Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Le cellule staminali derivate dall'ag virale specifico t linfociti sopprimeno la replica HBV nei topi

doi: 10.3791/60043 Published: September 25, 2019

Summary

Presentato qui è un protocollo per l'effettiva soppressione della replicazione del virus dell'epatite B (HBV) nei topi utilizzando il trasferimento di cellule adottive (ACT) di antigeni virali (Ag) specifici di cellule staminali. Questa procedura può essere adattata per una potenziale immunoterapia basata su ACT dell'infezione da HBV.

Abstract

L'infezione da virus dell'epatite B (HBV) è un problema di salute globale. Con oltre 350 milioni di persone colpite in tutto il mondo, l'infezione da HBV rimane la principale causa di cancro al fegato. Si tratta di una delle principali preoccupazioni, soprattutto nei paesi in via di sviluppo. Il fallimento del sistema immunitario per montare una risposta efficace contro l'HBV porta a infezioni croniche. Anche se il vaccino HBV è presente e si stanno creando nuovi farmaci antivirali, l'eradicazione delle cellule del serbatoio del virus rimane un importante argomento sanitario. Qui è descritto un metodo per la generazione di antigene virale (Ag) specifico CD8- linfociti T citotossici (CTL) derivati da cellule staminali pluripotenti indotte (iPSC) (cioè iPSC-CTL), che hanno la capacità di sopprimere la replicazione HBV. La replicazione HBV è indotta in modo efficiente nei topi attraverso l'iniezione idrodinamica di un plasmide di espressione HBV, pAAV/HBV1.2, nel fegato. Quindi, i mouse specifici di HBV Ag iPSC-CTL vengono trasferiti adottivamente, il che sopprime notevolmente la replicazione dell'HBV nel fegato e nel sangue e previene l'espressione Di HbV surface Ag negli epatociti. Questo metodo dimostra la replicazione HBV nei topi dopo l'iniezione idrodinamica e che i CTL virali specifici di Ag- delle cellule staminali possono sopprimere la replicaHBV. Questo protocollo fornisce un metodo utile per l'immunoterapia HBV.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

A seguito di infezione acuta, il sistema immunitario adattivo (cioè l'immunità umorale e cellulare) controlla la maggior parte dell'epatite acuta correlata all'HBV. Tuttavia, un certo numero di persone nelle regioni HBV-endemiche non può eliminare i virus e successivamente convertirsi come individui cronici. Più del 25% dei pazienti cronici (>250 milioni di persone) in tutto il mondo sviluppa malattie epatiche progressive, con conseguente cirrosi epatica e/o carcinoma epatocellulare (HCC)1. Di conseguenza, l'eradicazione delle cellule infettate insistenza rimane un problema generale di salubrità, anche se esiste un vaccino2 disponibile e numerosi farmaci antivirali sono in fase di sviluppo. Il trattamento standard per l'infezione da HBV include analoghi IFN-z, nucleoside e nucleotide. Questi agenti hanno attività antivirale diretta e capacità modulativi immunitarie. Tuttavia, la sieroconversione dell'antigene HBe (Ag)- portatori con anticorpo anti-HBe (Ab) e perdita di acido deossiribonucleico HBV del siero compaiono individualmente in circa il 20% dei pazienti trattati e il controllo immunologico completo del virus verificata dalla privazione dell'HBsAg non superiore al 5%3. Inoltre, la risposta al trattamento spesso non è durevole. La vaccinazione profilattica con HBs Ag ricombinante è altamente efficace nella prevenzione dell'infezione, ma la vaccinazione terapeutica hBs Ag non è efficace. Chiaramente, le risposte immunitarie mediate dalle cellule T svolgono un ruolo fondamentale nel controllo dell'infezione da HBV e della compromissione del fegato; tuttavia, nei pazienti cronici con epatite, le cellule T reattive HBV sono spesso eliminate, disfunzionali o convertite esaurite4,5,6. Di conseguenza, in individui con infezione da HBV persistente, nessun tentativo di ripristinare l'immunità specifica dell'HBV (cioè l'immunità basata sulle cellule T) per mezzo di rimedio anti-virale, citochine immunomodulatori o immunizzazione curativa hanno raggiunto successo.

Il trasferimento di cellule adottive (ACT) di cellule T specifiche DI HBV Ag è un trattamento efficace diretto a sradicare infine i rimanenti epatociti wih HBV7,8. L'ACT dei CL specifici dell'HBV nei topi infetti da HBV ha dimostrato di causare un calo transitorio e lieve e un calo drammatico nelle trascrizioni di acido ribonucleico HBV (RNA) negli epatociti. In questi studi, i CTL non hanno inibito la trascrizione dei geni HBV, ma hanno migliorato la degradazione delle trascrizioni HBV9. Gli HBV specifici sono importanti per prevenire l'infezione virale e mediare l'autorizzazione dell'HBV10,11. Per i rimedi basati su ACT, l'espansione in vitro di cellule T specifiche HBV con un'elevata reattività per il reinsediamento in vivo è stata suggerita come metodo ideale12,13,14; tuttavia, gli attuali approcci sono limitati per quanto riguarda la loro capacità di generare, separare e far crescere quantità e qualità appropriate di cellule T specifiche dell'HBV dai pazienti per le potenziali terapie.

Anche se gli studi clinici presentano sicurezza, praticabilità e attività terapeutica prospettica di trattamenti basati sulle cellule per mezzo di cellule T ingegnerizzate specifiche per gli epatociti infettati da virus HBV, ci sono preoccupazioni circa gli effetti sfavorevoli che si verificano da risposte autoimmuni a causa della reattività incrociata da recettori cellulari T (TCR)15,16, riconoscimento Ag off-target da non specifico TCR17 e on-target off-toxicity da un recettore Ag chierico (CAR) 18 mi lato , 19 con tessuti sani. Attualmente, le cellule T geneticamente modificate, che hanno solo persistenza a breve termine in vivo, sono di solito cellule T intermedie o successive. Ad oggi, le cellule staminali pluripotenti (PSC) sono l'unica fonte disponibile per generare un numero elevato di ingenue cellule T singole di tipo G20,21,22,23. I PSC indotti (iPSC) vengono semplicemente convertiti dalle cellule somatiche di un paziente attraverso l'uso della trasduzione genica di diversi fattori di trascrizione. Di conseguenza, gli iPSC hanno caratteristiche simili a quelle delle cellule staminali embrionali (ESC)24. A causa della flessibilità e della possibilità per l'infinita capacità di auto-rinnovarsi, oltre alla sostituzione dei tessuti, i trattamenti basati su iPSC possono essere ampiamente applicati nella medicina rigenerativa. Inoltre, i reggimenti alla base degli iPSC possono migliorare notevolmente le attuali terapie basate sulle cellule.

L'obiettivo generale di questo metodo è quello di generare una grande quantità di CTL specifici HBV da iPSC (cioè iPSC-CTL) per l'immunoterapia basata su ACT. I vantaggi rispetto alle tecniche alternative sono che gli iPSC-CTL specifici dell'HBV hanno un tCR di tipo singolo e un fenotipo ingenuo, che si traduce in più sviluppo di cellule T di memoria dopo l'ACT. È dimostrato che l'ACT degli iPSC-CTL specifici dell'HBV aumenta la migrazione delle cellule cLAmone CD8 - cLAmmi funzionali nel fegato e riduce la replicazione dell'HBV sia nel fegato che nel sangue dei topi somministrati. Questo metodo rivela un potenziale uso di iPSC-CTL virali specifici dell'Ag per l'immunoterapia HBV e può essere adattato per generare altre cellule iPSC-T virali specifiche dell'Ag per l'immunoterapia virale.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Tutti gli esperimenti sugli animali sono approvati dal Texas A&M University Animal Care Committee (IACUC; #2018-0006) e sono condotti in conformità con le linee guida dell'Associazione per la valutazione e l'accreditamento della cura degli animali di laboratorio. I topi vengono utilizzati durante 6-9 settimane di età.

1. Generazione di cellule virali specifiche dell'ag8- T da iPSC (iPSC-CD8- cellule T)

  1. Creazione dei costrutti retrovirali
    N.B.: I geni TCR e - sono collegati alla sequenza di auto-fessura 2A. Il vettore retrovirale MSCV-IRES-DsRed (MiDR) èDsRed 23.
    1. I geni TCR ibridi a basso clone183-191 (FLLTRILTI) specifici di A2(Figura 1A ) specifici del Multiqu (V-34 e V-28) specifici del MiDR per creare il costrutto MiDR s183 ( Figura 1A)25.
  2. Trasduzione retrovirale
    NOTA: Le cellule Platinum-E (Plat-E) vengono utilizzate per confezionare retrovirus (portando geni TCR s183), che verranno utilizzati per la trasduzione retrovirale. Le cellule Plat-E sono un efficace retrovirus delle cellule che annoiano le cellule 293T, che sono state sviluppate mediante costrutti di imballaggio unici tramite il promotore di EF1 per esprimere la proteina della struttura retrovirale, tra cui gag, pol ed ecotropic env.
    1. Su un piatto di coltura 100 mm, semi 3 x 106 cellule Plat-E in 8 mL di mezzo di coltura DMEM contenente 10% siero di vitello fetale (FCS) in un'incubatrice a 37 s con 5% di CO2, 1 giorno prima della trasfezione.
    2. Il giorno 0, trasfecare il costrutto MiDR s183 nelle cellule Plat-E utilizzando un reagente di trasfezione del DNA25.
    3. Il primo giorno, il seme 1 x 106 iPSCs (GFP) in un piatto di coltura pre-rivestito di gelatina.
    4. Nei giorni 2-3, raccogliere retrovirus-contenente soppaldante dalla coltura cellulare Plat-E per trasduciare iPSC con il s183 TCR in presenza di 1,6-dibromohexane soluzione25.
    5. Il giorno 4, provare gli iPSC trasdotti dal gene TCR s183, centrifugare a 400 x g per 5 min e semi 3 x 105 iPSCs in un piatto di coltura 100 mm pre-rivestito con 3 x 106 irradiato SNL76/7 (irSNL76/7) celle alimentazione25.
    6. Il giorno 5 o 6 di confluenza, provare le cellule, centrifugare a 400 x g per 5 min ed elaborare per lo smistamento cellulare. Gating su cellule vive, ordinare GFP e DsRED cellule doppio-positive (iPSC transdotta dal gene TCR s183) utilizzando una selezionatrice cellulare ad alta velocità. Analogamente al passaggio 1.2.5, la cocoltura delle celle ordinate nelle celle dell'alimentatore irSNL76/7 per un utilizzo futuro25.
  3. Differenziazione delle cellule iPSC-CD8 specifiche dell'HBV
    NOTA: Le celle stromali OP9-DL1/DL4 sovraesprimono sia i ligandri Dich DL1 e DL4, sia gli iPSC co-culminanti con gli iPSC possono promuovere la differenziazione delle cellule T mediata dalla segnalazione di Notch26.
    1. Coltiva iPSC trandotti dal gene TCR s183 (s183/iPSCs) nel monostrato di cellule OP9-DL1-DL4 su supporti me-minimi essenziali (MEM) contenenti il 20% del siero bovino fetale (FBS)27. Includere murine Flt3 ligando (mFlt-3L; concentrazione finale - 5 ng/mL) nella coltura.
    2. Il giorno 0, il seme 0,5–1,0 x 105 S183/iPSC in un piatto di coltura di 10 cm precedentemente coltivato con cellule OP9-DL1-DL4. Verificare che le celle OP9-DL1-DL4 siano in una condizione di confluenza dell'80%-90%.
    3. Il giorno 5, risciacquare gli iPSC con 10 mL di salina con fosfato-buffer (PBS), aspirare al largo del PBS, aggiungere questo a 4 mL di 0,25% di trypsin, e incubare in un incubatore di 37 gradi C per 10 min. Accumulare tutte le soluzioni digestive contenenti le cellule e centrifugare a 400 x g per 5 min a 15-30 gradi centigradi.
    4. Aspirare il supernatante e resospendere le cellule in 10 mL di supporti iPSC. Trasferire la sospensione cellulare in una nuova piastra Petri da 10 cm e incubare in un'incubatrice per 30 min a 37 gradi centigradi.
    5. Dopo 30 min, raccogliere il supporto iPSC contenente le celle galleggianti. Passare la sospensione cellulare attraverso un colino cellulare di 70 m e calcolare il numero di cella.
    6. Seme 5 x 105 cellule nel piatto di coltura precedentemente coltivate cellule OP9-DL1-DL4 con una condizione di 80%–90% confluente come descritto nel passaggio 1.3.1.
      NOTA: per la differenziazione delle cellule T, ogni 2-3 giorni, le cellule derivate da iPSC devono essere nuovamente sottoposte a seeding con un nuovo strato delle celle OP9-DL1-DL4.
  4. valutazione f
    1. Cambiamenti morfologici di differenziazione degli iPSC
      1. Osservare le cellule al microscopio in vari giorni.
        NOTA: Al giorno 5, le colonie hanno caratteristiche simili al mesoderma, che presentano una moderna morfologia classica a forma di mandrino simile ai fibroblasti dermici umani e alla crescita sostenuta in vitro. Al giorno 8, iniziano a comparire piccoli gruppi rotondi di celle.
    2. Analisi delle differenziazione degli iPSC per citometria di flusso
      1. In vari giorni di co-coltura, analizzare le cellule derivate da iPSC come descritto in precedenza25 (Figura 1B,C).
    3. Analisi funzionale degli iPSC differenzianti
      1. Il giorno 28 della co-coltura, raccogliere le cellule iPSC-CD8- T dalle colture attraverso la raccolta delle cellule galleggianti, provare le cellule rimaste con 0.25% trypsin, ri-sospendere in 8 mL di supporti iPSC, centrifugare per 5 min a 400 x g a 15-30 C, rimuovere il supporto, quindi risospendere le celle in 10 mL di supporti.
      2. Conservare le celle risospese in un piatto fresco di 10 cm in un'incubatrice di 37 gradi centigradi per 30 min e assemblare le cellule galleggianti. Quindi sciacquare le cellule una volta con un PBS freddo.
      3. Incubare 3 x 106 T splenociti impoveriti di cellule (CD4-CD8-) da milza di h-2 di classe I knockout, topi HLA-A2.1-transgenici (HHD) con 5 s183 peptide (FLLTRILTI) in 200 litri di supporti a 4 gradi centigradi per 30 min.
      4. Produrre una miscela di cellule iPSC-CD8- T con splenociti pulsati con peptide s183 (cellule T: splenociti - 1:4; utilizzare 0,75 x 106 cellule T). Incubare la miscela di cellule a 37 gradi centigradi in un'incubatrice di CO2 per 40 h. Durante le ultime 7 h, aggiungere 4 . L di brefeldin A diluito nella coltura (concentrazione finale di 1.000x, che sarà diluito in 1x supporti di coltura) per bloccare i processi di trasporto durante l'attivazione cellulare.
      5. Macchiare le cellule ed eseguire l'analisi citometrica del flusso di IFN-z intracellulare come descritto in precedenza(Figura 2).

2. Induzione della replicazione HBV attraverso la consegna idrodinamica del plasmide HBV

NOTA: il costrutto pAAV/HBV1.2 è stato generato come descritto in precedenza9. Il DNA completo HBV 1.2 è incorporato nel pAAV vettoriale.

  1. Consegne idrodinamiche di plasmide HBV attraverso la vena posteriore
    1. Riscaldare i topi HHD utilizzando una lampada termica per 5 minuti nella gabbia al fine di dilatare la vena della coda.
    2. Trattenere l'animale tramite un carrello, e pulire le code di topo con 70% spray etanolo.
    3. Consegna di plasmide nel fegato.
    4. Misurare il peso corporeo del mouse utilizzando una scala di misurazione.
    5. Diluire 10 g di plasmide HBV nell'8% equivalente di massa corporea PBS (ad esempio, 1,6 mL per un mouse da 20 g). Caricare il plasmide diluito in una siringa da 3 mL con un ago ipodermico da 26 G x 1x2" (0,45 x 12 mm).
    6. Posizionare una delle due vene laterali della coda nel terzo centrale della coda e posizionare l'ago in entrambe le vene laterali. Somministrare l'iniezione contenente il plasmide HBV attraverso la vena posteriore entro 3 - 5 s.
  2. Quantificazione della viremia dal siero di sangue dei topi infetti
    NOTA: la replica HBV avviene dal giorno 3-35 nel siero del mouse. La replicazione del DNA raggiunge il picco il giorno 7 e si riduce gradualmente. Il DNA HBV non viene eliminato dal siero fino al giorno 35.
    1. Raccolta del siero di sangue da topi infetti
      1. Raccogliere circa 0,1 mL di sangue in un tubo di microcentrifuga da ogni topo su 3, 5, 7 e 10 giorni dopo l'infezione mediante sanguinamento retroorbitale in un tubo di microcentrifuga da 1,5 ml, quindi incubare a temperatura ambiente (RT) per 20 min.
      2. Centrifugare il campione a 6.000 x g per 15 min a 4 gradi centigradi e raccogliere il siero supernatante dopo la centrifugazione.
    2. Purificare il DNA dal siero del sangue utilizzando un kit di estrazione del DNA disponibile in commercio seguendo le raccomandazioni del produttore. In breve, lisi le cellule in una colonna a base di silice, eseguire i lavamenti ed estrarre il DNA aggiungendo 100% etanolo alla colonna di eluizione e centrifugando a 6000 x g per 1 min. Elute il DNA in 50 :L di acqua senza RNase.
    3. Utilizzare 100 ng di DNA HBV dall'eluzione per l'analisi PCR in tempo reale. Utilizzare i seguenti primer e sonde: forward 5' TAGGAGGCTGTAGGAAATTGG 3'; reverse 5' GCACAGCTTGGAGGCTGT 3'; sonda 5' TCACCTCTGCCTCTAATC 3'.
      1. Utilizzare il genoma HBV contenente plasmide (pAAV/HBV1.2) per la curva standard ed eseguire la PCR in tempo reale in un volume totale di 10(L 3).
    4. Impostare la reazione PCR in un volume totale di 10 ,l, come mostrato nella Tabella 1.
    5. Impostare il programma PCR nel termociclore come illustrato nella tabella 2. Il tasso di transizione programmato della temperatura è di 20 gradi centigradi per la denaturazione/annealing e di 5 C/s per l'estensione. Misurare la fluorescenza alla fine della fase di annealing per ogni ciclo per il monitoraggio PCR in tempo reale.

3. Riduzione della replica HBV da parte dell'ACT delle cellule virali ag-CD8- T

  1. Trasferimento di celle adottivo (ACT)
    1. Differenziare s183/iPSCs (1.3.7) sulle cellule stromali OP9-DL1-DL4 in presenza di mFlt-3L e mIL-7 per 8 giorni, come descritto nella sezione 1.3.
    2. Il giorno 22, raccogliere le cellule iPSC-CD8- T dalla piastra da 10 cm con la trypsin, quindi lavare e riavviare ogni piastra da 10 cm in 10 mL di supporti freschi. Aggiungere le cellule a una piastra fresca di 10 cm e tornare all'incubatrice per 30 min come fatto nella sezione 1.3. Dopo 30 min, raccogliere le cellule galleggianti.
    3. Utilizzare un colino di nylon da 70 m per passare le cellule per eliminare gli ammassi di cellule e contare il numero di cella. Adattare le cellule a una concentrazione di 1,5 x 107 celle/mL in soluzione PBS a freddo e utilizzare un colino di nylon da 70 m per passare le cellule per eliminare nuovamente i cluster di cellule, se necessario. Tenere le cellule sul ghiaccio fino all'ACT.
    4. Iniettare i mouse HHD di 200 (3 x 106 cellule) in mouse HHD di 4-6 settimane attraverso la vena posteriore.
  2. Induzione della replica HBV
    1. Il giorno 14 dopo il trasferimento cellulare, eseguire la consegna idrodinamica del plasmide HBV attraverso la vena posteriore come descritto nella sezione 2.1.
  3. Rilevamento di proteine virali da fegato infetto
    1. Sacrificare i topi nei giorni 3, 5, 7, 14 e 21 post-infezione. Per l'eutanasia, in ogni gabbia, utilizzare 1–2 L di anidride carbonica (CO2)nella prima fase. Quando l'animale sviluppa la perdita di coscienza, ottenere la portata di CO2 intorno a 4-5 L/min. Eseguire l'eutanasia del topo utilizzando l'inalazione di CO2.
    2. Separare il fegato tagliando la pelle superficiale del peritoneo utilizzando forbici e pinze e trascinando leggermente il fegato indietro per scoprire la pelle interna che rivestola la cavità peritoneale. Raccogliere e tagliare i campioni di fegato (lunghezza x larghezza x altezza x 0,5 cm x 0,5 cm x 0,3 cm) dei topi infetti per adattarsi facilmente alla cassetta di incorporamento e bloccare in formalina buffer neutro 10% per 4-24 h.
    3. Decalcificare i campioni di fegatoutilizzando 2,5 M di acido formica; risciacquo in xilene per 3 min, risciacquare 2x in 100% etanolo, risciacquare 2x nel 95% di etanolo, risciacquare 2x in acqua deionizzata (DI) per 2 min, quindi decalcificare i campioni di fegato in 1 mM di acido etilenetratratratraeacetica (EDTA) corrispondentemente. Maneggiare a una temperatura sub-ebollizione (90 gradi centigradi) per 20 min.
    4. Raffreddare i tessuti epatici fissi per 30 min. Sciacquare i tessuti con 1x PBS per 4 min e incorporare i tessuti in paraffina. Disidratare i tessuti in una serie di crescenti concentrazioni di etanolo per sostituire l'acqua, e quindi immergersi in immersione xilene. Incorporare i tessuti infiltrati in blocchi di cera. Fare un sezionamento uniformemente verticale e orizzontale per la colorazione. Preparare 4 sezioni con un microtoma scorrevole.
    5. Passare le sezioni attraverso la deparaffinizzazione e la reidratazione utilizzando xilene ed etanolo, quindi eseguire la colorazione immunofluorescente delle sezioni.
    6. Macchiare le sezioni con 200 l di anticorpo specifico AG della superficie HBV (1:100 diluizione nella soluzione di blocco). Incubare le sezioni con l'anticorpo per 2 h a RT in una camera umidificata 75%–100% e lavare 5 volte in 1 x PBS per 5 min.
    7. Utilizzare un reagente anti-dissolvenza contenente 4',6-diamidino-2-fenylindole (DAPI) per la colorazione nucleare per contrastare i vetrini. Aggiungere la coverslip con circa 300 gradi l della diluita soluzione di colorazione DAPI (300 nM in 1x PBS) e convalidare l'intero coperchio coperto coperto. Tenere i vetrini al buio a 4 gradi centigradi fino all'ispezione al microscopio fluorescente.
  4. Infiltrazione infiammatoria delle cellule nei topi infetti
    1. Sacrificare i topi come descritto al punto 3.3.1. Raccogliere il fegato e fare sezioni come descritto nel passaggio 3.3.4.
    2. Macchiare la sezione con ematossilina ed eosina (H&E) per valutare l'infiltrazione delle cellule infiammatorie nel fegato.
    3. Conservare i vetrini al buio a 4 gradi centigradi fino a completare un'ulteriore analisi al microscopio fluorescente.
    4. Visualizzare i vetrini al microscopio a fluorescenza per rilevare l'infiltrazione delle cellule infiammatorie nel fegato (Figura 4).
  5. Rilevamento del DNA HBV del fegato infetto
    1. Isolamento del DNA virale.
    2. Eutanasia topi e raccogliere i campioni di fegato secondo la sezione 3.3.
    3. Lyse i tessuti epatici in Nonindet P-40 (NP-40) lyssi buffer (50 mM Tris-HCL, 1 mM EDTA, 1% NP-40) contenente un cocktail inibitore proteasi.
    4. Centrifuga brevemente a 16.000 x g per rimuovere i nuclei e detriti cellulari.
    5. Incubare il lisacito citoplasmico con nucleale micrococcico (nucleato S7; 150 unità/mL) e CaCl2 (5 mM) a 37 s per 90 min per degradare l'acido nucleico al di fuori dei nucleocapsidi (NC).
    6. Inattivare il nuclease S7 con l'aggiunta di 10 mM EDTA.
    7. Precipitare i nucleocapsidi con glicole di polietilene (PEG), interrompere dello 0,5% solfato di sodio dodecyl (SDS) e digerire con la proteinasi K (PK) di 0,6 mg/mL a 37 gradi centigradi per 1 h.
    8. Recuperare gli acidi nucleici virali mediante estrazione di cloroformio fenolo e precipitazioni di etanolo.
    9. Risolvere il DNA virale estratto su un gel di agarose dell'1,2% e rilevarlo mediante l'analisi standard della macchia meridionale utilizzando una sonda di DNA HBV con etichetta32 P.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Come mostrato qui, HBV virale Ag-specifico iPSC-CD8- le cellule T sono generate da un sistema di coltura in vitro. Dopo l'ACT di questi iPSC-CD8 virali specifici di Ag8- Le cellule T sopprimono sostanzialmente la replica HBV in un modello murino (File supplementare 1). Mouse iPSC sono tradotti con il costrutto retrovirale MIDR codificando un gene ibrido HBV TCR umano-mouse (HBs183-191-specific,s183), quindi gli iPSC trandotti dal gene sono co-coltivati con cellule OP9-DL1/DL4 che esprimono ligandi Notch (sia DL1 che DL4) molecole in presenza di rFlt3L e rIL-7. Il giorno 28 della co-coltura in vitro, le cellule derivate dall'iPSC esprimono sostanzialmente CD3 e TCR specifico di Ag (marcatori di cellule T). L'analisi citometricadel flusso indica che la trasduzione TCR HBV aumenta notevolmente la generazione di cellule CD8- T specifiche di s183 - specifiche di s183 - virali(Figura 1).

Il giorno 28 della co-coltura invitro, viene valutato l'iPSC-CD8 -single-positive (SP)- T cellule sono isolate e stimolate da splenociti impoveriti da T, pulsati con peptide s183 e produzione di citochine. Gli iPSC-CTL producono grandi quantità di IL-2 e IFN-z come rilevato dalla colorazione intracellulare o ELISA(Figura 2). L'infezione da HBV è indotta nei topi transgenici HLA-A2.1 mediante iniezione idrodinamica di 10 g di pAAV/HBV1.2 plasmide di DNA attraverso le vene posteriori dei topi. La replica HBV è stata rilevata dal giorno 3-21 nel siero dei topi HHD. La replicazione del DNA raggiunge il picco il giorno 6 e si riduce gradualmente utilizzando l'analisi PCR in tempo reale (Figura 3).

Due settimane dopo l'ACT, i topi sono sfidati con un'iniezione idrodinamica di pAAV/HBV1.2 plasmide di DNA. Il tibore virale è misurato da PCR in tempo reale dal siero in vari momenti dopo l'iniezione. I risultati dimostrano che la replicazione virale è significativamente ridotta in tutti i momenti nei topi che ricevono cellule T virali di HBV ad Ag rispetto ai topi che ricevono cellule di controllo (Figura 4A). L'espressione della proteina superficiale HBV viene esaminata anche nel fegato nell'impostazione di cui sopra del trattamento. I topi sono eutanasia in vari giorni dopo l'iniezione di HBV e i campioni di fegato sono isolati per l'esame istologico. I campioni sono macchiati per la proteina superficiale HBV ed esaminati al microscopio a fluorescenza. La proteina superficiale HBV è osservata come sostanzialmente diminuita nei topi che ricevono HBV virali Ag-specifici pre-iPSC-CTL, rispetto ai topi che ricevono cellule di controllo (Figura 4B). Questo esperimento dimostra chiaramente che le cellule virali iPSC-CD8 specifiche di Ag hanno la capacità di ridurre la replica HBV nel modello murino.

Figure 1
Figura 1: Generazione di cellule iPSC-CD8 specifiche dell'HBV Ag.
Gli iPSC murini sono trasdotti con i seguenti costrutti retrovirali: HBs183-91 TCR (MiDR-s183 TCR) o OVA257–264 TCR (MiDR-OVA TCR), e gli iPSC tradutti sono co-coltivati con cellule stromali OP9-DL1/DL4 per la differenziazione di linea T. (A) Rappresentazione schematica del costrutto retrovirale MiDR-s183 TCR che esprime TCR specifico di s183. Segnale di imballaggio; 2A - sequenza picornavirus auto-cleaving 2A; LTR: ripetizioni lunghe del terminale. (B) Morfologia della differenziazione delle cellule T nei giorni 0, 7, 14 e 22. (C) Analisi citometrica di flusso per le cellule derivate da iPSC il giorno 28. Lecellule (a sinistra) sono gated come indicato e analizzate per l'espressione di CD8 e TCRV-28 (a destra). I dati mostrati sono rappresentativi di tre esperimenti individuali. I valori rappresentano i test t -D : (-p < 0.01; coppie t-test). Fare clic qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2: Analisi funzionale delle cellule iPSC-CD8 specifiche dell'HBV Ag.
Il giorno 28 della co-coltura in vitro, vengono ordinati i pentameri SP CD8es183 TCR- iPSC-T. Le cellule iPSC-T e le cellule T CD8- T trasdotte con MiDR-s183 TCR sono stimolate da splenociti impoveriti di T (APC) da topi HHD e pulsate con peptide s183 (FLLTRILTI). (A) Colorazione intracellulare di IFN-z dopo 7 h (gated su CD8- cellule) (T/APC - 1:4). (B) ELISA di IFN-z dopo 40 h. I dati mostrati sono rappresentativi di tre esperimenti individuali. I valori rappresentano la media : SD (n.s., p > 0.05; t-test accoppiati). Fare clic qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3: Induzione della replicazione HBV nei topi HHD mediante iniezione idrodinamica.
I topi HHD sono i.v. amministrati con plasmide HBV tramite iniezione di vena coda idrodinamica. Vengono iniettati 10 g di plasmico con l'8% della massa corporea totale PBS. Nei punti temporali indicati dopo l'iniezione, il siero viene isolato dal sangue e il DNA viene estratto per la PCR in tempo reale. I dati mostrati sono rappresentativi di tre esperimenti individuali. I valori rappresentano la media : i dati Sono rappresentativi di cinque mouse per gruppo di tre esperimentiindipendenti. Fare clic qui per visualizzare una versione più grande di questa figura.

Figure 4
Figura 4: Riduzione della replica HBV da parte dell'ACT delle cellule virali iPSC-CD8 -T specifiche di Ag.
I topi HHD sono i.v. adottivi trasferiti con iPSC-CD8 virale specifico di Ag - progenitori delle cellule T (il giorno 22 della coltura in vitro) e amministrati con plasmide HBV alla settimana 2 dopo il trasferimento cellulare. (A) Siero HBV copie. Ai momenti indicati dopo l'iniezione, il siero viene isolato dal sangue e il DNA viene estratto per l'analisi PCR in tempo reale. I dati mostrati sono rappresentativi di tre esperimenti individuali. I valori rappresentano l'istologia dei tessuti epatici SD.(B). I topi sono eutanasia all'infezione dopo l'HBV giorno 8. I campioni di fegato sono isolati e macchiati per l'esame istologico. Il pannello superiore mostra l'espressione della proteina HBsAg nei topi infetti (colorazione IHC) e il pannello inferiore mostra l'infiltrazione infiammatoria delle cellule (colorazione HE). I dati sono rappresentativi di cinque topi per gruppo di tre esperimenti indipendenti. Fare clic qui per visualizzare una versione più grande di questa figura.

Modello di DNA 2 ml
Miscela di ibridazione master del DNA ((polimerasi del DNA Taq, buffer di reazione PCR, 10 mM MgCl2 e miscela dNTP) 1 ml
25 mM MgCl2 0,8 ml
0,3 M la sonda 3 ml
5 M di ogni primer 3,2 ml
totale 10 ml

Tabella 1: volume di reazione PCR

temperatura ora
Denaturazione 95 gradi centigradi 5 s
ricottura 53 gradi centigradi 10 s
interno 72 gradi centigradi 20 s
5 gradi centigradi

Tabella 2: Programma PCR

File supplementare 1: Fare clic qui per scaricare questo file.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Questo protocollo presenta un metodo per generare gli iPSC-CTL virali specifici di Ag da utilizzare come ACT per sopprimere la replica HBV in un modello murino. Nell'infezione cronica da HBV, il genoma virale forma un mini cromosoma stabile, il DNA circolare covalentmente chiuso (cccDNA) che può persistere per tutta la durata della vita dell'epatocito. Mirare alla clearance del mini cromosoma virale può provocare una cura dell'infezione cronica da HBV. L'attuale terapia antivirale si rivolge alla trascrizione inversa del virus, ma raramente stabilisce il controllo immunologico sulla replicazione HBV guidata dal cccDNA. CD8- CTL specifici per HBV possono mediare l'uccisione degli epatociti infetti e accelerare lo sgombero del cccDNA. Tuttavia, i CTL specifici dell'HBV vengono eliminati, disfunzionali o soccombere all'esaurimento nei pazienti con infezione cronica da HBV. L'ACT con i CL specifici dell'HBV è un trattamento favorevole per l'infezione cronica da HBV28,29. I linfociti T derivati da cellule T di memoria naive o centrale (cioè cellule immunitarie altamente reattive) sono efficaci ideali per le terapie basate su ACT a causa della loro grande proliferazione, della minore tendenza alla morte rispetto alle cellule differenziate terminalmente e capacità di rispondere alle citochine omeostatiche. Tuttavia, tale ACT spesso non è stato fattibile a causa delle difficoltà nell'ottenere un numero sufficiente di CTL dai pazienti. È stato dimostrato in precedenza che la riprogrammazione di CTL specifici di Ag o Treg da iPSC può essere utilizzata per terapie basate su cellule20,23,27,30. Questo rapporto dimostra un metodo per generare iPSC-CTL virali specifici dell'Ag e utilizzare queste cellule per l'immunoterapia basata su ACT in un modello murino di replicazione HBV.

Sebbene esistano modelli murini transgenici della replicazione dell'HBV, questi modelli sono impegnativi perché la tolleranza centrale indotta dai prodotti genici transgenici fa sì che i topi siano immuni tolleranti all'HBV Ags. Inoltre, i topi transgenici non sono adatti per monitorare la clearance virale in quanto il genoma integrato HBV persiste in ogni cellula murina31,32. Inoltre, nonostante che siano stati sviluppati vaccini efficaci per prevenire l'infezione, il trattamento o l'immunoterapia dopo l'infezione da HBV non è stato sviluppato. Inoltre, gli approcci sperimentali alla patogenesi HBV sono stati ostacolati perché la gamma ospite dell'infezione da HBV è limitata agli uomini e agli scimpanzé, e il sistema di coltura in vitro per la propagazione dell'HBV non è sufficiente. CD8- Le cellule T sono promettenti cellule eftraenti contro vari tipi di infezione virale; tuttavia, la risposta delle cellule T contro l'HBV non è abbondante. La causa può essere la specificità, il funzionamento e la mancanza di numeri sufficienti per montare una risposta immunitaria. Questo rapporto rivela il metodo di iniezione idrodinamica che induce in modo efficiente la replicazione HBV nei topi. Il metodo consente la consegna di una grande quantità di plasmide HBV direttamente nel fegato. Il modello presenta viremia continua per più di 8 settimane con rilevamento di mRNA, proteine e DNA HBV in giorni diversi dopo l'iniezione. Questo metodo per la replicazione dell'HBV nei topi è utile per l'immunoterapia HBV.

In sintesi, la replicazione HBV è stata indotta con successo nei topi attraverso la procedura di iniezione idrodinamica e gli iPSC-CTL virali specifici dell'Ag sono stati utilizzati come immunoterapia per la replicazione dell'HBV. Tuttavia, ci sono due limitazioni del metodo: (1) più di tre settimane di differenziazione delle cellule T in vitro possono ridurre le applicazioni traslazionali delle cellule T generate per ACT; e (2) l'iniezione idrodinamica HBV può indurre in modo efficiente la replicazione dell'HBV nel fegato; tuttavia, non forma il cccDNA, che è la ragione principale per l'infezione costante HBV. Tuttavia, il metodo fornisce un approccio alternativo per la replicazione e il trattamento dell'HBV. Un regime combinato con farmaci anti-HBV e l'ACT di iPSC-CTL virali specifici di Ag è probabile che riduca i serbatoi dell'HIV, con conseguente terapia per l'infezione da HIV cronica.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno nulla da rivelare.

Acknowledgments

Gli autori ringraziano il Dr. Adam J Gehring del Toronto General Hospital Research Institute per aver fornito cDNA per HBs183-91 (s183) (FLLTRILTI) - specifici geni TCR umano-murine con restrizioni A2, e il Dr. Pei-Jer Chen della National Taiwan University per aver fornito pAAV/HBV 1.2. Questo lavoro è supportato dal National Institute of Health Grant R01AI121180, R01CA221867 e R21AI109239 a J. S.

Materials

Name Company Catalog Number Comments
HHD mice Institut Pasteur, Paris, France H-2 class I knockout, HLA-A2.1-transgenic (HHD) mice
iPS-MEF-Ng-20D-17 RIKEN Cell Bank APS0001
SNL76/7 ATCC SCRC-1049
OP9 ATCC CRL-2749
pAAV/HBV1.2 plasmid Dr. Dr. Pei-Jer Chen (National Taiwan University Hospital, Taiwan) HBV DNA construct
HBs183-91(s183) (FLLTRILTI)-specific TCR genes Dr. Adam J Gehring (Toronto General Hospital Research Institute, Toronto, Canada) FLLTRILTI-specific A2-restricted human-murine hybrid TCR genes (Vα34 and Vβ28)
OVA257–264-specific TCR genes Dr. Dario A. Vignali (University of Pittsburgh, PA) SIINFEKL-specific H-2Kb-restricted TCR genes
Anti-CD3 (17A2) antibody Biolegend 100236
Anti-CD44 (IM7) antibody BD Pharmingen 103012
Anti-CD4 (GK1.5) antibody Biolegend 100408
Anti-CD8 (53-6.7) antibody Biolegend 100732
Anti-IFN-γ (XMG1.2) antibody Biolegend 505810
Anti-TNF-a (MP6-XT22) antibody Biolegend 506306
α-MEM Invitrogen A10490-01
Anti-HBs antibody Thermo Fisher MA5-13059
ACK Lysis buffer Lonza 10-548E
Brefeldin A Sigma B7651
DMEM Invitrogen ABCD1234
FBS Hyclone SH3007.01
FACSAria Fusion cell sorter BD 656700
Gelatin MilliporeSigma G9391
GeneJammer Agilent 204130
HLA-A201-HBs183-91-PE pentamer Proimmune F027-4A - 27
HRP Anti-Mouse Secondary Antibody Invitrogen A27025
mFlt-3L Peprotech 250-31L
mIL-7 Peprotech 217-17
Nuclease S7 Roche 10107921001
Paraformaldehyde MilliporeSigma P6148-500G Caution: Allergenic, Carcenogenic, Toxic
Permeabilization buffer Biolegend 421002
Polybrene MilliporeSigma 107689
ProLong™ Gold Antifade Mountant with DAPI Invitrogen P36931
QIAamp MinElute Virus Spin Kit Qiagen 57704

DOWNLOAD MATERIALS LIST

References

  1. Scaglione, S. J., Lok, A. S. Effectiveness of hepatitis B treatment in clinical practice. Gastroenterology. 142, (6), 1360-1368 (2012).
  2. Osiowy, C. From infancy and beyond... ensuring a lifetime of hepatitis B virus (HBV) vaccine-induced immunity. Human Vaccines & Immunotherapeutics. 14, (8), 2093-2097 (2018).
  3. Gish, R. G., et al. Loss of HBsAg antigen during treatment with entecavir or lamivudine in nucleoside-naive HBeAg-positive patients with chronic hepatitis B. Journal of Viral Hepatitis. 17, (1), 16-22 (2010).
  4. Kurktschiev, P. D., et al. Dysfunctional CD8+ T cells in hepatitis B and C are characterized by a lack of antigen-specific T-bet induction. Journal of Experimental Medicine. 211, (10), 2047-2059 (2014).
  5. Fisicaro, P., et al. Antiviral intrahepatic T-cell responses can be restored by blocking programmed death-1 pathway in chronic hepatitis B. Gastroenterology. 138, (2), 682-693 (2010).
  6. Schurich, A., et al. The third signal cytokine IL-12 rescues the anti-viral function of exhausted HBV-specific CD8 T cells. PLoS Pathogens. 9, (3), 1003208 (2013).
  7. Gehring, A. J., et al. Engineering virus-specific T cells that target HBV infected hepatocytes and hepatocellular carcinoma cell lines. Journal of Hepatology. 55, (1), 103-110 (2011).
  8. Xia, Y., et al. Interferon-gamma and Tumor Necrosis Factor-alpha Produced by T Cells Reduce the HBV Persistence Form, cccDNA, Without Cytolysis. Gastroenterology. 150, (1), 194-205 (2016).
  9. Huang, L. R., Wu, H. L., Chen, P. J., Chen, D. S. An immunocompetent mouse model for the tolerance of human chronic hepatitis B virus infection. Proceedings of the National Academy of Sciences U.S.A. 103, (47), 17862-17867 (2006).
  10. Wong, P., Pamer, E. G. CD8 T cell responses to infectious pathogens. Annual Review of Immunology. 21, 29-70 (2003).
  11. Murray, J. M., Wieland, S. F., Purcell, R. H., Chisari, F. V. Dynamics of hepatitis B virus clearance in chimpanzees. Proceedings of the National Academy of Sciences USA. 102, (49), 17780-17785 (2005).
  12. Hinrichs, C. S., et al. Adoptively transferred effector cells derived from naive rather than central memory CD8+ T cells mediate superior antitumor immunity. Proceedings of the National Academy of Sciences U.S.A. 106, (41), 17469-17474 (2009).
  13. Hinrichs, C. S., et al. Human effector CD8+ T cells derived from naive rather than memory subsets possess superior traits for adoptive immunotherapy. Blood. 117, (3), 808-814 (2011).
  14. Kerkar, S. P., et al. Genetic engineering of murine CD8+ and CD4+ T cells for preclinical adoptive immunotherapy studies. Journal of Immunotherapy. 34, (4), 343-352 (2011).
  15. Kuball, J., et al. Facilitating matched pairing and expression of TCR chains introduced into human T cells. Blood. 109, (6), 2331-2338 (2007).
  16. van Loenen, M. M., et al. Mixed T cell receptor dimers harbor potentially harmful neoreactivity. Proceedings of the National Academy of Sciences USA. 107, (24), 10972-10977 (2010).
  17. Cameron, B. J., et al. Identification of a Titin-derived HLA-A1-presented peptide as a cross-reactive target for engineered MAGE A3-directed T cells. Science Translational Medicine. 5, (197), (2013).
  18. Fedorov, V. D., Themeli, M., Sadelain, M. PD-1- and CTLA-4-based inhibitory chimeric antigen receptors (iCARs) divert off-target immunotherapy responses. Science Translational Medicine. 5, (215), (2013).
  19. Maus, M. V., et al. T cells expressing chimeric antigen receptors can cause anaphylaxis in humans. Cancer Immunolology Research. 1, (1), 26-31 (2013).
  20. Haque, R., et al. Programming of regulatory T cells from pluripotent stem cells and prevention of autoimmunity. Journal of Immunology. 189, (3), 1228-1236 (2012).
  21. Vizcardo, R., et al. Regeneration of human tumor antigen-specific T cells from iPSCs derived from mature CD8(+) T cells. Cell Stem Cell. 12, (1), 31-36 (2013).
  22. Nishimura, T., et al. Generation of rejuvenated antigen-specific T cells by reprogramming to pluripotency and redifferentiation. Cell Stem Cell. 12, (1), 114-126 (2013).
  23. Lei, F., et al. In vivo programming of tumor antigen-specific T lymphocytes from pluripotent stem cells to promote cancer immunosurveillance. Cancer Research. 71, (14), 4742-4747 (2011).
  24. Kim, J. B., et al. Oct4-induced pluripotency in adult neural stem cells. Cell. 136, (3), 411-419 (2009).
  25. Lei, F., Haque, R., Xiong, X., Song, J. Directed differentiation of induced pluripotent stem cells towards T lymphocytes. Journal of Visualized Experiments. (63), e3986 (2012).
  26. Lei, F., Haque, M., Sandhu, P., Ravi, S., Ni, Y., Zheng, S., Fang, D., Jia, H., Yang, J. M., Song, J. Development and characterization of naive single-type tumor antigen-specific CD8+ T lymphocytes from murine pluripotent stem cells. OncoImmunology. 6, (2017).
  27. Haque, M., et al. Melanoma Immunotherapy in Mice Using Genetically Engineered Pluripotent Stem Cells. Cell Transplantation. 25, (5), 811-827 (2016).
  28. Tan, A. T., et al. Use of Expression Profiles of HBV DNA Integrated Into Genomes of Hepatocellular Carcinoma Cells to Select T Cells for Immunotherapy. Gastroenterology. (2019).
  29. Wu, L. L., et al. Ly6C(+) Monocytes and Kupffer Cells Orchestrate Liver Immune Responses Against Hepatitis B Virus in Mice. Hepatology. (2019).
  30. Haque, M., et al. Stem cell-derived tissue-associated regulatory T cells suppress the activity of pathogenic cells in autoimmune diabetes. Journal of Clinical Investigation Insights. (2019).
  31. Chisari, F. V., et al. Structural and pathological effects of synthesis of hepatitis B virus large envelope polypeptide in transgenic mice. Proceedings of the National Academy of Sciences USA. 84, (19), 6909-6913 (1987).
  32. Wirth, S., Guidotti, L. G., Ando, K., Schlicht, H. J., Chisari, F. V. Breaking tolerance leads to autoantibody production but not autoimmune liver disease in hepatitis B virus envelope transgenic mice. Journal of Immunology. 154, (5), 2504-2515 (1995).
Le cellule staminali derivate dall'ag virale specifico t linfociti sopprimeno la replica HBV nei topi
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Xiong, X., Lei, F., Haque, M., Song, J. Stem Cell-Derived Viral Ag-Specific T Lymphocytes Suppress HBV Replication in Mice. J. Vis. Exp. (151), e60043, doi:10.3791/60043 (2019).More

Xiong, X., Lei, F., Haque, M., Song, J. Stem Cell-Derived Viral Ag-Specific T Lymphocytes Suppress HBV Replication in Mice. J. Vis. Exp. (151), e60043, doi:10.3791/60043 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter