Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Stamcel afkomstige virale AG-specifieke T-lymfocyten onderdrukken HBV-replicatie bij muizen

doi: 10.3791/60043 Published: September 25, 2019

Summary

Hier is een protocol voor de effectieve onderdrukking van replicatie van het hepatitis B-virus (HBV) in muizen door gebruik te maken van de adoptieve celoverdracht (ACT) van stamcel afkomstige virale antigeen (AG)-specifieke T-lymfocyten. Deze procedure kan worden aangepast voor mogelijke op ACT gebaseerde immunotherapie van HBV-infectie.

Abstract

Infectie met het hepatitis B-virus (HBV) is een wereldwijde gezondheidskwestie. Met meer dan 350.000.000 mensenwereld wijd getroffen, de HBV infectie blijft de belangrijkste oorzaak van leverkanker. Dit is een grote zorg, vooral in ontwikkelingslanden. Falen van het immuunsysteem om een effectieve reactie tegen HBV te monteren leidt tot chronische infectie. Hoewel HBV-vaccin aanwezig is en nieuwe antivirale geneesmiddelen worden aangemaakt, blijft de uitroeiing van virus reservoir cellen een belangrijk gezondheids onderwerp. Hier beschreven is een methode voor het genereren van virale antigeen (AG)-specifieke CD8+ cytotoxische T lymfocyten (ctl's) afgeleid van geïnduceerde pluripotente stamcellen (ipscs) (dat wil zeggen, IPSC-CTLS), die de mogelijkheid hebben om HBV-replicatie te onderdrukken. HBV-replicatie wordt efficiënt geïnduceerd bij muizen via hydrodynamische injectie van een HBV-expressie plasmide, pAAV/HBV 1.2, in de lever. Vervolgens, HBV oppervlak AG-specifieke muis iPSC-Ctl's zijn adoptively overgebracht, die sterk onderdrukt HBV replicatie in de lever en bloed, alsmede voorkomt dat HBV oppervlakte AG expressie in hepatocyten. Deze methode demonstreert HBV-replicatie in muizen na hydrodynamische injectie en die door stamcel afkomstige virale AG-specifieke Ctl's kunnen de HBV-replicatie onderdrukken. Dit protocol biedt een nuttige methode voor HBV-immunotherapie.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Na acute infectie regelt het adaptieve immuunsysteem (d.w.z. de humorale en cellulaire immuniteit) het grootste deel van de acute HBV-gerelateerde hepatitis. Toch kunnen een aantal mensen in de HBV-endemische regio's de virussen niet elimineren en vervolgens converteren als chronische individuen. Meer dan 25% van de chronische patiënten (> 250 miljoen mensen) wereldwijd ontwikkelen progressieve leverziekte, resulterend in levercirrose en/of hepatocellulaire carcinoom (HCC)1. Als gevolg daarvan blijft het uitroeien van de met de ziekte besmette cellen een algemeen gezondheidsprobleem, ook al is er een beschikbaar vaccin2 en zijn er talrijke antivirale geneesmiddelen in ontwikkeling. Standaardbehandeling voor HBV-infectie omvat IFN-α, nucleoside en nucleotide-analogen. Deze agenten hebben directe antivirale activiteit en immuun modulatoire capaciteiten. Niettemin verschijnen seroconversie van HBe-antigenen (AG)+ -dragers met anti-HBe antilichaam (AB) en verlies van serum HBV-deoxyribonucleïnezuur (DNA) afzonderlijk in ongeveer 20% van de behandelde patiënten en volledige immunologische controle van het virus geverifieerd door de ontbering van de HBsAg is niet meer dan 5%3. Bovendien is de respons op de behandeling vaak niet duurzaam. Profylactische vaccinatie met recombinant HBs AG is zeer effectief in het voorkomen van infecties, maar therapeutische HBs AG vaccinatie is niet effectief. Duidelijk, T cel-gemedieerde immuunresponsen spelen een cruciale rol bij het beheersen van HBV infectie en leverinsufficiëntie; echter, bij chronische hepatitis patiënten, HBV-reactieve T cellen worden vaak verwijderd, disfunctioneel, of omzetten uitgeput4,5,6. Dientengevolge, bij personen met aanhoudende HBV-infectie, geen pogingen om HBV-specifieke immuniteit (d.w.z., T cel-gebaseerde immuniteit) te herstellen door middel van anti-virale remedie, immuno-modulerende cytokines, of curatieve immunisatie hebben succes bereikt.

Adoptieve celoverdracht (Act) van HBV AG-specifieke T-cellen is een efficiënte behandeling gericht op het uiteindelijk uitroeien van resterende hepatocyten wih HBV7,8. ACT van HBV-specifieke Ctl's in HBV geïnfecteerde muizen is aangetoond dat voorbijgaande, milde hepatitis veroorzaken, en een dramatische daling in HBV ribonucleïnezuur (RNA) transcripties in hepatocyten. In deze studies, Ctl's niet remmen transcriptie van HBV genen maar verbeterde de afbraak van HBV transcripten9. HBV-specifieke Ctl's zijn belangrijk om virale infectie te voorkomen en bemiddel de klaring van HBV10,11. Voor Act-based remedies is voorgesteld om in-vitro expansie van HBV-specifieke T-cellen met een hoge reactiviteit voor in vivo hervestiging een ideale methode te zijn12,13,14; Niettemin zijn de huidige benaderingen beperkt met betrekking tot hun capaciteiten om de juiste hoeveelheden en kwaliteiten van HBV-specifieke T-cellen van patiënten voor de mogelijke therapieën te genereren, te scheiden en te laten groeien.

Hoewel klinische proeven aanwezige veiligheid, uitvoerbaarheid, en potentiële therapeutische activiteit van cel-gebaseerde behandelingen door middel van engineered T cellen die specifiek zijn voor HBV virus geïnfecteerde hepatocyten, er zijn zorgen over de ongunstige effecten die zich voordoen bij auto-immuunresponsen vanwege cross-reactiviteit van de verkeerde T Cell receptor (TCR)15,16, off-target AG herkenning door niet-specifieke TCR17 en on-target off-toxiciteit door een chimeer AG receptor (auto) 18 , 19 met gezonde weefsels. Op dit moment zijn de genetisch gemodificeerde T-cellen, die alleen kortstondige persistentie in vivo hebben, meestal tussenliggende of latere Effector T-cellen. Tot op heden zijn pluripotente stamcellen (pscs) de enige bron die beschikbaar is voor het genereren van hoge aantallen naïeve single-type AG-specifieke T-cellen20,21,22,23. Geïnduceerde PSCs (iPSCs) worden eenvoudig omgezet van somatische cellen van een patiënt door het gebruik van gentransductie van verschillende transcriptiefactoren. Als gevolg hiervan hebben de iPSCs vergelijkbare kenmerken als die van embryonale stamcellen (ESCs)24. Vanwege de flexibiliteit en de mogelijkheid voor het oneindige vermogen om zichzelf te verlengen, kunnen, naast weefsel vervanging, iPSC-behandelingen op grote schaal worden toegepast in regeneratieve geneeskunde. Bovendien kunnen de onderliggende regimenten van iPSCs de huidige op cellen gebaseerde therapieën aanzienlijk verbeteren.

Het algemene doel van deze methode is om een grote hoeveelheid HBV-specifieke Ctl's te genereren van iPSCs (d.w.z. iPSC-CTLs) voor op ACT gebaseerde immunotherapie. De voordelen ten opzichte van alternatieve technieken zijn dat HBV-specifieke iPSC-Ctl's een single-type TCR en naïef fenotype hebben, wat resulteert in meer geheugen T celontwikkeling na de ACT. Het is aangetoond dat de wet van HBV-specifieke iPSC-CTLs verhoogt de migratie van functionele CD8+ T cellen in de lever en vermindert HBV replicatie in zowel de levers en bloed van de toegediende muizen. Deze methode onthult een potentieel gebruik van virale AG-specifieke iPSC-CTLs voor HBV-immunotherapie en kan worden aangepast om andere virale AG-specifieke iPSC-T-cellen voor virale immunotherapie te genereren.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Alle dier experimenten zijn goedgekeurd door de Texas A & M University Animal Care Committee (IACUC; #2018-0006) en worden uitgevoerd in overeenstemming met de richtlijnen van de vereniging voor de beoordeling en accreditatie van laboratoriumdieren zorg. Muizen worden gebruikt tijdens de leeftijd van 6 – 9 weken.

1. generatie van virale AG-specifieke CD8+ t-cellen van ipscs (IPSC-CD8+ t-cellen)

  1. Creatie van de retrovirale constructies
    Opmerking: TCR α-en β-genen zijn gekoppeld aan een zelfcleagerende sequentie van 2A. De retrovirale vector mscv-IRES-dsred (midr) is dsred+ 23.
    1. Sub-Clone HBs183-191 (flltrilti)-specifieke a2-restricted mens-Murine Hybrid TCR (S183 TCR) genen (vα 34 en Vβ28) in de midr om de S183 midr constructie te creëren (Figuur 1A)25.
  2. Retrovirale transductie
    NB: de Platinum-E (plat-E) cellen worden gebruikt voor het verpakken van retrovirussen (met s183 TCR-genen), die gebruikt zullen worden voor retrovirale transductie. De plat-E-cellen zijn een effectieve retrovirus-verpakkings cellen die aan de 293T-cellen ten grondslag liggen, die zijn ontwikkeld door middel van unieke verpakkings constructies via de EF1α-promotor voor het uitdrukken van eiwit met retrovirale structuur, waaronder gag, Pol en ecotropic env.
    1. Op een 100 mm kweek schotel, zaad 3 x 106 plat-E cellen in 8 ml DMEM kweekmedium met 10% foetaal kalf serum (FCS) in een incubator bij 37 ° c met 5% Co2, 1 dag voor de trans fectie.
    2. Op dag 0, transfect de s183 MiDR construct in de plat-E cellen met behulp van een DNA-transfectie reagens25.
    3. Op dag 1, zaad 1 x 106 ipscs (GFP+) in een gelatine voorgecoate kweek plaat.
    4. Op dagen 2 – 3, verzamelen retrovirussen-bevattende supernatant van plat-E celcultuur om iPSCs met de s183 TCR in de aanwezigheid van 1,6-dibromohexaan oplossing25.
    5. Op dag 4, trypsinize de s183 TCR gen-transduced iPSCs, centrifugeer bij 400 x g voor 5 min en zaad 3 × 105 ipscs in een 100 mm kweek schotel voorgecoat met 3 x 106 bestraalde SNL76/7 (irSNL76/7) feeder cellen25.
    6. Op dag 5 of 6 van samenvloeiing, trypsinize de cellen, centrifugeer bij 400 x g gedurende 5 minuten en proces voor het sorteren van cellen. Gating op levende cellen, Sorteer GFP en DsRED dubbel-positieve cellen (de s183 TCR gen-transduced iPSCs) met behulp van een hoge-snelheid cel sorteerder. Vergelijkbaar met stap 1.2.5, co-cultuur de gesorteerde cellen op irSNL76/7 feeder cellen voor toekomstig gebruik25.
  3. Differentiatie van HBV-specifieke iPSC-CD8+ T-cellen
    Opmerking: de OP9-DL1/DL4 stromale cellen vertonen zowel notch liganden DL1 en DL4, en co-culturing ipscs met de ipscs kunnen notch signalering-gemedieerde T-celdifferentiatie26bevorderen.
    1. Groeien s183 TCR gen-transduced ipscs (s183/ipscs) in de OP9-DL1-DL4 Cell monolaag in α-minimum Essential medium (MEM) media met 20% foetaal runderserum (FBS)27. Omvatten Murine Flt3 ligand (mFlt-3L; eindconcentratie = 5 ng/mL) in de cultuur.
    2. Op dag 0, zaad 0.5 – 1.0 x 105 S183/ipscs in een 10 cm cultuur schotel eerder GEGROEID met OP9-DL1-DL4 cellen. Valideer dat de OP9-DL1-DL4 Cells in een voorwaarde van 80% – 90% confluency zijn.
    3. Spoel op dag 5 de iPSCs af met 10 mL fosfaatgebufferde zoutoplossing (PBS), zuig de PBS uit, voeg dit toe aan 4 mL 0,25% trypsine en 37 incupeer gedurende 10 min. daarna, voeg een aanvullende 8 mL iPSC-media toe om trypsine-spijsvertering te beëindigen. Verzamel alle spijsverterings oplossingen die de cellen bevatten en centrifugeer bij 400 x g gedurende 5 minuten bij 15 – 30 °c.
    4. Aspireren de supernatant en respenderen cellen in 10 mL iPSC media. Breng de celsuspensie over naar een nieuwe 10 cm Petri plaat en inculeer 30 minuten in een incubator bij 37 °C.
    5. Verzamel na 30 minuten de iPSC-media met de zwevende cellen. Geef de celsuspensie door een 70 μm celzeef en bereken het celnummer.
    6. Zaad 5 x 105 cellen in de cultuur schotel eerder gegroeid OP9-DL1-DL4 cellen met een voorwaarde van 80% – 90% Confluent Health zoals beschreven in stap 1.3.1.
      Opmerking: voor T-celdifferentiatie, elke 2 – 3 dagen, moeten de iPSC-afgeleide cellen opnieuw worden nageslacht met een nieuwe laag van de OP9-DL1-DL4-cellen.
  4. Evaluatie
    1. Morfologische veranderingen van differentiërende iPSCs
      1. Observeer de cellen onder een microscoop op verschillende dagen.
        Let op: op dag 5 hebben kolonies mesoderm-achtige kenmerken, die een klassieke spindel vorm morfologie vertonen die lijkt op humane dermale fibroblasten en aanhoudende groei in vitro. Op dag 8 beginnen kleine ronde clusters van cellen te verschijnen.
    2. Analyse van het differentiëren van iPSCs door flow cytometrie
      1. Analyseer op verschillende dagen van co-cultuur iPSC-afgeleide cellen zoals eerder beschreven25 (afbeelding 1B, C).
    3. Functionele analyse van differentiërende iPSCs
      1. Op dag 28 van co-cultuur, verzamelen iPSC-CD8+ T cellen uit culturen door het oogsten van de zwevende cellen, trypsinize de overgebleven cellen met 0,25% trypsine, re-Suspend in 8 ml IPSC media, centrifuge gedurende 5 min bij 400 x g bij 15 – 30 ° c, verwijder de media, vervolgens de cellen in 10 mL media hervatten.
      2. Houd de hersuspendeerde cellen in een verse 10 cm schaal in een incubator van 37 °C gedurende 30 minuten en monteer de zwevende cellen. Spoel de cellen vervolgens één keer met een koude PBS.
      3. Incuberen 3 x 106 T cel-uitgeputte splenocyten (CD4-CD8-) van milt van H-2 klasse I Knockout, HLA-a 2.1-transgene (hhd) muizen met 5 ΜM S183 peptide (flltrilti) in 200 μL media bij 4 °c gedurende 30 minuten.
      4. Produceer een mengsel van iPSC-CD8+ T cellen met splenocyten gepulseerd met s183 peptide (T cellen: splenocytes = 1:4; gebruik 0,75 x 106 T cellen). Incuberen het mengsel van cellen bij 37 °C in een CO2 -incubator voor 40 uur. Voeg gedurende de laatste 7 uur 4 μL verdunde brefeldin A toe aan de kweek (uiteindelijke concentratie van 1.000 x, die in 1x kweekmedia zal worden verdund) om transportprocessen tijdens de celactivatie te blokkeren.
      5. Beits de cellen en voer een flowcytometrische analyse uit van intracellulaire IFN-γ zoals eerder beschreven (Figuur 2).

2. inductie van HBV-replicatie via hydrodynamische levering van HBV plasmide

Opmerking: pAAV/HBV 1.2 construct is gegenereerd zoals eerder beschreven9. Het HBV 1,2 complete DNA is opgenomen in de vector pAAV.

  1. Hydrodynamische leveringen van HBV plasmide via de staart ader
    1. Verwarm HHD-muizen met een warmte lamp gedurende 5 minuten in de kooi om de staart ader te verwijden.
    2. Houdt het dier aan door middel van een fixator en reinig de muis staarten met 70% ethanol spray.
    3. Levering van plasmide in de lever.
    4. Meet het lichaamsgewicht van de muis met behulp van een meetschaal.
    5. Verdun 10 μg HBV plasmide in het 8% equivalent van de lichaamsmassa PBS (bijv. 1,6 mL voor een muis van 20 g). Plaats verdunde plasmide in een injectiespuit van 3 mL met een hypodermische naald van 26 G × 12"(0,45 × 12 mm).
    6. Zoek een van de twee laterale staart aders in het middelste derde deel van de staart en plaats de naald in een laterale ader. Dien de injectie met HBV-plasmide toe via de staart ader binnen 3-5 s.
  2. Kwantificering van hersenen uit bloed serum van geïnfecteerde muizen
    Opmerking: HBV-replicatie vindt plaats vanaf dag 3 – 35 in het muis serum. De DNA-replicatie pieken op dag 7 en vermindert geleidelijk. Het HBV-DNA wordt tot dag 35 niet uit het serum gewist.
    1. Verzameling van bloed serum van geïnfecteerde muizen
      1. Verzamel ongeveer 0,1 mL bloed in een microcentrifuge buis van elke muis op 3, 5, 7 en 10 dagen na de infectie door een retroorbitale bloeding in een micro centrifugebuis van 1,5 mL, en inincuberen bij kamertemperatuur (RT) gedurende 20 minuten.
      2. Centrifugeer het monster bij 6.000 x g gedurende 15 minuten bij 4 °c en verzamel het serum supernatant na centrifugeren.
    2. Reinig het DNA uit het bloed serum met behulp van een in de handel verkrijgbare DNA-extractie Kit volgens de aanbevelingen van de fabrikant. Kort, Lyse de cellen in een kolom op basis van silica, voert de wassing uit en extraheer DNA door 100% ethanol toe te voegen aan de elutie kolom en centrifugeren bij 6000 x g gedurende 1 minuut. ELUEER het dna in 50 ΜL RNase-vrij water.
    3. Gebruik 100 ng van HBV DNA uit de elutie voor real-time PCR-analyse. Gebruik de volgende primers en sondes: Forward 5 ' TAGGAGGCTGTAGGCATAAATTGG 3 '; omgekeerde 5 ' GCACAGCTTGGAGGCTTGT 3 '; Probe 5 ' TCACCTCTGCCTAATC 3 '.
      1. Gebruik HBV genoom met plasmide (pAAV/HBV 1.2) voor standaard curve en voer real-time PCR uit in een totaal volume van 10 μL (Figuur 3).
    4. Stel de PCR-reactie op in een totaal volume van 10 μL, zoals weergegeven in tabel 1.
    5. Stel het PCR-programma in de Thermocycler in zoals weergegeven in tabel 2. De geprogrammeerde temperatuur-overgangssnelheid is 20 °C/s voor denaturatie/gloeien en 5 °C/s voor verlenging. Meet de fluorescentie aan het einde van de gloeien fase voor elke cyclus voor real-time PCR-bewaking.

3. reductie van HBV-replicatie door daad van virale AG-specifieke iPSC-CD8+ T-cellen

  1. Adoptieve celoverdracht (ACT)
    1. Differentiëren s183/iPSCs (1.3.7) op de OP9-DL1-DL4 stromale cellen in aanwezigheid van mFlt-3L en mIL-7 gedurende 8 dagen, zoals beschreven in paragraaf 1,3.
    2. Verzamel op dag 22 iPSC-CD8+ T-cellen van de 10 cm plaat met trypsine, was en revoer elke 10 cm plaat in 10 ml verse media. Voeg de cellen toe aan een verse 10 cm plaat en keer 30 minuten terug naar de incubator zoals gedaan in paragraaf 1,3. Verzamel na 30 minuten zwevende cellen.
    3. Gebruik een 70 μm nylon zeef om cellen te passeren om celclusters te elimineren en het celnummer te tellen. Pas de cellen aan een concentratie van 1,5 x 107 cellen/ml in koude PBS oplossing en gebruik een 70 μm nylon zeef om cellen te passeren om celclusters opnieuw te elimineren indien nodig. Houd cellen op ijs totdat de ACT.
    4. Injecteer 200 μL celsuspensie (3 x 106 cellen) in 4 – 6 week oude hhd-muizen via de staart ader.
  2. Inductie van HBV-replicatie
    1. Voer op dag 14 na celoverdracht de hydrodynamische afgifte van HBV plasmide uit via de staart ader zoals beschreven in punt 2,1.
  3. Virus eiwit detectie van geïnfecteerde lever
    1. Offer muizen op dag 3, 5, 7, 14 en 21 na infectie. Gebruik voor euthanasie in elke kooi 1 – 2 L koolstofdioxide (CO2) in de eerste fase. Wanneer het dier het bewustzijnsverlies ontwikkelt, krijgt de CO2 -stroomsnelheid rond 4 – 5 L/min. euthanasie van de muis uitvoeren met co2 inademing.
    2. Scheid de lever door het snijden van de oppervlakte huid van het peritoneum met behulp van een schaar en een tang en sleep de lever lichtjes terug om de inwendige huid te onthullen die de peritoneale holte binnendoet. Verzamel en snijd lever monsters (lengte x breedte x hoogte = 0,5 cm x 0,5 cm X 0,3 cm) van de geïnfecteerde muizen om gemakkelijk in de insluitings cassette te passen en Blokkeer in 10% neutrale buffer formaline voor 4 – 24 h.
    3. Decalcify de lever samplesusing 2,5 M mierenzuur; Spoel in xyleen gedurende 3 minuten, spoel 2x in 100% ethanol, spoel 2x in 95% ethanol, spoel 2x in gedeïoniseerd (DI) water gedurende 2 minuten en onthaf vervolgens de lever monsters in 1 mM ethyleendiaminetetraazijnzuur (EDTA) dienovereenkomstig. Handgreep bij een sub-kooktemperatuur (90 °C) gedurende 20 min.
    4. Koel de vaste lever weefsels gedurende 30 min. Spoel de weefsels met 1x PBS gedurende 4 minuten en sluit de weefsels in paraffine in. Dehydraat de weefsels in een reeks toenemende concentraties ethanol om het water te vervangen en dompel vervolgens onder in de onderdompeling in xyleen. Embed de geïnfiltreerde weefsels in Wax blokken. Maak gelijkmatig verticaal en horizontaal snijden voor vlekken. Maak 4 μm profielen met een schuivende microtoom.
    5. Geef de secties door de deparaffinisatie en rehydratie met behulp van xyleen en ethanol en voer vervolgens immunofluorescentie kleuring van de secties uit.
    6. Beits de delen met 200 μL HBV oppervlak AG-specifiek antilichaam (1:100 verdunning in de blokkerende oplossing). Inbroed de delen met het antilichaam voor 2 uur bij RT in een 75% – 100% bevoficeerde kamer, en was 5x in 1x PBS gedurende 5 minuten.
    7. Gebruik een anti-fade-reagens met 4 ', 6-diamidino-2-fenylindole (DAPI) voor nucleaire kleuring om de dia's tegen te gaan. Voeg de afdek toe met ongeveer 300 μL van de verdunde DAPI-kleurings oplossing (300 nm in 1x PBS) en valideer de gehele afdek cover. Houd de glaasjes in het donker bij 4 °C tot de inspectie onder een fluorescerende Microscoop.
  4. Inflammatoire celinfiltratie in geïnfecteerde muizen
    1. Offerande muizen zoals beschreven in stap 3.3.1. Verzamel de lever en maak secties zoals beschreven in stap 3.3.4.
    2. Vlek de sectie met hematoxyline en eosine (H & E) om infiltratie van ontstekingscellen in de lever te evalueren.
    3. Bewaar dia's in het donker bij 4 °C tot verdere analyse onder een fluorescerende Microscoop.
    4. Visualiseer dia's onder een fluorescentiemicroscoop om de infiltratie van ontstekingscellen in de lever te detecteren (Figuur 4).
  5. HBV DNA detectie van geïnfecteerde lever
    1. Isolatie van virale DNA.
    2. Euthaniseer muizen en verzamel de lever monsters volgens paragraaf 3,3.
    3. Lyse de lever weefsels in Nonindet P-40 (NP-40) lysisbuffer (50 mM tris-HCL, 1 mM EDTA, 1% NP-40) bevattende een cocktail van de proteaseremmer.
    4. Centrifugeer kort op 16.000 x g om de kernen en celresten te verwijderen.
    5. Incuberen het cytoplasminezuur lysaat met micrococcal Nuclease (Nuclease S7; 150 eenheden/mL) en CaCl2 (5 mm) bij 37 °c gedurende 90 min om het nucleïnezuur buiten de nucleocapsiden (nc's) te degraderen.
    6. Inactiveren van de Nuclease S7 door toevoeging van 10 mM EDTA.
    7. Neerslaan van de nucleocapsiden met polyethyleenglycol (PEG), verstoren door 0,5% natriumdodecylsulfaat (SDS), en Digest met 0,6 mg/ml proteïnase K (PK) bij 37 °c gedurende 1 uur.
    8. Herstel de virale nucleïnezuren door fenol chloroform extractie en ethanol precipitatie.
    9. Los het geëxtraheerde virale DNA op een 1,2% agarose-gel op en Detecteer door de standaard Southern blot-analyse met behulp van een32 P-GELABELDE HBV-DNA-sonde.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Zoals hier wordt weergegeven, worden HBV virale AG-specifieke iPSC-CD8+ T-cellen gegenereerd door een in vitro cultuur systeem. Na handeling van deze virale AG-specifieke iPSC-CD8+ T cellen onderdrukken HBV replicatie in een Murine model (aanvullend bestand 1) aanzienlijk. Muis IPSC zijn getransduceerde met de midr retrovirale construct coderen van een mens-muis hybride HBV TCR gen (HBS183-191-specifieke, s183), dan zijn de gen-getransduceerde ipscs co-gekweekte met OP9-DL1/DL4 cellen uitdrukken notch liganden (zowel DL1 en DL4) moleculen in aanwezigheid van rFlt3L en rIL-7. Op dag 28 van in vitro co-cultuur, de iPSC-afgeleide cellen aanzienlijk Express CD3 en AG-specifieke TCR (T celmarkeringen). Flow cytometrische analyse van de CD3+CD8+ populatie toont aan dat de HBV TCR transductie de aanmaak van virale s183-specifieke CD8+ T-cellen drastisch verhoogt (Figuur 1).

Op dag 28 van in vitro co-cultuur worden de CD4-CD8+ single-positieve (SP) IPSC-CD8+ T-cellen geïsoleerd en gestimuleerd door T-uitgeput splenocyten gepulseerd met s183 peptide, en de productie van cytokine wordt beoordeeld. De iPSC-CTLs produceren grote hoeveelheden IL-2 en IFN-Υ zoals gedetecteerd door intracellulaire kleuring of ELISA (Figuur 2). HBV-infectie wordt geïnduceerd in HLA-A 2.1 transgene (HHD) muizen door hydrodynamische injectie van 10 μg pAAV/HBV 1.2 DNA plasmide door de staart aders van muizen. HBV-replicatie wordt gedetecteerd vanaf dag 3 – 21 in het serum van HHD-muizen. De DNA-replicatie pieken op dag 6 en vermindert geleidelijk met behulp van real-time PCR-analyse (Figuur 3).

Twee weken na de ACT worden muizen uitgedaagd met een hydrodynamische injectie van pAAV/HBV 1.2 DNA plasmide. De virale titer wordt gemeten door real-time PCR van serum op verschillende tijdstippen na de injectie. De resultaten tonen aan dat virale replicatie op alle tijdspunten in de muizen die HBV virale AG-specifieke T-cellen krijgen significant wordt verminderd in vergelijking met de muizen die controle cellen ontvangen (Figuur 4A). HBV oppervlakte eiwit expressie wordt ook onderzocht in de lever in de bovenstaande setting van de behandeling. Muizen worden op verschillende dagen na de injectie met HBV geëuseerd en de lever monsters zijn geïsoleerd voor histologisch onderzoek. Monsters worden gekleurd voor HBV-oppervlakte eiwitten en onderzocht onder een fluorescentiemicroscoop. HBV-oppervlakte proteïne wordt gezien als substantieel verlaagd in de muizen die HBV virale AG-specifieke pre-iPSC-Ctl's ontvangen, vergeleken met de muizen die controle cellen ontvangen (Figuur 4B). Dit experiment toont duidelijk aan dat virale AG-specifieke iPSC-CD8+ T-cellen de mogelijkheid hebben om HBV-replicatie in het muriene model te verminderen.

Figure 1
Figuur 1: generatie van HBV virale AG-specifieke iPSC-CD8+ T-cellen.
Muis iPSCs zijn getransduceerde met de volgende retrovirale constructies: HBs183-91 TCR (midr-S183 TCR) of OVA257-264 TCR (MIDR-OVA TCR), en de getransduceerde ipscs zijn co-gekweekt met OP9-DL1/DL4 stromale cellen voor T-Lineage-differentiatie. A) Schematische voorstelling van de retrovirale constructie midr-S183 TCR die s183 specifieke TCR uitdrukt. Ψ = verpakkings signaal; 2A = Picornavirus zelf-cleaving 2A sequentie; LTR = lange terminale herhalingen. B) morfologie van T-celdifferentiatie op de dagen 0, 7, 14 en 22. C) flowcytometrische analyse voor de cellen met IPSC-afgeleide op dag 28. CD3+CD8+ cellen (links) zijn omheind zoals aangegeven en geanalyseerd voor de uitdrukking van CD8 en TCRVβ28 (rechts). Getoonde gegevens zijn representatief voor drie individuele experimenten. De waarden vertegenwoordigen gemiddelde ± SD (* * p < 0,01; gekoppelde t-tests). Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 2
Figuur 2: functionele analyse van de HBV virale AG-specifieke iPSC-CD8+ T-cellen.
Op dag 28 van de in vitro co-cultuur worden de SP CD8+s183 TCR pentamer+ IPSC-T-cellen gesorteerd. De iPSC-T-cellen en CD8+ T-cellen met midr-S183 TCR worden gestimuleerd door T-verarmd splenocyten (apc's) van hhd-muizen en gepulseerd met s183 PEPTIDE (FLLTRILTI). A) intracellulaire kleuring van IFN-Υ na 7 uur (afgesloten op CD8+ cellen) (T/APCs = 1:4). B) Elisa van IFN-γ na 40 h. de getoonde gegevens zijn representatief voor drie individuele experimenten. De waarden vertegenwoordigen gemiddelde ± SD (n.s., p > 0,05; gekoppelde t-tests). Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 3
Figuur 3: inductie van HBV-replicatie in HHD-muizen door hydrodynamische injectie.
HZVH muizen worden i.v. toegediend met HBV plasmide via hydrodynamische staart ader injectie. 10 μg van het plasmide wordt geïnjecteerd met 8% van de totale lichaamsmassa PBS. Op de aangegeven tijdstippen na de injectie wordt het serum geïsoleerd uit het bloed en wordt het DNA geëxtraheerd voor real-time PCR. Getoonde gegevens zijn representatief voor drie individuele experimenten. De waarden vertegenwoordigen gemiddelde ± SD. gegevens zijn representatief voor vijf muizen per groep van drie onafhankelijke experimenten. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 4
Figuur 4: reductie van HBV-replicatie door daad van virale AG-specifieke iPSC-CD8+ T-cellen.
HHD-muizen worden i.v.-adoptively overgebracht met virale AG-specifieke iPSC-CD8+ T Cell-voor ouders (op dag 22 van de in-vitro cultuur) en beheerd met HBV plasmide in week 2 na de overdracht van de cel. A) kopieën van serum HBV. Op de aangegeven tijdpunten na de injectie wordt het serum geïsoleerd uit het bloed en wordt het DNA geëxtraheerd voor real-time PCR-analyse. Getoonde gegevens zijn representatief voor drie individuele experimenten. De waarden vertegenwoordigen gemiddelde ± SD. (B) leverweefsel histologie. Muizen worden geëuseerd op dag 8 na HBV-infectie. Lever monsters zijn geïsoleerd en gekleurd voor histologisch onderzoek. Bovenste paneel toont de HBsAg eiwit expressie in geïnfecteerde muizen (IHC kleuring) en onderste paneel toont de inflammatoire cel infiltratie (hij-kleuring). Gegevens zijn representatief voor vijf muizen per groep van drie onafhankelijke experimenten. Klik hier om een grotere versie van dit cijfer te bekijken.

DNA-template 2 ml
DNA Master hybridisatie mengsel ((Taq DNA polymerase, PCR-reactiebuffer, 10 mM MgCl2 en dNTP mengsel) 1 ml
25 mM MgCl2 0,8 ml
0,3 μM de sonde 3 ml
5 μM van elke primer 3,2 ml
Totale 10 ml

Tabel 1: PCR-reactievolume

Temperatuur Tijd
Denaturatie 95 °C 5 s
Annealing 53 °C 10 s
Extensie 72 °C 20 s
5 °C

Tabel 2: PCR-programma

Aanvullend bestand 1: Klik hier om dit bestand te downloaden.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Dit protocol presenteert een methode voor het genereren van de virale AG-specifieke iPSC-CTLs voor gebruik als ACT te onderdrukken HBV replicatie in een model van de Murine. Bij chronische HBV-infectie vormt het virale genoom een stabiel mini-chromosoom, het covalent gesloten cirkelvormige DNA (cccDNA) dat gedurende de levensduur van de hepatocyte kan aanhouden. Gericht op de klaring van het virale mini-chromosoom kan resulteren in een genezing van chronische HBV-infectie. De huidige antivirale therapie richt zich op het virus reverse transcriptase, maar stelt zelden immunologische controle in over HBV-replicatie, aangestuurd door cccDNA. HBV-specifieke CD8+ ctl's kunnen het doden van de geïnfecteerde hepatocyten bemiddelen en de klaring van cccDNA versnellen. Niettemin, de HBV-specifieke Ctl's worden verwijderd, disfunctioneel, of bezwijken voor uitputting bij patiënten met chronische HBV infectie. Handelen met de HBV-specifieke ctl's is een gunstige behandeling voor chronische HBV-infectie28,29. Naïeve of centraal geheugen T-cel-afgeleide T-lymfocyten (d.w.z. zeer reactieve immuuncellen) zijn ideale Effectors voor ACT-based therapieën vanwege hun grote proliferatie, lagere neiging tot overlijden in vergelijking met terminaal gedifferentieerde cellen, en uitstekende mogelijkheid om te reageren op homeostatische cytokines. Een dergelijke handeling is echter vaak niet haalbaar vanwege moeilijkheden bij het verkrijgen van voldoende Ctl's van patiënten. Er is al eerder aangetoond dat herprogrammering van AG-specifieke ctl's of T-regs van ipscs kan worden gebruikt voor op cellen gebaseerde therapieën20,23,27,30. Dit rapport toont een methode om virale AG-specifieke iPSC-Ctl's te genereren en deze cellen te gebruiken voor op ACT gebaseerde immunotherapie in een muriene model van HBV-replicatie.

Hoewel er transgene muismodellen van HBV-replicatie zijn, zijn deze modellen uitdagend, omdat de centrale tolerantie geïnduceerd door de transgene genproducten ervoor zorgt dat muizen immuun tolerant zijn voor HBV AGS. Bovendien zijn transgene muizen niet geschikt voor het monitoren van virale klaring, omdat het geïntegreerde HBV-genoom aanhoudt in elke muiskel31,32. Ondanks dat er succesvolle vaccins zijn ontwikkeld om de infectie te voorkomen, is de behandeling of immunotherapie na HBV-infectie niet ontwikkeld. Bovendien zijn de experimentele benaderingen van HBV-pathogenese belemmerd omdat het hostbereik van HBV-infectie beperkt is tot mannen en chimpansees, en in vitro cultuur systeem voor de vermeerdering van HBV niet volstaat. CD8+ T cellen zijn veelbelovende Effector cellen tegen verschillende soorten virale infectie; de respons van de T-cel tegen HBV is echter niet overvloedig. Specificiteit, werking, en het ontbreken van voldoende aantallen om een immuunrespons te monteren kan de oorzaak zijn. Dit rapport onthult de methode van hydrodynamische injectie die de HBV-replicatie op efficiënte wijze induceert bij muizen. De methode maakt de levering van een grote hoeveelheid HBV plasmide direct in de lever. Het model vertoont continue hersenen gedurende meer dan 8 weken met detectie van HBV mRNA, eiwitten, en DNA op verschillende dagen na de injectie. Deze methode voor HBV-replicatie in muizen is nuttig voor HBV-immunotherapie.

Samenvattend, HBV replicatie werd met succes geïnduceerd in muizen via hydrodynamische injectieprocedure, en virale AG-specifieke iPSC-Ctl's werden gebruikt als immunotherapie voor HBV replicatie. Er zijn echter twee beperkingen van de methode: (1) meer dan drie weken van in vitro T celdifferentiatie kan de translationele toepassingen van de gegenereerde T-cellen voor ACT verminderen; en (2) HBV hydrodynamische injectie kan efficiënt induceren HBV replicatie in de lever; echter, het vormt geen de cccDNA, dat is de belangrijkste reden voor de aanhoudende HBV infectie. Niettemin biedt de methode een alternatieve aanpak voor HBV-replicatie en-behandeling. Een combinatieregime met anti-HBV-geneesmiddelen en de daad van virale AG-specifieke iPSC-Ctl's zal waarschijnlijk de HIV-reservoirs verminderen, waardoor een therapie voor chronische HIV-infectie ontstaat.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

De auteurs bedanken Dr. Adam J Gehring van het Toronto General Hospital Research Institute voor het verstrekken van cDNA voor HBs183-91 (s183) (FLLTRILTI)-specifieke a2-beperkte humane-Murine Hybrid TCR-genen, en Dr. Pei-Jer Chen van de nationale universiteit van Taiwan voor het verstrekken van pAAV/HBV 1,2 construct. Dit werk wordt ondersteund door het National Institute of Health Grant R01AI121180, R01CA221867 en R21AI109239 to J. S.

Materials

Name Company Catalog Number Comments
HHD mice Institut Pasteur, Paris, France H-2 class I knockout, HLA-A2.1-transgenic (HHD) mice
iPS-MEF-Ng-20D-17 RIKEN Cell Bank APS0001
SNL76/7 ATCC SCRC-1049
OP9 ATCC CRL-2749
pAAV/HBV1.2 plasmid Dr. Dr. Pei-Jer Chen (National Taiwan University Hospital, Taiwan) HBV DNA construct
HBs183-91(s183) (FLLTRILTI)-specific TCR genes Dr. Adam J Gehring (Toronto General Hospital Research Institute, Toronto, Canada) FLLTRILTI-specific A2-restricted human-murine hybrid TCR genes (Vα34 and Vβ28)
OVA257–264-specific TCR genes Dr. Dario A. Vignali (University of Pittsburgh, PA) SIINFEKL-specific H-2Kb-restricted TCR genes
Anti-CD3 (17A2) antibody Biolegend 100236
Anti-CD44 (IM7) antibody BD Pharmingen 103012
Anti-CD4 (GK1.5) antibody Biolegend 100408
Anti-CD8 (53-6.7) antibody Biolegend 100732
Anti-IFN-γ (XMG1.2) antibody Biolegend 505810
Anti-TNF-a (MP6-XT22) antibody Biolegend 506306
α-MEM Invitrogen A10490-01
Anti-HBs antibody Thermo Fisher MA5-13059
ACK Lysis buffer Lonza 10-548E
Brefeldin A Sigma B7651
DMEM Invitrogen ABCD1234
FBS Hyclone SH3007.01
FACSAria Fusion cell sorter BD 656700
Gelatin MilliporeSigma G9391
GeneJammer Agilent 204130
HLA-A201-HBs183-91-PE pentamer Proimmune F027-4A - 27
HRP Anti-Mouse Secondary Antibody Invitrogen A27025
mFlt-3L Peprotech 250-31L
mIL-7 Peprotech 217-17
Nuclease S7 Roche 10107921001
Paraformaldehyde MilliporeSigma P6148-500G Caution: Allergenic, Carcenogenic, Toxic
Permeabilization buffer Biolegend 421002
Polybrene MilliporeSigma 107689
ProLong™ Gold Antifade Mountant with DAPI Invitrogen P36931
QIAamp MinElute Virus Spin Kit Qiagen 57704

DOWNLOAD MATERIALS LIST

References

  1. Scaglione, S. J., Lok, A. S. Effectiveness of hepatitis B treatment in clinical practice. Gastroenterology. 142, (6), 1360-1368 (2012).
  2. Osiowy, C. From infancy and beyond... ensuring a lifetime of hepatitis B virus (HBV) vaccine-induced immunity. Human Vaccines & Immunotherapeutics. 14, (8), 2093-2097 (2018).
  3. Gish, R. G., et al. Loss of HBsAg antigen during treatment with entecavir or lamivudine in nucleoside-naive HBeAg-positive patients with chronic hepatitis B. Journal of Viral Hepatitis. 17, (1), 16-22 (2010).
  4. Kurktschiev, P. D., et al. Dysfunctional CD8+ T cells in hepatitis B and C are characterized by a lack of antigen-specific T-bet induction. Journal of Experimental Medicine. 211, (10), 2047-2059 (2014).
  5. Fisicaro, P., et al. Antiviral intrahepatic T-cell responses can be restored by blocking programmed death-1 pathway in chronic hepatitis B. Gastroenterology. 138, (2), 682-693 (2010).
  6. Schurich, A., et al. The third signal cytokine IL-12 rescues the anti-viral function of exhausted HBV-specific CD8 T cells. PLoS Pathogens. 9, (3), 1003208 (2013).
  7. Gehring, A. J., et al. Engineering virus-specific T cells that target HBV infected hepatocytes and hepatocellular carcinoma cell lines. Journal of Hepatology. 55, (1), 103-110 (2011).
  8. Xia, Y., et al. Interferon-gamma and Tumor Necrosis Factor-alpha Produced by T Cells Reduce the HBV Persistence Form, cccDNA, Without Cytolysis. Gastroenterology. 150, (1), 194-205 (2016).
  9. Huang, L. R., Wu, H. L., Chen, P. J., Chen, D. S. An immunocompetent mouse model for the tolerance of human chronic hepatitis B virus infection. Proceedings of the National Academy of Sciences U.S.A. 103, (47), 17862-17867 (2006).
  10. Wong, P., Pamer, E. G. CD8 T cell responses to infectious pathogens. Annual Review of Immunology. 21, 29-70 (2003).
  11. Murray, J. M., Wieland, S. F., Purcell, R. H., Chisari, F. V. Dynamics of hepatitis B virus clearance in chimpanzees. Proceedings of the National Academy of Sciences USA. 102, (49), 17780-17785 (2005).
  12. Hinrichs, C. S., et al. Adoptively transferred effector cells derived from naive rather than central memory CD8+ T cells mediate superior antitumor immunity. Proceedings of the National Academy of Sciences U.S.A. 106, (41), 17469-17474 (2009).
  13. Hinrichs, C. S., et al. Human effector CD8+ T cells derived from naive rather than memory subsets possess superior traits for adoptive immunotherapy. Blood. 117, (3), 808-814 (2011).
  14. Kerkar, S. P., et al. Genetic engineering of murine CD8+ and CD4+ T cells for preclinical adoptive immunotherapy studies. Journal of Immunotherapy. 34, (4), 343-352 (2011).
  15. Kuball, J., et al. Facilitating matched pairing and expression of TCR chains introduced into human T cells. Blood. 109, (6), 2331-2338 (2007).
  16. van Loenen, M. M., et al. Mixed T cell receptor dimers harbor potentially harmful neoreactivity. Proceedings of the National Academy of Sciences USA. 107, (24), 10972-10977 (2010).
  17. Cameron, B. J., et al. Identification of a Titin-derived HLA-A1-presented peptide as a cross-reactive target for engineered MAGE A3-directed T cells. Science Translational Medicine. 5, (197), (2013).
  18. Fedorov, V. D., Themeli, M., Sadelain, M. PD-1- and CTLA-4-based inhibitory chimeric antigen receptors (iCARs) divert off-target immunotherapy responses. Science Translational Medicine. 5, (215), (2013).
  19. Maus, M. V., et al. T cells expressing chimeric antigen receptors can cause anaphylaxis in humans. Cancer Immunolology Research. 1, (1), 26-31 (2013).
  20. Haque, R., et al. Programming of regulatory T cells from pluripotent stem cells and prevention of autoimmunity. Journal of Immunology. 189, (3), 1228-1236 (2012).
  21. Vizcardo, R., et al. Regeneration of human tumor antigen-specific T cells from iPSCs derived from mature CD8(+) T cells. Cell Stem Cell. 12, (1), 31-36 (2013).
  22. Nishimura, T., et al. Generation of rejuvenated antigen-specific T cells by reprogramming to pluripotency and redifferentiation. Cell Stem Cell. 12, (1), 114-126 (2013).
  23. Lei, F., et al. In vivo programming of tumor antigen-specific T lymphocytes from pluripotent stem cells to promote cancer immunosurveillance. Cancer Research. 71, (14), 4742-4747 (2011).
  24. Kim, J. B., et al. Oct4-induced pluripotency in adult neural stem cells. Cell. 136, (3), 411-419 (2009).
  25. Lei, F., Haque, R., Xiong, X., Song, J. Directed differentiation of induced pluripotent stem cells towards T lymphocytes. Journal of Visualized Experiments. (63), e3986 (2012).
  26. Lei, F., Haque, M., Sandhu, P., Ravi, S., Ni, Y., Zheng, S., Fang, D., Jia, H., Yang, J. M., Song, J. Development and characterization of naive single-type tumor antigen-specific CD8+ T lymphocytes from murine pluripotent stem cells. OncoImmunology. 6, (2017).
  27. Haque, M., et al. Melanoma Immunotherapy in Mice Using Genetically Engineered Pluripotent Stem Cells. Cell Transplantation. 25, (5), 811-827 (2016).
  28. Tan, A. T., et al. Use of Expression Profiles of HBV DNA Integrated Into Genomes of Hepatocellular Carcinoma Cells to Select T Cells for Immunotherapy. Gastroenterology. (2019).
  29. Wu, L. L., et al. Ly6C(+) Monocytes and Kupffer Cells Orchestrate Liver Immune Responses Against Hepatitis B Virus in Mice. Hepatology. (2019).
  30. Haque, M., et al. Stem cell-derived tissue-associated regulatory T cells suppress the activity of pathogenic cells in autoimmune diabetes. Journal of Clinical Investigation Insights. (2019).
  31. Chisari, F. V., et al. Structural and pathological effects of synthesis of hepatitis B virus large envelope polypeptide in transgenic mice. Proceedings of the National Academy of Sciences USA. 84, (19), 6909-6913 (1987).
  32. Wirth, S., Guidotti, L. G., Ando, K., Schlicht, H. J., Chisari, F. V. Breaking tolerance leads to autoantibody production but not autoimmune liver disease in hepatitis B virus envelope transgenic mice. Journal of Immunology. 154, (5), 2504-2515 (1995).
Stamcel afkomstige virale AG-specifieke T-lymfocyten onderdrukken HBV-replicatie bij muizen
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Xiong, X., Lei, F., Haque, M., Song, J. Stem Cell-Derived Viral Ag-Specific T Lymphocytes Suppress HBV Replication in Mice. J. Vis. Exp. (151), e60043, doi:10.3791/60043 (2019).More

Xiong, X., Lei, F., Haque, M., Song, J. Stem Cell-Derived Viral Ag-Specific T Lymphocytes Suppress HBV Replication in Mice. J. Vis. Exp. (151), e60043, doi:10.3791/60043 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter