplate.

  1. Kombiner vektoren og sett inn i et 1:2 molar-forhold (20-500 fmol hver) i 10 μL vann.
  2. Tilsett 10 μL DNA Assembly Master Mix.
  3. Inkuber prøvene i 60 minutter ved 50 °C.
  4. Deretter forvandle kompetente celler med den totale monteringsreaksjonen. Her bruker du E. coli stamme 1 celler for kortere konstruksjoner eller E. coli stamme 2 celler for lengre eller ustabile konstruksjoner. Celler bør være i et 50 μL-volum.
  5. Tin celler på is og tilsett 2 μL av det kjølte monterte produktet til de kompetente cellene. Bland ved å knipse røret forsiktig 4-5 ganger. Ikke virvle.
  6. La blandingen sitte på is i 30 min.
  7. Varmesjokk ved 42 °C i 30 s. Ikke bland.
  8. Overfør røret tilbake til is i 2 min.
  9. Tilsett 950 μL soc media med romtemperatur i røret.
  10. Inkuber reaksjonsrøret ved 37 °C i 60 min. Rist kraftig (300 rpm).
  11. Varme utvalgsplater med riktig antibiotika under inkubasjon ved 37 °C.
  12. Pellet cellene gjennom sentrifugering (10.000 x g,30 s) og plate ut 1/4 og 3/4 av celler på to utvalgsplater og inkubere ved 37 °C over natten.

8. Validering av kloner

  1. Bruk koloni-PCR, ved hjelp av PCR-primere som strekker seg over monteringsstedene (figur 1C)for deteksjon.
  2. Ta en steril tannpirker og berør en enkelt bakteriell koloni.
  3. Berør bunnen av et PCR-rør med tannpirken som har kolonien og deretter strek tannpirken på en antibiotikaagarplate, inkuber den stripete platen ved 37 °C eller romtemperatur for følsomme konstruksjoner over natten.
  4. Overlegg PCR-røret som berøres med kolonien med en PCR-blanding som inneholder deteksjonsprimerne. Disse er designet ved hjelp av primer 3 (http://bioinfo.ut.ee/primer3-0.4.0/). Programmet har muligheten til å tvinge primer design over en definert sekvens ved hjelp av "[ccc]" skilt ene for å velge primere over monteringskrysset. DNA fra positive stammer er isolert og verifisert ved sekvensering.

9. Analyse av sirkulære RNA uttrykker reportergener

  1. For analyse, transfect reporter gener i eukaryotic celler. Her bruker du HEK293-celler (ATTC #CRL-1573) da de gir høy transfection effektivitet. Bruk PEI-løsninger (polyetylenimin).
  2. For PEI-oppløsningen oppløses lineær polyetyleniminhydroklorid (PEI) ved 1 mg/ml i vann ved lav pH, pH 2. Ta opp pH til 7 med NaOH. Sterilt filter med 0,22 μm filtre og oppbevares ved 4 °C.
  3. Del celler i seks brønner (ca. 150 000 celler per brønn) og la dem vokse over natten i 10% FBS i DMEM-medier.
  4. Aliquot 1 μg av reportergenet i et sterilt rør og tilsett 200 μL sterilfiltrert 150 mM NaCl. Bland med DNA ved å virvle.
  5. Legg PEI løsning til denne blandingen og vortex, kort sentrifuge for å samle prøver nederst på røret. Bruk et forhold på 1 μg DNA per 3 μL PEI.
  6. Inkuber ved romtemperatur i 10 min og legg deretter direkte til HEK 293 celler.
  7. Inkuber HEK293 celler ved 37 °C, 5% CO2, over natten.
  8. Isoler RNA for RT-PCR via et RNA-isolasjonssett.

10. RNase R-behandling for å fjerne lineære RNAer

  1. Bruk 10 μg av total RNA i et RNase-fritt rør.
  2. Tilsett 10 μL av 10x RNase R buffer (0,2 M Tris-HCl (pH 8,0), 1 M KCl, 1 mM MgCl2) til RNA.
  3. Tilsett RNase R til RNA (1 μl = 20U).
  4. Tilsett 1 μL glykolblå til RNA og bringe volumet opp til 100 μL med sterilt vann.
  5. Inkuber prøvene ved 37 °C i 30 min.
  6. Tilsett 100 μL fenol/kloroform og vortex i 1 min.
  7. Sentrifuge ved 21 000 x gr i 1 min til separate faser.
  8. Ta supernatanten (vandig fase) og tilsett 1 volum (rundt 80 μL kloroform).
  9. Vortex i 1 min, og deretter sentrifuge i 1 min for å skille faser.
  10. Ta supernatant, tilsett 1:10 vol KAc og 2,5 vol etanol, og utfell ved -20 °C i 1-4 h. Sentrifuge ved 4 °C i 30 min ved full hastighet (21 000 x g). Det vil være en liten blå pellet nederst.
  11. Fjern supernatanten, og vask med 80% etanol. La luften tørke i 5 min ved romtemperatur, og oppløs i 10 μL vann.

11. RT-PCR-analyse

  1. Bruk 1 μg RNA per RT-reaksjon.
  2. Lag reaksjonsblanding for et endelig totalt volum på 20 μL per reaksjon. For en reaksjon, bruk 1 μL av 10 mM dNTPs, 1 μL av 0,1 M Dithiothreitol (DTT), 4 μL av 5x First-Strand Buffer og 0,5 μL revers transcriptase.
  3. Aliquot 6,5 μL reaksjonsblanding i nye PCR-rør.
  4. Bland opptil 5 primere i en blanding. Noen primere kan imidlertid feilpare med andre primere i PCR(figur 5). Primer sekvenser er i tabell 2. Vi bruker rutinemessig genspesifikke exon-junction primere, men det er også mulig å grunne med tilfeldige hexamers.
  5. Tilsett 1 μL 10 μM Omvendt primer til ønsket RT-reaksjonsrør.
  6. Tilsett 1 μg RNA i PCR-reaksjonsrøret.
  7. Tilsett RNase-fri H2O opptil et totalt volum på 20 μL.
  8. Spinrør ned for å fjerne rester på siden av rørene og plasser i termocycler.
  9. Kjør RT-reaksjonen i termocycler ved 50 °C i 50 minutter.
  10. Oppbevar RT cDNA ved -20 °C eller fortsett til PCR-reaksjonen.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Reportergener tillater bestemmelse av regulatoriske faktorer som påvirker sirkulær RNA-dannelse. Imidlertid er disse reportergenene store og inneholder repeterende elementer som ofte gjør DNA-konstruksjoner ustabile. På grunn av deres store størrelse er det ofte nødvendig å slette deler av intronene, som oppnås ved å forsterke genomiske stykker som inneholder exons og mindre flankerende intronic-deler. Disse DNA-brikkene er enzymatically montert, slik at bygging uten begrensning enzymer.

Eksemplet på en sirkulær RNA generert fra mikrotubule assosiert protein tau (MAPT) viser en anvendelse av minigene tilnærming for å analysere sirkulære RNAs. Tau 9→12 minigene som ble brukt i dette eksemplet var samtidig transfected med forskjellige spleisingsfaktorer, og effekten av disse spleisingsfaktorene ble oppdaget av RT-PCR (figur 6). Ulike transvirkende faktorer påvirker både sirkulær RNA og lineær pre-mRNA-dannelse. Eksperimentet viser også at alle sekvenselementene som er nødvendige for sirkulær RNA-dannelse, er lokalisert i det klonede fragmentet.

Figure 1
Figur 1: Oversikt over teknikken. (A) Et hypotetisk gen vises. Introner er linjer, exons er bokser, Alu elementer er mindre stripete bokser. Rygging fra exon C til A skaper en sirkulær RNA. Strukturen til denne sirkulære RNA er vist i panelet (E). (B) For å lage et reportergen, forsterkes exons og omkringliggende introner (minst 500 nt på hver side). Konstruksjonene bør inneholde repeterende elementer, som vanligvis er Alu-elementer hos mennesker. En exon oppstrøms av exon A ble inkludert for å gi en ekstra Alu element. De genomiske fragmentene overlapper med sine flankerende 25 nts. (C) Fragmenter er klonet inn i et uttrykk vektor, drevet av en CMV arrangør. Den vellykkede rekombinasjonen oppdages ved deteksjonsprimere og valideres ved sekvensering. (D) Celler er transfected med denne konstruksjonen. (E) Sirkulær RNA er isolert og (F) forsterket ved hjelp av sirkulære RNA-spesifikke primere, fortrinnsvis exon junction primers. Under PCR forsterkning kan lineær RNA også forsterkes (G). (G) Orientering av primere som brukes til å oppdage sirkulære RNAer. Den fremre primeren er i fornuftsorientering (dvs. har samme rekkefølge som RNA) og omvendt primer er i antisansorientering (dvs. er det motsatte komplementet av RNA). Vær oppmerksom på at forskjellig fra RT-PCR for lineære mRNAer, er omvendt primer oppstrøms av den fremre primeren. Vennligst klikk her for å se en større versjon av denne figuren.

Figure 2
Figur 2: Valg av sekvensen for minigenkonstruksjon. (A) Nettleservisning etter sekvensen som vises i tilleggsfigur 1 kjøres mot den menneskelige genomiske databasen ved hjelp av BLAT. Litteratur exon nummer36 er angitt i genvisningen, de er forskjellige fra tallene gitt av nettleseren.
1. De justerte sekvensene vises under 'YourSeq'
2-4. Vær oppmerksom på at blat ikke kobler alle exons med linjer som det gjør i lineær RNA på grunn av sirkulariteten. Exons 10 og 11 (tilsvarende 2 og 3) er koblet til, men exon 12 (tilsvarende 4) er ikke koblet til exon 11.
5. Alu-elementer vises i det repeterende elementsporet.
(B) Sekvensjustering mellom den planlagte konstruksjonen og genomisk DNA.
6. Den planlagte konstruksjonen ble kjørt mot databasen ved hjelp av BLAT.
7. Legg merke til inkluderingen av flere Alu-elementer i konstruksjonen. Vennligst klikk her for å se en større versjon av denne figuren.

Figure 3
Figur 3: Eksempel på amplicons før kloning. (A) Optimaliserte PCR-produkter atskilt på en 1% agarose gel som inneholder 1x GelGreen. De enkelte båndene representerer PCR-produktene som skal brukes i enzymatisk DNA-montering. (B) Båndene fra (A) ble kuttet ut fra gelen og renset. De rensede PCR-produktene ble separert på en 1% agarose gel, som senere ble farget med ethidiumbromid. Vennligst klikk her for å se en større versjon av denne figuren.

Figure 4
Figur 4: Begrensningsanalyse av reportergener. Tau 9-12 minigene som ble brukt som eksempel ble kuttet med begrensningenzymer indikert for å utelukke store rekombinasjoner. Lane 1: cut med NcoI forventet størrelse 735 bp, 3345 bp, 6266 bp, lane 2 cut med XbaI forventet størrelse 10346 bp, lane 3 kutt med HindIII forventet størrelser 3951 bp, 6395 bp, lane 4 kuttet med SmaI forventet størrelse 1168 bp, 1688 bp, 2708 bp, 4782 bp. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 5
Figur 5: Effekt av primer multipleksing og RNase R behandling på sirkulær RNA deteksjon. (A) cDNA fra prøver A og B avledet fra humant hjernevev ble forsterket med sirkulære RNA-primerer circTau exon12_10 Reverse og circTau exon10_11 Forward. Den omvendte transkripsjonen for cDNA ble utført med primere for lineær og sirkulær tau RNA. Det forventede båndet som tilsvarer tau sirkulær RNA vises med en trekant. De andre sterke bandene er gjenstander som ikke stemte overens med det menneskelige genomet. (B) Eksperimentet ble gjentatt med identiske PCR-forhold, men omvendt transkripsjon ble utført bare med circTau exon12_10 Reverse primer. Bare det forventede båndet ble forsterket og validert gjennom sekvensering. (C) RNA ble behandlet med RNase R som fjerner lineær RNA. Den sirkulære RNA kan detekteres etter behandlingen (venstre), mens lineær RNA gir ikke lenger et påviselig signal (høyre) Vennligst klikk her for å se en større versjon av denne figuren.

Figure 6
Figur 6: Eksempel på en analyse av et circRNA-reportergen. 1 μg av tau 9→1237 reportergenet ble transfected med 1 μg spleisingsfaktorer indikert. RNA ble isolert 24 h etter transfection og analysert av RT-PCR. (A) Forsterkning av lineær tau mRNA. På grunn av alternativ spleising av exon observeres 10 to bånd. Deres forholdsendringer på grunn av overuttrykk av spleising faktorer38,39. (B) Forsterkning av rundskrivet 12→10 tau RNA23. Legg merke til avhengigheten av tau circRNA uttrykk på uttrykk for noen spleising faktorer, spesielt cdc2 som kinase clk2 og SR protein 9G8. (C) Den sirkulære RNA av HIPK3 ble brukt som en positiv kontroll som indikerer lik belastning. Vennligst klikk her for å se en større versjon av denne figuren.

Tabell 1: Liste over gjeldende minigenes uttrykker sirkulære RNAer. Vennligst klikk her for å laste ned denne filen.

Sirkulære HIPK3-kontrollprimerer
HIPK3 omvendt
HIPK3 fremover
TGCTTGGCTCTACTTTGAGTTTC (Nær TGCTTGGCTCTACTTTGAGTTTC)
TCGGCCAGTCATGTATCAAA (Andre)
Lineære primere
Tau Exon 12 Omvendt
Tau Exon 9 Fremover
CCCAATCTTCGACTGGACTC (andre er i gang med å
TGTCAAGTCCAAGATCGGCT (Nær TGTCAAGTCCAAGATCGGCT)
Sirkulære primere
circTau exon12_10 omvendt
circTau exon10_11 Fremover
Cagcttcttattaattatctgcaccttttt
Gaggcggcagtgtgcaa

Tabell 2: Liste over primere.

Supplemental Figure 1
Tilleggsfigur 1: Tau sirkulær RNA-testsekvens. Testsekvens som tilsvarer en sirkulær RNA fra MAPT-gressrøret. Ulike exons er indikert ved understreket, kapslinger og store caps. Vennligst klikk her for å se en større versjon av denne figuren.

Supplemental Figure 2
Supplerende figur 2: Genomisk sekvens som inneholder det planlagte minigenet. Exons er uthevet i farge og repeterende elementer er understreket, kursiv og fet. Grå skyggelegging indikerer flankerende områder med lav kompleksitet som kan brukes til å generere primere. Vennligst klikk her for å laste ned denne filen.

Supplemental Figure 3
Tilleggsfigur 3: Sekvenser av det planlagte reportergenet. Vektorsekvensen og de planlagte genomiske fragmentene vises. Vennligst klikk her for å laste ned denne filen.

Supplemental Figure 4
Tilleggsfigur 4: Primers design for montering. Sekvensen fra tilleggsfigur 3 ble inngått i byggherreverktøyet. Vennligst klikk her for å se en større versjon av denne figuren.

Supplemental Figure 5
Supplerende figur 5: Sekvens av tau 9-> 12 reporter genet brukes som et eksempel. Vennligst klikk her for å laste ned denne filen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Generelt er sirkulære RNAer lave rikelig1, noe som kompliserer studiet av deres funksjon og dannelse. I likhet med lineære RNAs13, tillater bruk av reporter minigenes identifisering av cis og trans-fungerende faktorer som regulerer dannelsen av sirkulære RNAer. Dermed genererer denne tilnærmingen hypoteser som kan testes ytterligere ved hjelp av endogene gener.

Det mest kritiske trinnet er utformingen av reportergenet. Den enzymatiske monteringen av DNA-fragmenter ("Gibson kloning"27) letter denne designen, da det tillater bygging av store reportergener uavhengig av restriksjonssteder.

De tilbake-spleising nettsteder er samlet gjennom flankert invertert gjentakelser, som bør tas i betraktning i reporter genkonstruksjon. Repetisjonene kommenteres i genomleseren "gjenta spor" og velge dem viser sin orientering. Husk at proteiner også kan tvinge tilbake-spleising spleising nettsteder i en sekundær struktur som trengs for sirkulære RNA uttrykk28 og for en objektiv analyse 1-2 kb av flankerende intronic regioner bør undersøkes.

For å sikre stabiliteten i konstruksjonene, er en viktig vurdering typen bakterielle stammer og deres vekstforhold. For kortere, enkle konstruksjoner brukes standard kloning bakterier, som er nesten identiske med DH5-alfa (huA2 Δ(argF-lacZ)U169 phoA glnV44 Φ80 Δ (lacZ)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17). For lengre fragmenter, som inneholder mer enn 6 Alu-elementer, "stabile" kompetente celler brukes som mangler en rekombinase (recA) og endonuclease (endA1) (F' proA + B + lacIq (lacZ)M15 zzf::Tn10 (TetR) (ara-leu) 7697 araD13 9 fhuA lacX74 galK16 galE15 e14- Φ80dlacZM15 recA1 relA1 endA1 nupG rpsL (StrR) rph spoT1 (mrr-hsdRMS-mcrBC). Hvis det oppstår problemer med rekombinasjon, indikert ved lave transformasjonsantall, plate de forvandlede bakteriene på to plater og la dem vokse ved henholdsvis 30 ºC og 37 ºC. På grunn av tilstedeværelsen av mange repeterende elementer i minigenes, må de være fullt sekvensert ved hjelp av neste generasjons sekvensering, som er kommersielt tilgjengelig for rundt $ 150 per plasmid til 2019 priser. Sekvensen for eksemplet vises i tilleggsfigur 5. I tillegg er begrensning fragment lengde polymorfisme analyse for ny større utarbeidelse av konstruksjonene rutinemessig utført. For eksempel, ved hjelp av nettsteder som kutter 1-4 ganger resulterer i et karakteristisk bånd mønster som utelukker rekombinasjoner (Figur 4). Enzymer bør velges som gir et karakteristisk båndmønster av fragmenter som kan skilles på en agarosegel.

Sirkulære RNAer analyseres med RT-PCR ved hjelp av exon junction-primere som overlapper med backsplicing-hendelsen (figur 1F). På grunn av RNA's sirkulære natur er den motsatte (dvs. antisense) primeren oppstrøms av forover (dvs. forstand) primer (figur 1G). Primere som oppdager det rikelig uttrykte homeodomain-interagerende proteinkinase 3 (HIPK3) sirkulære RNA1 brukes som en positiv kontroll. HIPK3 og minigene spesifikke omvendtprimere er omvendt transkribert i samme rør, noe som gjør at de kan sammenligne. PCR-reaksjoner utføres med primere som forsterker de lineære mRNAene for å sammenligne behandlingsmønstre av sirkulære og lineære pre-mRNAer. Vi observerte ofte avvikende bånd når primere for lineære og sirkulære RNAer ble blandet (Figur 5), og dermed holde omvendt transkripsjon av disse prøvene atskilt.

RT-PCR analyse av sirkulære RNAer er utfordrende og må kontrolleres nøye. Selv om den er følsom og praktisk, kan den produsere artefakter som er unike for sirkulære RNAer29. Den omvendte transkripsjonen kan bevege seg flere ganger rundt RNA-sirkelen, noe som genererer koncatemerer. De fleste sirkulære RNA reporter gener generere både sirkulær og lineær RNA, som kan kryss-hybridisere, fører til flere PCR artefakter21,30,31. Det er derfor viktig å sekvensere PCR-produktene og validere funn ved hjelp av ulike teknikker ved hjelp av Northern blots32 eller RNase beskyttelse23.

Uforklarlige bånd kan også stamme fra avvikende forsterkning av lineær RNA. Lineær RNA kan fjernes ved hjelp av exonuclease RNase R, som beriker sirkulære RNAs33 (Figur 5C). RNase R behandling hjelper i den første optimalisering av deteksjon primere og kan ofte utelates når primere er optimalisert.

Alternativ ryggspleising kan også bidra til uforklarlige bånd, da flere sirkulære RNAer kan dannes fra en genomisk locus34. Denne alternative tilbakespleningen er ofte et resultat av konkurrerende pre-mRNA strukturer dannet av mer enn to inverterte gjentatte elementer. I tillegg kan kryptiske back-splice nettsteder oppstå32,35. Avhengig av det eksperimentelle målet kan Alu-elementer gjentas eller legges til konstruksjonene. De komplementære områdene som flankerer ryggspleningssteder kan være så korte som 30-40 nt35, og utskifting av Alu-elementer med kortere komplementære regioner kan øke sirkulær RNA-formasjon2, som kan testes for å forbedre sirkulær RNA-dannelse. Når pre-mRNA sekvenser som forårsaker back-spleising er identifisert, er det dermed mulig å forkorte sirkulære RNA uttrykkekonstruksjoner, noe som kan forbedre transfection effektivitet i noen tilfeller.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Ingenting å avsløre.

Acknowledgments

Dette arbeidet ble støttet av Forsvarsdepartementet DoD stipend AZ180075. Stefan Stamm takker Jacqueline Noonan Begavelse. Anna Pawluchin ble støttet av DAAD, tysk akademisk utvekslingsprogram, Justin R. Welden var mottaker av University of Kentucky Max Steckler Award.

Materials

Name Company Catalog Number Comments
(PEI) Hydrochloride Polysciences 24765-1
Builder tool NEB https://nebuilder.neb.com/#!/
Dark Reader Transilluminator. Clare Chemical Research
Enzymatic DNA assembly kit NEB E2621S
Gel and PCR cleanup kit Promega A9282
Glyco Blue Thermo Fisher AM9516
pcDNA3.1 cloning site Polycloning site https://assets.thermofisher.com/TFS-Assets/LSG/manuals/pcdna3_1_man.pdf
Polymerase 1 NEB M0491L Q5 DNA polymerase
Polymerase 2 Biorad 1725310 Long range polymerase (NEB), iproof (BioRad)
Polymerase 2 Qiagen 206402 Qiagen long range polymerase kit
Reverse Transcriptase Thermo Fisher 18080044
RNA isolation kit Life Technologies 12183025 Ambion by Life Technologies
RNAse R Lucigen RNR07250 Epicenter/Lucigen
Stable competent cells NEB C3040H NEB stable cells
Standard cloning bacteria NEB C2988J NEB5-alpha competent
Web tool to design primers NEB https://nebuilder.neb.com/#!/
Web-based temperature calculations NEB https://tmcalculator.neb.com/#!/main

DOWNLOAD MATERIALS LIST

References

  1. Jeck, W. R., et al. Circular RNAs are abundant, conserved, and associated with ALU repeats. RNA. 19, (2), 141-157 (2013).
  2. Zhang, X. O., et al. Complementary sequence-mediated exon circularization. Cell. 159, (1), 134-147 (2014).
  3. Deininger, P. Alu elements: know the SINEs. Genome Biology. 12, (12), 236 (2011).
  4. Bazak, L., Levanon, E. Y., Eisenberg, E. Genome-wide analysis of Alu editability. Nucleic Acids Research. 42, (11), 6876-6884 (2014).
  5. Levanon, E. Y., et al. Systematic identification of abundant A-to-I editing sites in the human transcriptome. Nature Biotechnology. 22, (8), 1001-1005 (2004).
  6. Hansen, T. B., et al. Natural RNA circles function as efficient microRNA sponges. Nature. 495, (7441), 384-388 (2013).
  7. Kelly, S., Greenman, C., Cook, P. R., Papantonis, A. Exon Skipping Is Correlated with Exon Circularization. Journal of Molecular Biology. 427, (15), 2414-2417 (2015).
  8. Li, Z., et al. Exon-intron circular RNAs regulate transcription in the nucleus. Nature Structural & Molecular Biology. 22, (3), 256-264 (2015).
  9. Yang, Y., et al. Extensive translation of circular RNAs driven by N(6)-methyladenosine. Cell Research. 27, (6), 626-641 (2017).
  10. Abe, N., et al. Rolling Circle Translation of Circular RNA in Living Human Cells. Scientific Reports. 5, 16435 (2015).
  11. Salzman, J., Chen, R. E., Olsen, M. N., Wang, P. L., Brown, P. O. Cell-type specific features of circular RNA expression. PLOS Genetics. 9, (9), 1003777 (2013).
  12. Ottesen, E. W., Luo, D., Seo, J., Singh, N. N., Singh, R. N. Human Survival Motor Neuron genes generate a vast repertoire of circular RNAs. Nucleic Acids Research. 47, (6), 2884-2905 (2019).
  13. Stoss, O., Stoilov, P., Hartmann, A. M., Nayler, O., Stamm, S. The in vivo minigene approach to analyze tissue-specific splicing. Brain Research Protocols. 4, 383-394 (1999).
  14. Mardon, H. J., Sebastio, G., Baralle, F. E. A role for exon sequences in alternative splicing of the human fibronectin gene. Nucleic Acids Research. 15, 7725-7733 (1987).
  15. Gaildrat, P., et al. Use of splicing reporter minigene assay to evaluate the effect on splicing of unclassified genetic variants. Methods in Molecular Biology. 653, 249-257 (2010).
  16. Cooper, T. A. Use of minigene systems to dissect alternative splicing elements. Methods. 37, (4), 331-340 (2005).
  17. Baralle, D., Baralle, M. Splicing in action: assessing disease causing sequence changes. Journal of Medical Genetics. 42, (10), 737-748 (2005).
  18. Percifield, R., Murphy, D., Stoilov, P. Medium throughput analysis of alternative splicing by fluorescently labeled RT-PCR. Methods in Molecular Biology. 1126, 299-313 (2014).
  19. Stoilov, P., Lin, C. H., Damoiseaux, R., Nikolic, J., Black, D. L. A high-throughput screening strategy identifies cardiotonic steroids as alternative splicing modulators. Proceedings of the National Academy of Sciences of the United States of America. 105, (32), 11218-11223 (2008).
  20. Shen, M., et al. Pyrvinium pamoate changes alternative splicing of the serotonin receptor 2C by influencing its RNA structure. Nucleic Acids Research. 41, (6), 3819-3832 (2013).
  21. Noto, J. J., Schmidt, C. A., Matera, A. G. Engineering and expressing circular RNAs via tRNA splicing. RNA Biology. 1-7 (2017).
  22. Schmidt, C. A., Noto, J. J., Filonov, G. S., Matera, A. G. A Method for Expressing and Imaging Abundant, Stable, Circular RNAs In Vivo Using tRNA Splicing. Methods in Enzymology. 572, 215-236 (2016).
  23. Welden, J. R., van Doorn, J., Nelson, P. T., Stamm, S. The human MAPT locus generates circular RNAs. Biochimica et Biophysica Acta - Molecular Basis of Disease. 2753-2760 (2018).
  24. Casper, J., et al. The UCSC Genome Browser database: 2018 update. Nucleic Acids Research. 46, 762-769 (2018).
  25. Grozdanov, P. N., MacDonald, C. C. Generation of plasmid vectors expressing FLAG-tagged proteins under the regulation of human elongation factor-1alpha promoter using Gibson assembly. Journal of Visualized Experiments. (96), (2015).
  26. Wang, Y., et al. A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro. Nucleic Acids Research. 32, (3), 1197-1207 (2004).
  27. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  28. Conn, S. J., et al. The RNA binding protein quaking regulates formation of circRNAs. Cell. 160, (6), 1125-1134 (2015).
  29. Jeck, W. R., Sharpless, N. E. Detecting and characterizing circular RNAs. Nature Biotechnology. 32, (5), 453-461 (2014).
  30. Pamudurti, N. R., et al. Translation of CircRNAs. Molecular Cell. 66, (1), 9-21 (2017).
  31. Kramer, M. C., et al. Combinatorial control of Drosophila circular RNA expression by intronic repeats, hnRNPs, and SR proteins. Genes & Development. 29, (20), 2168-2182 (2015).
  32. Starke, S., et al. Exon circularization requires canonical splice signals. Cell Reports. 10, (1), 103-111 (2015).
  33. Suzuki, H., Tsukahara, T. A view of pre-mRNA splicing from RNase R resistant RNAs. International Journal of Molecular Sciences. 15, (6), 9331-9342 (2014).
  34. Zhang, X. O., et al. Diverse alternative back-splicing and alternative splicing landscape of circular RNAs. Genome Research. 26, (9), 1277-1287 (2016).
  35. Liang, D., Wilusz, J. E. Short intronic repeat sequences facilitate circular RNA production. Genes & Development. 28, (20), 2233-2247 (2014).
  36. Wang, Y., Mandelkow, E. Tau in physiology and pathology. Nature Reviews Neuroscience. 17, (1), 5-21 (2016).
  37. Fejes-Toth, K., et al. Post-transcriptional processing generates a diversity of 5'-modified long and short RNAs. Nature. 457, (7232), 1028-1032 (2009).
  38. Gao, Q. S., et al. Complex regulation of tau exon 10, whose missplicing causes frontotemporal dementia. Journal of Neurochemistry. 74, (2), 490-500 (2000).
  39. Hartmann, A. M., et al. Regulation of alternative splicing of human tau exon 10 by phosphorylation of splicing factors. Molecular and Cellular Neuroscience. 18, (1), 80-90 (2001).
  40. Wang, Y., Wang, Z. Efficient backsplicing produces translatable circular mRNAs. RNA. 21, (2), 172-179 (2015).
  41. Yang, Y., Wang, Z. Constructing GFP-Based Reporter to Study Back Splicing and Translation of Circular RNA. Methods in Molecular Biology. 1724, 107-118 (2018).
  42. Zheng, Q., et al. Circular RNA profiling reveals an abundant circHIPK3 that regulates cell growth by sponging multiple miRNAs. Nature Communications. 7, 11215 (2016).
  43. Jia, W., Xu, B., Wu, J. Circular RNA expression profiles of mouse ovaries during postnatal development and the function of circular RNA epidermal growth factor receptor in granulosa cells. Metabolism. 85, 192-204 (2018).
  44. Liang, D., et al. The Output of Protein-Coding Genes Shifts to Circular RNAs When the Pre-mRNA Processing Machinery Is Limiting. Molecular Cell. 68, (5), 940-954 (2017).
  45. Legnini, I., et al. Circ-ZNF609 Is a Circular RNA that Can Be Translated and Functions in Myogenesis. Molecular Cell. 66, (1), 22-37 (2017).
  46. Li, X., et al. Coordinated circRNA Biogenesis and Function with NF90/NF110 in Viral Infection. Molecular Cell. 67, (2), 214-227 (2017).
  47. Zhang, Y., et al. The Biogenesis of Nascent Circular RNAs. Cell Reports. 15, (3), 611-624 (2016).
Bruk av <em>Alu</em> Element som inneholder minigenes å analysere sirkulære RNAs
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Welden, J. R., Pawluchin, A., van Doorn, J., Stamm, S. Use of Alu Element Containing Minigenes to Analyze Circular RNAs. J. Vis. Exp. (157), e59760, doi:10.3791/59760 (2020).More

Welden, J. R., Pawluchin, A., van Doorn, J., Stamm, S. Use of Alu Element Containing Minigenes to Analyze Circular RNAs. J. Vis. Exp. (157), e59760, doi:10.3791/59760 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter