Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Stamcells-härledda viral AG-specifika T-lymfocyter undertrycka HBV-replikering hos möss

doi: 10.3791/60043 Published: September 25, 2019

Summary

Presenteras här är ett protokoll för effektiv dämpning av hepatit B-virus (HBV) replikering hos möss genom att använda adoptiv cell överföring (ACT) av stamceller härledda viral antigen (AG)-specifika T-lymfocyter. Detta förfarande kan anpassas för potentiell ACT-baserad immunterapi av HBV-infektion.

Abstract

Infektion med hepatit B-virus (HBV) är en global hälsofråga. Med över 350 000 000 människor drabbade världen, HBV-infektion är fortfarande den vanligaste orsaken till levercancer. Detta är ett stort bekymmer, särskilt i utvecklingsländerna. Fel i immunförsvaret att montera ett effektivt svar mot HBV leder till kronisk infektion. Även om HBV-vaccin förekommer och nya antivirala läkemedel skapas, är utrotning av virus-reservoarceller fortfarande en viktig hälsofråga. Beskrivs här är en metod för generering av viral antigen (AG)-specifika CD8+ cytotoxiska T-lymfocyter (CTL) härrör från inducerad pluripotenta stamceller (iPSCs) (dvs, IPSC-ctls), som har förmågan att undertrycka HBV-replikering. HBV-replikation induceras effektivt i möss genom hydrodynamisk injektion av en HBV-Expression plasmid, pAAV/HBV 1.2, i levern. Sedan, HBV yta AG-specifika mus iPSC-CTL är adoptiv överförs, vilket kraftigt dämpar HBV-replikering i levern och blodet samt förhindrar HBV yta AG uttryck i hepatocyter. Denna metod visar HBV-replikering hos möss efter hydrodynamisk injektion och att stamcells härledda virala AG-specifika CTL kan undertrycka HBV-replikering. Detta protokoll ger en användbar metod för HBV-immunoterapi.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Efter akut infektion kontrollerar det adaptiva immunsystemet (dvs., humorala och cellulära immunitet) huvuddelen av akut HBV-relaterad hepatit. Fortfarande, ett antal personer i HBV-endemiska regioner kan inte eliminera virusen och därefter konvertera som kroniska individer. Mer än 25% av kroniska patienter (> 250 miljoner människor) över hela världen utveckla progressiv leversjukdom, vilket resulterar i levercirros och/eller Hepatocellulär cancer (HCC)1. Som ett resultat av detta förblir utrotning av envist infekterade celler ett allmänt sundhet problem, även om det finns ett tillgängligt vaccin2 och många antivirala läkemedel är under utveckling. Standard behandling för HBV-infektion inkluderar IFN-α, nukleosid och nukleotidanaloger. Dessa agenter har direkt antiviral aktivitet och immunmodulerande kapacitet. Icke desto mindre uppträder serokonversion av HBe antigen (AG)+ bärare med anti-HBE-antikropp (AB) och förlust av serumhbv-deoxyribonukleinsyra (DNA) individuellt hos cirka 20% av de behandlade patienterna, och hela den immunologiska kontrollen av viruset som verifierats av förlusten av HBsAg är högst 5%3. Dessutom är svaret på behandlingen ofta inte hållbart. Profylaktisk vaccination med rekombinant HBs AG är mycket effektivt för att förebygga infektion, men terapeutisk HBs AG-vaccination är inte effektiv. Tydligt, T cell-medierade immunsvar spelar en avgörande roll för att kontrollera HBV-infektion och nedsatt leverfunktion; men, hos kroniska hepatit patienter, HBV-reaktiva T-celler är ofta bort, dysfunktionella, eller konvertera utmattad4,5,6. Följaktligen, hos personer med ihållande HBV-infektion, inga försök att återinföra HBV-specifik immunitet (dvs., T-cellbaserad immunitet) med hjälp av anti-viral Remedy, Immuno-modulatoriska cytokiner, eller läkande immunisering har uppnått framgång.

Adoptiv cell överföring (Act) av HBV AG-specifika T-celler är en effektiv behandling inriktad på att så småningom utrota kvarvarande hepatocyter wih HBV7,8. ACT av HBV-specifika CTL till HBV-infekterade möss har visat sig orsaka övergående, mild hepatit, och en dramatisk minskning av HBV-ribonukleinsyra (RNA) transkriptioner i hepatocyter. I dessa studier hämmade CTLs inte transkription av HBV-gener men förbättrade nedbrytningen av HBV-transkriptioner9. HBV-specifika CTLs är viktiga för att förhindra virusinfektion och medla clearance av HBV10,11. För ACT-baserade rättsmedel, in vitro-expansion av HBV-specifika T-celler med en hög reaktivitet för in vivo vidarebosättning har föreslagits vara en idealisk metod12,13,14; icke desto mindre är de nuvarande strategierna begränsade när det gäller deras förmåga att generera, separera och odla lämpliga mängder och kvaliteter av HBV-specifika T-celler från patienter för potentiella terapier.

Även om kliniska prövningar presenterar säkerhet, genomförbarhet, och prospektiv terapeutisk aktivitet av cellbaserade behandlingar med hjälp av konstruerade T-celler som är specifika för HBV-virus-infekterade hepatocyter, det finns bekymmer om de ogynnsamma effekter inträffar från autoimmuna reaktioner på grund av korreaktivitet från mispvädring T cell receptor (TCR)15,16, off-Target AG erkännande av icke-specifika TCR17 och on-target off-toxicitet av en chimär AG-receptorn (bil) 18 , 19 med friska vävnader. För närvarande är de genetiskt modifierade T-cellerna, som endast har kortvarig beständighet in vivo, vanligtvis mellanliggande eller senare effektort celler. Till datum, pluripotenta stamceller (PSCs) är den enda tillgängliga källan för att generera stora mängder av naiva Single-typ AG-specifika T-celler20,21,22,23. Inducerade PSC: er (iPSCs) omvandlas helt enkelt från patientens somatiska celler genom användning av gentransduktion av flera transkriptionsfaktorer. Som ett resultat av detta har iPSCs liknande egenskaper som de hos embryonala stamceller (ESCs)24. På grund av flexibiliteten och möjligheten för den oändliga förmågan att själv förnya, förutom vävnads ersättning, iPSC-baserade behandlingar kan vara allmänt tillämpas i regenerativ medicin. Dessutom kan de regementen som är underliggande iPSCs avsevärt förbättra nuvarande cellbaserade terapier.

Det övergripande målet med denna metod är att generera en stor mängd HBV-specifika CTL från iPSCs (dvs., iPSC-CTLs) för ACT-baserad immunterapi. Fördelarna jämfört med alternativa tekniker är att HBV-specifika iPSC-CTLs har en enda typ TCR och naiva fenotyp, vilket resulterar i mer minne T cell utveckling efter handlingen. Det påvisas att akten av HBV-specifika iPSC-CTL ökar migrationen av funktionella CD8+ T-celler i levern och minskar HBV-replikation i både lever och blod av administrerade möss. Denna metod avslöjar en potentiell användning av viral AG-specifika iPSC-CTL för HBV immunterapi och kan anpassas för att generera andra viral AG-specifika iPSC-T celler för viral immunterapi.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Alla djurförsök godkänns av Texas A & M University Animal Care Committee (IACUC; #2018-0006) och genomförs i enlighet med riktlinjerna från sammanslutningen för bedömning och ackreditering av laboratoriedjur omsorg. Möss används under 6 – 9 veckors ålder.

1. generering av viral AG-specifika CD8+ t celler från iPSCs (IPSC-CD8+ t-celler)

  1. Skapandet av retrovirala konstruktioner
    Anmärkning: TCR α-och β-gener är sammankopplade med 2A självklyva sekvens. Den retrovirala vektorn mscv-IRES-dsred (midr) är dsred+ 23.
    1. Sub-klon HBs183-191 (flltrilti)-specifik a2-begränsad Human-murin hybrid TCR (S183 TCR) gener (vα 34 och Vβ28) i midr att skapa S183 midr konstruera (figur 1A)25.
  2. Retroviral Signaltransduktion
    Notera: Platinum-e (Plat-e) celler används för att paketera retrovirus (bära S183 TCR gener), som ska används för antiretrovirala Transduction. Den Plat-E celler är en effektiv retrovirus förpacknings celler underliggande 293T celler, som utvecklades med hjälp av unika förpackningar konstruktioner via EF1α promotorn att uttrycka retrovirala struktur protein, inklusive gag, pol, och ecotropic ENV.
    1. På en 100 mm kultur rätt, utsäde 3 x 106 Plat-E celler i 8 ml DMEM odlingssubstrat innehållande 10% fetalt kalv serum (FCS) i en inkubator vid 37 ° c med 5% Co2, 1 dag före transfektion.
    2. På dag 0, transfect den S183 MiDR konstruera i Plat-E celler med hjälp av en DNA-transfektion reagens25.
    3. På dag 1, utsäde 1 x 106 iPSCs (GFP+) till en gelatin pre-coated odlings skylt.
    4. På dag 2 – 3, samla retroviruses-innehåller supernatanten från Plat-E cellkultur till transduce iPSCs med S183 TCR i närvaro av 1, 6-dibromohexane lösning25.
    5. På dag 4, trypsinize S183 TCR gen-transduced iPSCs, Centrifugera vid 400 x g för 5 min och utsäde 3 × 105 ipscs i en 100 mm kultur skålen pre-belagda med 3 x 106 bestrålade SNL76/7 (irSNL76/7) Feeder celler25.
    6. På dag 5 eller 6 av Confluence, trypsinize cellerna, Centrifugera vid 400 x g för 5 min och process för cell sortering. Gating på levande cellerna, sortera GFP och DsRED dubbel-positiv cellerna (den S183 TCR gen-transduced iPSCs) användande en hög-fart cell sorterare. Liknar steg 1.2.5, Co-Culture de sorterade cellerna på irSNL76/7 Feeder celler för framtida användning25.
  3. Differentiering av HBV-specifika iPSC-CD8+ T-celler
    Anmärkning: den OP9-DL1/DL4 stromacellstumörer celler överuttrycker både notch ligander DL1 och DL4, och co-culturing iPSCs med iPSCs kan främja notch signalering-medierad T celldifferentiering26.
    1. Odla S183 TCR gen-transduced iPSCs (S183/iPSCs) i OP9-DL1-DL4 cell enskiktslager i α-minsta essentiella mediet (MEM) media som innehåller 20% fetalt Nötkreaturserum (FBS)27. Inkludera murina FLT3 ligand (mflt-3L; slutlig koncentration = 5 ng/ml) i kulturen.
    2. På dag 0, utsäde 0.5-1.0 x 105 S183/iPSCs i en 10 cm kultur maträtt som tidigare VUXIT med OP9-DL1-DL4 celler. Validera att OP9-DL1-DL4-cellerna är i ett tillstånd på 80% – 90% sammanlänkning.
    3. På dag 5, skölj iPSCs med 10 mL fosfatbuffrad saltlösning (PBS), aspirera bort PBS, tillsätt detta till 4 mL 0,25% trypsin, och inkubera i en 37 ° c inkubator för 10 min. efteråt, tillsätt en kompletterande 8 mL iPSC media för att avsluta trypsin matsmältningen. Ackumulera alla matsmältnings lösningar som innehåller cellerna och centrifugera vid 400 x g i 5 min vid 15 – 30 ° c.
    4. Aspirera på supernatanten och Omsuspendera cellerna i 10 mL iPSC-media. Överför cellsuspensionen till en ny 10 cm Petriskplatta och inkubera i en inkubator i 30 min vid 37 ° c.
    5. Efter 30 min, samla iPSC media som innehåller de flytande cellerna. Passera cellsuspensionen genom en 70 μm cell sil och beräkna cellnumret.
    6. Utsäde 5 x 105 celler i kultur skålen tidigare vuxit OP9-DL1-DL4 celler med ett tillstånd av 80%-90% konfluenta som beskrivs i steg 1.3.1.
      Anmärkning: för T celldifferentiering, varje 2 – 3 dagar, iPSC-härledda celler måste re-Seed med ett nytt lager av OP9-DL1-DL4 celler.
  4. Utvärdering
    1. Morfologiska förändringar av differentierande iPSCs
      1. Observera celler under ett Mikroskop på olika dagar.
        Obs: vid dag 5, kolonier har mesoderm-liknande egenskaper, uppvisar en klassisk spindel-form morfologi som liknar Human dermal fibroblaster och ihållande tillväxt in vitro-. Vid dag 8 börjar små runda kluster av celler att dyka upp.
    2. Analys av differentiering av iPSCs med flödescytometri
      1. På olika dagar av samodling, analysera iPSC-härledda celler som beskrivits tidigare25 (figur 1B, C).
    3. Funktionell analys av differentierande iPSCs
      1. På dag 28 av co-Culture, samla iPSC-CD8+ T celler från kulturer genom skörd de flytande cellerna, trypsinize de överblivna cellerna med 0,25% trypsin, re-Suspend i 8 ml av IPSC media, Centrifugera i 5 min vid 400 x g vid 15 – 30 ° c, ta bort media, sedan Omsuspendera cellerna i 10 mL media.
      2. Håll återsuspenderade celler i en ny 10 cm skålen i en 37 ° c inkubator för 30 min och montera de flytande cellerna. Skölj sedan cellerna en gånger med en kall PBS.
      3. Inkubera 3 x 106 T cell-utarmade splenocyter (CD4-CD8-) från mjälte av H-2 klass I knockout, HLA-a 2,1-transgena (HHD) möss med 5 μm S183 peptid (flltrilti) i 200 μl av media vid 4 ° c i 30 min.
      4. Producera en blandning av iPSC-CD8+ T-celler med splenocyter pulsade med S183 peptid (T-celler: splenocyter = 1:4; Använd 0,75 x 106 T-celler). Inkubera blandningen av celler vid 37 ° c i en CO2 inkubator för 40 h. Under de senaste 7 h, tillsätt 4 μL utspädd brefeldin A i kulturen (slutlig koncentration av 1000X, som kommer att spädas i 1x odlingsmedier) för att blockera transportprocesser under cell aktiveringen.
      5. Färga cellerna och utför flödescytometrisk analys av intracellulär IFN-γ som beskrivits tidigare (figur 2).

2. induktion av HBV-replikation genom hydrodynamisk tillförsel av HBV-plasmid

Obs: pAAV/HBV 1.2-konstruktionen genererades enligt tidigare beskrivna9. HBV 1,2 komplett DNA ingår i Vector pAAV.

  1. Hydrodynamiska leveranser av HBV-plasmid genom svans venen
    1. Värm HHD-möss med en värmelampa i 5 min i buren för att vidga svans venen.
    2. Kvarhålla djuret med hjälp av en besprutare, och rengör mus svansar med 70% etanol spray.
    3. Tillförsel av plasmid in i levern.
    4. Mät mus kroppens vikt med hjälp av en Mät skala.
    5. Späd ut 10 μg HBV-plasmid i 8%-motsvarigheten till Body Mass PBS (t. ex. 1,6 mL för en 20 g-mus). Ladda utspädd plasmid i en 3 mL spruta med en 26 G × 12"(0,45 × 12 mm) Hypodermic nål.
    6. Lokalisera en av de två laterala svans venerna i mitten tredjedel av svansen och placera nålen i antingen laterala ven. Administrera injektionen som innehåller HBV-plasmid genom svans venen inom 3-5 s.
  2. Kvantifiering av viremi från blod serum från infekterade möss
    Obs: HBV-replikering sker från dag 3 till 35 i musens serum. DNA-replikation toppar dag 7 och minskar gradvis. HBV-DNA rensas inte från serumet förrän dag 35.
    1. Insamling av blod serum från infekterade möss
      1. Samla in cirka 0,1 mL blod i ett microcentrifugerör från varje mus på 3, 5, 7, och 10 dagar efter infektion av retroorbital blödning i en 1,5 mL microcentrifug röret, sedan Inkubera i rumstemperatur (RT) för 20 min.
      2. Centrifugera provet på 6 000 x g i 15 min vid 4 ° c och samla upp serum supernatanten efter centrifugering.
    2. Rena DNA från blod serum med hjälp av en kommersiellt tillgänglig DNA-extraktion kit enligt tillverkarens rekommendationer. Kortfattat, lyse cellerna i en kiseldioxid-baserad kolumn, utföra tvättar och extrahera DNA genom att tillsätta 100% etanol till elutionskolonnen och centrifugering vid 6000 x g för 1 min. eluera dna i 50 μl av RNase-fritt vatten.
    3. Använd 100 ng av HBV-DNA från elueringen för realtids PCR-analys. Använd följande primers och sonder: Forward 5 ' TAGGAGGCTGTAGGCATAAATTGG 3 '; omvänd 5 ' GCACAGCTTGGAGGCTTGT 3 '; sond 5 ' TCACCTCTGCCTAATC 3 '.
      1. Använd HBV-genomet som innehåller plasmid (pAAV/HBV 1.2) för standardkurva och utför realtids PCR i en total volym på 10 μL (figur 3).
    4. Ställ in PCR-reaktionen i en total volym på 10 μL som visas i tabell 1.
    5. Ställ in PCR-programmet i termocycleren som visas i tabell 2. Den programmerade temperatur övergången är 20 ° c/s för denaturering/glödgning och 5 ° c/s för förlängning. Mät fluorescensen i slutet av glödgnings fasen för varje cykel för realtids PCR-övervakning.

3. reduktion av HBV-replikation genom ACT av viral AG-specifika iPSC-CD8+ T-celler

  1. Adoptiv-cell överföring (agera),
    1. Differentiera S183/iPSCs (1.3.7) på OP9-DL1-DL4 stromaceller i närvaro av mFlt-3L och mIL-7 i 8 dagar som beskrivs i avsnitt 1,3.
    2. På dag 22, samla iPSC-CD8+ T celler från 10 cm plattan med trypsin, sedan tvätta och Omsuspendera varje 10 cm tallrik i 10 ml av färska medier. Tillsätt cellerna till en ny 10 cm plåt och återvänd till inkubatorn i 30 min som det görs i avsnitt 1,3. Efter 30 min, samla flytande celler.
    3. Använd en 70 μm nylon SIL att passera celler för att eliminera cell kluster och räkna cellnumret. Anpassa cellerna till en koncentration av 1,5 x 107 celler/ml i kall PBS lösning och använda en 70 μm nylon SIL att passera celler för att eliminera cell kluster igen om det behövs. Håll celler på is tills handlingen.
    4. Injicera 200 μL cellsuspension (3 x 106 celler) i 4 – 6 veckor gamla HHD-möss genom svans venen.
  2. Induktion av HBV-replikering
    1. På dag 14 efter cell överföring, utför den hydrodynamiska leveransen av HBV-plasmid genom svans venen enligt beskrivningen i avsnitt 2,1.
  3. Virus protein detektion från infekterade lever
    1. Offra möss på dag 3, 5, 7, 14 och 21 efter infektion. För dödshjälp, i varje bur, Använd 1 – 2 liter koldioxid (CO2) i den första etappen. När djuret utvecklar medvetslöshet, få CO2 flödet runt 4 – 5 L/min. utföra mus eutanasi med co2 inandning.
    2. Separera levern genom att skära ytan huden på bukhinnan använda sax och pinmetter och något dra levern tillbaka för att avslöja den inre huden foder i bukhålan. Samla och skär leverprover (längd x bredd x höjd = 0,5 cm x 0,5 cm X 0,3 cm) av de infekterade möss för att passa lätt in i inbäddning kassett och block i 10% neutral buffert formalin för 4 – 24 h.
    3. DECALCIFY levern samplesusing 2,5 M myrsyra; Skölj i xylen i 3 min, skölj 2x i 100% etanol, skölj 2x i 95% etanol, skölj 2x i avjoniserat (di) vatten i 2 min, sedan avkalka leverprover i 1 mm etylendiamintetraättiksyra (EDTA) på motsvarande sätt. Handtag vid en sub-kokande temperatur (90 ° c) för 20 min.
    4. Kyla den fasta levern vävnader för 30 min. Skölj vävnaderna med 1x PBS i 4 min och bädda in vävnaderna i paraffin. Torka av vävnaderna i en serie av ökande koncentrationer av etanol för att ersätta vattnet, och sänk sedan ned i xylendoppning. Bädda in de infiltrerade vävnaderna i vax block. Gör jämn vertikal och horisontell snittning för färgning. Förbered 4 μm sektioner med en glidande mikrotom.
    5. Passera sektionerna genom avparaffinering och rehydrering med xylen och etanol, sedan utföra Immunofluorescerande färgning av sektionerna.
    6. Fläcken delar upp med 200 μL av HBV-ytag-specifik antikropp (1:100 spädning i den blockerande lösningen). Inkubera avsnitten med antikroppen för 2 h vid RT i en 75% – 100% fuktad kammare, och tvätta 5x i 1x PBS i 5 min.
    7. Använd en anti-Fade reagens som innehåller 4 ', 6-diamidino-2-phenylindole (DAPI) för nukleär färgning för att motverka fläckar på bilderna. Tillsätt täckglan med ca 300 μL av den utspädda DAPI-färgningslösningen (300 nM i 1x PBS) och validera hela täckglan täckt. Håll bilderna i mörker vid 4 ° c tills de är i ett fluorescerande Mikroskop.
  4. Inflammatorisk cell infiltration hos infekterade möss
    1. Offra möss enligt beskrivningen i steg 3.3.1. Samla levern och göra avsnitt som beskrivs i steg 3.3.4.
    2. Fläcken avsnittet med hematoxylin och eosin (H & E) att utvärdera infiltration av inflammatoriska celler i levern.
    3. Förvara diabilder i mörker vid 4 ° c tills ytterligare analys under ett fluorescerande Mikroskop.
    4. Visualisera bilder under ett fluorescensmikroskop för att detektera infiltration av inflammatoriska celler i levern (figur 4).
  5. HBV-DNA-detektion av infekterad lever
    1. Isolering av viral DNA.
    2. Euthanize möss och samla in leverprover enligt avsnitt 3,3.
    3. Lyse levern vävnader i Nonindet P-40 (NP-40) lysis buffert (50 mM Tris-HCL, 1 mM EDTA, 1% NP-40) innehållande en proteas inhibitor cocktail.
    4. Kort Centrifugera vid 16 000 x g för att ta bort kärnor och cell skräp.
    5. Inkubera cytoplasmatiska lysat med micrococcal Nuclease (Nuclease S7; 150 enheter/mL) och CaCl2 (5 mm) vid 37 ° c för 90 min att försämra nukleinsyran utanför nucleocapsids (NCS).
    6. Inaktivera Nuclease S7 genom tillsats av 10 mM EDTA.
    7. Fäller nucleocapsids med polyetylenglykol (PEG), störa med 0,5% natriumdodecylsulfat (SDS), och smälta med 0,6 mg/ml proteinas K (PK) vid 37 ° c för 1 h.
    8. Återvinna de virala nukleinsyror genom fenol kloroform utvinning och etanol nederbörd.
    9. Lös den extraherade viral DNA på en 1,2% aguppstod gel och upptäcka genom standard Southern blot analys med en32 P-märkt HBV-DNA-sond.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Som visas här, HBV viral AG-specifika iPSC-CD8+ T celler genereras av en in vitro-kultur system. Efter handling av dessa viral AG-specifika iPSC-CD8+ T celler kraftigt undertrycka HBV replikering i en murin modell (kompletterande fil 1). Mus IPSC är sensorik med midr antiretrovirala konstruera kodning en människa-mus hybrid HBV TCR gen (HBS183-191-specifik, S183), då gen-sensorik iPSCs är co-odlade med OP9-DL1/DL4 celler uttrycker notch ligander (både DL1 och DL4) molekyler i närvaro av rFlt3L och rIL-7. På dag 28 av in vitro Co-Culture, den iPSC-härledda celler uttryckligen uttrycker CD3 och AG-specifika TCR (T cell markörer). Flödescytometrisk analys av CD3+CD8+ populationen visar att HBV TCR-transduktion dramatiskt ökar uppkomsten av viral S183-specifika CD8+ T-celler (figur 1).

På dag 28 av in vitro Co-kultur, CD4-CD8+ enda positiva (SP) IPSC-CD8+ T celler isoleras och stimuleras av T-utarmade splenocyter pulsade med S183 peptid, och cytokin produktion bedöms. IPSC-CTLs producerar stora mängder IL-2 och IFN-Υ som upptäcks genom intracellulär färgning eller ELISA (figur 2). HBV-infektion induceras i HLA-A 2.1 transgena (HHD) möss genom hydrodynamisk injektion av 10 μg pAAV/HBV 1,2 DNA plasmid genom svansen vener av möss. HBV-replikering upptäcks från dag 3 – 21 i serum hos HHD-möss. DNA-replikeringen toppar dag 6 och minskar gradvis med hjälp av realtids PCR-analys (figur 3).

Två veckor efter handlingen utmanas möss med en hydrodynamisk injektion av pAAV/HBV 1.2 DNA-plasmid. Viral titer mäts genom realtids PCR från serum vid olika tidpunkter efter injektionen. Resultaten visar att virusreplikation reduceras signifikant vid alla tidpunkter hos möss som får HBV-virala AG-specifika T-celler jämfört med de möss som får kontrollceller (figur 4a). HBV-ytproteinuttryck undersöks också i levern i ovanstående inställning av behandlingen. Möss är euthanized på olika dagar efter HBV-injektion och leverprover är isolerade för Histologisk undersökning. Proverna färgas för HBV-ytprotein och undersöks under ett fluorescensmikroskop. HBV-ytprotein observeras som väsentligt minskat hos de möss som får HBV-virala AG-specifika pre-iPSC-CTL, jämfört med de möss som får kontrollceller (figur 4B). Detta experiment visar tydligt att viral AG-specifika iPSC-CD8+ T-celler har förmågan att minska HBV-replikering i murin modellen.

Figure 1
Figur 1: generering av HBV viral AG-specifika iPSC-CD8+ T-celler.
Mus iPSCs är sensorik med följande retrovirala konstruktioner: HBS183-91 TCR (midr-S183 TCR) eller OVA257 – 264 TCR (midr-OVA TCR), och sensorik iPSCs är co-odlade med OP9-DL1/DL4 stromaceller för T härstamning. Aschematisk representation av den retrovirala konstruktionen midr-S183 TCR som uttrycker S183-specifik TCR. Ψ = förpacknings signal; 2A = Picornavirus självklyva 2A sekvens; LTR = långa terminalens repetitioner. B) morfologi av T-cellsdifferentiering på dag 0, 7, 14 och 22. Cflödescytometrisk analys av de IPSC-härledda cellerna på dag 28. CD3+CD8+ celler (vänster) är gated som anges och analyseras för uttrycket av CD8 och TCRVβ28 (höger). Data som visas är representativa för tre individuella experiment. Värdena motsvarar medelvärdet ± SD (* * p < 0,01; parade t-test). Vänligen klicka här för att se en större version av denna siffra.

Figure 2
Figur 2: funktionell analys av HBV viral AG-specifika iPSC-CD8+ T-celler.
På dag 28 av in vitro Co-Culture, den SP CD8+S183 TCR pentamer+ IPSC-T celler sorteras. Den IPSC-T celler och CD8+ T celler sensorik med midr-S183 TCR stimuleras av T-utarmade splenocyter (APCS) från HHD möss och pulsade med S183 peptid (flltrilti). (A) intracellulär färgning av IFN-Υ efter 7 h (gated på CD8+ celler) (T/APCS = 1:4). B) Elisa på IFN-γ efter 40 h. uppgifter som visas är representativa för tre individuella experiment. Värdena motsvarar medelvärdet ± SD (NS, p > 0,05; parade t-test). Vänligen klicka här för att se en större version av denna siffra.

Figure 3
Figur 3: induktion av HBV-replikering i HHD-möss genom hydrodynamisk injektion.
HHD-möss administreras intravenöst med HBV-plasmid via hydrodynamisk injektion av svans ven. 10 μg plasmid injiceras med 8% av den totala kroppsmassan PBS. Vid indikerade tidpunkter efter injektion isoleras serumet från blodet och DNA extraheras för realtids PCR. Data som visas är representativa för tre individuella experiment. Värdena representerar medelvärde ± SD. data är representativa för fem möss per grupp med tre oberoende experiment. Vänligen klicka här för att se en större version av denna siffra.

Figure 4
Figur 4: reduktion av HBV-replikation genom ACT av viral AG-specifika iPSC-CD8+ T-celler.
HHD-möss är intravenöst adoptiv överförda med viral AG-specifika iPSC-CD8+ T-stamceller (dag 22 i in vitro-kulturen) och administreras med HBV-plasmid vid vecka 2 efter cell överföringen. A) serum-HBV-kopior. Vid de indikerade tids punkterna efter injektion isoleras serum från blod och DNA extraheras för realtids PCR-analys. Data som visas är representativa för tre individuella experiment. Värdena representerar medelvärdet ± SD.B) levervävnads histologi. Möss är euthanized på dag 8 efter HBV-infektion. Leverprover isoleras och färgas för Histologisk undersökning. Övre panelen visar HBsAg protein uttrycket i infekterade möss (IHC färgning) och nedre panelen visar den inflammatoriska cell infiltration (han-färgning). Data är representativa för fem möss per grupp med tre oberoende experiment. Vänligen klicka här för att se en större version av denna siffra.

DNA-mall 2 ml
DNA Master hybridisering blandning ((Taq DNA-polymeras, PCR-reaktion buffert, 10 mM MgCl2, och dNTP blandning) 1 ml
25 mM MgCl2 0,8 ml
0,3 μM sonden 3 ml
5 μM av varje primer 3,2 ml
Totala 10 ml

Tabell 1: volym för PCR-reaktion

Temperatur Tid
Denaturering 95 ° c 5 s
Glödgning 53 ° c 10 s
Förlängning 72 ° c 20 s
5 ° c

Tabell 2: PCR-program

Kompletterande fil 1: Vänligen klicka här för att ladda ner denna fil.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Detta protokoll presenterar en metod för att generera viral AG-specifika iPSC-CTLs för användning som ACT att undertrycka HBV-replikering i en murin modell. Vid kronisk HBV-infektion, den virala genomet bildar en stabil mini-kromosom, den kovalent slutna cirkulära DNA (cccDNA) som kan kvarstå under hela livslängden av hepatocyte. Inriktning clearance av viral mini-kromosom kan resultera i ett botemedel av kronisk HBV-infektion. Nuvarande antiviral terapi riktar sig till viruset omvänt transkriptase men sällan etablerar immunologisk kontroll över HBV-replikering driven av cccDNA. HBV-specifika CD8+ ctls kan medla dödandet av de infekterade hepatocyterna och påskynda clearance av cccDNA. Icke desto mindre tas de HBV-specifika CTL-värdena bort, dysfunktionella eller ge efter för utmattning hos patienter med kronisk HBV-infektion. Med de HBV-specifika CTL-värdena är en gynnsam behandling för kronisk HBV-infektion28,29. Naiv eller centralminne T-cell-härledda T-lymfocyter (dvs, mycket reaktiva immunceller) är idealiska effektorer för ACT-baserade terapier på grund av deras stora spridning, lägre tendens till döden jämfört med terminellt differentierade celler, och utmärkt förmåga att reagera på homeostatiska cytokiner. En sådan handling har dock ofta inte varit möjlig på grund av svårigheterna att få tillräckligt många CTL-listor från patienter. Det har tidigare visats att omprogrammering av AG-specifika ctls eller Tregs från iPSCs kan användas för cellbaserade terapier20,23,27,30. Denna rapport visar en metod för att generera viral AG-specifika iPSC-CTLs och använda dessa celler för ACT-baserad immunterapi i en murin modell av HBV-replikering.

Även om det finns transgena musmodeller av HBV-replikation, är dessa modeller utmanande eftersom den centrala toleransen induceras av transgena genprodukter gör att möss är immuntoleranta mot HBV-AGS. Dessutom, transgena möss är inte lämpliga för övervakning av viral clearance som den integrerade HBV arvsmassan kvarstår i varje mus cell31,32. Även, trots att framgångsrika vacciner har utvecklats för att förhindra infektion, behandling eller immunterapi efter HBV-infektion har inte utvecklats. Dessutom har de experimentella metoderna för HBV-patogenes hämmats eftersom värd utbudet av HBV-infektion är begränsat till män och schimpanser, och in vitro-kultursystem för förökning av HBV är inte tillräckligt. CD8+ T-celler är lovande effektorceller mot olika typer av virusinfektion; emellertid, T-cellsrespons mot HBV är inte riklig. Specificitet, funktion, och brist på tillräckligt antal för att montera ett immunsvar kan vara orsaken. Denna rapport avslöjar metoden för hydrodynamisk injektion som effektivt inducerar HBV-replikering hos möss. Metoden tillåter leverans av en stor mängd HBV plasmid direkt in i levern. Modellen uppvisar kontinuerlig viremia i mer än 8 veckor med detektion av HBV mRNA, protein och DNA vid olika dagar efter injektion. Denna metod för HBV-replikering hos möss är användbar för HBV-immunoterapi.

Sammanfattnings, HBV-replikering var framgångsrikt induceras i möss genom hydrodynamisk injektion förfarande, och viral AG-specifika iPSC-CTL användes som immunoterapi för HBV-replikering. Det finns dock två begränsningar av metoden: (1) mer än tre veckor av in vitro-T celldifferentiering kan minska den translationella tillämpningar av de genererade T-celler för ACT; och (2) HBV hydrodynamisk injektion kan effektivt inducera HBV-replikation i levern; emellertid, det utgör inte cccDNA, vilket är den främsta orsaken till den ihållande HBV-infektion. Icke desto mindre, metoden ger en alternativ metod för HBV-replikering och behandling. En kombinationsbehandling med anti-HBV-läkemedel och ACT av viral AG-specifika iPSC-CTLs är sannolikt att minska HIV-reservoarer, vilket resulterar i en behandling för kronisk HIV-infektion.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har inget att avslöja.

Acknowledgments

Författarna tackar Dr Adam J Gehring från Toronto General Hospital Research Institute för att tillhandahålla cDNA för HBs183-91 (S183) (FLLTRILTI)-specifika a2-begränsad Human-murin hybrid TCR gener, och Dr Pei-jer Chen från National Taiwan University för att tillhandahålla pAAV/HBV 1,2 konstruktion. Detta arbete stöds av National Institute of Health Grant R01AI121180, R01CA221867 och R21AI109239 till J. S.

Materials

Name Company Catalog Number Comments
HHD mice Institut Pasteur, Paris, France H-2 class I knockout, HLA-A2.1-transgenic (HHD) mice
iPS-MEF-Ng-20D-17 RIKEN Cell Bank APS0001
SNL76/7 ATCC SCRC-1049
OP9 ATCC CRL-2749
pAAV/HBV1.2 plasmid Dr. Dr. Pei-Jer Chen (National Taiwan University Hospital, Taiwan) HBV DNA construct
HBs183-91(s183) (FLLTRILTI)-specific TCR genes Dr. Adam J Gehring (Toronto General Hospital Research Institute, Toronto, Canada) FLLTRILTI-specific A2-restricted human-murine hybrid TCR genes (Vα34 and Vβ28)
OVA257–264-specific TCR genes Dr. Dario A. Vignali (University of Pittsburgh, PA) SIINFEKL-specific H-2Kb-restricted TCR genes
Anti-CD3 (17A2) antibody Biolegend 100236
Anti-CD44 (IM7) antibody BD Pharmingen 103012
Anti-CD4 (GK1.5) antibody Biolegend 100408
Anti-CD8 (53-6.7) antibody Biolegend 100732
Anti-IFN-γ (XMG1.2) antibody Biolegend 505810
Anti-TNF-a (MP6-XT22) antibody Biolegend 506306
α-MEM Invitrogen A10490-01
Anti-HBs antibody Thermo Fisher MA5-13059
ACK Lysis buffer Lonza 10-548E
Brefeldin A Sigma B7651
DMEM Invitrogen ABCD1234
FBS Hyclone SH3007.01
FACSAria Fusion cell sorter BD 656700
Gelatin MilliporeSigma G9391
GeneJammer Agilent 204130
HLA-A201-HBs183-91-PE pentamer Proimmune F027-4A - 27
HRP Anti-Mouse Secondary Antibody Invitrogen A27025
mFlt-3L Peprotech 250-31L
mIL-7 Peprotech 217-17
Nuclease S7 Roche 10107921001
Paraformaldehyde MilliporeSigma P6148-500G Caution: Allergenic, Carcenogenic, Toxic
Permeabilization buffer Biolegend 421002
Polybrene MilliporeSigma 107689
ProLong™ Gold Antifade Mountant with DAPI Invitrogen P36931
QIAamp MinElute Virus Spin Kit Qiagen 57704

DOWNLOAD MATERIALS LIST

References

  1. Scaglione, S. J., Lok, A. S. Effectiveness of hepatitis B treatment in clinical practice. Gastroenterology. 142, (6), 1360-1368 (2012).
  2. Osiowy, C. From infancy and beyond... ensuring a lifetime of hepatitis B virus (HBV) vaccine-induced immunity. Human Vaccines & Immunotherapeutics. 14, (8), 2093-2097 (2018).
  3. Gish, R. G., et al. Loss of HBsAg antigen during treatment with entecavir or lamivudine in nucleoside-naive HBeAg-positive patients with chronic hepatitis B. Journal of Viral Hepatitis. 17, (1), 16-22 (2010).
  4. Kurktschiev, P. D., et al. Dysfunctional CD8+ T cells in hepatitis B and C are characterized by a lack of antigen-specific T-bet induction. Journal of Experimental Medicine. 211, (10), 2047-2059 (2014).
  5. Fisicaro, P., et al. Antiviral intrahepatic T-cell responses can be restored by blocking programmed death-1 pathway in chronic hepatitis B. Gastroenterology. 138, (2), 682-693 (2010).
  6. Schurich, A., et al. The third signal cytokine IL-12 rescues the anti-viral function of exhausted HBV-specific CD8 T cells. PLoS Pathogens. 9, (3), 1003208 (2013).
  7. Gehring, A. J., et al. Engineering virus-specific T cells that target HBV infected hepatocytes and hepatocellular carcinoma cell lines. Journal of Hepatology. 55, (1), 103-110 (2011).
  8. Xia, Y., et al. Interferon-gamma and Tumor Necrosis Factor-alpha Produced by T Cells Reduce the HBV Persistence Form, cccDNA, Without Cytolysis. Gastroenterology. 150, (1), 194-205 (2016).
  9. Huang, L. R., Wu, H. L., Chen, P. J., Chen, D. S. An immunocompetent mouse model for the tolerance of human chronic hepatitis B virus infection. Proceedings of the National Academy of Sciences U.S.A. 103, (47), 17862-17867 (2006).
  10. Wong, P., Pamer, E. G. CD8 T cell responses to infectious pathogens. Annual Review of Immunology. 21, 29-70 (2003).
  11. Murray, J. M., Wieland, S. F., Purcell, R. H., Chisari, F. V. Dynamics of hepatitis B virus clearance in chimpanzees. Proceedings of the National Academy of Sciences USA. 102, (49), 17780-17785 (2005).
  12. Hinrichs, C. S., et al. Adoptively transferred effector cells derived from naive rather than central memory CD8+ T cells mediate superior antitumor immunity. Proceedings of the National Academy of Sciences U.S.A. 106, (41), 17469-17474 (2009).
  13. Hinrichs, C. S., et al. Human effector CD8+ T cells derived from naive rather than memory subsets possess superior traits for adoptive immunotherapy. Blood. 117, (3), 808-814 (2011).
  14. Kerkar, S. P., et al. Genetic engineering of murine CD8+ and CD4+ T cells for preclinical adoptive immunotherapy studies. Journal of Immunotherapy. 34, (4), 343-352 (2011).
  15. Kuball, J., et al. Facilitating matched pairing and expression of TCR chains introduced into human T cells. Blood. 109, (6), 2331-2338 (2007).
  16. van Loenen, M. M., et al. Mixed T cell receptor dimers harbor potentially harmful neoreactivity. Proceedings of the National Academy of Sciences USA. 107, (24), 10972-10977 (2010).
  17. Cameron, B. J., et al. Identification of a Titin-derived HLA-A1-presented peptide as a cross-reactive target for engineered MAGE A3-directed T cells. Science Translational Medicine. 5, (197), (2013).
  18. Fedorov, V. D., Themeli, M., Sadelain, M. PD-1- and CTLA-4-based inhibitory chimeric antigen receptors (iCARs) divert off-target immunotherapy responses. Science Translational Medicine. 5, (215), (2013).
  19. Maus, M. V., et al. T cells expressing chimeric antigen receptors can cause anaphylaxis in humans. Cancer Immunolology Research. 1, (1), 26-31 (2013).
  20. Haque, R., et al. Programming of regulatory T cells from pluripotent stem cells and prevention of autoimmunity. Journal of Immunology. 189, (3), 1228-1236 (2012).
  21. Vizcardo, R., et al. Regeneration of human tumor antigen-specific T cells from iPSCs derived from mature CD8(+) T cells. Cell Stem Cell. 12, (1), 31-36 (2013).
  22. Nishimura, T., et al. Generation of rejuvenated antigen-specific T cells by reprogramming to pluripotency and redifferentiation. Cell Stem Cell. 12, (1), 114-126 (2013).
  23. Lei, F., et al. In vivo programming of tumor antigen-specific T lymphocytes from pluripotent stem cells to promote cancer immunosurveillance. Cancer Research. 71, (14), 4742-4747 (2011).
  24. Kim, J. B., et al. Oct4-induced pluripotency in adult neural stem cells. Cell. 136, (3), 411-419 (2009).
  25. Lei, F., Haque, R., Xiong, X., Song, J. Directed differentiation of induced pluripotent stem cells towards T lymphocytes. Journal of Visualized Experiments. (63), e3986 (2012).
  26. Lei, F., Haque, M., Sandhu, P., Ravi, S., Ni, Y., Zheng, S., Fang, D., Jia, H., Yang, J. M., Song, J. Development and characterization of naive single-type tumor antigen-specific CD8+ T lymphocytes from murine pluripotent stem cells. OncoImmunology. 6, (2017).
  27. Haque, M., et al. Melanoma Immunotherapy in Mice Using Genetically Engineered Pluripotent Stem Cells. Cell Transplantation. 25, (5), 811-827 (2016).
  28. Tan, A. T., et al. Use of Expression Profiles of HBV DNA Integrated Into Genomes of Hepatocellular Carcinoma Cells to Select T Cells for Immunotherapy. Gastroenterology. (2019).
  29. Wu, L. L., et al. Ly6C(+) Monocytes and Kupffer Cells Orchestrate Liver Immune Responses Against Hepatitis B Virus in Mice. Hepatology. (2019).
  30. Haque, M., et al. Stem cell-derived tissue-associated regulatory T cells suppress the activity of pathogenic cells in autoimmune diabetes. Journal of Clinical Investigation Insights. (2019).
  31. Chisari, F. V., et al. Structural and pathological effects of synthesis of hepatitis B virus large envelope polypeptide in transgenic mice. Proceedings of the National Academy of Sciences USA. 84, (19), 6909-6913 (1987).
  32. Wirth, S., Guidotti, L. G., Ando, K., Schlicht, H. J., Chisari, F. V. Breaking tolerance leads to autoantibody production but not autoimmune liver disease in hepatitis B virus envelope transgenic mice. Journal of Immunology. 154, (5), 2504-2515 (1995).
Stamcells-härledda viral AG-specifika T-lymfocyter undertrycka HBV-replikering hos möss
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Xiong, X., Lei, F., Haque, M., Song, J. Stem Cell-Derived Viral Ag-Specific T Lymphocytes Suppress HBV Replication in Mice. J. Vis. Exp. (151), e60043, doi:10.3791/60043 (2019).More

Xiong, X., Lei, F., Haque, M., Song, J. Stem Cell-Derived Viral Ag-Specific T Lymphocytes Suppress HBV Replication in Mice. J. Vis. Exp. (151), e60043, doi:10.3791/60043 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter