Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Høy tetthet DNA og RNA Microarrays-Photolithographic syntese, hybridisering og utarbeidelse av store nukleinsyre acid Libraries

Published: August 12, 2019 doi: 10.3791/59936

Summary

I denne artikkelen presenterer vi og diskutere nye utbygginger i syntese og anvendelser av nukleinsyre acid Microarrays fabrikkert in situ. Nærmere bestemt viser vi hvordan protokollene for DNA-syntese kan utvides til RNA og hvordan Microarrays kan brukes til å lage hentes nukleinsyre yre biblioteker.

Abstract

Foto litografi er en kraftig teknikk for syntese av DNA-oligonukleotider på glass sklier, da den kombinerer effektiviteten til phosphoramidite koplings reaksjoner med presisjonen og tettheten av UV-lys som reflekteres fra mikrometer speil. Foto litografi gir Microarrays som kan romme fra hundretusener opp til flere millioner forskjellige DNA-sekvenser, 100-NT eller lengre, på bare noen få timer. Med denne svært store sekvensen plass, Microarrays er ideelle plattformer for å utforske mekanismer for nukleinsyre acid · ligand interaksjoner, som er spesielt relevant i tilfelle av RNA. Vi har nylig rapportert om utarbeidelse av et nytt sett med RNA-phosphoramidites som er kompatible med in situ Foto litografi og som senere ble brukt til å dyrke RNA-oligonukleotider, homopolymers samt blandede base sekvenser. Her illustrerer vi i detalj prosessen med RNA Microarray fabrikasjon, fra eksperimentell design, til instrumental oppsett, array syntese, deprotection og endelig hybridisering analysen ved hjelp av en mal 25mer sekvens som inneholder alle fire baser som et eksempel. Parallelt går vi utover hybridisering eksperimenter og utnytter Microarray Foto litografi som en billig gateway til komplekse nukleinsyre acid biblioteker. For å gjøre dette, er høy tetthet DNA Microarrays fabrikkert på en base-sensitive monomer som gjør at DNA å være beleilig kløyvde og hentes etter syntese og deprotection. Den fabrikasjon protokollen er optimalisert for å begrense antall syntetiske feil og at effekten, et lag av β-karoten løsning er innført for å absorbere UV fotoner som kan ellers reflektere tilbake på syntese underlag. Vi beskriver i en trinnvis måte den komplette prosessen med biblioteks forberedelser, fra design til kløft og kvantifisering.

Introduction

Den praktiske bruken av DNA-Microarrays har tradisjonelt vært i studiet av variasjonene i gen uttrykks nivåene mellom to celle populasjoner, ved hjelp av komplementære tråder og fluorescens som deteksjons metode1. Av og til DNA Microarrays venture i bindende hendelser med ikke-nukleinsyre acid ligander, slik som proteiner, med en strategi for systematisk sekvens permutasjon som gir en omfattende oversikt over bindings landskapet2,3, 4,5. Denne tilnærmingen forvandler effektivt Microarrays fra bare hybridisering overflater til plattformer med bred sekvensdekning, noe som ville være et aktivum for studiet av den rikere og mer komplekse verden av RNA struktur og funksjon. Støttet av ekstremt effektiv phosphoramidite kopling reaksjon6, in SITU syntetisert DNA arrays kan nå også betraktes som en billig kilde til DNA7, som blir spesielt relevant med tanke på stadig økende etterspørsel etter nukleinsyre yre materiale for gen montering8,9, DNA-basert nanostrukturer10, informasjonslagring eller sekvensering11,12. På samme måte vil sekvensering teknologier trolig dra nytte av utviklingen av metoder som gir svært komplekse blandinger av RNA oligonukleotider13. I denne konteksten, array fabrikasjon protokoller som gjør det mulig for oligonukleotider å bli syntetisert in situ og ved høy tetthet er ideelt plassert for å møte behovene til den raskt voksende feltet av nukleinsyre acid bioteknologi. Men med et felt så forskjellige som bioteknologi, kan formålet med hvert program kreve at DNA på Microarray produseres enten ved høy gjennomstrømming eller med en svært lav mengde syntetiske feil14,15, eller begge, som krever en nærmere titt på syntese protokoller av DNA Microarrays som historisk har vært primært optimalisert for hybridisering analyser. I mellomtiden, in situ syntese av RNA Microarrays har blitt funnet å være en utfordrende forsøke, med de fleste av vanskelighetene forbundet med å beskytte gruppen for 2 '-OH funksjon, vanligvis en silyl moiety i standard solid-fase syntese som er fjernet med fluor reagenser, kjemikalier som ikke er kompatible med glass eller silisium overflater. De spørsmål og utfordringer i DNA og RNA Microarray syntese har i det siste vært gjenstand for en stor kropp av arbeid, særlig med foto litografi tilnærming16.

Foto litografi bruker UV-lys for å oppheve oligonukleotider før kopling og krever masker for å konstruere et mønster av UV-eksponering, og dermed romlig organisering og kontrollere veksten av oligonukleotider. Fysiske masker har blitt erstattet av datastyrte micromirrors hvis vippe selektivt reflekterer UV lys på Microarray underlaget17,18,19. Som en UV-kilde, bruker vi 365 NM lys fra en høyeffekts LED-kilde20. Nåværende photolithographic oppsett er utstyrt med Micromirror Device arrays inneholder 1024 × 768 speil, tilsvarende mer enn 780 000 individuelt adresserbart flekker ("funksjoner") på et lite område på bare 1,4 cm2, eller 1080p med matriser av 1920 × 1080, eller > 2 millioner speil. Hver av speilene i enheten har derfor direkte kontroll over sekvensen vokst på tilsvarende funksjon. Med unntak av UV-lys, foto litografi funksjoner som en solid fase syntese teknikk og vedtar syklus BAS ert phosphoramidite kjemi. Bare det krever en helt annen beskyttelses strategi for RNA-syntese for å lykkes. Vi utviklet en ny serie med lysfølsomme RNA-phosphoramidites som lager hydrazin-labilt som beskytter grupper21. Disse monomerer gjør det mulig for RNA-er å bli deprotected under milde forhold som ikke påvirker integriteten til overflaten. Et første deprotection trinn bruker triethylamine til å fjerne cyanoethyl phosphodiester beskytte grupper, mens hydrazin brukes i et sekund, separate trinn for å fjerne dem på 2 '-OH og exocyclic Amin funksjoner. Dermed kan RNA oligonukleotider ~ 30-NT i lengde og en hvilken som helst sekvens nå bli syntetisert in situ på Microarrays22,23. Parallelt, vi har også nylig begynt å ta opp spørsmål om gjennomstrømning, kvalitet og hastighet i DNA og RNA Foto litografi. Vi målte koblings effektiviteten > 99% for alle DNA-og RNA-amidites (figur 1) og undersøkte hvert enkelt trinn i oligonukleotid forlengelse syklus, fra oksidasjons tid, til valg av Aktivator og til optimal UV-eksponering24 , 25. we har brakt inn nye lysfølsomme 5 ' beskytte grupper som kan fjernes i løpet av sekunder, transformere syntesen av hundretusenvis av 100mers i et par timer lang prosess26. Vi har også doblet gjennomstrømningen av array fabrikasjon ved å utsette to underlag samtidig27. Til slutt har vi innført en dT phosphoramidite som inneholder en base-sensitiv succinyl gruppe som en praktisk måte å holde, samle og analysere DNA og RNA oligonukleotider, som er sentralt i biblioteks forberedelser28.

Til tross for den relativt kjedelige aspektet av DNA og RNA solid-fase syntese, spesielt for nukleinsyre yre kjemikere, Microarray Foto litografi fortsatt en ikke-triviell oppgradering krever et komplekst oppsett, nøye kontroll og tilsyn med prosessen, og separate instruksjoner for post-syntetisk håndtering avhengig av arten av oligonukleotid og type søknad. I denne artikkelen ønsker vi å gi en detaljert presentasjon av hele steg-for-steg prosedyre av in situ syntese av DNA og RNA Microarrays av foto litografi, fra eksperimentell design til dataanalyse, med vekt på utarbeidelse av instrumenter og forbruksvarer. Deretter beskriver vi de post-syntetiske deprotection metodene som samsvarer med det tiltenkte formålet med Microarray fabrikasjon (dvs. enten hybridisering eller utvinning av nukleinsyre syre biblioteker).

Protocol

1. Microarray design

  1. Skriv sekvensene som skal syntetisert i et tekstredigeringsprogram, 5 ' → 3 ', én linje per sekvens. For kvalitetskontroll 25mer, bruk sekvensen "GTCATCATCATGAACCACCCTGGTC". Bruk A-, C-, G-og T-bokstaver for DNA-nukleotider og 5, 6, 7 og 8 tall for RNA-nukleotider.
  2. Når det gjelder biblioteket forberedelse, legge til et ekstra tall (dvs. 9) på 3 ' slutten av hver sekvens. Dette vil tilsvare koplingen av den base følsomme monomer.
  3. Hver sekvens må etterfølges av et komma. Tildel et navn til hver sekvens etter kommaet, og kontroller at hvert kjørefelt følger formatet [Sequence, #sequence_name] (uten parenteser). Lagre listen over sekvenser som en txt-fil.
  4. Start MatLab deretter laste programmet ChipDesign. m. Kjør programmet.
  5. Last inn Microarray EntireChip layout-filen i egenskaps panel vinduet. Belaste det MilliChip layout arkiv hvis målet er å syntetisere det hel oppstille for fire identisk plasseringene.
  6. I egenskaps panel vinduet, under chip-spesifikasjon, velger du Velg beholder og deretter syntese området. Under mønstervelger du mønsteret som gir riktig mengde adresserbare funksjoner, og teller antall sekvenser × antall replikeres. For kvalitetskontrollen 25mer, Velg 25:36-mønsteret.
  7. Velg fiducialunder Velg beholder. Fiducial funksjoner er vanligvis syntetisert i hjørnene av syntese området og brukes til å trekke ut hybridisering data. Med fiducial valgt, skriver en sekvens (5 ' → 3 ') som vil bli syntetisert på fiducial funksjoner og som kan fungere som en positiv kontroll. For 25mer eksperimentet, bruk samme DNA sekvensen.
  8. Under sekvenslaster du inn tekstfilen som inneholder alle skrevne sekvenser. Kontroller at det er merket av for tilfeldig . Gi en tittel til eksperimentet i prosjekttittel og, i linker Sequence, skrive TTTTT (tilsvarende en T5 linker).
  9. Trykk Generer, deretter finne array design filer og masker (figur 2) under MaskGen_delta_rc1/design mappe. Kontroller at den inneholder et visnings skript, en flyt sekvens og en utformings fil.
  10. Når du skal klargjøre biblioteket, åpner du skjerm skriptet. Legg til en ekstra linje nederst i skjerm skriptet som kopierer nøyaktig den første linjen i skriptet (for eksempel Vis First_Mask. bmp 150). Dette vil fjerne Terminal photoprotecting gruppe på 5 ' slutten av alle oligonukleotider.
  11. Start Job Creator AutoJob programmet, laste en mal ved å klikke på Last mal, og klikk deretter på skjerm skript for å laste skjerm skriptfilen som ble generert av MatLab. Trykk Generer. Dette trinnet vil skape en rekke instruksjoner, kalt en jobfile, som vil kontrollere kommunikasjonen av datamaskinen med micromirrors og DNA synthesizer.

2. Slide forberedelse og funksjonalisering

  1. Bor ett lysbilde på to posisjoner som tilsvarer plasseringen av innløpet og utløps slangen på syntese cellen. Bruk en 0,9 mm diamant bit på en CNC-ruter for å bore presist og pålitelig. Skyll de boret lysbildene med ultrarent vann og ordne dem i en sklie rack.
  2. Rengjør overflatene ved å sonikere lysbildene i et vannbad som inneholder 5% av et ammoniakk-basert spesielt formål renere i 30 min ved 35 ° c. Skyll lysbildet med dobbel destillert H2O og Overfør dem i et rent, tørt rack.
  3. Ordne boret og uten boring mikroskop lysbilder i en lysbilde rack. I en stor gradert sylinder klargjør du den funksjonalisering løsningen ved å blande 475 mL etanol (EtOH) med 25 mL ddH2O, 10 g silanizing reagens (N-(3-triethoxysilylpropyl) -4-Hydroxybutyramide) og 1 ml eddiksyre. Rør godt til homogen deretter overføre i en egnet, lukket container.
  4. Plasser det lastede stativet i beholderen, Lukk lokket og la beholderen klippe forsiktig på en orbital shaker i 4 timer ved romtemperatur.
  5. Etter 4 h, kast den funksjonalisering oppløsningen og erstatt den med 500 mL vaskeløsning, bestående av 475 mL EtOH, 25 mL ddH2O og 1 ml eddiksyre. Agitere langsomt i 20 minutter ved romtemperatur, deretter kastes og erstattes med 500 mL fersk vaskeløsning.
  6. Etter ytterligere 20 min ved romtemperatur, kast oppløsningen, tørk lysbildene med en strøm av Argon og kurere dem i en forvarmet vakuum ovn ved 120 ° c. Etter 2 timer, slå av ovnen og vakuumpumpen men la lysbildene under redusert trykk over natten. Deretter tar du ovnen tilbake til atmosfærisk trykk og lagrer lysbildene i en desikator inntil videre bruk.

3. utarbeidelse av syntese reagenser og reaktantene

  1. Ta med det phosphoramidite pulveret (figur 1) fra lagrings temperaturen (-25 eller-45 ° c) til romtemperatur i en desikator.
  2. Når phosphoramidites nådde romtemperatur, oppløse pulveret med et volum av ultra-tørr acetonitril (< 30 ppm H2O) for å nå 30 mm konsentrasjon for standard DNA og RNA-phosphoramidites, og 50 mm for den base-sensitive dt monomer ( biblioteket forberedelse). Legg en liten molekylær sikter bag å felle noen spor av fuktighet.
  3. Forbered en løsning på 1% (w/w) imidazole i DMSO ved oppløsning 11 g av imidazole i 1 L tørr DMSO. Rist godt inntil helt oppløst. Fest løsningen til den ekstra porten på DNA-synthesizer. Dette vil være den eksponeringen løsningsmiddel nødvendig for fullstendig fjerning av 5 ′-photoprotecting gruppe.
  4. For syntese av bibliotekene, utarbeide en løsning på 1% (w/v) β-karoten i diklormetan ved oppløsning 100 mg β-karoten i 10 mL diklormetan. Rist godt i en rav glass flaske og pakk i aluminiumsfolie.

4. forberedelse og overvåking av Microarray syntese.

  1. Rekord temperatur og fuktighet i Microarray fabrikasjon rom og sørge for at DNA-synthesizer er under tilstrekkelig helium trykk.
  2. Slå på UV-LED og kjøleviften. Fest en UV intensitet meter på fokalplanet av innkommende UV-lys og slå den på (Figur 3a).
  3. Start jobfile/Micromirror Device/syntese filer Kontroller programvare (kalt eksperiment reverserer aldring) på datamaskinen. Slå på deretter initialisere Micromirror Device enheten og laste en helt hvit maske fil ved å høyreklikke på DMD, og deretter velge Load Image.
  4. Høyreklikk på UVS-ikonet og velg UV - lukkeren åpen. Les strøm verdien (i mW/cm2) på intensitet måleren og telle 60 s. Etter 60 s, Les strøm verdien igjen og noter ned start-og sluttverdiene. Lukk lukkeren ved å velge UV - lukking og slå av intensitet måleren. Beregn den gjennomsnittlige verdien for UV-intensitet i mW/cm2.
  5. Beregn eksponeringstiden som er nødvendig for å nå en strålende energi av 6 J/cm2 for 5 '-NPPOC PHOTODEPROTECTION (DNA og RNA Microarrays) og 3 J/cm2 for 5 '-BzNPPOC photodeprotection (DNA biblioteker), bare Equation 1 etter forholdet.
  6. I programvaren for DNA-synthesizer oppretter du en sekvens fil i sekvens redigering ved å kopiere og lime inn innholdet i flyt sekvensen som genereres av MatLab. Legg til en ekstra to vasketrinn på 3 ' end (standard syklus brev: "s") for å vaske overflaten av underlag før du går videre til første kopling. Lagre og Eksporter sekvens filen.
  7. I Protokollredigering av Workstation-programvaren oppretter du en protokoll som inneholder en egen syklus oppkalt etter hver av bokstavene og tallene som finnes i sekvens filen (Hvis for eksempel en sekvens fil bare inneholder bokstavene A, C, G og T, må protokoll filen inneholder fire sykluser, kalt A, C, G og T).
  8. Still inn koplings tiden for DNA-phosphoramidites (sykluser A, C, G og T) til 15 s, til 120 s for rU phosphoramidite (syklus 8) og til 300 s for rA, rC og rG phosphoramidites (sykluser 5, 6 og 7). For biblioteks forberedelser setter du koplingen på den base følsomme, spaltbare dT monomer til 2 × 120 s (tabell 1 og tabell 2).
  9. Kontroller at ventetiden mellom to hendelse 2 ut kommunikasjons hendelser i hver syklus TILSVARER beregnet UV eksponeringstid for å nå den nødvendige strålende energi. Som for sekvensen filen, lagre og eksportere protokollen filen.
  10. I eksperiment reverserer aldring programvare, laste jobben, sekvens og protokoll filer i sine respektive sub-Vinduer klikk deretter Send å sende sekvensen og protokollen filer til DNA synthesizer.
  11. I sekvens filen teller du antall koblinger for hver phosphoramidite.
  12. For å måle det nødvendige volum (i μL) av phosphoramidite løsning som trengs for å utføre hver syntese, multiplisere antall koblinger med 60. Legg 250 μL til hvert volum for sikkerhet og grunning av linjen på DNA synthesizer. Bruk et basis volum på 250 μL for phosphoramidites som bare krever en enkelt kopling.
  13. Overfør løsningen raskt inn i hetteglassene på DNA-synthesizer som tilsvarer port bokstaven/tallet i protokoll syklusene.
  14. Prime portene med phosphoramidite løsninger med 10 førsteklasses pulser hver for å fylle linjene med reagens. Prime acetonitril vaske linje før du fester reaksjons cellen.
  15. For å montere syntese cellen, plasserer en tykk (250 μm) perfluoroelastomer (FFKM) pakning først på kvarts blokk av cellen. Plasser et boret, funksjonalisert mikroskop på toppen av den første pakningen, og kontroller at hullene på lysbildene er koblet til med innløps-og utløps slangen til syntese cellen.
  16. Plasser en ny, tynn (50 μm) polytetrafluoretylen (PTFE) over det boret lysbildet, som omgir de to hullene. Til slutt plasserer et sekund, funksjonalisert men uten boring Slide oppå den andre pakningen (Figur 3B). Plasser en metallramme med 4 skruer oppå den monterte cellen med dobbelt substrat, og stram skruen til den samme stramme kraften (0,45 nm) med en dreiemoment skrutrekker.
  17. Fest innløps-og utløps slangen til DNA-synthesizer. Prime den acetonitril vaske linjen og kontroller riktig strøm av acetonitril (ACN) gjennom underlaget. Demonter og Monter igjen cellen hvis en eventuell lekkasje av ACN kan observeres på dette stadiet. Målvolumet av ACN på avfalls linjen etter å ha gått gjennom 7 sykluser med ACN-grunning. Dette volumet bør være 2 mL.
  18. Fest syntese cellen på fokalplanet av innkommende UV-lys. I tilfelle av biblioteket forberedelse, feste en ekstra innløp og utløp linje til baksiden av cellen og fylle bak kammeret med β-karoten løsning (2 mL oppløsning er tilstrekkelig). Kontroller at det ikke er lekkasje (Figur 3C).
  19. Start syntese ved først å klikke på Kjør i eksperiment reverserer aldring programvare. Ved første WAIT-kommando i jobb filen, trykker du på Start på DNA-synthesizer.
  20. Under syntese, regelmessig verifisere at visningen av masken filer sammenfaller med UV-eksponering og åpning av lukkeren.
  21. Etter syntese av regelmessige Microarrays, koble cellen fra synthesizer, demontere cellen og bruke en diamant penn til å etse syntese tall på glass lysbilder. Etse tallet på det ikke-syntetisert ansiktet til hvert lysbilde. Overfør lysbildene til 50 mL sentrifugerør og oppbevares i et desiccated område inntil videre bruk.
  22. Etter syntese av biblioteket Microarrays, først tappe β-karoten løsning ut av kammeret deretter vaske det ved å strømme 2 × 5 mL CH2CL2, deretter avløp. Fortsett med demontering som per trinn 4,21. Syntetisert Array kan være synlig for det blotte øye (Figur 4).

5. DNA Microarray deprotection

  1. Fyll en farge glas krukke med 20 mL EtOH og 20 mL etylendiamin (EDA). Plasser kun DNA-Microarrays vertikalt i glasset, Lukk lokket og la lysbildene deprotect i 2 timer ved romtemperatur.
    FORSIKTIG: EDA er en akutt giftig, etsende og brannfarlig væske. Arbeid med hansker i en godt ventilert avtrekks hette.
  2. Etter 2 h, hente lysbildene ved hjelp av pinsett og skyll dem grundig med dobbel-destillert H2O.
  3. Tørk lysbildene i en Microarray sentrifuge i noen sekunder, og lagre i en desikator.

6. RNA Microarray deprotection

  1. I et 50 mL sentrifugerør, klargjør du en tørr løsning av 2:3 triethylamine/ACN (20 mL og 30 mL av hver, henholdsvis). Overfør en RNA Microarray Slide inn i sentrifuge røret, Lukk lokket og pakk med plast tetnings film. Rist sentrifuge røret forsiktig på en orbital shaker for 1h og 30 min ved romtemperatur.
  2. Etter 1h og 30 min, Fjern raset, vask med 2 × 20 mL tørr ACN deretter tørke i en Microarray sentrifuge i noen sekunder.
    FORSIKTIG: Triethylamine er en akutt giftig, etsende og brannfarlig væske. Acetonitril er giftig og brannfarlig. Arbeid med hansker i en godt ventilert avtrekks hette.
    Merk: første deprotection trinnet er fullført.
  3. Forbered en 0,5 M hydrazin hydrat oppløsning i 3:2 pyridine/eddiksyre. Bland først 20 mL eddiksyre og 30 mL pyridine i en gradert sylinder. Vent til løsningen avkjøles før du legger til 1,21 mL hydrazin hydrat. Overfør rundt 40 mL av den resulterende oppløsningen til et 50 mL sentrifugerør.
    FORSIKTIG: Hydrazin hydrat er en akutt giftig og etsende væske. Pyridine er svært brannfarlig og akutt giftig. Eddiksyre er brannfarlig og etsende. Arbeid med hansker i en godt ventilert avtrekks hette.
  4. Etter det første deprotection trinnet overfører du RNA-lysbildet til den hydrazin hydrat oppløsningen, lukker lokket og brytes med plast tetnings film. Rist slangen forsiktig på en orbital shaker for 2 timer ved romtemperatur. Etter 2 timer, Fjern raset, vask med 2 × 20 mL tørr ACN deretter tørke i en Microarray sentrifuge i noen sekunder.
    Merk: det andre deprotection trinnet er fullført.
  5. Hvis RNA-Microarray også inneholder DNA-nukleotider, fortsetter du med et tredje deprotection trinn. I et 50 mL sentrifugerør, bland 20 mL av EDA med 20 mL EtOH. Legg DNA/RNA-Microarray til 1:1 EDA/EtOH-løsningen og la det ligge i romtemperatur i 5 minutter.
  6. Etter 5 min, Fjern raset, vask med 2 × 20 mL sterilt vann og tørk i en Microarray sentrifuge og oppbevar i en desikator.

7. hybridisering med en fluorescensmerkete-merket komplementær tråd

  1. Tin acetylert i storfe serum albumin (10 mg/mL) og Cy3-merket komplementær strand (100 nM) og varm opp til romtemperatur.
  2. I et 1,5 mL sterilt mikrosentrifugen rør, bland 150 μL av 2x MES buffer (200 mM 2-(N-morpholino) ethanesulfonic syre; 1,8 M NaCl; 40 mm EDTA; 0,02% mellom-20) med 26,7 μL av Cy3-merket DNA, 13,4 μL av acetylert BSA og 110 μL av steril H2O. Bland og Vortex. Doble volumet hvis begge lysbildene skal brukes til hybridisering.
  3. Pre-Warm en hybridisering ovn til en temperatur under Tm av duplex, men høy nok til å sikre god diskriminering mellom full-match og ikke-match sekvenser. For kvalitetskontroll 25mer, Still inn temperaturen til 42 ° c (Tm på 59 ° c).
  4. Forsiktig plassere en selvklebende 300 μL hybridisering kammer over syntese området på hvert lysbilde og Pipet i hybridisering løsning utarbeidet ovenfor. Dekk hullene i kammeret med selvklebende prikker og pakk hele lysbildet i aluminiumsfolie.
  5. Plasser Microarray glir inn i hybridisering ovnen, dekk og la den forsiktig rotere ved den valgte hybridisering temperatur for 2 t.
  6. Etter 2 h, løsne raset, Fjern aluminiumsfolie og forsiktig rive av hybridisering kammeret. Overfør lysbildene til et sentrifugerør som inneholder 30 mL ikke-strenge vaske buffer (NSWB; 0,9 M NaCl, 0,06 M fosfat, 6 mM EDTA, 0,01% Tween20, pH 7,4) og rist kraftig i 2 minutter ved romtemperatur.
  7. Overfør lysbildet til et sentrifugerør som inneholder 30 mL streng vaske buffer (SWB; 100 mM MES, 0,1 M NaCl, 0,01% Tween20) og rist kraftig i 1 min.
  8. Til slutt overfører du lysbildet til et sentrifugerør som inneholder 30 mL av Final Wash buffer (FWB; 0,1 x natrium saltvann citrate) og rister i noen sekunder. Tørk lysbildet i en Microarray sentrifuge.
  9. Plasser den tørre Microarray, syntese området vendt ned, i lysbilde holderen til Microarray skanneren. For Cy3-merket duplexes, skann ved 5 μm oppløsning med en 532 nm eksitasjon bølgelengde, et 575 NM filter og en photomultiplier på 350. Lagre skanningen med høy oppløsning som en TIF-bildefil (figur 5a).

8. data utvinning og analyse

  1. Før data utvinning, Roter lagret array skanning i et bilderedigeringsprogram slik som å situate den lengste kjeden av fiducial funksjoner i øvre venstre hjørne av skanningen. Lagre det roterte bildet.
  2. Start NimbleScan, og trykk deretter på fil | Åpne og Last inn array Scan. Deretter laster du inn filen ved å klikke Bla gjennom i avsnittet utformings fil. NDF design fil som ble automatisk generert under utformingen av Microarray eksperimentet. Deretter klikker du Åpne.
  3. I visningenklikker du automatisk kontrast/lysstyrke. Klikk på ikonet manuelt justere over skanningen. Plasser fire firkantede markører i de fire hjørnene av skanningen, og klikk deretter på det nå grønne ikonet igjen. Pakk ut hybridisering data ved å klikke på analyse, rapporter deretter sonde rapport.
  4. Åpne. sonde rapportfil i et regneark redigeringsprogram. Behold kolonne B og jeg, og Forkast resten før du fortsetter med å beregne gjennomsnittsverdier og standardavvik fra de utpakkede dataene (figur 5B).

9. bibliotek deprotection, kløft og utvinning

  1. For å deprotect og holde på DNA-bibliotekene, klargjør du en løsning av 1:1 Dry EDA/toluen i et 50 ml sentrifugerør. Dypp glidebryteren inn i kløften, Lukk glidebryteren og pakk med plast tetnings film, deretter forsiktig rotere i en orbital shaker for 2 t ved romtemperatur.
  2. Etter 2 timer, Fjern raset og vask med 2 × 20 mL omhyggelig tørre ACN. Fjern lysbildet og la det lufttørke.
  3. Med en pipette påføres 100 μL av steril H2O over det nå merkes syntese-området. Pipet løsningen opp og ned et par ganger før du overfører den til en 1,5 mL mikrosentrifugen tube. Gjenta prosessen og Kombiner Microarray eluatet i samme rør (figur 6).
  4. Fordampe de 2 × 100 μL av chip eluatet til tørrhet deretter redissolve inn 10 μL av nuklease-fri H2O. mål absorbansen på en UV-Vis spektrofotometer.
  5. Avsalte DNA-biblioteket på en 10 μL pipette-tupp utstyrt med C18 harpiks. Først transformere chip eluatet i en 0,1 M triethylammonium acetate (TEAA) bufret løsning.
  6. Fukt harpiks av håpefulle 3 x 10 μL av H2O/ACN 1:1, og likevekt harpiks ved vasking med 3 x 10 ΜL 0,1 M TEAA buffer. Bind DNA ved å pipettering chip eluatet 10 ganger opp og ned gjennom harpiks. Vask harpiks med 3 x 10 μL av 0,1 M TEAA buffer, 3 x 10 μL av H2O.
  7. Eluere avsalte DNA fra spissen ved å vaske harpiks med 10 μL av H2O/ACN 1:1. Tørk den avsalte oppløsningen ned og redissolve inn i 10 μL av steril H2O. mål absorbansen på en UV-Vis spektrofotometer (figur 7). Fordampe biblioteket til tørrhet og oppbevar ved-20 ° c til videre bruk.

Representative Results

DNA og RNA Microarray hybridisering
Figur 5 viser resultatene av en hybridisering analysen utført på en Microarray som inneholder DNA og RNA versjoner av en 25mer sekvens (5 '-GTCATCATCATGAACCACCCTGGTC-3 ' i DNA form). Skanningen i figur 5a vises i et greenscale format som tilsvarer eksitasjon/utslipps spekteret til Cy3 fluorescens, med fluorescens intensitet innspilt i vilkårlige enheter mellom 0 og 65536. Array-designen fulgte oppsettet av 25:36-funksjonen som er beskrevet i protokoll delen. Skanningen vises etter riktig orientering av matrisen, med øvre venstre hjørne befolket med den lengste kjeden av fiducial funksjoner. Her, fiducial funksjoner inneholder DNA-versjon av 25mer og bør i prinsippet alltid gi et positivt fluorescens signal for å utføre skanning justering og data utvinning. Den hybridisert Microarray skal fremstå jevnt lys, med kantene av syntese området er imidlertid vanligvis lysere enn sentrum (opptil 50% lysere). Den store mengden sekvens replikerer, tilfeldig fordelt over hele området, reduserer virkningen av romlige gjenstander. Her ble hver sekvens (DNA og RNA) syntetisert på 2 000 tilfeldige steder. Det er vanligvis lav fluorescens støy (bakgrunn), < 50 a.u., noe som fører til et signal/støy-forhold i størrelsesorden 200:1 til 800:1 i hybridisering analyser. Etter uttrekking av data er fluorescens intensitet i gjennomsnitt og plottet ± SD.

Det er betydelig variasjon i absolutte fluorescens verdier mellom eksperimenter. Her viser vi resultatene for tre uavhengige synteser som bruker de samme produksjonsparametrene og den samme post-syntetiske håndteringen. Den 25mer DNA, når hybridisert til sin komplementære Cy3-merket DNA strand, vil gi fluorescens signaler som spenner alt fra 20 000 til 30 000, svært sjelden over eller under. 25mer RNA, når den hybridisert til samme Cy3-merket DNA-komplement, vil gi fluorescens intensitet på de tilsvarende funksjonene som spenner fra 15 000 til 20 000. Imidlertid vil fluorescens intensitet av RNA/DNA-duplexes av og til falle under 8 000, når tilsvarende DNA/DNA-duplexes fortsatt vil fluorescerer innenfor 20000-30000-serien. I slike tilfeller kan resultatene for RNA betraktes som sub-optimale. En syntese eller hybridisering svikt, enten for DNA eller RNA, vil være umiddelbart merkbar under skanning fra den åpenbare mangelen på fluorescens. Det er flere muligheter for RNA-syntese til enten mislykkes eller delvis lykkes, og de vil bli skissert i diskusjonen delen.

Bibliotek deprotection, kløft og utvinning
Avhengig av kompleksiteten og tettheten av biblioteket, form og omrisset av syntetisert Array kan sees uten forstørrelse, men under riktig belysning (Figur 4), med DNA fortsatt i beskyttet form. Etter deprotection med EDA/toluen, og før tilsetning av vann for å samle inn kløyvde biblioteket, kan syntese området som inneholder den nå deprotected oligonukleotider skiller seg ut som en hydrofile sone, når resten av glasset lysbildet vises dekket med et grumsete hydrofobe lag. Den direkte observasjon av syntese området avhenger av det totale arealet som brukes til å syntetisere oligonukleotider: større bruk av syntese området vil tilsvare en større sjanse for klart skille mellom hydrofile og hydrofobe regioner på overflaten. I motsatt fall kan bibliotekene syntetisert med færre speil og med mindre funksjoner ikke umiddelbart Observer.

Tilsvarende mengden gjenvunnet DNA etter avsaltingsspisser overlegne sammenlignet er direkte proporsjonal med det totale arealet som brukes for syntese. Hvis alle funksjoner brukes for oligonukleotid syntese, bør kløften og utvinning prosedyren gir mellom 25 og 30 pmol av DNA. En 10% bruk av syntese området vil derfor ha råd til bare rundt 3 pmol av DNA.

Figure 1
Figur 1 . Kjemiske strukturer av DNA og RNA phosphoramidites brukes i oligonukleotid syntese ved Microarray Foto litografi. Standard nitrophenylpropyloxycarbonyl (NPPOC) fotosensitive beskytte grupper ved 5 '-OH brukes i vanlig DNA og RNA Microarray syntese for hybridisering formål. For syntese av komplekse DNA-biblioteker, jo mer photolabile benzylalkohol-NPPOC (BzNPPOC) foretrekkes på 5 '-OH, som BzNPPOC er fjernet dobbelt så fort som NPPOC, som i betydelig grad reduserer total Microarray syntese tid. DNA oligonukleotider for bibliotekene krever også kobling av en spaltbare dT monomer på 3 ' end. Denne monomer, hvilke bærer en succinyl Ester funksjonen, ville være kløyvde i løpet av deprotection, tillater for det DNA å bli avhentet fra det microchip. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2 . Eksempel på en maske som en bildefil som sendes til den Micromirror Device enheten under UV-eksponering. De hvite pikslene tilsvarer speil som vil bli vippet i "" posisjon, noe som reflekterer UV-lys på syntese cellen. Svarte piksler tilsvarer "av" speil, der UV-lyset vil bli reflektert vekk fra cellen. Hvite piksler vil derfor tillate kobling av neste innkommende phosphoramidite på oligonukleotider som finnes på de tilsvarende funksjonene på glass underlag. Oligonukleotider syntetisert på funksjoner som tilsvarende speil er, i denne masken filen, svarte piksler vil imidlertid forbli inert under neste kopling hendelsen. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3 . Fotografier av Microarray Foto litografi optisk og syntese oppsett. (A) optisk KRETS for UV-eksponering. UV-lys fra UV-LED er først homogenisert gjennom en rektangulær-tverrsnitt lysrør deretter reflekterer over micromirrors. Micromirrors som har blitt vippet inn i en "OFF" posisjon vil reflektere UV-lys bort fra syntese cellen, men Micromirrors i "ON" posisjon vil reflektere lys på syntese cellen, som ligger på fokalplanet, ved først å passere gjennom en 1:1 Offner Relay bilde systemet. (B) syntese cellen, en gang montert, består av en boret lysbilde plasseres først på kvarts blokk av cellen, atskilt av en tykk PTFE pakning (ikke vist). Et annet, ikke-boret lysbilde er deretter plassert over boret lysbildet, adskilt av en tynn PTFE pakning. En metallramme (ikke vist) holder forsamlingen sammen. (C). for bibliotek forberedelse, når syntesen cellen er festet på fokalplanet av innkommende UV-lys, kammeret ligger mellom kvarts blokken og boret lysbildet er fylt med en 1% løsning av β-KAROTEN i ch2CL2. For å gjøre dette, en ekstra innløps-og utløps slange er festet til kvarts blokken og den oransje løsningen renner fra høyre til venstre posisjon. Flyten av reagenser og løsemidler for syntesen er vist i hvite piler. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4 . Syntese området er vanligvis synlig for det blotte øye. Her kan et DNA-bibliotek sees på glassflaten rett etter syntese, med DNA fortsatt i beskyttet form. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 5
Figur 5 . Hybridisering analyser til 25mer DNA og RNA sekvenser syntetisert in situ på Microarrays. (A) fluorescens skanning av hele hybridisert DNA og RNA Microarray. 25mer DNA-og RNA-oligonukleotider er hybridisert til deres Cy3-merkede komplementære tråder. Matrisen ble skannet med en laser på en 532 nm eksitasjon bølgelengde, ved 5 μm oppløsning. (B) fluorescens intensitet (vilkårlige enheter) av DNA: DNA og RNA: DNA-duplexes i tre separate eksperimenter. De lys grønne dataene for in situ syntetisert RNA-oligonukleotider kan betraktes som suboptimal, sammenlignet med den fluorescens intensiteten til de tilsvarende DNA-sekvensene. Feilfelt er SD. please Klikk her for å se en større versjon av dette tallet.

Figure 6
Figur 6 . Skjematisk fremstilling av deprotection, kløft og gjenvinnings prosedyre for DNA-bibliotekene syntetisert på Microarrays. DNA-sekvenser dyrkes på en base-følsom Spaltbare dt nukleosid (vist i zoomet området). Etter syntese er deprotection av DNA-oligonukleotider (base beskytte grupper representert som røde sfærer) i EDA/toluen etterlater deprotected materialet elektrostatisk bundet til overflaten og kan deretter Pipet tert ut ved å påføre en liten mengde vann på syntetisert området. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 7
Figur 7 . Representative absorbansen spektrum (220-350 Nm) av en kløyvde, avsalte DNA bibliotek som inneholder 4 000 forskjellige sekvenser, 100-NT i lengde. Totalt 940 ng av DNA ble isolert fra en enkelt array syntese, tilsvarende 30 pmol av DNA totalt, eller 15 pmol per glass substrat. Vennligst klikk her for å se en større versjon av dette tallet.

Table 1
Tabell 1. Representativ syklus protokoll for kopling/oksidasjon/photodeprotection av 5 '-BzNPPOC-da, forutsatt at tilsvarende phosphoramidite ble lastet på port "A". Koplings tiden (i sekunder) vises på "par monomer"-linjen. UV photodeprotection tid, her tilsvarer en strålende energi av 3 J/cm2 (BzNPPOC fotokjemi), beregnes som tiden gått mellom de to "Event 2 ut" kommunikasjons signaler.

Table 2
Tabell 2. Representativ syklus protokoll for kopling/oksidasjon/photodeprotection av 5 '-NPPOC-rA, forutsatt at den KORRESPONDERENDE RNA-phosphoramidite ble lastet på port "A". Koplings tiden (i sekunder) vises på "par monomer"-linjen. UV photodeprotection tiden, her tilsvarer en strålende energi av 6 J/cm2 (NPPOC fotokjemi), beregnes som tiden gått mellom de to "Event 2 ut" kommunikasjons signaler.

Discussion

Solid-fase DNA og RNA syntese er brødet og smør av hver nukleinsyre acid kjemi lab, og selv om tillegg av foto litografi komponenten er riktignok en kompleks operasjon, Microarray fabrikasjon formidlet av UV-lys er også en svært pålitelig prosess . Det er i tillegg den eneste tilgjengelige metoden for in situ RNA syntese på Microarrays. Likevel, som i alle multi-Stage eksperimentell prosedyre, det er god plass for menneskelig feil.

Kanskje den mest kritiske trinnet er koblingen av en phosphoramidite, som det er behov for å være en stadig høy gir kjemisk reaksjon for å ha råd til oligonukleotider med få syntetiske feil. I vår Microarray syntese protokollen, er phosphoramidite kopling enda mer sentral til generell syntese kvalitet siden fabrikasjon prosessen omgår capping og forhindrer oligonukleotid rensing. Trinnvis koblings effektivitet over 99% er beregnet for alle fotosensitive DNA-og RNA-phosphoramidites, selv for svært korte koblingstider (15 s)24 , men lavere koblings kapasitet kan av og til forekomme, spesielt i tilfelle av dG-amidites. Stabiliteten av solubilized phosphoramidites ved romtemperatur har blitt undersøkt før og ble vist å avhenge av arten av nucleobase, med guanosin phosphoramidites utsatt for omfattende degradering i bare et spørsmål om dager29, 30i det. Men da det ble oppbevart ved-25 ° c, ble dG phosphoramidites oppløst i ACN som 30 mM løsning for å være stabile i flere uker. Den relative ustabilitet i dG phosphoramidite løsninger ved romtemperatur betyr imidlertid at de ikke skal holdes festet til DNA-synthesizer i flere dager.

For RNA-phosphoramidites er koplings utbyttet svært avhengig av phosphoramidite kvalitet (som kan vurderes med 31P NMR spektroskopi) og koblingstid. Koblingstider på 5 minutter for rA, rG, rC og 2 min for rU synes nødvendig. Faktisk fant vi ut at forkorte kondens tiden til 2 min for alle RNA phosphoramidites førte til betydelig lavere hybridisering signaler.

Selve DNA-synthesizer, samt reagenser og løsemidler, må absolutt være så rene som mulig for å oppnå høyest utbytte av oligonukleotid syntese. Imidlertid kan uløselig materiale, salter eller partikler, akkumuleres over tid i linjene og slangen i leveringssystemet, noe som fører til en gradvis reduksjon i forbruket av reagenser og reaktantene. Der en generell rengjøring av synthesizer ikke løser et lavt utgangs volum, kan en økning i antall pulser være en alternativ løsning. Spesielt nyttig i tilfelle av lavt phosphoramidite forbruk, kan linjen i koplings protokollen som tilsvarer pumping av en blanding av phosphoramidite og aktivator (tredje linje av koplingen ledd i tabell 1 og tabell 2) være modifisert, fra 6 til 9 pulser uten merkbar negativ effekt på syntese kvalitet. Videre, antall pulser av aktivator som trengs for å bringe amidite/aktivator Mix til syntese substrat (for tiden 6, fjerde linje i koblingen ledd, se tabell 1 og tabell 2) avhenger av DNA synthesizer seg selv så vel som på slange lengden i syntese cellen. Dette tallet kan justeres etter utskifting av phosphoramidite med en farget oppløsning og telling av antall pulser som trengs for å presse den fargede blandingen til glass underlaget for kopling.

Metoden som beskrives her, gjør det mulig for DNA-og RNA-syntese å fortsette samtidig, på samme Microarray. Hybrider av DNA og RNA kan også være forberedt uten noen endring i array fabrikasjon protokoller, og så lenge de tre-trinns deprotection protokollen er fulgt. Det bør imidlertid bemerkes at RNA-bare Microarrays bare krever en to-trinns deprotection: en decyanoethylation først med et3N etterfulgt av hydroksyl og base deprotection med hydrazin. DNA-nucleobases ble funnet å være ufullstendig deprotected under disse forholdene, og trenger ytterligere trinn i EDA for å kunne gjennomføre fullstendig fjerning av phenoxyacetyl (PAC) grupper. Denne ekstra behandlingen med EDA er kortere (5 min) enn for standard deprotection av DNA-Microarrays31, men det er tilstrekkelig å kjøre den til ferdigstillelse etter triethylamine og hydrazin behandlinger. I tillegg begrenser en kort reaksjonstid med EDA eksponeringen av en fullt deprotected RNA-oligonukleotid til grunnleggende forhold.

En fordel med in situ RNA array syntese over alternative metoder som spotting eller DNA transkripsjon32,33,er34 muligheten til å lagre syntetisert RNA microchip i beskyttet form til bruk, og dermed unngå risikoen for potensiell RNA-degradering. Etter syntetiske prosedyrer for RNA betyr derimot at forbruksvarer og reagenser holdes sterile og at håndteringen utføres under RNase-frie forhold. Av notatet, fant vi at tillegg av RNase hemmer til hybridisering Mix ikke gi sterkere hybridisering signaler for RNA funksjoner.

Syntesen av DNA-bibliotekene på en base-følsom monomer er mer kompleks enn syntesen av noen kontroll sekvenser på en overflate, og som sådan er sikkert mer utsatt for design feil. Likevel, forutsatt at sekvensen design (dvs. naturen og antall sekvenser) er riktig, transformere denne listen til en samling av eksponering masker og en organisert serie av kopling sykluser forblir en grei prosess. Imidlertid, betydelig variasjoner fra målestokk Microarray syntese eksisterer og er betenkelig å en heldig fabrikasjon av en høy-tettheten bibliotek oppstille.

Først er en base-følsom dT monomer kombinert som den første phosphoramidite etter syntese av linker. Koblings utbyttet fra denne monomer (figur 1) ble funnet å være relativt lav, rundt 85%28, noe som er grunnen til at arbeidet er gjort for å forbedre sin innlemmelse rate, enten ved å øke konsentrasjonen i ACN fra 30 mm til 50 mm, eller ved å gjenta koplings trinn: to påfølgende koblings reaksjoner ved hjelp av ferske monomerer, eller to separate, men påfølgende koplings sykluser.

Den andre endringen er tilsetning av en β-karoten løsning i bakre kammer av syntese cellen, som beleilig absorberer 365 NM lys. Dette er en viktig modifikasjon av foto litografi oppsett som hindrer UV-lys fra å reflektere tilbake på array underlaget. Faktisk, etter traversering mellomliggende medium mellom underlag, innkommende UV-lys utganger gjennom boret lysbildet og når kvarts blokk av cellen. Den Fresnel ligninger spår at ~ 4% av vinkelrett hendelsen UV-lys vil reflektere fra hver av de tre nedstrøms luft-glass grensesnitt (Exit side av 2nd substrat og begge sider av kvarts blokk) og tilbake på syntese substrat, fører til utilsiktet eksponering av photoprotected oligonukleotider. Diffraksjon og spredning bidrar også til "off-target" photodeprotection og derfor til nukleotid innsetting, som direkte påvirker feilfrekvensen av syntese, men disse bidragene er mye mindre enn refleksjoner og kan i hovedsak bli behandlet av redusere syntese tetthet (forlater gap mellom funksjoner). Vi har funnet at nivået av β-karoten løsning i nedre kammeret av cellen har en tendens til å minske litt bare i løpet av de første minuttene av array syntese, og derfor må overvåkes og justeres.

Til slutt, den tredje endringen er deprotection løsning, erstatter EtOH for toluen, som holder kløyvde DNA biblioteket bundet til overflaten, antagelig gjennom elektrostatisk samhandling. Ved å bruke en liten mengde vann til syntese området etter ACN-vasking, kan biblioteket enkelt samles inn. Prosessen er imidlertid bare vellykket hvis vanninnholdet i EDA og toluen er minimalt, og gjengir nukleinsyre syre helt uløselig i deprotection cocktail. Alternativt kan DNA-bibliotekene være kløyvde av chip ved hjelp av ammoniakk9,10,14,35, deretter ytterligere deprotected ved å varme opp DNA-inneholdende vandig ammoniakk løsning til 55 ° c over natten. Gjenvinning av DNA-bibliotekene ved hjelp av ammoniakk er imidlertid ikke kompatibel med RNA. RNA-oligonukleotider på et base-spaltbare substrat kan eluert fra overflaten ved hjelp av samme EDA/toluen-prosedyre som beskrevet ovenfor, men bare ved den nest siste etappen etter et3N og hydrazin to-trinns deprotection strategi28.

Alternative strategier for å gjenopprette oligonukleotid bassenger fra Microarrays uten behov for en bestemt grunnleggende behandling finnes, er i prinsippet kompatibel med foto litografi og stole på bruk av enzymer. For eksempel kan en enkelt deoxyuracil nukleotid være målet for uracil-DNA-glycosylase (UDG) og excised fra resten av DNA-sekvensen, eller en enkelt RNA-enhet kan gjenkjennes av RNase H type 2-enzymer og phosphodiester Bond 5 ' til RNA-kløyvde , slippe 5 ' DNA del23.

Vi har nå en kraftig, pålitelig og høy tetthet metode for syntese av DNA, RNA, og hybrid DNA/RNA Microarrays. Disse kan ikke bare tjene som plattformer for hybridisering eller bindende analyser36, men de representerer også en rask og rimelig måte å produsere komplekse nukleinsyre acid biblioteker. For DNA-basert digital datalagring, kan Microarray Foto litografi bli en potensiell løsning på "skrive" flaskehalsen (dvs. til koding av informasjon ved syntese). Suksessen i Digital koding på DNA og i de Novo Gene forsamlingen avhenger sekvens troskap som, på syntese nivå, oversettes til feil rate. Syntetiske og optiske feil i våre nåværende array fabrikasjon protokoller vil bli diskutert og rapportert på andre steder. Parallelt er arbeidet nå i gang for ytterligere å øke fabrikasjon skala og gjennomstrømning.

Disclosures

Forfatterne bekrefter at de ikke har noen tilknytning til noen for-profit organisasjon.

Acknowledgments

Dette arbeidet ble støttet av den østerrikske Science Fund (FWF tilskudd P23797, P27275 og P30596) og Swiss National Science Foundation (Grant #PBBEP2_146174).

Materials

Name Company Catalog Number Comments
Slide functionalization
Acetic acid >99.8% Sigma 33209 For RNA deprotection
CNC router Stepcraft 300 CK
Ethanol absolute VWR 1.07017.2511 For deprotection and functionalization
N-(3-triethoxysilylpropyl)-4-hydroxybutyramide Gelest SIT8189.5 Silanizing reagent
Nexterion Glass D microscope slides Schott 1095568
Polymax 1040 Heidolph Orbital shaker
Proclean 507 Ultrasonic water bath Ulsonix To clean slides after drilling
Tickopur RW 77 Special Purpose Cleaner Sigma Z860086 To clean slides after drilling
Microarray synthesis
0.25 M dicyanoimidazole in ACN Biosolve 0004712402BS Activator
0.7 XGA DMD Texas Instruments Digital Micromirror Device
20 mM I2 in pyridine/H2O/THF Sigma L860020-06 Oxidizer
250 μm thick Chemraz 584 perfluoroelastomer FFKM Lower teflon gasket
2'-O-ALE RNA phosphoramidites ChemGenes
365 nm high-power UV-LED Nichia NVSU333A
5'BzNPPOC DNA phosphoramidites Orgentis
5'NPPOC DNA phosphoramidites FlexGen
Acetonitrile Biosolve 0001205402BS For DNA synthesis
Amidite Diluent for DNA synthesis Sigma L010010 For dissolving phosphoramidites
Cleavable dT ChemGenes Base-sensitive monomer for library preparation
DMSO Biosolve 0004474701BS As exposure solvent
DNA and RNA microarray deprotection
Ethylenediamine >99.5% Sigma 3550 For deprotection
Expedite 8909 PerSeptive Biosystems DNA synthesizer
Hydrazine hydrate 50-60% hydrazine Sigma 225819 For RNA deprotection
Imidazole Sigma 56750
Industrial Strength lower-density PTFE tape Gasoila Thin, upper teflon gasket
Pyridine >99% Sigma P57506 For RNA deprotection
Triethylamine >99% Sigma T0886 For RNA deprotection
β-carotene Sigma C9750 For library preparation
Hybridization and scanning
20x Sodium Saline Citrate Roth 1054.1
5'Cy3-labelled complementary strand Eurogentec For duplex hybridization
Biopur Safe-Lock microcentrifuge tube Eppendorf
BSA (10 mg/mL) Promega R3961
EDTA molecular biology grade Promega H5031
GenePix 4100A Molecular Devices Microarray scanner
Hybridization oven Boekel Scientific 230500
MES monohydrate Sigma 69889
MES sodium Sigma M3058
NaCl >99.5% Sigma 71376
SecureSeal SA200 hybridization chamber Grace BioLabs 623503
Spectrafuge mini Labnet C1301 Microarray centrifuge
Tween-20 molecular biology grade Sigma P9416
Data extraction
Excel Microsoft For data extraction
MatLab MathWorks Microarray design
NimbleScan 2.1 Roche NimbleGen
Desalting and quantification
NanoDrop One Spectrophotometer Thermo Scientific
Toluene Merck
ZipTip C18 Millipore ZTC18s008 Desalting pipet tips

DOWNLOAD MATERIALS LIST

References

  1. Bumgarner, R. Current protocols in molecular biology. 101, 22 (2013).
  2. Berger, M. F., Bulyk, M. L. Universal protein-binding microarrays for the comprehensive characterization of the DNA-binding specificities of transcription factors. Nature Protocols. 4, (3), 393-411 (2009).
  3. Tietjen, J. R., Donato, L. J., Bhimisaria, D., Ansari, A. Z. Sequence-specificity and energy landscapes of DNA-binding molecules. Methods in enzymology. 497, 3-30 (2011).
  4. Katilius, E., Flores, C., Woodbury, N. W. Exploring the sequence space of a DNA aptamer using microarrays. Nucleic Acids Research. 35, (22), 7626-7635 (2007).
  5. Franssen-van Hal, N. L. W., et al. Optimized Light-Directed Synthesis of Aptamer Microarrays. Analytical Chemistry. 85, (12), 5950-5957 (2013).
  6. Matteucci, M. D., Caruthers, M. H. Nucleotide Chemistry .4. Synthesis of Deoxyoligonucleotides on a Polymer Support. Journal of the American Chemical Society. 103, (11), 3185-3191 (1981).
  7. Eroshenko, N., Kosuri, S., Marblestone, A. H., Conway, N., Church, G. M. Gene Assembly from Chip-Synthesized Oligonucleotides. Current Protocols in Chemical Biology. 2012, (2012).
  8. Kosuri, S., et al. Scalable gene synthesis by selective amplification of DNA pools from high-fidelity microchips. Nature Biotechnology. 28, (12), 1295 (2010).
  9. Richmond, K. E., et al. Amplification and assembly of chip-eluted DNA (AACED): a method for high-throughput gene synthesis. Nucleic Acids Research. 32, (17), 5011-5018 (2004).
  10. Schmidt, T. L., et al. Scalable amplification of strand subsets from chip-synthesized oligonucleotide libraries. Nature Communications. 6, (2015).
  11. Grass, R. N., Heckel, R., Puddu, M., Paunescu, D., Stark, W. J. Robust Chemical Preservation of Digital Information on DNA in Silica with Error-Correcting Codes. Angewandte Chemie International Edition. 54, (8), 2552-2555 (2015).
  12. Erlich, Y., Zielinski, D. DNA Fountain enables a robust and efficient storage architecture. Science. 355, (6328), 950-953 (2017).
  13. Garalde, D. R., et al. Highly parallel direct RNA sequencing on an array of nanopores. Nature Methods. 15, (3), 201-206 (2018).
  14. Cleary, M. A., et al. Production of complex nucleic acid libraries using highly parallel in situ oligonucleotide synthesis. Nature Methods. 1, (3), 241-248 (2004).
  15. LeProust, E. M., et al. Synthesis of high-quality libraries of long (150mer) oligonucleotides by a novel depurination controlled process. Nucleic Acids Research. 38, (8), 2522-2540 (2010).
  16. Lietard, J., Damha, M. J., Somoza, M. M. Enzymatic and Chemical Synthesis of Nucleic Acid Derivatives. Fernández-Lucas, J. Wiley Online Books. (2018).
  17. Fodor, S. P. A., et al. Spatially Addressable Parallel Chemical Synthesis. Science. 251, (4995), 767-773 (1991).
  18. Singh-Gasson, S., et al. Maskless fabrication of light-directed oligonucleotide microarrays using a digital micromirror array. Nature Biotechnology. 17, (10), 974-978 (1999).
  19. Pease, A. C., et al. Light-Generated Oligonucleotide Arrays for Rapid DNA-Sequence Analysis. Proceedings of the National Academy of Sciences of the United States of America. 91, (11), 5022-5026 (1994).
  20. Holz, K., Lietard, J., Somoza, M. M. High-Power 365 nm UV LED Mercury Arc Lamp Replacement for Photochemistry and Chemical Photolithography. ACS Sustainable Chemistry & Engineering. 5, (1), 828-834 (2017).
  21. Lackey, J. G., Mitra, D., Somoza, M. M., Cerrina, F., Damha, M. J. Acetal Levulinyl Ester (ALE) Groups for 2′-Hydroxyl Protection of Ribonucleosides in the Synthesis of Oligoribonucleotides on Glass and Microarrays. Journal of the American Chemical Society. 131, (24), 8496-8502 (2009).
  22. Lackey, J. G., Somoza, M. M., Mitra, D., Cerrina, F., Damha, M. J. In-situ chemical synthesis of rU-DNA chimeras on chips and enzymatic recognition. Chimica Oggi-Chemistry Today. 27, (6), 30-33 (2009).
  23. Lietard, J., Ameur, D., Damha, M., Somoza, M. M. High-density RNA microarrays synthesized in situ by photolithography. Angewandte Chemie International Edition. 57, (46), 15257-15261 (2018).
  24. Agbavwe, C., et al. Efficiency, Error and Yield in Light-Directed Maskless Synthesis of DNA Microarrays. Journal of Nanobiotechnology. 9, (2011).
  25. Sack, M., et al. Express photolithographic DNA microarray synthesis with optimized chemistry and high-efficiency photolabile groups. Journal of Nanobiotechnology. 14, (2016).
  26. Kretschy, N., Holik, A. K., Somoza, V., Stengele, K. P., Somoza, M. M. Next-Generation o-Nitrobenzyl Photolabile Groups for Light-Directed Chemistry and Microarray Synthesis. Angewandte Chemie International Edition. 54, (29), 8555-8559 (2015).
  27. Sack, M., Kretschy, N., Rohm, B., Somoza, V., Somoza, M. M. Simultaneous Light-Directed Synthesis of Mirror-Image Microarrays in a Photochemical Reaction Cell with Flare Suppression. Analytical Chemistry. 85, (18), 8513-8517 (2013).
  28. Lietard, J., et al. Base-cleavable microarrays for the characterization of DNA and RNA oligonucleotides synthesized in situ by photolithography. Chemical Communications. 50, (85), 12903-12906 (2014).
  29. Krotz, A. H., et al. Solution stability and degradation pathway of deoxyribonucleoside phosphoramidites in acetonitrile. Nucleosides Nucleotides & Nucleic Acids. 23, (5), 767-775 (2004).
  30. Hargreaves, J. S., Kaiser, R., Wolber, P. K. The Degradation of Dg Phosphoramidites in Solution. Nucleosides Nucleotides & Nucleic Acids. 34, (10), 691-707 (2015).
  31. McGall, G. H., et al. The efficiency of light-directed synthesis of DNA arrays on glass substrates. Journal of the American Chemical Society. 119, (22), 5081-5090 (1997).
  32. Collett, J. R., et al. Functional RNA microarrays for high-throughput screening of antiprotein aptamers. Analytical Biochemistry. 338, (1), 113-123 (2005).
  33. Buenrostro, J. D., et al. Quantitative analysis of RNA-protein interactions on a massively parallel array reveals biophysical and evolutionary landscapes. Nature Biotechnology. 32, (6), 562-568 (2014).
  34. Wu, C. -H., Holden, M. T., Smith, L. M. Enzymatic Fabrication of High-Density RNA Arrays. Angewandte Chemie International Edition. 53, (49), 13514-13517 (2014).
  35. Tian, J., et al. Accurate multiplex gene synthesis from programmable DNA microchips. Nature. 432, (7020), 1050-1054 (2004).
  36. Lietard, J., et al. Mapping the affinity landscape of Thrombin-binding aptamers on 2'F-ANA/DNA chimeric G-Quadruplex microarrays. Nucleic Acids Research. 45, (4), 1619-1632 (2017).
Høy tetthet DNA og RNA Microarrays-Photolithographic syntese, hybridisering og utarbeidelse av store nukleinsyre acid Libraries
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Lietard, J., Schaudy, E., Hölz, K., Ameur, D., Somoza, M. M. High-Density DNA and RNA microarrays - Photolithographic Synthesis, Hybridization and Preparation of Large Nucleic Acid Libraries. J. Vis. Exp. (150), e59936, doi:10.3791/59936 (2019).More

Lietard, J., Schaudy, E., Hölz, K., Ameur, D., Somoza, M. M. High-Density DNA and RNA microarrays - Photolithographic Synthesis, Hybridization and Preparation of Large Nucleic Acid Libraries. J. Vis. Exp. (150), e59936, doi:10.3791/59936 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter