Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

הדור של המסגרת של גן In-Frame מוטציות מחיקה ב פסאודומונס aeruginosa ובדיקת התקפה אלימה מודל עכבר פשוט של זיהום

doi: 10.3791/60297 Published: January 8, 2020

Summary

כאן, אנו מתארים פרוטוקול פשוט ומשתנה של מודל העכבר של זיהום כדי להעריך את הנחת של זנים מהונדסים גנטית של הפסאודומונס aeruginosa בהשוואה לארצות הברית מינהל המזון והתרופות (FDA)-מאושר es, האנציכיה ליישומים מסחריים.

Abstract

המיקרואורגניזמים הם מגוונים מבחינה גנטית ומגוונות והפכו למקור עיקרי של מוצרים מסחריים רבים וביופרמצבטיקה. למרות שחלק מהמוצרים הללו מיוצרים באופן טבעי על ידי האורגניזמים, מוצרים אחרים דורשים הנדסה גנטית של האורגניזם כדי להגדיל את תפוקת הייצור. באופן מסורתי היתה המין החיידקי המועדף על הפקת הביו-פרמצבטיקה; עם זאת, מוצרים מסוימים קשים E. coli לייצר. כך, avirulent זנים של מינים חיידקיים אחרים יכול לספק חלופות שימושיות לייצור של כמה מוצרים מסחריים. פסאודומונס aeruginosa הוא חיידק משותף שלילי גראם שליליים שיכול לספק חלופה מתאימה ל -E. coli. למרות זאת, פ. אירויוגנוסה הוא פתוגן אנושי אופורטוניסטי. כאן, אנו מפרטים הליך שניתן להשתמש בו כדי ליצור זנים שאינם פתוגניים של P. aeruginosa באמצעות מחיקות גנומית רציפה באמצעות PEX100T-noti פלמיד. היתרון העיקרי של שיטה זו הוא לייצר זן ללא סמן. שיטה זו עשויה לשמש להפקת מאוד מחליש P. aeruginosa זנים לייצור מוצרים מסחריים, או כדי לעצב זנים עבור שימושים ספציפיים אחרים. אנו מתארים גם מודל העכבר פשוט הניתן ל, של זיהום מערכתי חיידקי באמצעות הזרקה הצפק של זנים בדיקה מאומת כדי לבדוק את הנחת המתח מהונדסים גנטית בהשוואה לBL21 מאושר ה-FDA של E. coli.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

פסאודומונס aeruginosa הוא פתוגן בקטריאלי אופורטוניסטי שיכול לגרום סכנת חיים מחלות בבני אדם, במיוחד בתוך החיסוני. הפתוגניות של P. aeruginosa היא בשל ביטוי של גורמים התקפה אלימה רבים, כולל פרוטסים וליפופוליסכד, כמו גם את היכולת ליצור ביואלוilm הגנה1. בשל יכולתה לייצר גורמי התקפה אלימה ולגרום למחלות בבני אדם, באמצעות P. aeruginosa לעשות מוצרים מסחריים מציג חששות בטיחות. זנים שאינם פתוגניים של E. coli השתמשו באופן מסורתי כדי bioengineer מוצרים רפואיים ומסחריים לשימוש אנושי. עם זאת, מוצרים מסוימים קשים עבור E. coli לעשות, ורבים ארוזים בגופי הכללה, ביצוע מפרך החילוץ. זנים חיידקיים מהונדסים עם היכולת לבצע ולהפריש מוצרים ספציפיים הוא רצוי מאוד, כמו הפרשה צפויה להגדיל את התשואה ולהקל תהליכי טיהור. כך, זנים שאינם פתוגניים של מינים אחרים של חיידקים (למשל, מינים המשתמשים יותר הפרשה מסלולים) עשוי לספק חלופות שימושיות e. coli. לאחרונה דיווחו על התפתחות של מאמץ של P. aeruginosa, PGN5, שבו הפתוגניות ורעילות של האורגניזם הוא מאוד מחליש2. וחשוב מכך, זן זה עדיין מייצר כמויות גדולות של רב הסוכר, מרכיב מעניין מסחרית של ה -P. aeruginosa .

הזן PGN5 נוצר באמצעות שגרת allelic החלפת הליך עם pEX100T-NotI פלמיד כדי למחוק באופן רציף חמישה גנים (Toxa, plch, phzm wapr, aroa) ידוע לתרום הפתוגניות של האורגניזם. pEX100T-noti הופק על ידי שינוי smai הגבלת הגבלה noti אתר זיהוי אנזים בתוך האתר שיבוט מרובים של pEX100T פלמיד, אשר פותחה במעבדה של הרברט שוייצר3,4. אתר הזיהוי של האנזים ההגבלה NotI הוא רצף DNA נדיר יותר לעומת SmaI ופחות סביר להיות נוכח רצפים לשכפל, ולכן זה נוח יותר למטרות שיבוט. במרכז יש גנים המאפשרים בחירה, כולל הגן של בלה , אשר מקודד את ההתנגדות העצמית והcarbenicillin, ואת ה -b. Sub ssacb גן, אשר מקנה רגישות לסוכרוז (איור 1א). במרכז הפלמיד יש גם מקור שכפול (אורי) התואם ל -e. coli, ומקור העברה (אורית) המאפשר להעביר באמצעות החיידק הקולי למינים מסוג אי-האודומונס באמצעות קוניוגציה. עם זאת, הפלסמיד חסר מקור של שכפול תואם לפסאודומונס, ולכן אין באפשרותו לשכפל בתוך מינים פסבדו-דוממונס (כלומר, זהו וקטור התאבדות של פסבדו -פנים). מאפיינים אלה להפוך pEX100T-NotI אידיאלי עבור המיקוד מחיקות גנטיות מתוך כרומוזום הפסאודומונס . צעדי שיבוט פלמיד מתבצעים באמצעות E. coli והפלמיד התוצאה מועברת לפסאודומונס על ידי שינוי או קוניוגציה. לאחר מכן, באמצעות הומולוגי אירועים שילוב מחדש וצעדים סלקטיבית, מחיקה ממוקדת במסגרת מסגרת נוצרת, ללא סמן. שיטה זו של מחיקה ברציפות אזורים גנומית מן הכרומוזום של P. aeruginosa יכול לשמש כדי ליצור מאוד מחליש את הזנים של מאוד זני דוממונס , כמו PGN5, או כדי לעצב זנים עבור שימושים ספציפיים אחרים (למשל, זנים לקויה לאחר התפשטות פלסטלינה או זנים לקויה לייצור של חלבונים של עניין).

התקפה אלימה כוללת של זנים של חיידקים מושפעת מתנאי צמיחה ושלבים, במהלכו מוטציות מתרחשות לעתים קרובות. לכן, מדידת הבטיחות של זנים גנטית מהונדסים יכול להיות מאתגר. כדי להעריך מבודד חיידקי עבור התקפה אלימה מערכתית, התאמתי פרוטוקול שפורסם בעבר של זיהום על ידי הזרקה תוך הצפק של C57BL/6 עכברים5. שינו הליך זה כדי להשתמש מניות בקטריאלי קפוא להזרקה, אשר אפשרה עבור מינון מדויק ואימות קל של זנים המשמשים. במודל זה, החיידק E. coli BL21, אשר כבר אושרה על-ידי ה-FDA לייצור של ביו-פרמצבטיקה, שימש כתקן בטיחות שליטה לקביעת הפתוגנזה היחסית של הנבג6,7,8. היתרון העיקרי כדי להשתמש בשיטה זו היא כי הוא מתאחד וממזער מקורות של וריאציה, כמו זנים הדבקה מאומתים עבור מספר תא חיידקי, פנוטיפ, סמנים גנטיים הן לפני ואחרי זיהום. עם צעדים אלה מבוקרים, מספר בעלי החיים הנדרשים הוא מופחת. במודל זה, P. aeruginosa זנים הנובעים שיעורי תמותה C57BL/6 מורטין שווה או פחות מאשר E. coli BL21 כאשר מוזרק intraperitoneally עשוי להיחשב מחליש. זה מודל העכבר הפשוט של זיהום עשוי לשמש גם כדי להעריך את הפתוגניות החליש של זנים מהונדסים גנטית ממינים אחרים באמצעות ה-FDA שאושרו E. coli החומר כמו ההפניה. שלבים 1-7 לפרט את הדור של מחיקות גנומית רציפים ב P. aeruginosa (איור 1) ושלבים 8-12 לפרט את השימוש במודל העכבר כדי לבדוק את הפתוגניות של P. aeruginosa זנים.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

לפני תחילת ניסויים בבעלי חיים, הפרוטוקול שיש להשתמש בו חייב להיות מאושר על ידי טיפול בעלי חיים מוסדיים והוועדה לשימוש (IACUC). אישור עבור הפרוטוקול המתואר הושג באמצעות IACUC באוניברסיטת מרשל (הנטינגטון, WV, ארה ב).

1. עיצוב פלמיד

  1. כדי ליצור מחיקה גנטית באמצעות pEX100T-NotI פלמיד, לשכפל את אזורי ה-DNA באגף את רצף המחיקה הרצוי ולהכניס לתוך אתר ההגבלה NotI של הפלביניים. התותב הפלמיד צריך להכיל כ 500 נוקלאוטידים הזרם של רצף היעד הסמוך ישירות על 500 נוקלאוטידים במורד רצף של מחיקת היעד. בנוסף, על ההוספה להכיל את רצף הזיהוי NotI (GCGGCCGC) בקצוות 5 ' ו-3 ' (איור 1B).

2. הכנה פלסמיד

  1. אפשרות 1: לנצל את ההליכים המסורתיים לשכפול. השתמש ב-PCR כדי להגביר אזורים גנומית במעלה ובמורד הזרם של הגן של עניין, ואחריו ה-pcr מוצלב9,10 כדי להצטרף שברי שנוצר, הגבלת העיכול endonuclease של מוצר ה-PCR ו פלסמיד, ולאחר11 (איור 1ב, ג).
  2. אופציה 2: לאחר עיצוב רצף המחיקה ב סיליקו, חוזה חברה כי דה נובו מגדלים אותו כדי להכניס לתוך הפלpEX100T-NotI. חברות רבות יש לייעל את תהליך השכפול כדי במהירות וביעילות ליצור את הפלמיד של הריבית. בנוסף, רצף לאמת את הפלסטלינה להיות נקי מוטציה לפני המסירה.

3. E. coli טרנספורמציה

  1. המרה אלקטרומוסמכת E. coli עם הפלמיד על פי המלצות היצרן. באמצעות לולאה סטרילית מנווים, פס 10 μL של תגובת שינוי עבור מושבות מבודדות על מחומם טרום לוריא ציר (LB) הצלחת אגר שיושלם עם 100 μg/mL של carbenicillin ו-דגירה לילה ב 37 ° c.
    הערה: יש לטפל בכל הציוד והמדיה המשמשים לבקטריות התרבות בהתאם להנחיות הבטיחות של המוסד.
  2. . מעבר פעמיים
    1. מוציאים את הצלחת מהאינקובטור ומזהים מושבה מבודדת. באמצעות לולאה סטרילית לענות, להרים את המושבה רצף לפני מחומם לפני ליברות אגר לוחית שיושלם עם 100 μg/mL של carbenicillin עבור מושבות מבודדות. המלון משלב בין לילה ב-37 ° c. חזור על שלב זה שוב כדי ליצור תרבות טהורה.
  3. שימוש בלולאה סטרילית, האיחסן 5 מ ל של LB עם מושבה אחת מהצלחת אגר הסופי. מניחים את התרבות באינקובטור רועד ב-37 ° c בלילה. למחרת, לערבב 1 מ ל של תרבות זו עם 1 mL של 5% ב קריובקבוקון וחנות ב-80 ° c כדי ליצור מלאי קפוא של המתח.

4. הכנה לזנים חיידקי ובניינים תלת-הורים

  1. השתמש במושבה בודדה אחת מלוחות אגר של הזנים הבאים כדי להשתמש בתרבויות הציר ומניחים בחממה רועדת לילה ב 37 ° c.
    1. הוסף E. coli PEX100T-noti לתוך 5 מ ל של LB בתוספת עם 100 μg/mL של carbenicillin.
    2. הוסף P. aeruginosa זן PAO1 לתוך 5 מ ל של מדידות הפסאודומונס ציר (pib).
    3. הוסף E. coli prk2013 לתוך 5 מ ל של LB בתוספת עם 50 μg/mL של kanamycin.
      הערה: prk2013 פלמיד הוא מסייע פלמיד המשכפל ב -E. coli אבל לא P. aeruginosa; היא נושאת את הגנים העברת משחק טרנס כי לגייס את pEX100T-NotI באמצע מן התורם E. coli לנמען P. aerginosa 12. P. aeruginosa הוא מהווה ביוטיחות רמה 2 (bsl-2) פתוגן. נא בצע את ההנחיות של המוסד לבטיחות בעת עבודה עם אורגניזמים BSL-2.
  2. למחרת, להסיר את התרבויות לילה מן החממה ולהוסיף 0.5 mL של כל תרבות לצינור 1.5 mL מיקרוצנטריפוגה. צנטריפוגה ב 6,000 x g עבור 5 דקות. לבטל את supernatant ולהשעות את הגלולה התא ב 50-100 μl של LB.
  3. פיפטה את המתלה הנייד כולו בתוך droplet אחד על צלחת לפני מחומם של LB אגר. . הניחו ל-droplet להתייבש ואז להפוך את הצלחת הדגירה ב 37 ° c עבור 4-6 h.
  4. לאחר הדגירה, השתמש בלולאה סטרילית לאסוף את התאים לתוך 1 מ ל של LB בצינור מיקרוצנטריפוגה. הפיפטה עולה ויורדת. כדי לערבב את התאים
  5. באמצעות spreader תא, רצף התאים באופן שווה על יבש טרום מחומם פסבדו בידוד הלוח של אגר (PIA) בתוספת עם 300 μg/mL של carbenicillin. פס לוחות מרובים עם הגדלת כרכים של תערובת התא (למשל, 10 μL, 100 μL, 500 μL). המלון משלב בין לילה ב-37 ° c.

5. זיהוי Recombinants מוצלב יחיד של P. aerginosa

  1. להסיר צלחות מן החממה ולבדוק עבור מבודדים carbenicillin עמידים המושבות. מכיוון pEX100T-NotI פלמיד לא יכול לשכפל את P. aeruginosa, מושבות שגדלו על הצלחות carbenicillin-יושלם צריך להיות מתאים שבו הפלביניים שולבו לתוך הכרומוזום.
    1. בחר לפחות 4 של מושבות אלה רצף עבור בידוד על הצלחות טרום מחומם של PIA בתוספת עם 300 μg/mL של carbenicillin. לוחיות הרישוי של הלילה. ב-37 ° c
  2. להסיר צלחות מן החממה ולבדוק לצמיחה. Carbenicillin-עמיד מושבות צריך להיות יחיד מוצלב recombinants (כלומר, הם שילבו את הפלבאמצע לתוך כרומוזום באמצעות אירוע משולב מחדש בין אזור הומולוגי של הכנס הפלסמיד ואת הכרומוזום של P. aeruginosa).
    1. טלאי 8 או יותר מושבות עם קיסמי סטרילי על לוחות טרום מחומם של: 1) בתוספת PIA עם 300 μg/mL של carbenicillin ו 2) PIA בתוספת 300 μg/mL של carbenicillin ו-10% סוכרוז (ללא גליצרול).
    2. אם לא הושגה צמיחה של המושבה משלב 5.1, חזרו על הקוניוגציה והגדילו את נפח התרכובת התאית בשלב 4.5. אם הגדילה יותר מדי התרחשה, חזור על הקוניוגציה והפחת את עוצמת הקול.
    3. אם הקוניוגציה נכשלת שוב ושוב, הכינו תאים אלקטרו מוכשרים של המתח P. aeruginosa והפוך ישירות עם PEX100T-noti פלמיד. פרוטוקולים מפורטים להכנת אלקטרומוסמכת פ. aeruginosa וטרנספורמציה זמינים במקומות אחרים13,14.
  3. לוחות הדגירה ב 37 ° c בלילה.
  4. להסיר צלחות מאינקובטור ולבדוק לצמיחה. אמת recombinants מוצלב יחיד יהיה עמיד carbenicillin ו-סוכות רגיש (כלומר, המושבות שגדלו ב-PIA בתוספת carbenicillin, אך לא גדלו ב-PIA בתוספת carbenicillin וסוכרוז).
    1. לבחור 4 או יותר true מוצלב יחיד recombinants ו החיסונים כל אחד לתוך 5 מ ל של LB ללא בחירה. מודטה באינקובטור רועד ב-37 ° c בלילה.
    2. אם לא זוהו אף recombinants מוצלב יחיד, חזור על הקוניוגציה.

6. זיהוי כפול מוצלב Recombinants של P. aerginosa

  1. עבור כל תרבות ציר, האיחסן 10 μL של התרבות על צלחת טרום מחומם של PIA בתוספת 10% סוכרוז (ללא גליצרול) ו פס עבור מושבות מבודדות. לוחיות הרישוי של הלילה. ב-37 ° c
  2. למחרת, להסיר צלחות מן החממה ולבדוק אותם לצמיחה. סוכרוז עמידים מושבות צריך להיות כפול מוצלב recombinants (כלומר, הסירו את הפלמיד מן הכרומוזום באמצעות אירוע שילוב מחדש בין האזור ההומוולוגי השני של הכנס הפלסמיד וכרומוזום P. aeruginosa ).
    1. תיקון לפחות 20 מושבות עם קיסמי שיניים סטריליים ללוחות קדם-מחוממים של: 1. pia, 2. pia עם 10% סוכרוז (ללא גליצרול) ו-3) לפיה בתוספת 300 μg/mL של carbenicillin.
  3. לוחיות הרישוי של הלילה. ב-37 ° c
  4. להסיר צלחות מן החממה ולבחון אותם לצמיחה. Recombinants מוצלב אמיתי כפול יהיה carbenicillin רגיש והוא עמיד בפני סוכות (כלומר, מושבות שגדלו ב-PIA ו-PIA עם סוכרוז, אך לא גדלו ב-PIA בתוספת carbenicillin).

7. אישור מחיקת גנים דרך המושבה PCR

  1. הכינו 10-20 מושבות למסך מחיקה עם ה-PCR.
    1. להרים את הצמיחה של חשוד כפול מוצלב רקומביננטי עם קיסם סטרילי להשעות תאים ב 50 μL של מלוחים 1 x פוספט מאגור (PBS). להרתיח השעיה ב 100 ° c עבור 10 דקות, צנטריפוגה עבור 3 דקות ב 13,000 x g, ולאחר מכן המקום על הקרח.
  2. בצע PCR כדי להקרין מושבות עבור המחיקה הממוקדת.
    1. השתמש ב-1 μL של סופרנטנט כתבנית בתגובת PCR של 25 μL כדי לאשר מחיקה של גן העניין.
    2. השתמש בצבעי יסוד ספציפיים לגנים המגבירים את האזור של המחיקה גנומית. השימוש התחל להגביר את האזור של מחיקה גנומית בתוספת 100-200 bp של החוצה רצפים במעלה הזרם.
    3. הכינו שליטה נפרדת ב-PCR עם זן האב (למשל, PAO1).
      הערה: תנאי הציקלונים התרמיים ישתנו בהתאם לטמפרטורת הריפוי האופטימלית לצמדים, הקוקטייל הפילמור המשמש, ואורך האזור להיות מוגבר.
  3. בצעו אלקטרופורזה של ג'ל במוצרי ה-PCR. מושבות בהן האזור של העניין נמחק תשואה מוצרי הגברה קטנים יותר מאשר מושבות שחסרות מחיקה (איור 2).
  4. בחר מושבות אחת או יותר באמצעות המחיקה מאושרת ב-PCR. פס עבור מושבות מבודדות על לוחית טרום מחומם (s) ו הדגירה ב 37 ° c בלילה.
  5. . מעבר לפחות עוד פעם אחת להסיר את הצלחות מן החממה ולזהות מושבה מבודדת. באמצעות לולאה סטרילית לענות, להרים את המושבה ומעלה לוחית מחומם מראש של PIA של מושבות מבודדות. המלון משלב בין לילה ב-37 ° c.
  6. בחרו מושבה מכל לוח סופי והשתמשו בו לאיחסן 5 מ ל של PIB. מניחים באינקובטור רועד ב-37 ° c בלילה.
    1. מערבבים 1 מ ל של תרבות זו עם 1 מ"ל של 5% חלב רזה ב קריובקבוקון וחנות ב-80 ° צ' כדי ליצור מלאי של המתח.
    2. באמצעות תרבות זו, להכין דנ א גנומית מן המתח (g., באמצעות ערכת טיהור DNA). ההגביר את אזור המחיקה של גנומית באמצעות ה-PCR, הספציפי לאזור הריבית.
      1. לטהר את מוצרי ה-PCR (למשל, עם ערכת טיהור DNA, או מיצוי כלורופורם-פנול), או רצף ישירות בעזרת הצבעי היסוד הספציפיים לגנים או ליגולי לתוך וקטור ברצף עם התחל הספציפי.
  7. לאחר מחיקת הגנים אושרה באמצעות רצף, חזור על הליך זה עם זן חדש מחיקה כדי ליצור ברציפות מחיקות גנומית ללא סמן רבים. כאשר הזן הרצוי נוצר, להשתמש רצף הגנום כולו כדי לאמת את מחיקות ממוקדות כדי לזהות שינויים אחרים הגנום (לעומת זן ההתייחסות, למשל, PAO1) שהתרחשו לאורך כל התהליך. לאחר ביאורים הגנים, להפקיד את הרצף GenBank ולהקליט מספרי ההצטרפות.

8. הכנת זן חיידקי לבדיקת בעלי חיים

  1. כדי לבדוק את הפתוגניות של P. aeruginosa זנים, ראשית להכין תרבויות מאומת ומניות. הכן את זנים p. aerginosa של עניין, זן פראי של p. aeruginosa (מדבק), ו-FDA מאושר זן של E. COLI (למשל, BL21) כדי לשמש שליטה בטיחות שאינה פתוגניים.
  2. פס את הזנים של החיידקים נבדק על האגר סלקטיבי מתוך רצף ומאומת קפוא מניות. מודטה ב-37 ° c בלילה.
  3. עם לולאה סטרילית, להרים מושבה אחת מכל מתח ורצף עבור מושבות מבודדות על מדיה סלקטיבית שוב. מודטה ב-37 ° c בלילה.
  4. . הסר צלחות מהאינקובטור עבור כל זן, בחר מושבה אחת ורצף עבור בידוד על צלחות LB.
  5. לאחר 24 שעות של צמיחה ב 37 ° c, האיחסן של 500 mL בקבוקון המכיל 250 mL של LB עם מושבה אחת לבודד מכל זן.
    1. תהליך אימות: שימוש בשאריות של אותה מושבה, לאמת את המתח באמצעות ה-PCR והתחל הספציפי לזנים, ו/או התחל כדי לאמת את הנוכחות של שינויים גנטיים שנעשו במתח. השתמש התחל למטה לאימות של זנים בדוגמה המוצגת:
      E. coli BL21:
      T7 פולימראז F:TGGCTATCGCTAATGGTCTTACG
      T7 פולימרואז בקרת החלקה

      VE2 ו-PGN5:
      אראה שאלה: כיצד לאסוף
      אראה ר: ATCTGGCTCGCGATGCCGGTCC
  6. מודלת את התרבויות בחממה רועדת ב 160 rpm ו 37 ° צ' עד שהם מגיעים הצמיחה שלב היומן (כלומר, OD600 מדידה 0.4-0.6 על ספקטרוסקופיה).
  7. באמצעות ה-OD600 value שהושג כאשר שלב הרישום הושג, חשב את נפח הציר הנדרש לתשואה 2.5 x 109 המושבה היוצרת יחידות (Cfu) לכל mL. גלולה הנפח של ציר מחושב בצינורות 50 mL ב 4,500 x g עבור 10 דקות.
  8. להיפטר supernatant ולהשעות מחדש את הגלולה בצינור אחד באמצעות 50 mL של ה-PBS 1x כדי לשטוף את התאים. צנטריפוגה שוב ב 4,500 x g עבור 10 דקות.
  9. השמט את הסופרנטאנט והשהה מחדש את הגלולה ב -25 מ ל של 5% חלב רזה ב-1x PBS.
    1. שלב אימות: השתמש במדגם של 25 מ"ל מחדש לבצע ספירות לוחית קיימא כדי לקבוע את מספר CFU/mL.
  10. מחלקים את 25 מ"ל התרבות חלב מחדש לתוך 2 מ ל מניות תרבות 2 מ ל קריובקבוקונים. הקפאת מבזק בחנקן נוזלי ובחנות ב-80 ° c לפחות לילה לפני השימוש.

9. ואלידציה של צמיחה והזן של מניות המאוחסנים לבדיקות בעלי חיים.

  1. עבור כל זן להיבדק, להסיר לפחות 3 קריובקבוקונים של מניות קפואות מ-80 ° c אחסון ולהפשיר ב 4 ° צ' עבור 2-4 h. אם נשאר מלאי קפוא, חם לזמן קצר ב-37 ° c.
  2. לקחת דגימות קטנות מכל קריובקבוקון כדי לאמת כל זן.
    1. לבצע ספירות לוחית קיימא כדי לקבוע את מספר CFU/mL. זה נורמלי יש פחות CFU/mL לאחר הקפאת, עקב מוות של כמה תאים חיידקיים.
    2. השתמש ב-PCR ובצבעי היסוד ספציפיים לזנים כדי לאמת כל מאמץ.
    3. רצף כל זן על מדיה סלקטיבית כדי לאמת את הפנוטיפים.
  3. לאחר אישור כי זנים הם של גנוטיפ נכון ו פנוטיפ, ואימות CFU/mL, להמשיך בדיקות בעלי חיים.

10. חיסונים של בעלי חיים עם זנים חיידקיים על ידי הזרקה

  1. בבוקר של זריקות, להסיר קריובקבוקונים של זנים חיידקיים נבדק להפשיר ב 4 ° צ' עבור 3-4 h. הפשרה 0.5 mL עבור כל עכבר כי ייזרקו. שמרו על קרח לאחר הזמן. והזרק עכברים בתוך 2 שעות
  2. לאחר הפשרה, להעביר כל קריובקבוקון לצינור חדש 2 mL ו צנטריפוגה ב 4,500 x g עבור 10 דקות, למחוק את supernatant, ולהשעות מחדש את הגלולה בתא 1 mL של 1X PBS.
  3. צנטריפוגה שוב ב 4,500 x g עבור 10 מ ' למחוק supernatant ולהשהות את הגלולה ב-1X PBS לריכוז הסופי 2.5 x 109 cfu/mL. כדי לקבוע את כמות 1x PBS הדרושים עבור השעיה מחדש, השתמש בנתונים CFU/mL המתקבלים מספירות לוחית קיימא על מניות קפוא בשלב 2.2.1. הסכום המדויק של 1 x PBS בשימוש ישתנה מעט בין זנים.
    1. לקחת 3 דגימות מהשהייה הסופי של כל זן כדי לאמת CFU/mL, גנוטיפ, ו פנוטיפ כמתואר לעיל.
  4. עבור כל זן, סדרת מחלקים 1.5 mL של השעיית PBS/cell לתוך אחד 2 mL שפופרת לכל 5 עכברים כדי להגביל את מספר הפעמים הצינור נכנס. כמו כן, להכין צינורות של 1 x PBS עבור זריקות שליטה.
  5. לאסוף עכברים (10 זכר ו 10 נקבה C57BL/6 לכל קבוצה לניסוי זה) וחומרים הדרושים זריקות (מזרקים, מחטים, מכולות שרפ, סמנים, עט נייר, וכו '). מעבר לחדר הניתוחים. הסטרילי של החיות נגב את כל המשטחים. עם מגבונים לחיטוי
    1. כדי למנוע את המצוקה ואת הסיכון של פגיעה ניסויים, רק להביא מין אחד הקבוצה הניסיונית של עכברים לחדר כירורגי בכל פעם (למשל, קבוצה של 10 עכברים גברים להידבק במתח מסוים). ללבוש שני זוגות של כפפות לטקס כדי לחסל את הניקוב של כפפות אם ננשך. לבש חלוק מעבדה, משקפי בטיחות ומסכת פנים כדי למנוע זיהום.
  6. התחלת זריקות של קבוצת הבקרה באמצעות 1x PBS. זה יהיה לוודא אם תופעות לוואי כתוצאה מזריקה בלבד.
    1. הסרת עכבר מהכלוב. הסר עכבר אחד בלבד בכל פעם.
    2. שוקלים את העכבר ולסמן את זנבו עם סמן קבוע כדי לעקוב אחר הרזיה לאחר ההזרקה.
    3. פתח מזרק חדש 1 mL ו 27 מחט G (להשתמש מזרק חדש ומחט עבור כל עכבר כדי לחסל את הזיהום) ולהזריק 200 μL של הערוץ הסטרילי 1 x.
      1. לתפוס את העכבר מאחורי האוזניים שלו באמצעות האגודל ואת האצבע. צביטה כדי ליצור קיפול העור בעורף הצוואר כדי להחזיק על-קיפול הדוק יותר מפחית את תנועת הצוואר ואת הסיכון להיות ננשך במהלך ההזרקה. מאובטח הזנב לתוך כף היד באמצעות הזרת להחזיק את שטוח העכבר עם תנועה קטנה.
      2. לסובב את העכבר מעל ולהוסיף מחט בזווית 30 ° לתוך חלל הצפק בצד שמאל או ימין של קו האמצע. הרם את המחט מעט פעם נוספת כדי לוודא שהוא הוכנס לאזור הצפק ולא לתוך איברים. . ואז למשוך את המחט
      3. הניחו את המחט המשמשת במיכל מכיל של מיכל בידוד. אל תשתמש שוב במזרק או במחט. מנת ההזנה באתר ההזרקה אופיינית.
    4. לאחר הזרקה, להזיז את העכבר לכלוב נפרד.
    5. חזור על ההליך עם העכבר הבא. אחרי כל העכברים של כלוב אחד מוזרק, להחזיר אותם לכלוב המקורי שלהם מיד.
  7. לאחר הזרקת קבוצת הביקורת, התחל בהזרקת השעיות של זנים שייבדקו בעקבות אותו הליך.
    1. הכנס 200 μL של השעיית התא. כאשר מתחילים עם השעיות תא של 2.5 x 109 cfu/mL, כל עכבר מקבל 5 x 108 cfu.
      הערה: ריכוזים אלה היו ממוטבים עם מחקר בעלי חיים ראשוניים כדי לקבוע מינונים קטלניים של כל זן. ייתכן שיהיה צורך לכוונן את המינון עבור זנים/מינים אחרים.
  8. לאחר כל הזריקות הושלמו, להחזיר עכברים לחדר המגורים כדי להקל על המצוקה. אזור עבודה נקי עם מגבונים.
  9. נטר את בעלי החיים לתמותה לאחר ההזרקה על ידי בדיקת כלובים עבור עכברים מתים כל 3 h עבור 72 h ו כל 12 h במשך 10 ימים. להקליט את המשקל של עכברים כל 12 h כדי לקבוע הרזיה בשל מחלה.
  10. הקלטת התנהגות שלילית בשעות הבאות לאחר ההזרקה, כגון שינוי בתנוחה, חוסר הטיפוח או ההתריעות, היעדר ניידות או שינוי בנשימה. עכברים כי מתוך פציעה הקשורים בהזרקה יהיה להפגין התנהגות שלילית ולמות במהירות לאחר ההזרקה. מצד שני, עכברים שמקלים על הידבקות לא יתחילו להפגין התנהגות שלילית או מוות עד לאחר 18 שעות. כל העכברים שעושים התנהגות שלילית או סימנים נרחבים של תחלואה, כולל נשימה מהירה או מאומצת, חוסר ניידות, תנוחה משוחלת, עיניים שקועות, התייבשות חמורה, או אחרים צריכים להיות מורדמים כדי להפחית את הסבל המיותר (כתואם ב מאושרים פרוטוקולים IACUC). עם זאת, בניסויים שלנו, המתת חסד לא נדרשה עבור כל עכבר במהלך הניסוי. עכברים ששרדו הורדמים 10 ימים לאחר סיום בדיקות.
  11. בעקבות תקופת ניטור של 10 ימים, לאפשר בעלי חיים שנותרו להתאושש באופן מלא ולהיות ברורים של כל זיהום מנוהל במהלך הבדיקה. בעלי המתת חסד בעקבות הליך IACUC.

11. ניתוח סטטיסטי של תמותת חיות

  1. בצע ניתוח סטטיסטי באמצעות תוכנת גרפים. כל תוכנה המסוגלת לייצר גרפים ולבצע ניתוח סטטיסטי מתאימה.
  2. כדי להתוות את נתוני התמותה, השתמש בעמודת X כדי לייצג את הזמן (h) ואת העמודה Y כדי לייצג את הקבוצות שנבדקו.
  3. מייצגים כל עכבר או נושא במחקר באמצעות קוד = 0 (אפס) או קוד = 1, המציין הישרדות או מוות, בהתאמה.
    1. עבור כל חיה שמתה, הצב 1 בעמודה Y של אותה קבוצה בעת המוות בעמודה X. אם ישנם מקרי מוות רבים בנקודת זמן בודדת בקבוצה, ניתן למקם עותק של נקודת זמן זו בעמודת ה-X. לדוגמה, אם שלושה נושאים בקבוצה מתים ב-3 שעות, נקודת הזמן של 3 שעות תופיע שלוש פעמים בעמודה X.
    2. עבור כל בעלי החיים ששרדו בקבוצה, הצב אפס בעמודה Y בנקודת הזמן הסופית שנמדדה. לדוגמה, אם ארבעה עכברים שורדים, הצב ארבע נקודות זמן סיום בעמודת X המסומנות בארבעה אפסים בעמודה Y.
  4. לאחר הזנת נתוני חיות עבור כל הקבוצות, השתמש בתבנית גרף הישרדות כדי ליצור גרף הישרדות.
    1. השאר את קידוד ברירת המחדל כ-0 ו-1.
    2. הגדר את הפרמטרים עבור הגרף כאחוזים.
  5. לאחר שנבחרו פרמטרים לעקומת הישרדות, בצעו ניתוח סטטיסטי באמצעות מבחן אח-קוקס (מדרג יומן).
  6. עיצוב מגרשים של קפלן-מאייר באמצעות נתונים סטטיסטיים.
    הערה: זנים המוצגים שיעורי התמותה, כי הם פחות או שווים את זן האב ואת מאמץ מאושר ה-FDA (למשל, e. coli BL21) עשוי להיחשב החליש.

12. הדמיה של הזיהום בביולומינסנציה

  1. כדי להמחיש את ההתקדמות של הזיהום, הכנס את החומר הביולולומיאלי כרומוזומיום (Luxcdabe) לתוך PGN5 ו VE2 המתח נבדק. הפלמידים והפרוטוקולים המשמשים לתוויות זנים אלה פותחו במעבדה של שוויץ וייתכן שאינם תואמים לכל המינים/זנים של חיידקים13. חשוב מכך, ויזואליזציה של הזיהום הוא אופציונלי; לכן, החדרת גנומית של המבצע הזה אין צורך לבצע את מחקר התמותה המתואר לעיל.
  2. הכן ואמת את הזנים באמצעות השיטה המתוארת לעיל. בנוסף, בדוק ביולומינסנציה בזנים המסומנים בתווית בכל שלב של אימות.
  3. לאחר זנים מוכנים, להזריק את בעלי החיים בקבוצות של 10 עם זנים biלומינזלי בעקבות השלבים לעיל.
  4. התמונה בעלי החיים כל 3 שעות עבור 24 שעות באמצעות מערכת הדמיה בעלי חיים מסוגל ביולומיסנס.
    1. ראשית להכין את צמידה ידי הגדרת פרמטרים המצלמה ולחמם את הבמה עבור החיות. כמו כן, הגדר את זרימת החמצן ל-1.5 L לדקה (או להלן המלצות היצרן).
    2. לאחר שהאימגר והבמה מיוצבים, הציבו עכבר אחד לתוך תא ההרדמה מיד לאחר ההזרקה וניהול 3.5% isofלחדר עם O2 זרימה עבור כ 4 דקות. שיטות ההרדמה עשוי להשתנות בהתאם לחדר ו/או סוכן הרדמה בשימוש; בצע את ההמלצות של היצרן. קביעת הרדמה נכונה באמצעות מבחן רפלקס הגמילה.
    3. להזיז את העכבר כדי הטמפרטורה התייצב הבמה. למקם את העכבר על גבו עם הזרועות פרושות ולהתאים את העכבר עם חרוט אף לניהול של 2.5% isof, לאורך תהליך ההדמיה.
    4. סגור את הדלת ולקחת תמונות ביולומי, וצילומי רנטגן של העכבר.
    5. כאשר ההדמיה תושלם, החזר את העכבר לכלוב שלו ונטר אותו. העכבר צריך להחזיר את ההכרה בתוך 3-5 דקות.
    6. המשך לעכברים תמונה כל 3 שעות עבור 24 שעות, בכל פעם באמצעות עכבר שונה מכל קבוצה. אין לצלם מחדש עכבר בתוך 24 שעות עקב האפשרות של תופעות לוואי בשל חשיפה מחודשת להרדמה. עכבר אחד צריך רק לקבל מנה אחת של הרדמה כל 24-36 h. לנקות את פלטפורמת ההדמיה לאחר כל עכבר מתמונה. כבה את האימגר בין נקודות זמן הדמיה.
      הערה: ביולומינסנציה ידעך, ללא קשר למתח שהוזרק. העוצמה ואריכות החיים של הביולומינציה ישתנו בהתאם לגורמים רבים, כולל מספר החיידקים הזריקו, מאמץ העכבר, זן חיידקי, וכו '.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

כפי שמוצג באיור 2, ניתן לאשר את המחיקה גנומית ממוקדת באמצעות ה-PCR של המושבה עם התחל הספציפי המהגביר את אזור הריבית. מושבות שנושאות מחיקה גנומית תניב גודל להקה קצרה יותר של ה-PCR בהשוואה למושבות מסוג פראי. מסך PCR של 10-12 מושבות הוא בדרך כלל מספיק כדי לזהות לפחות מושבה אחת שנושאת את המחיקה ממוקדת. אם לא מאותרים מחיקות לאחר סיבובים מרובים של מסכים, חזור על ההליך החל מהקוניוגציה. אם המחיקה עדיין נכשלת, ייתכן שיהיה צורך לאשר את הוספת הפלאמצע באמצעות רצף, עיצוב מחדש או המחיקה עלולה להיות קטלנית. באמצעות האימות של מחיקת גנים דרך ה-PCR, לאשר את המחיקה באמצעות רצף. המתח שנוצר עשוי להיות נתון להליך שוב ושוב כדי ליצור שינויים גנומיים רציפים.

כפי שמוצג באיור 3, התמותה הקשורה הזרקה התוך הצפק של המתח הקלוש של P. aeruginosa PGN5 (+ muce) היה 0%, אשר שווה ערך לתמותה נצפתה עם E. coli BL21. מצד שני, הזרקה תוך הצפק של זן האב (VE2) היה קטלני 80% של עכברים. תוצאות אלה הושגו עם צעדים נרחבים כדי לאמת את הזנים הזריקו. בעוד הגורם המדויק של המוות בעכברים האלה אינו ידוע, הוא יכול לפחות חלק לייחס לביטוי של גורמים התקפה אלימה בתוך זן האב שנמחקו מתוך PGN5 החליש את המתח. הבדלים בהתקדמות הזיהום התבצע במעקב באמצעות ההורה המסומן בביולומינציה וזנים מהנחתה. הנבג הנחלש נשאר מקומי באתר ההזרקה עד שהביולומינציה דהויה (איור 4). הסיווג של הזיהום ככל הנראה בד בבד עם התפוגגות הביולומינציה. ביולומינסנציה לא זוהה 24 שעות לאחר ההזרקה ועכברים חיו במשך שבועות לאחר ההזרקה עד הוקרב, ללא תופעות לוואי נצפתה.

Figure 1
איור 1: יצירת מחיקות גנים ב P. aeruginosa עם PEX100T-noti. (א) מפת הpEX100T-מרכז מנופים. (ב) דור של בונה המורכב מאזורים ישירות במעלה הזרם (צהוב) ובמורד הזרם (כחול) של אזור הריבית (ROI), מוקף באתרי זיהוי אנזימים של הגבלת noti. ראשית, ה-PCR-להגביר את הזרם ואת אזורי הזרם באופן עצמאי עם התחל הספציפי הוסף 5 ' אתרי העיכול NotI (למשל, NotI-aroa F CGCGGCCGCTGAAGGTCCTGGGCTCCTATCCGAAAGCGGTGCTCT ו Noti-AROA R GCGGCCGCAGTTGGGTTGTTCTGCGATGGCGCCAGGCA) ו 3 ' אזורים הומולוגיים חופפים כמוצג (למשל, Aroa-מוצלב F CTCCAGGCGCTGGGCAAGGTGCTGGCGCATGACTGAGGTCACGCCGGTCGCCGTGGAGAACA ו aroa-מוצלב r TGTTCTCCACGGCGACCGGCGTGACCTCAGTCATGCGCCAGCACCTTGCCCAGCGCCTGGAG. לאחר מכן, השתמש ב-PCR withNotI המכילה את התחל להצטרף למוצרים במעלה הזרם ולמטה שנוצרו בתגובת ה-PCR הראשונה. (ג) הpEX100T-מרכז הפלמיד, חמוש ומוכן. ליגייט את המוצר החוצה מעל ה-PCR בתוך מאכל מתעכל NotI. (ד) זרימה תרשים של התהליך כדי למחוק אזורים גנומית מתוך כרומוזום P. aeruginosa באמצעות pEX100T-noti פלמיד. לאחר המחיקה הרצויה אושרה ומטוהר, את הנבג יכול להילקח דרך ההליך שוב ושוב כדי למחוק אזורים גנומיים אחרים מן הכרומוזום. כאשר הזן הרצוי מושגת, רצף את הגנום כולו כדי לאשר מחיקות ושינויים אחרים הכרומוזום. הפתוגניות של הנבג ניתן לבחון עכברים באמצעות ההליך המתואר חלק II של הפרוטוקול. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 2
איור 2: אלקטרופורזה ג'ל של מוצרי ה-PCR של המושבה ממסך עבור מחיקת Aroa כדי לייצר את המתח P. aeruginosa מחליש, PGN5. המושבה PCR מוצרים לרוץ בנתיבים 2-5 ו 8-11 לציין מושבות עם מסוג פראי Aroa. המושבה PCR מוצרים לרוץ בנתיבים 6 ו 7 לשאת את המחיקה הגן Aroa , המצוין על ידי מוצר ה-pcr הקטן (כוכביות צהובות). בשימוש התחל במיוחד הוגבר האזור גנומית המכילה את הגן aroa : aroa-F: GCGAACGCCAACAGCA, ו AROA-R: ATCTGGCTCGCGATGCCGGTCC. המוצר הצפוי של גודל ה-PCR במושבות מסוג פראי היה 2,548 נוקלאוטידים (nt). גודל המוצר הצפוי של ה-PCR במושבות עם מחיקת Aroa היה 307 nt. . סולם די. אנ. איי הופעל במסלולים 1 ו -12 אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 3
איור 3: התמותה הכוללת של עכברים שהוזרקו עם זן של מVE2 פתוגניים מאמץ (החליש), P. AERUGINOSA זן (PGN5 + muce), ו-FDA שליטה E. coli זן (BL21). רק עכברים שהוחדרו למתח הורה פתוגניים הציגו תמותה ב 80%. מחליש P. aeruginosa זן בקרת ה -FDA זן E. coli הציגו 0% תמותה. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 4
איור 4: התמונה של העכבר 3 h לאחר ההזרקה של זן החליש של P. aeruginosa PGN5 + muce נושאת סמן ביולומינטי. החיידק הביולומילי היה לזיהוי עד 18-24 h בעקבות ההזרקה. במהלך תקופה זו, הביולומינציה נשארה באתר ההזרקה המציינת שהחיידק נשאר מקומי להזרקה באתר. עכבר זה התאושש לחלוטין ללא תופעות לוואי. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

PEX100T-Not1 פלמיד הוא מתווך יעיל של מחיקות גנומית רציפה כי הם סמן חינם ו-מסגרת. כאשר זנים חיידקיים הנדסה עבור התקפה אלימה מחליש, מחיקה של רצפי גנים שלמים במקום לייצר מוטציות נקודה מקטין את הסבירות של הגירסה החוזרת לפנוטיפ המודבק. בנוסף, כל מחיקת הגנים הפתוגניות מחליש את הפתוגן עוד, ומחזקת את יציבות ההנחתה.

שיטה זו יכולה לשמש גם כדי ליצור שינויים גנומית אחרים מאשר מחיקות, כגון מוטציות נקודה והוספות, פשוט על ידי שינוי העיצוב של הוספת באמצע הפלסטיק. סוגים אלה של שינויים עשויים להיות שימושיים יותר מאשר מחיקות גנים שלמים עבור חיידקים הנדסיים עם חילוף חומרים משתנה, למשל. שינוי גנומית רציפה יש פוטנציאל משמעותי ליצירת זנים חיידקיים מעצב כדי להתאים למטרות ספציפיות במחקר ובתעשייה. שיטות אחרות של יצירת הרצוי סמן שינויים גנומית בחיידקים תוארו15,16,17,18. כמו עם כל שיטות לעריכת הגנום, ניסיון שינויים באזורים גנומית חיוניים עלולים להיות קטלניים, ובכך נכשל. במקרים אלה, זיהוי של שינויים גנטיים שונים או גנים מועמדים אחרים נדרש כדי ליצור את המתח החיידקי של עניין.

בהינתן אירועים שכפול רבים ומעברים של כל מושבה במהלך פרוטוקול זה, שינויים לא מכוונים הגנום יתרחשו המתח שנוצר. השינויים גנומית מדויקת ניתן לזהות באמצעות רצף שלמות הגנום. עם זאת, קשה יותר לקבוע את ההשפעה של שינויים אלה. כאשר חיידקים הנדסה למטרה מסוימת, שינויים גנומית שאינם משפיעים לרעה על צמיחת האורגניזם או מסלול (ים) ממוקדות הם נסבלים. בהתאם למתח שנוצר, ייתכן שיהיה אפשר לזהות "בדיקה" כדי להבטיח שהמאמץ עדיין שימושי למטרתו המיועדת. לדוגמה, עם PGN5, המטרה הייתה ליצור זן מחליש ששמר את היכולת לייצר כמויות גדולות של alginate. לאחר מחיקה של חמישה גנים פתוגניות, את הכמות ואת ההרכב של קילוף פלסטיצידיות המיוצר על ידי PGN5 נמדד ונקבע להיות דומה לזנים אחרים קילוף פלסטיצידיות לייצר. כך, ייצור קילוף פלסטיצידיות לא הושפע על ידי חמישה מחיקות גנים, ולא על ידי שינויים גנומית לא מכוונות שהתרחשו במהלך הפיתוח של PGN5.

מודל של הזרקת עכבר תוך הצפק שימש כדי לקבוע אם זן הנדסה היה החליש לעומת זן האב ו -E. coli BL21, זן שאושרו על ידי ה-FDA לייצור ביופרמצבטיקה. הצעדים החשובים ביותר שננקטו במהלך הליך זה בדיקה בעלי חיים היו הכנה ותיקוף של מניות בקטריאלי קפוא. הכנה ושימוש של תרבויות בקטריאלי קפוא להזריק עכברים עדיף להשתמש בתרבות רציפה, כפי שהוא מפחית את מוטציות מספר כי באופן טבעי להתרחש אוכלוסיות חיידקי19. בנוסף, תרבויות קפואות צריכות להישאר מיורות במשך שנים. ספירת צלחות קיימא הראה לא הבדל משמעותי בין CFU/mL ישירות לאחר המניות היו מוכנים ושלושה חודשים לאחר ההכנה. השימוש בצעדי אימות מרובים לאורך הליך זה הבטיח שהשיטה היתה בלתי מויית, והתוצאות לא היו מוטה על ידי חיידקים מזהם. בנוסף, עם מספר הצעדים אמצעי הזהירות שננקטו כדי להבטיח הרתעה, פחות בעלי חיים היו נחוצים. באמצעות זן חיידקי שאושרו על-ידי ה-FDA לייצור ביו-פרמקולוגיה כפקד (כגון החיידק הBL21), שיטה זו יכולה לשמש כדי לבדוק את הנחת של זנים אחרים מהונדסים גנטית של P. aeruginosa, או מינים אחרים של חיידקים.

שימוש בביולומינציה כסמן מספק אימות נוסף של זנים חיידקיים הזריק, כמו הסמן יכול להיות דמיינו באתר ההזרקה. החדרת הסמן biלומינסנציה לתוך כרומוזום חיידקי נדרש עבור הדמיה biלומינסנציה אבל לא יכול להיות אפשרי אם העבודה עם זנים שאינם תואמים/מינים. עם זאת, סימון זנים עם ביולומינציה אינו נדרש כדי לבדוק הנחתה. זנים נבדק במחקר זה סומנו עם biלומינסנציה, אשר אפשרה ויזואליזציה של הבדלים לוקליזציה בין זנים במהלך הזיהום. הבחנו כי זן הפתוגניים הפיץ דרך הגוף של העכבר, אבל הזנים הלא פתוגניים נשאר באתר ההזרקה. בעוד ניסוי זה בדק רק שני זנים קרובים מאוד של P. aeruginosa, זה מרמז כי הפצת חיידקי מקושר התקפה אלימה, לפחות P. aeruginosa. כך, הליך זה של תיוג עם biלומינסנציה כדי להמחיש את ההתקדמות של הזיהום יכול לשמש בעתיד כדי להעריך במהירות את החליש של זנים מהונדסים של חיידקים.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

המחבר Hongwei D. Yu הוא קצין המדע הראשי ומייסד שותף של Progenesis טכנולוגיות, LLC.

Acknowledgments

עבודה זו נתמכת על ידי המכון הלאומי לבריאות (NIH) מענקים R44GM113545 ו P20GM103434.

Materials

Name Company Catalog Number Comments
0.2 mL tubes with flat caps ThermoScientific AB-0620 via Fisher Scientific
1 mL Syringe BD 22-253-260 via Fisher Scientific
1.5 mL disposable polystyrene cuvette Fisher Scientific 14955127
1.5 mL Microcentrifuge Tubes Fisher Scientific 05-408-129
2.0 mL Cryogenic Vials Corning 430659 via Fisher Scientific
27G needle BD 14-821-13B via Fisher Scientific
50 mL tubes Fisher Scientific 05-539-13 via Fisher Scientific
Accu block Digital Dry Bath Labnet NC0205808 via Fisher Scientific
Benchtop Centrifuge 5804R Eppendorf 04-987-372 via Fisher Scientific
Benchtop Microcentrifuge Sorvall 75-003-287 via Fisher Scientific
Cabinet Incubator VWR 1540
Carbenicillin disodium salt Fisher Scientific BP2648250
Culture Test Tube, Polystyrene Fisher Scientific 14-956-6D via Fisher Scientific
Diposable Inoculation Loops Fisher Scientific 22-363-597
Dneasy UltraClean Microbial Kit (50) Qiagen 12224-50 or preferred method/vendor
E.Z.N.A. Cycle Pure Kit (50) Omega bio-tek D6493-01 or preferred method/vendor
EcoRI-HF, restriction endonuclease New England BioLabs R3101L
Electroporation Cuvettes Bulldog Bio NC0492929 via Fisher Scientific
FastLink II DNA Ligation Kit Epicentre Technologies LK6201H via Fisher Scientific
Gentamycin Sulfate Fisher Scientific BP918-1
Glycerol Fisher Scientific BP229-4
GoTaq G2 Colorless Master Mix Promega M7833 via Fisher Scientific
Isothesia Isoflurane Henry Schein Animal Health 29405
IVIS Lumina XRMS Series III In Vivo Imaging System Perkins and Elmer CLS136340
Kanamycin monosulfate Fisher Scientific BP906-5
LE agarose Genemate 3120-500 via Fisher Scientific
Luria Broth Difco 240230 via Fisher Scientific
MicroPulser Electroporator BioRad 1652100
Noble agar, ultrapure Affymetris/USB AAJ10907A1 via Fisher Scientific
NotI-HF, restriction endonuclease New England BioLabs R3189
One Shot TOP10 Electrocomp E. coli Invitrogen C404052 via Fisher Scientific
Phosphate buffered saline powder Sigma P3813-10PAK Sigma-Aldrich
Prism 7 GraphPad https://www.graphpad.com/scientific-software/prism/
Pseudomonas isolation agar Difco 292710 via Fisher Scientific
Pseudomonas isolation broth Alpha Biosciences P16-115 Custom made batch
QIAprep Spin Miniprep Kit (250) Qiagen 27106 or preferred method/vendor
Shaking Incubator New Brunswick Scientific Innova 4080 shake at 200 rpm
SimpliAmp Thermal Cycler Applied Biosystems A24811
Skim Milk Difco DF0032-17-3 via Fisher Scientific
Small Plates (100 O.D. x 10 mm) Fisher Scientific FB0875713
SmartSpec Plus Spectrophotometer Bio-Rad 170-2525 or preferred method/vendor
Sucrose Fisher Scientific S5-500
Toothpicks, round Diamond Any brand of toothpicks, autoclaved
TOPO TA Cloning Kit, for seqeuncing Invitrogen 45-0030
XAF-8 Anesthesia System Filters Perkins and Elmer 118999
XGI 8 Gas Anesthesia System Caliper Life Sciences/Xenogen

DOWNLOAD MATERIALS LIST

References

  1. Gellatly, S. L., Hancock, R. E. Pseudomonas aeruginosa: new insights into pathogenesis and host defenses. Pathogens and Disease. 67, (3), 159-173 (2013).
  2. Valentine, M. E., et al. Generation of a highly attenuated strain of Pseudomonas aeruginosa for commercial production of alginate. Microbial Biotechnology. (2019).
  3. Schweizer, H. P., Hoang, T. T. An improved system for gene replacement and xylE fusion analysis in Pseudomonas aeruginosa. Gene. 158, (1), 15-22 (1995).
  4. Damron, F. H., Qiu, D., Yu, H. D. The Pseudomonas aeruginosa sensor kinase KinB negatively controls alginate production through AlgW-dependent MucA proteolysis. Journal of Bacteriology. 191, (7), 2285-2295 (2009).
  5. Yu, H., Boucher, J. C., Hibler, N. S., Deretic, V. Virulence properties of Pseudomonas aeruginosa lacking the extreme-stress sigma factor AlgU (sigmaE). Infection and Immunity. 64, (7), 2774-2781 (1996).
  6. Baeshen, M. N., et al. Production of Biopharmaceuticals in E. coli: Current Scenario and Future Perspectives. Journal of Microbiology and Biotechnology. 25, (7), 953-962 (2015).
  7. Marisch, K., Bayer, K., Cserjan-Puschmann, M., Luchner, M., Striedner, G. Evaluation of three industrial Escherichia coli strains in fed-batch cultivations during high-level SOD protein production. Microbial Cell Factories. 12, 58 (2013).
  8. Ferrer-Miralles, N., Domingo-Espin, J., Corchero, J. L., Vazquez, E., Villaverde, A. Microbial factories for recombinant pharmaceuticals. Microbial Cell Factories. 8, 17 (2009).
  9. Horton, R. M., Cai, Z. L., Ho, S. N., Pease, L. R. Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction. Biotechniques. 8, (5), 528-535 (1990).
  10. Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., Pease, L. R. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene. 77, (1), 61-68 (1989).
  11. Sambrook, J., Fritsch, E. F., Maniatis, T. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press. (1989).
  12. Figurski, D. H., Helinski, D. R. Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans. Proceedings of the National Academy of Sciences of the United States of America. 76, (4), 1648-1652 (1979).
  13. Choi, K. H., Schweizer, H. P. mini-Tn7 insertion in bacteria with single attTn7 sites: example Pseudomonas aeruginosa. Nature Protocols. 1, (1), 153-161 (2006).
  14. Choi, K. H., Kumar, A., Schweizer, H. P. A 10-min method for preparation of highly electrocompetent Pseudomonas aeruginosa cells: application for DNA fragment transfer between chromosomes and plasmid transformation. Journal of Microbiological Methods. 64, (3), 391-397 (2006).
  15. Liang, R., Liu, J. Scarless and sequential gene modification in Pseudomonas using PCR product flanked by short homology regions. BMC Microbiology. 10, 209 (2010).
  16. Martinez-Garcia, E., de Lorenzo, V. Engineering multiple genomic deletions in Gram-negative bacteria: analysis of the multi-resistant antibiotic profile of Pseudomonas putida KT2440. Environmental Microbiology. 13, (10), 2702-2716 (2011).
  17. Song, C. W., Lee, S. Y. Rapid one-step inactivation of single or multiple genes in Escherichia coli. Biotechnology Journal. 8, (7), 776-784 (2013).
  18. Yan, M. Y., et al. CRISPR-Cas12a-Assisted Recombineering in Bacteria. Applied and Environmental Microbiology. 83, (17), (2017).
  19. Prakash, O., Nimonkar, Y., Shouche, Y. S. Practice and prospects of microbial preservation. FEMS Microbiology Letters. 339, (1), 1-9 (2013).
הדור של המסגרת של גן In-Frame מוטציות מחיקה ב <em>פסאודומונס aeruginosa</em> ובדיקת התקפה אלימה מודל עכבר פשוט של זיהום
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Valentine, M. E., Kirby, B. D., Yu, H. D. Generation of In-Frame Gene Deletion Mutants in Pseudomonas aeruginosa and Testing for Virulence Attenuation in a Simple Mouse Model of Infection. J. Vis. Exp. (155), e60297, doi:10.3791/60297 (2020).More

Valentine, M. E., Kirby, B. D., Yu, H. D. Generation of In-Frame Gene Deletion Mutants in Pseudomonas aeruginosa and Testing for Virulence Attenuation in a Simple Mouse Model of Infection. J. Vis. Exp. (155), e60297, doi:10.3791/60297 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter