Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Genetics

Transformación de raíz de tomate Seguida de inoculación con Ralstonia Solanacearum para el análisis genético directo de la enfermedad bacteriana de Wilt

doi: 10.3791/60302 Published: March 11, 2020

Summary

Aquí, presentamos un método versátil para la transformación de la raíz de tomate seguido de la inoculación con Ralstonia solanacearum para realizar un análisis genético sencillo para el estudio de la enfermedad bacteriana de la enfermedad de wilt.

Abstract

Ralstonia solanacearum es un patógeno vascular devastador que puede infectar a una amplia gama de especies vegetales, causando una amenaza importante para la agricultura. Sin embargo, el modelo Ralstonia está considerablemente infraexplorado en comparación con otros modelos que involucran patógenos vegetales bacterianos, como Pseudomonas syringae en Arabidopsis. La investigación dirigida a comprender la interacción entre Ralstonia y las plantas de cultivo es esencial para desarrollar soluciones sostenibles para luchar contra la enfermedad bacteriana de la inejique, pero actualmente se ve obstaculizada por la falta de ensayos experimentales sencillos para caracterizar los diferentes componentes de la interacción en las plantas anfitrionas nativas. En este escenario, hemos desarrollado un método para realizar análisis genéticos de la infección por Ralstonia de tomate, un huésped natural de Ralstonia. Este método se basa en la transformación mediada por Agrobacterium rhizogenesde las raíces de tomate, seguida de la inoculación de Ralstonia soil-drenching de las plantas resultantes, que contiene raíces transformadas que expresan la construcción de interés. La versatilidad del ensayo de transformación de raíz permite realizar una sobreexpresión genética o un silenciamiento de genes mediado por el ARNI. Como prueba de concepto, utilizamos este método para demostrar que el silenciamiento mediado por ARNi de SlCESA6 en raíces de tomate confirió resistencia a Ralstonia. Aquí, describimos este método en detalle, permitiendo enfoques genéticos para entender la enfermedad de marchitamiento bacteriano en un tiempo relativamente corto y con pequeños requisitos de equipo y espacio de crecimiento de la planta.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Ralstonia solanacearum, agente causal de la enfermedad bacteriana de wilt, es un patógeno vascular devastador transmitido por el suelo con una distribución mundial que puede infectar una amplia gama de especies vegetales, incluyendo papa, tomate, tabaco, plátano, pimienta y berenjena, entre otros1,2. Las pérdidas de rendimiento causadas por Ralstonia pueden alcanzar el 80-90% de la producción en tomate, patata o plátano, dependiendo del cultivar, clima, suelo y otros factores3. Sin embargo, el modelo Ralstonia está considerablemente infraexplorado en comparación con otros modelos que involucran patógenos vegetales bacterianos, como Pseudomonas syringae o Xanthomonas spp. Además, la mayoría de los estudios en interacciones entre plantas y microbios se centran en la planta modelo Arabidopsis thaliana. Aunque la investigación utilizando estos modelos ha contribuido en gran medida a nuestra comprensión de las interacciones entre plantas y bacterias, no abordan la necesidad actual de entender estas interacciones en las plantas de cultivo. La investigación dirigida a comprender la interacción entre Ralstonia y las plantas de cultivo es esencial para desarrollar soluciones sostenibles para luchar contra la enfermedad bacteriana de la inejique, pero actualmente se ve obstaculizada por la falta de ensayos experimentales sencillos para caracterizar los diferentes componentes de la interacción. Particularmente, el tomate, un huésped natural de Ralstonia,es el segundo cultivo vegetal más importante a nivel mundial y se ve afectado por una plétora de enfermedades4,incluida la enfermedad bacteriana de wilt. En este trabajo, hemos desarrollado un método fácil para realizar análisis genéticos de la infección por Ralstonia del tomate. Este método se basa en la transformación mediada por Agrobacterium rhizogenesde las raíces de tomate, utilizando la fluorescencia DsRed como marcador de selección5,seguido de la inoculación de Ralstonia soil-drenching de las plantas resultantes, que contiene raíces transformadas que expresan la construcción de interés. La versatilidad del ensayo de transformación de raíz permite realizar una sobreexpresión genética o un silenciamiento de genes mediado por el ARNI.

Una limitación potencial de este método consiste en el crecimiento residual de raíces no transformadas. Esto es particularmente importante en los casos en que el plásmido utilizado carece de un gen reportero que permita la selección de raíces transformadas. Para resolver este problema, hemos desarrollado un método alternativo basado en la selección de antibióticos, que inhibe el crecimiento de raíces no transformadas al tiempo que permite el crecimiento de raíces transformadas sanas resistentes a los antibióticos. Dado que A. rhizogenes no induce la transformación de los brotes, son susceptibles al antibiótico y, por lo tanto, deben mantenerse separados del medio que contiene antibióticos.

Aunque la resistencia de las plantas contra Ralstonia no se entiende bien, varios informes han asociado alteraciones de la pared celular a una mayor resistencia a la marchitabacteriana6,,7,8,9. Se ha sugerido que estas alteraciones de la pared celular afectan el desarrollo vascular, un aspecto esencial para el estilo de vida de Ralstonia dentro de la planta10. Se ha demostrado que las mutaciones en genes que codifican las sinteas de celulosa CESA4, CESA7 y CESA8 en Arabidopsis thaliana afectan la integridad de la pared celular secundaria, causando una mayor resistencia a Ralstonia,que parece estar vinculada a la señalización ABA8. Por lo tanto, como prueba de concepto para nuestro método, realizamos silenciamiento de genes mediado por ARNi de SlCESA6 (Solyc02g072240), una celulosa de pared celular secundaria sintasa, y ortolog de AtCESA8 (At4g18780). La posterior inoculación de drenado del suelo con Ralstonia mostró que silenciar SlCESA6 mejoró la resistencia a los síntomas de marchitamiento bacteriano, lo que sugiere que la resistencia mediada por la pared celular a Ralstonia probablemente se conserva en el tomate, y validando nuestro método para llevar a cabo análisis genéticos de la resistencia bacteriana a la marchitamiento en las raíces del tomate. Aquí, describimos este método en detalle, permitiendo enfoques genéticos para entender la enfermedad de marchitamiento bacteriano en un tiempo relativamente corto y con pequeños requisitos de equipo y espacio de crecimiento de la planta.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

NOTA: Las partes importantes de este método implican la manipulación de materiales vegetales in vitro, y por lo tanto es importante mantener las condiciones estériles durante todos estos procedimientos, incluida la visualización de la fluorescencia DsRed. Durante todo el proceso de transformación, las plántulas de tomate crecen a 25 o28 oC y 16 h/8 h de luz/oscuridad (130 mmol fotones m-2s-1 luz). Las placas están selladas con cinta adhesiva de microporos para facilitar el intercambio y la transpiración de gas.

1. Preparación de plantas de tomate y Agrobacterium rhizogenes

  1. Esterilizar las semillas de tomate (Solanum lycopersicum cv. Moneymaker, LA2706, Centro de Recursos de Genética del Tomate, TGRC) con 5% (v/v) hipoclorito de sodio durante 5 min. Lavar 4-5 veces con agua estéril destilada y mantener las semillas lentamente temblando en agua estéril durante la noche para facilitar la germinación.
  2. Transfiera las semillas de tomate al medio de Murashige y Skoog (1/2 MS) sin sacarosa (2,21 g/L MS, 8% p/v agar). Mantener las semillas en la oscuridad a 25-28 oC durante tres días(Figura 1A).
    NOTA: Por lo general, se necesitan alrededor de 40 semillas para cada construcción.
  3. Autoclave 8,5 cm2 papeles de filtro cuadrados. Coloque los papeles de filtro cuadrados dentro de 9 cm2 platos de petri cuadrados que contengan medio MS (coloque el papel encima del agar) y coloque seis semillas de tomate germinadas en cada plato(Figura 1B). Sellar la placa con cinta adhesiva de microporoe e incubar las semillas germinadas a 25 o 28 oC durante 3 x 4 días.
  4. Cultivar Agrobacterium rhizogenes MSU440 en medio sólido de LB (con antibióticos apropiados) a 28 oC dos días antes de la transformación de la planta.
    NOTA: A. rhizogenes es proporcionado por el Dr. Juan Antonio López Ráez, EEZ-CSIC, Granada, España. En el experimento descrito en este artículo, se utilizó A. rhizogenes que contienen pK7GWIWG2_II-RedRoot::CESA6 o un vector vacío, como control. pK7GWIWG2_II-RedRoot contiene un gen reportero, DsRed, impulsado por el promotor de la ubiquitina Arabidopsis thaliana (pAtUBQ10), y confiere resistencia a la espectromicina (50 g/ml). Es posible utilizar otros vectores para la sobreexpresión genética, como se informó antes de5. En este trabajo, la amplificación del fragmento específico para el silenciamiento SlCESA6 se obtuvo mediante transcripción inversa (RT) PCR utilizando ARN aislado de tomate (S. lycopersicum cv. Moneymaker) y ligado en vector p-ENTR/D-TOPO (Tabla 1). Posteriormente, el fragmento SlCESA6-RNAi fue clonado en el vector binario pK7GWIWG2_II-RedRoot.

2. Transformación y selección de plantas

  1. Usando un bisturí estéril, corte el radio y la parte inferior del hipocotículo de las plántulas de tomate(Figura 1C,D).
  2. Cosecha A. rhizogenes biomasa de la superficie del medio LB utilizando puntas de plástico o una cuchilla de bisturí y sumerja cuidadosamente las plántulas de tomate cortadas en la biomasa bacteriana (Figura 1E).
  3. Después de la inoculación con A. rizogenes, cubra las plántulas de tomate con un papel de filtro semicircular de 2 cm x 4 cm(Figura 1F),con el fin de mantener una alta humedad y facilitar la supervivencia y el desarrollo de nuevas raíces.
  4. Almacene las plántulas de tomate transformadas durante 6-7 días. Luego, utilice un bisturí estéril para cortar las nuevas raíces peludas emergentes(Figura 1G,H; en este paso, las raíces aún no se transforman) y permitir que las plántulas produzcan nuevas raíces peludas.
  5. Una vez que aparezca la segunda generación de nuevas raíces peludas(Figura 1I),retire el papel de filtro en la parte superior de las plántulas y vuelva a sellar la placa con cinta adhesiva de microporo.
    NOTA: En este punto, la presencia del marcador fluorescente DsRed en el vector de transformación permite visualizar la eficiencia de transformación en las nuevas raíces.
  6. Para visualizar la fluorescencia DsRed, utilice un estereomicroscopio o cualquier otro equipo para la obtención de imágenes en vivo(Figura 1J). Marque las raíces transformadas positivas (fluorescencia roja) y elimine las raíces negativas no transformadas (sin fluorescencia roja) utilizando un bisturí estéril.
  7. Transferir las plántulas que muestren fluorescencia roja a una nueva placa que contenga un medio MS, con el fin de facilitar el desarrollo de la raíz transformada como raíz principal(Figura 1K). Conservar las plántulas que no muestran fluorescencia roja en la misma placa para comprobar la aparición de raíces fluorescentes(Figura 1L)en puntos de tiempo posteriores.
  8. Método alternativo basado en la selección de antibióticos
    1. Alternativa al paso 2.5, preparar placas cuadradas de 9 cm2 semicargadas que contengan medio DeM con el antibiótico adecuado. Incline las placas aproximadamente 5o durante el proceso de preparación para generar un espacio vacío sin medio(Figura 2A),permitiendo que los brotes crezcan evitando el contacto con el antibiótico.
    2. Alternativa al paso 2.6, después de cortar las primeras raíces peludas no transformadas emergieron (paso 2.4), transfiera las plántulas sin raíces a las placas semicargadas utilizando papeles de filtro con el tamaño adecuado(Figura 2B).
      NOTA: Como control positivo, se recomienda transformar varias plántulas con un plásmido que contenga la misma resistencia a los antibióticos y un gen reportero (en este protocolo, pK7GWIWG2_II-RedRoot; kanamicina 50 g/ml).
    3. Alternativamente al paso 2.7, deje que las plántulas desarrollen nuevas raíces peludas y corten aquellas raíces que no están en contacto directo con la superficie de los papeles de sándwich de filtro, ya que estas raíces pueden evitar la selección de antibióticos.
      NOTA: Debido al efecto antibiótico, el desarrollo de la raíz puede ser más lento que en placas sin antibióticos. Nuevas raíces peludas transformadas aparecen dentro de 14 a 18 días después de transferir las plántulas sin raíces a las placas semillenas (paso 2.8.2)(Figura 2C-E).
  9. Cubra las plántulas con un papel de filtro semicírculo de 2 cm x 4 cm, selle la placa e incubar las plántulas para dejarlas desarrollar nuevas raíces peludas.
    NOTA: No es necesario eliminar el A. rizogenes usando antibióticos. El papel filtrante en la parte superior del medio MS y la falta de sacarosa inhiben la propagación de la A. rizogenes en la placa5.
  10. Cinco a siete días después de la primera selección de raíz, repita el proceso de selección para seleccionar nuevas raíces transformadas y eliminar raíces no transformadas. Transfiera las plántulas que contienen raíces transformadas a una placa nueva que contenga un medio MS.

3. Transferencia a macetas de inoculación

  1. Preparar macetas de inoculación donde la superficie de las raíces estará expuesta al inóculo bacteriano: remojar las ollas de inoculación con agua, verter cualquier exceso de agua y colocarlas en una bandeja de plantación de plástico. Transfiera las plántulas seleccionadas con raíces transformadas a macetas de inoculación utilizando pinzas(Figura 3A).
  2. Cubra la bandeja con una envoltura de plástico o una tapa transparente y manténgala a 25 o28 oC y 65% de humedad (16 h/8 h de luz/oscuridad; 130 mmol fotones m-2s-1 luz), para mantener un alto nivel de humedad Figura 3B). Retire la cubierta después de cinco o seis días.
    NOTA: Las plantas de tomate transformadas están listas para la inoculación de dos a tres semanas después de transferirlas al suelo(Figura 3C). Durante el crecimiento en el suelo, las plantas de tomate pueden producir nuevas raíces que no se transforman. Para determinar el alcance de este fenómeno, la fluorescencia roja se visualizó en las raíces de las plantas de tomate transformadas de 3 semanas de edad. La mayoría de las raíces (80%-100%) mostraron fluorescencia roja, lo que indica que efectivamente se transforman(Figura 3D,E).

4. Inoculación de desgranación del suelo

  1. Crecer R. solancearum (strain GMI1000 en este protocolo) en medio líquido phi(Tabla 211) en un agitador orbital (200 rpm) a 28oC hasta la fase estacionaria.
  2. Determinar los números bacterianos midiendo la densidad óptica del cultivo bacteriano a 600 nm (OD600). Diluir el cultivo bacteriano con agua a una Do6600 de 0,1 (en las condiciones utilizadas aquí, esto corresponde a aproximadamente 108 unidades formadoras de colonias [CFU]/mL).
  3. Colocar macetas de inoculación de 16 a 20 que contengan plantas de tomate transformadas en una bandeja de inoculación (29 cm x 20 cm; Figura 4A).
  4. Vierta 300 ml (15 ml por planta) de inóculo bacteriano (OD600 de 0,1) en la bandeja que contiene las ollas de inoculación. Dejar los empaparse en el inóculo durante 20 min(Figura 4B).
  5. Prepare una nueva bandeja con una capa de tierra para macetas. Mover las macetas inoculadas en la nueva bandeja(Figura 4C)y colocar las bandejas en una cámara de crecimiento con 75% de humedad, 26 x 28 oC, y un fotoperiodo de 12 h de luz y 12 h de oscuridad (130 mómicos de luz m-2s-1).

5. Determinación de parámetros de infección y análisis estadístico

  1. Puntuar los síntomas de la enfermedad como se describió anteriormente12,13, utilizando una escala que va desde 0 (sin síntomas) a 4(marchitamientocompleto) ( Figura 4D-H), cada día después de la inoculación de Ralstonia durante dos semanas.
    NOTA: Los datos del índice de enfermedad se recopilan de la misma unidad experimental (cada planta) a lo largo del tiempo.

6. Análisis de la expresión génica

NOTA: La expresión del transgén o el silenciamiento del gen objetivo puede determinarse mediante RT-PCR o por RT-PCR cuantitativo (qRT-PCR).

  1. Recoger muestras y extraer ARN de una parte representativa del sistema radicular transformado (para evaluar el efecto sobre el gen objetivo) y hojas (como control interno).
  2. Sintetice el ADNc utilizando 1 g de ARN total tratado con DNase.
  3. Analizar la expresión génica de los genes diana por qRT-PCR. Calcule los niveles de transcripción relativos utilizando el método 2--CT 14, utilizando SlIF-1 como gen de limpieza15.
    NOTA: Las secuencias de imprimación se enumeran en la Tabla 1.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

La Figura 5 muestra el desarrollo de síntomas de enfermedad de plantas de tomate con raíces transformadas con un vector vacío (EV), y plantas con raíces transformadas con una construcción de ARNi dirigida a SlCESA6 (Solyc02g072240). Los datos del índice de la enfermedad(Figura 5A)se recopilan de la misma unidad experimental (cada planta) a lo largo del tiempo de acuerdo con una escala arbitraria de 0 a 4, y no siguen una distribución gaussiana, descartando el uso de pruebas estándar para los datos paramétricos. Además, hay una variación intrínseca planta-planta en este tipo de experimentos, debido a la colonización y la dinámica de infección. A continuación consideramos diferentes métodos para la representación y análisis estadístico de los síntomas asociados a la infección por Ralstonia.

Como enfoque estándar, se utilizó una prueba no paramétrica de dos colas U Mann-Whitney para comparar las curvas de infección de control (EV) y SlCESA6-RNAi. Según este análisis, la diferencia entre las medianas de ambas curvas parece no ser significativa(P a 0,16).

También es posible cuantificar el área bajo la curva de progreso de la enfermedad (AUDPC), que permite combinar múltiples observaciones del progreso de la enfermedad en un solo valor. La AUDPC mostró un valor más alto para las plantas de control (EV; 28,75 a 4,75) en comparación con las plantas de SlCESA6-RNAi (21,01 a 4,74) al final del proceso de infección, lo que indica que las plantas silenciadas por SlCES6son más resistentes a la infección por Ralstonia que las plantas de control (Figura 5B).

Los intervalos de confianza (CI) ofrecen una forma de estimar, con alta probabilidad, un rango de valores en el que se encuentra el valor de población (o parámetro) de una variable determinada. Como se muestra en la Figura 5C, el área de IC del 95% para las curvas de infección de control (EV) y SlCESA6-RNAi estiman una mayor probabilidad de resistencia cuando se silencia SlCESA6.

Los valores del índice de la enfermedad se pueden transformar en datos binarios, teniendo en cuenta un índice de enfermedad inferior a 2 correspondiente a "0", y un índice de enfermedad igual o superior a 2 correspondiente a "1"12. Esto permite la representación de una curva de supervivencia después de la inoculación de Ralstonia. Esta transformación se basa en la observación de que, una vez que las plantas comienzan a desarrollar síntomas claros (índice de enfermedad de 2), se consideran como "infectados" y morirán como consecuencia de esta infección. Las diferencias en la tasa de supervivencia entre las plantas de EV y SlCESA6-RNAi no fueron estadísticamente significativas según una prueba estadística Gehan-Breslow-Wilcoxon (P a 0,13) (Figura 5D).

Además de realizar análisis estadísticos, e independientemente de los valores P obtenidos, vale la pena interpretar estos datos en función de la reproducibilidad de las tendencias observadas dentro de diferentes réplicas(Figura Suplementaria 1). De acuerdo con esta noción, un número cada vez mayor de científicos han comentado recientemente sobre los riesgos de sobreutilizar umbrales estadísticos estrictos (como el estándar P a 0,05)16.

La expresión de SlCESA6 se analizó en dos raíces transformadas seleccionadas aleatoriamente antes del paso de inoculación, lo que muestra que la mayor resistencia a la ralstonia se correlaciona con la expresión reducida de SlCESA6 (Figura 5E). Con este método, se puede obtener una tasa de transformación de 35-40% después de dos rondas de selección (Figura 5F). Este valor se puede aumentar realizando rondas de selección adicionales5.

Figure 1
Figura 1: Preparación, transformación y selección de plantas. (A) Germinación de semillas de tomate en medio de la MUS de media resistencia (1/2). (B) Semillas de tomate germinadas colocadas sobre papel filtrante que se encuentran sobre un plato que contiene medio MS. Separaciones de tomate antes (C) y después (D) cortando el radio y la parte inferior del hipocotilo. (E) Transformación de la plántula de tomate sumergiendo en biomasa bacteriana. (F) Plántulas de tomate transformadas cubiertas con papel de filtro para mantener la humedad. Emergencia (G) y eliminación (H) de raíces vellosas nuevas (no transformadas). (I) Raíces transformadas. (J) Selección de raíces peludas de tomate transformadas mediante la visualización de la fluorescencia DsRed. Las flechas rojas indican raíces transformadas positivas que expresan la fluorescencia DsRed. (K) Desarrollo de las raíces transformadas como raíces principales. (L) Visualización de la fluorescencia DsRed en raíces maduras transformadas. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2: Método alternativo basado en la selección de antibióticos. (A) Placa cuadrada medio llena que contiene un medio MS de 1/2. (B) Cortar las plántulas desechadas en papel filtrante en un medio de Em con antibióticos, después de la eliminación de las primeras raíces peludas no transformadas. (C) Raíces cubiertas con papel de filtro adicional. (D) Raíces transformadas en tomate cultivadas en medio de SM 1/2 con antibióticos. (E) Seedlings transformados con pK7GWIWG2_II-RedRoot (kanamicina 50 g/mL), expresando DsRed, como control positivo. Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3: Transferencia de tomate transformado a macetas de inoculación. (A) Tomates transformados en raíces transferidos a ollas de inoculación tope. (B) Tomates transformados en ollas de inoculación cubiertas con una tapa de plástico para mantener un alto nivel de humedad. (C) Tomates transformados en raíces de dos a tres semanas de edad, después de la transferencia a macetas de inoculación, listos para ser inoculados. (D) Plantas de tomate de tres semanas de edad después de retirar el suelo. (E) Fluorescencia DsRed en raíces de plantas de tomate transformadas de 3 semanas de edad. Haga clic aquí para ver una versión más grande de esta figura.

Figure 4
Figura 4: Inoculación de ralstonia de drenado del suelo. (A) Materiales necesarios para la inoculación R. solanacearum GMI1000. (B) Drenado del suelo de tomates transformados en macetas de inoculación con R. solanacearum GMI1000 inóculo. (C) Tomates inoculados colocados sobre una capa de tierra maceta. (D-H) Los síntomas de la enfermedad de Ralstonia se escalan entre 0 (sin síntomas) y 4 (marchitamiento completo). Haga clic aquí para ver una versión más grande de esta figura.

Figure 5
Figura 5: El silenciamiento SlCESA6 mejora la resistencia a R. solanacearum. (A) Síntomas de enfermedad de SlCESA6mediadopor en ARNi6 -silencio (CESA6-RNAi) y plantas de tomate transformadas en raíz (EV) y vectores vacíos (EV) tras la inoculación con R. solanacearum. Los valores corresponden a los medios de sede de ocho plantas. (B) Zona bajo la curva de progreso de la enfermedad de las plantas que se muestra en el panel A. (C) 95% de confianza Intervalo de las plantas mostradas en el panel A. (D) Porcentaje de plantas supervivientes que se muestran en el panel A. (E) Análisis de la expresión génica por qRT-PCR de lasplantas de tomate silenciadas (CESA6i) y ev transformadas en raíces (1,2) y brote (S). Los valores corresponden a los medios - SE de tres réplicas técnicas. (F) Tasa de transformación de LAS plantas de tomate transformadas en raíz de EV y CESA6-RNAi de dos experimentos independientes. Los valores corresponden a las medias - SE, después de dos rondas de selección. Haga clic aquí para ver una versión más grande de esta figura.

Primer nombre Secuencia de imprimación (5'-3')
EF-1-F GGTGGGGAGCATGATTTTGA
EF-1-R CGAGCCAACCATGGAAAACAAA
qCESA6-F GATCTGGTTCGCTTCTCGT
qCESA6-R TCCCTCCCTTTCATACCTTG
CESA6-RNAi-F CACCGGCGAACAAGTGGGGTTAG
CESA6-RNAi-R TTTGAGACTTTGGCACTGGA

Tabla 1: Secuencias de imprimación.

Ingredientes Para 1 L
Peptona de bacto 10 g
Extracto de levadura 1 g
Acidos Casamino 1 g

Tabla 2: Composición media de Phi.

Figura suplementaria 1: Reproducibilidad del resultado mostrado en la Figura 5A. Síntomas de enfermedad de las plantas de tomate silladas por ARNiSA6-silenced (CESA6-RNAi) y EV transformaron en raíz tras la inoculación con R. solanacearum. Los valores corresponden a los medios de sede de ocho plantas. El análisis de la expresión génica fue realizado por SlCESA6qRT-PCR de plantas de tomate transformadas en raíces (1,2) y brote (S) mediadas por ARNi. Los valores corresponden a los medios - SE de tres réplicas técnicas. Haga clic aquí para descargar esta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Ralstonia solanacearum representa una amenaza importante para la agricultura; sin embargo, su interacción con los huéspedes naturales de importancia agrícola todavía se entiende mal en comparación con otros patógenos bacterianos, especialmente en especies de plantas de cultivo. En la mayoría de los casos, el análisis genético se ve obstaculizado por el tiempo y los gastos necesarios para modificar genéticamente las plantas anfitrionas. Para abordar este problema y facilitar el análisis genético de la infección por R. solanacearum en el tomate, hemos desarrollado un método fácil basado en la transformación mediada por Agrobacterium rhizogenesde las raíces de tomate(Figura 1),seguido de la inoculación del suelo(Figura 3). Las raíces transformadas se seleccionan mediante un reportero fluorescente (DsRed en este protocolo) (Figura 1). Además, también hemos desarrollado un método alternativo basado en la selección de antibióticos que no daña la parte aérea no transformada(Figura 2).

El protocolo de transformación se basa en el descrito por Ho-Plágaro et al.5, con varias modificaciones. La versatilidad de este método permite múltiples ensayos adicionales en raíces transformadas, como los para analizar la fisiología vegetal, la respuesta a tratamientos químicos y/o respuestas a diferentes tensiones bióticas y abióticas.

Después de transferir las plantas transformadas al suelo, consideramos la posibilidad de que las plantas puedan desarrollar nuevas raíces que no pueden ser transformadas. Exploramos esta posibilidad observando la fluorescencia de DsRed en el sistema radicular de las plantas transformadas dos semanas después de transferirlas al suelo (antes de la inoculación de Ralstonia). Los resultados mostraron fluorescencia roja en la mayoría de las raíces(Figura 3D).

La transferencia de ADN T por Agrobacterium se integra en el genoma del huésped de manera aleatoria y, por lo tanto, este método genera una población heterogénea de plantas de tomate con diferentes niveles de expresión del gen diana. La infección por R. solanacearum normalmente causa la muerte de las plantas, lo que, posteriormente, dificulta la recolección de muestras de raíz después del experimento para analizar la expresión génica de cada planta. Para analizar el nivel de expresión del gen objetivo durante los experimentos, seleccionamos de dos a tres plantas transformadas en raíz antes del paso de inoculación, como muestra representativa de la población que se inoculará. La Figura 5 muestra que la reducción de los síntomas de la enfermedad en las plantas de tomate se correlaciona con la eficiencia del silenciamiento de SlCESA6 antes de la etapa de inoculación. Por lo tanto, y a pesar de las limitaciones del protocolo, nuestros resultados representativos demuestran claramente que este método es una poderosa herramienta para estudiar los genes candidatos involucrados en la resistencia o susceptibilidad a R. solanacearum en el tomate. El ejemplo mostrado en este artículo nos permitió determinar que el derribo SlCESA6, una célula secundaria relacionada con la celulosa sintasa, mejora la resistencia a la infección por R. solanacearum, que se asemeja a observaciones anteriores utilizando su ortolog AtCESA8 (At4g18780) de Arabidopsis thaliana8.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

Agradecemos a todos los miembros del laboratorio Macho por sus útiles debates, a Alvaro López-García por el asesoramiento estadístico y a Xinyu Jian por su asistencia técnica y administrativa durante este trabajo. Agradecemos a la instalación central de Biología Celular del PSC por la asistencia con la imagen por fluorescencia Este trabajo fue apoyado por el Programa Estratégico de Investigación Prioritaria de la Academia China de Ciencias (concesión XDB27040204), el Centro de Shanghai para biología del estrés vegetal (chino Academia de Ciencias) y el programa chino 1000 Talents.

Materials

Name Company Catalog Number Comments
90 mm square Petri-dishes
Agar powder Sigma-Aldrich
Bacto peptone BD (Becton and Dickinson)
Casamino acids Sigma-Aldrich
Filter paper
In Vivo Plant Imaging System NightShade LB 985 Berthold Technologies
Jiffy pots Jiffy Products International A.S.
Micropore tape 3M
Murashige and Skoog medium (M519) Phytotechlab
Pindstrup substrate Pindstrup Mosebrug A/S
Scalpel and blade
Sodium hypochlorite Sigma-Aldrich
Sterile clean bench
Tweezers
Wahtman paper Wahtman International Ltd. Maldstone
Yeast extract OXOID

DOWNLOAD MATERIALS LIST

References

  1. Jiang, G., et al. Bacterial Wilt in China: History, Current Status, and Future Perspectives. Frontiers in Plant Science. 11, (8), 1549 (2017).
  2. Mansfield, J., et al. Top 10 plant pathogenic bacteria in molecular plant pathology. Molecular plant pathology. 13, (6), 614-629 (2012).
  3. Elphinstone, J. G. The current bacterial wilt situation: a global overview. In: Bacterial Wilt Disease and the Ralstonia solanacearum Species Complex. Allen, C., Prior, P., Hayward, A. C. American Phytopathological Society Press. St Paul, MN. 9-28 (2005).
  4. Jones, J. B., Jones, J. P., Stall, R. E., Zitter, T. A. Compendium of Tomato 1094 Diseases. APS Press. St Paul, MN. (1991).
  5. Ho-Plágaro, T., Huertas, R., Tamayo-Navarrete, M. I., Ocampo, J. A., García-Garrido, J. M. An improved method for Agrobacterium rhizogenes-mediated transformation of tomato suitable for the study of arbuscular mycorrhizal symbiosis. Plant Methods. 14, 34 (2018).
  6. Wydra, K., Beri, H. Structural changes of homogalacturonan, rhamnogalacturonan I and arabiogalactan protein in xylem cell walls of tomato gentoypes in reaction to Ralstonia solanacearum. Physiological and Molecular Plant Pathology. 68, 41-50 (2006).
  7. Wydra, K., Beri, H. Immunohistochemical changes in methyl-ester distribution of homogalacturonan and side chain composition of rhamnogalacturonan I as possible components of basal resistance in tomato inoculated with Ralstonia solanacearum. Physiological and Molecular Plant Pathology. 70, 13-24 (2007).
  8. Hernández-Blanco, C., et al. Impairment of cellulose synthases required for Arabidopsis secondary cell wall formation enhances disease resistance. Plant Cell. 19, (3), 890-903 (2007).
  9. Denancé, N., et al. Arabidopsis wat1 (walls are thin1)-mediated resistance to the bacterial vascular pathogen, Ralstonia solanacearum, is accompanied by cross-regulation of salicylic acid and tryptophan metabolism. Plant Journal. 73, (2), 225-239 (2013).
  10. Digonnet, C., et al. Deciphering the route of Ralstonia solanacearum colonization in Arabidopsis thaliana roots during a compatible interaction: focus at the plant cell wall. Planta. 236, (5), 1419-1431 (2012).
  11. Sang, Y., et al. The Ralstonia solanacearum type III effector RipAY targets plant redox regulators to suppress immune responses. Molecular Plant Pathology. 19, (1), 129-142 (2018).
  12. Remigi, P., Anisimova, M., Guidot, A., Genin, S., Peeters, N. Functional diversification of the GALA type III effector family contributes to Ralstonia solanacearum adaptation on different plant hosts. New Phytologist. 192, 976-987 (2011).
  13. Wang, K., et al. Functional assignment to positively selected sites in the core type III effector RipG7 from Ralstonia solanacearum. Molecular Plant Pathology. 17, 553-564 (2016).
  14. Livak, K. J., Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods. 25, (4), 402-408 (2001).
  15. León-Morcillo, R. J., Martín-Rodríguez, J. A., Vierheilig, H., Ocampo, J. A., García-Garrido, J. M. Late activation of the 9-oxylipin pathway during arbuscular mycorrhiza formation in tomato and its regulation by jasmonate signalling. Journal of Experimental Botany. 63, (10), 3545-3558 (2012).
  16. Amrhein, V., Greenland, S., McShane, B. Retire statistical significance. Nature. 567, 305-307 (2019).
Transformación de raíz de tomate Seguida de inoculación con <em>Ralstonia Solanacearum</em> para el análisis genético directo de la enfermedad bacteriana de Wilt
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Morcillo, R. J. L., Zhao, A., Tamayo-Navarrete, M. I., García-Garrido, J. M., Macho, A. P. Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease. J. Vis. Exp. (157), e60302, doi:10.3791/60302 (2020).More

Morcillo, R. J. L., Zhao, A., Tamayo-Navarrete, M. I., García-Garrido, J. M., Macho, A. P. Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease. J. Vis. Exp. (157), e60302, doi:10.3791/60302 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter