Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Genetisk modifikation af cyanobakterier ved konjugering ved hjælp af det modulære Cyanogat klonings værktøjssæt

doi: 10.3791/60451 Published: October 31, 2019
* These authors contributed equally

Summary

Her præsenterer vi en protokol, der beskriver hvordan i) samler en selvkopierende vektor ved hjælp af den modulære CyanoGate klonings værktøjssæt, II) indfører vektoren i en cyanobakterial vært ved konjugering, og III) karakteriserer transgene cyanobakterier stammer ved hjælp af en plade læseren eller flowcytometri.

Abstract

Cyanobakterier er en mangfoldig gruppe af prokaryotiske fotosyntetiske organismer, der kan modificeres genetisk til vedvarende produktion af brugbare industrivarer. Nylige fremskridt inden for syntetisk biologi har ført til udvikling af flere klonings værktøjssæt som cyanogat, et standardiseret modulært klonings system til opbygning af plasmid-vektorer til efterfølgende omdannelse eller ægteskabelige overførsel til cyanobakterier. Her skitserer vi en detaljeret metode til montering af en selvkopierende vektor (f. eks. med et fluorescerende markør udtryks kassette) og konjugeret overførsel af vektoren til cyanobakteriale stammer Synechocystis Sp. pcc 6803 eller Synechococcus elongatus utex 2973. Derudover skitserer vi, hvordan man karakteriserer udførelsen af en genetisk del (f. eks. en promotor) ved hjælp af en plade læser eller flow cytometri.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Cyanobakterier er autotrofisk bakterier, der kan anvendes til biosyntesen af en bred vifte af naturlige og heterologe høj værdi metaboliske produkter1,2,3,4,5, 6. Flere forhindringer skal stadig overvindes for at udvide deres kommercielle levedygtighed, især de relativt dårlige udbytter i forhold til heterotrofisk bio-platforme (f. eks. Escherichia coli og gær)7. Den nylige udvidelse af de tilgængelige genteknologiske værktøjer og udbredelsen af det syntetiske biologi paradigme inden for cyanobakteriel forskning bidrager til at overvinde sådanne udfordringer og videreudvikle cyanobakterier som effektive biofactorier8, 9,10.

De vigtigste tilgange til indførelse af DNA i cyanobakterier er omdannelse, konjugering og elektroporation. De vektorer, der overføres til cyanobakterier ved omdannelse eller elektroporation, er "selvmords vektorer" (dvs. Integrative vektorer, som letter homologe rekombination), mens selvkopierende vektorer kan overføres til cyanobakterier ved omdannelse, konjugering eller elektroporation. For førstnævnte, en protokol er tilgængelig for Engineering model arter modtagelig for naturlig transformation11. For nylig, en modulær kloning (MoClo) Toolkit for cyanobakterier kaldet Cyanogat er blevet udviklet, der beskæftiger en standardiseret Golden Gate vektor montage metode til teknik ved hjælp af naturlig transformation, elektro poration eller konjugering12.

Golden Gate-type montage teknikker er blevet stadig mere populære i de seneste år, og montage standarder og del biblioteker er nu tilgængelige for en række organismer13,14,15,16 ,17. Golden Gate brugertype IIS restriktionsenzymer (f. eks BsaI, BpiI, BsmBI, BtgZI og AarI) og en dragt af acceptorer og unikke udhæng for at lette retningsbestemt hierarkisk samling af flere sekvenser i en "en pot" assembly reaktion. Type IIS-begrænsnings enzymer genkender en unik asymmetrisk sekvens og skærer en defineret afstand fra deres genkendelses steder for at generere en forskudt, "klæbrig ende" udskæring (typisk en 4 nucleotid [NT] udhæng), som efterfølgende kan udnyttes til at drive bestilt DNA monterings reaktioner15,18. Dette har lettet udviklingen af store biblioteker af modulære niveau 0 dele (f. eks initiativtagere, åbne læse rammer og terminatorer) defineret ved en fælles syntaks, såsom PhytoBricks standard19. Niveau 0 dele kan derefter let samles i niveau 1 udtryk kassetter, hvorefter mere komplekse højere ordre samlinger (f. eks multi gene Expression konstruktioner) kan bygges i en acceptor vektor af valg12,15. En vigtig fordel ved montering af gyldne Gate-typer er deres modtagelighed for automatisering ved højkapacitets anlæg, såsom DNA-støberier20,21, som kan muliggøre afprøvning af komplekse eksperimentelle designs, der kan ikke nemt opnås ved manuel arbejdskraft.

Cyanogat bygger på det etablerede Plant moclo system12,15. For at indarbejde en ny del i Cyanogat, skal den del sekvens først være domesticerede, dvs "ulovlige" anerkendelse sites for BsaI og BpiI skal fjernes. I tilfælde af en del kodning for en åben læse ramme (dvs. en kodnings sekvens, cd'er), kan genkendelses stederne forstyrres ved at generere synonyme mutationer i sekvensen (dvs. ændre en codon til et alternativ, der koder for den samme aminosyre rest). Dette kan opnås ved en række forskellige tilgange, lige fra DNA-syntese til polymerase kædereaktion (PCR) forstærknings baserede strategier som Gibson assembly22. Afhængigt af det udtryk vært, der anvendes, bør der udvises forsigtighed for at undgå indførelsen af sjældne kodon, der kan hæmme effektiviteten af oversættelse23. Fjernelse af genkendelses websteder i promotor-og terminatorsekvenser er typisk en mere risikobetonet bestræbelse, da ændringer kan påvirke funktionen, og delen muligvis ikke fungerer som forventet. For eksempel kan ændringer i formodede transskriptionsfaktor bindingssteder eller ribosom-bindingsstedet i en promotor ændre styrke og reaktionsevne over for induktion/undertrykkelse. På samme måde kan ændringer af centrale Terminator strukturelle funktioner (f. eks GC rige stilk, loop og poly-U hale) ændre termineringseffekten og effekt genekspression24,25. Selv om der er flere online ressourcer til rådighed til at forudsige aktiviteten af promotor-og terminatorsekvenser og oplyse, om en foreslået mutation vil påvirke ydeevnen26,27, er disse værktøjer ofte dårlige prædiktorer for ydeevne i cyanobakterier28,29,30.. Som sådan, in vivo karakterisering af modificerede dele anbefales stadig at bekræfte aktiviteten. For at hjælpe med kloning af genstridige sekvenser, cyanogate omfatter en lav kopi kloning acceptor vektor baseret på biobrick vektor pSB4K512,16,31. Desuden er en "design og build" Portal tilgængelig gennem Edinburgh Genome Foundry til at hjælpe med vektor design (dab.genomefoundry.org). Endelig, og vigtigst af alt, omfatter CyanoGate to niveau T acceptor vektor designs (svarende til niveau 2 acceptor vektorer)15 for at indføre DNA i cyanobakterier ved hjælp af selvmords vektorer, eller brede Host-Range vektorer i stand til selv-replikation i flere cyanobakteriale arter32,33,34.

Her vil vi fokusere på at beskrive en protokol til generering af niveau T selvkopierende vektorer og den genetiske modifikation af Synechocystis pcc 6803 og Synechococcus elongatus Utex 2973 (synechocystis PCC 6803 og S. elongatus Utex 2973 herefter) ved konjugering (også kendt som Tri-Parental Mating). Conjugal overførsel af DNA mellem bakterieceller er en velbeskrevet proces og er tidligere blevet anvendt til ingeniør cyanobakteriale arter, især dem, der ikke er naturligt kompetente, såsom S. elongatus utex 297335, 36,37,38,39,40,41. Kort sagt inkuberes cyanobakteriale kulturer med en E. coli -stamme, der bærer vektoren, og som skal overføres ("Cargo"-vektoren) og vektorer (enten i den samme E. coli -stamme eller i yderligere stammer) for at muliggøre konjugering ("mobilizer" og "hjælpe" vektorer). Der er behov for fire nøglebetingelser for overførsel af konjugering: 1) direkte kontakt mellem de celler, der er involveret i DNA-overførsel, 2) last vektoren skal være kompatibel med konjugations systemet (dvs. den skal indeholde en egnet overførings kilde (Orit), også kendt som en bom (grund af mobilitet) site), 3) et DNA nicking protein (f. eks, kodet af Mob genet), at Nicks DNA på Orit at initiere enkelt-strandede overførsel af DNA til cyanobacterium skal være til stede og udtrykkes fra enten lasten eller hjælpe vektorer, og 4) det overførte DNA må ikke destrueres i recipient cyanobacterium (dvs. skal være modstandsdygtig over for nedbrydning ved f. eks. begrænsningens endonukleaseaktivitet)35,42. For at last vektoren kan fortsætte, skal Replikeringens oprindelse være kompatibel med modtageren cyanobacterium for at give mulighed for selv-replikering og spredning i datter celler post division. For at støtte med betingelser 3 og 4 er flere hjælpe vektorer tilgængelige via Addgene og andre kommercielle kilder, der koder for Mob samt flere methylaser for at beskytte mod indfødte endonukleaser i værten cyanobacterium43. I denne protokol blev konjugering lettet af en MC1061 E. coli -stamme, der bærer mobilizer-og hjælpe vektorer pRK24 (henholdsvis www. addgeneorg/51950) og pRL528 (www.addgene.org/58495). Man skal være forsigtig, når man vælger de vektorer, der skal anvendes til konjugat overførsel. For eksempel, i CyanoGate kit den selvkopierende Cargo vektor pPMQAK1-T koder for en Mob protein12. Men, pSEVA421-T ikke44, og som sådan, Mob skal udtrykkes fra en egnet hjælper vektor. De vektorer, der anvendes, bør også være passende for målorganismen. For eksempel kræver effektiv konjugat overførsel i Anabaena Sp. pcc 7120 en hjælpe vektor, der beskytter mobilizer-vektoren mod fordøjelsen (f. eks. pRL623, som koder for de tre Methylaser Avaim, Eco47iiM og Ecot22iM)45, 46.

I denne protokol skitserer vi yderligere, hvordan man karakteriserer ydeevnen af dele (dvs. initiativtagere) med en fluorescerende markør ved hjælp af en plade læser eller et flow cytometer. Flowcytometre er i stand til at måle fluorescens på en enkelt celle basis for en stor population. Desuden giver flow cytometre brugerne mulighed for at "gate" de erhvervede data og fjerne baggrundsstøj (f. eks. fra partikler i kulturen eller kontaminering). I modsætning hertil erhverver plade læsere en samlet fluorescens måling af en given mængde kultur, typisk i flere replikat brønde. De vigtigste fordele ved plade læsere over cytometre omfatter lavere omkostninger, højere tilgængelighed og typisk ingen krav til specialsoftware til downstream-dataanalyser. De største ulemper ved plade læsere er den relativt lavere følsomhed sammenlignet med cytometre og potentielle problemer med den optiske tæthed af målte kulturer. Ved sammenlignende analyser skal prøveeksemplarer af plade læseren normaliseres for hver brønd (f. eks. til en måling af dyrkningstætheden, der typisk tages som absorbansen ved den optiske tæthed ved 750 nm [OD750]), hvilket kan føre til unøjagtigheder for prøver, der er for tætte og/eller ikke godt blandet (f. eks. når de er tilbøjelige til at aggregere eller flokkulering).

Som en oversigt, her viser vi i detaljer principperne for at generere niveau 0 dele, efterfulgt af hierarkisk samling ved hjælp af cyanogate kit og kloning i en vektor egnet til ægteskabelige overførsel. Vi viser derefter konjugal overførselsprocessen, udvælgelse af axeniske transconjugant stammer, der udtrykker en fluorescerende markør, og efterfølgende erhvervelse af fluorescens data ved hjælp af et flow flowcytometer eller en plade læser.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. vektor samling ved hjælp af anlæggets MoClo og Cyanogatværktøjssæt

Bemærk: før du fortsætter med vektor samling, anbefales det kraftigt, at brugerne sætter sig ind i anlæggets vektor niveau strukturer og cyanogate moclo systemer12,15.

  1. Opførelse af niveau 0 dele
    Bemærk: niveau 0 dele kan syntetiseres som komplette vektorer eller som lineære sekvenser for montering med level 0 acceptorer (f. eks gBlocks, IDT). Alternativt kan sekvenser forstærkes fra en kilde skabelon (f. eks. en vektor eller et renset genomisk DNA). Her beskrives, hvordan du genererer en ny niveau 0-del fra et forstærket produkt. En oversigt over Golden Gate-samlingsprocessen fra niveau 0 til niveau T vises iFigur 1.
    1. Design primere.
      1. Beslut hvilket niveau 0 modul til at samle og identificere de relevante 5 ′ og 3 ′ udhæng (tabel 1)12,15. Kontroller DNA-sekvensen for at klone for tilstedeværelsen af BpiI-eller BsaI-begrænsnings steder.
        Bemærk: en sekvens, der indeholder et af disse steder, skal domesticere ved at ændre en eller flere NTs i restriktions stedet sekvens. En strategi for at gøre dette ved hjælp af Golden Gate assembly er skitseret i figur 2.
      2. For at forstærke en DNA-sekvens skal du designe et passende fremad-og omvendt primer-par. For Forward primer skal du vælge 18 − 30 BP, som supplerer 5 ′ enden af DNA-skabelon sekvensen. For den omvendte primer skal du vælge 18 − 30 BP reverse supplement til 3 ′ enden af DNA-skabelon sekvensen.
        Bemærk: primere med smeltetemperaturer (Tm) på 58 − 62 °c giver typisk de mest konsistente forstærknings resultater (figur 1A).
      3. Tilsæt følgende til 5 ′ enden af Forward primer: 1) en tilfældig streng på 4 − 6 NTs ved 5 ′ enden af BpiI-stedet, 2) BpiI-begrænsnings stedet (GAAGAC), 3) to tilfældige NTs og 4) 5 ′ udhæng valgt i trin 1.1.1.1. Tilsæt følgende til 5 ′ enden af den omvendte primer: 1) en tilfældig streng på 4 − 6 NTs ved 5 ′ enden af BpiI-stedet, 2) BpiI restriktions stedet (GAAGAC), 3) to tilfældige NTs og 4) den 3 ′ udhæng valgt i trin 1.1.1.1. Når den er færdig, Bestil primer par.
        Bemærk: Se figur 1a for et eksempel på et fremad-og omvendt primer-par.
    2. Amplificere en DNA-sekvens fra genomisk DNA.
      1. Udtrække genomisk DNA som beskrevet i afsnit 5. Amplificere produkter ved PCR ved hjælp af en high-fidelity DNA Polymerase (tabel over materialer).
        Bemærk: som et eksempel skal du opsætte PCR-reaktioner (20 − 50 μL) i henhold til producentens anvisninger. Brug ~ 100 ng af genomisk DNA pr. reaktion. Brug et termisk cykel program bestående af et Initial Denaturerings trin på 98 °c i 30 s, efterfulgt af ikke mere end 25 cyklusser af denaturering ved 98 °c i 10 s, primer udglødning ved 58 °c for 15 s og produkt udvidelse ved 72 °c for 30 s (ændre sidstnævnte afhængigt af produkt/type af anvendt DNA-Polymerase), efterfulgt af et endeligt forlængelses trin på 72 °C i 2 min.
      2. Hvis PCR-produktet skal renses for gel, køres hele PCR-reaktionen på en agrose gel som beskrevet i punkt 6. Skær bandet af interesse ud af agrose gel og rense det ved hjælp af en gel ekstraktions Kit (tabel over materialer).
      3. Alternativ til trin 1.1.2.2, hvis PCR-produktet skal anvendes uden gel rensning, kontrolleres bånd størrelsen ved at køre en alikvot af PCR-reaktions prøven (~ 5 μL) på en agrose gel. Hvis gelen kun viser det relevante bånd og ingen tegn på primer-dimere, kan du rense PCR-produktet ved hjælp af et DNA-rensningsudstyr (tabel over materialer).
      4. Elute renset DNA i en lille mængde deioniseret vand (f. eks. 10 μL) for at opnå en høj DNA-koncentration (> 20 ng/μL er typisk tilstrækkeligt).
    3. Saml det forstærkede DNA-produkt (eller produkter, se figur 2) på niveau 0. Der forberedes en 20 μl reaktionsblanding med bpii (figur 1b), og der oprettes et termisk variator program som beskrevet i tabel 2. Fortsæt til E. coli -transformation med 5 μl af det samlede niveau 0-reaktions mix (som beskrevet i punkt 2).
  2. Opførelse af niveau 1-samlinger
    1. Bestem, hvilket niveau 0-dele du vil montere (figur 1C og tabel 1). Vælg et passende niveau 1 acceptor vektor15.
      Bemærk: på dette tidspunkt er det vigtigt at vide, hvad den endelige vektor design vil være i niveau T, da dette vil påvirke valget af niveau 1 acceptor vektor. Niveau 1 position 1 (fremad) acceptor Vector (pICH47732) kan bruges som standard, hvis målet er at have et enkelt niveau 1-modul (f. eks. en genekspressions kassette) i niveau T. Hvis to eller flere niveau 1-enheder skal samles i niveau T, skal positionen og retningen for hvert niveau 1-modul dog tages i betragtning. Op til syv niveau 1-samlinger kan samles i en level T acceptor vektor ved hjælp af niveau 1 acceptor vektorer med passende positioner12.
    2. Saml niveau 0-delene på niveau 1. Forbered en 20 μl reaktionsblanding med bsai, og Indstil det termiske variator program som beskrevet i tabel 2. Fortsæt til E. coli -transformation med 5 μl af det samlede niveau 1-reaktions mix (som beskrevet i punkt 2).
  3. Opførelse af niveau T-samlinger
    1. Beslut, hvilke niveau 1-samlinger du vil samle (figur 1D). Vælg et passende niveau T acceptor vektor.
      Bemærk: pUC19A-T (ampicillin resistens) og pUC19S-T (Spectinomycin resistens) er højt-Copy-nummer Integrative vektorer, der ikke er i stand til at replikere i cyanobakterier og primært anvendes til genomintegration (dvs., Knock-in eller knock-out af gener) via homologe rekombination12. Levering af Integrative vektorer kan fortsætte ved naturlig transformation i modtagelig cyanobakteriale arter11. pPMQAK1-T er et bredt værtsområde, replikerende vektor, der leveres af ægteskabelige Transfer (afsnit 3).
    2. Vælg en passende slut-link til at ligere den 3 ′ ende af den endelige niveau 1 samling til niveau T backbone15.
      Bemærk: det krævede link er det samme nummer som positionen for den sidste del. For eksempel vil en niveau T vektor med kun én niveau 1 position 1 (fremad eller omvendt) del kræve end-link 1 (pICH50872) for ligering i niveau T backbone.
    3. Saml et eller flere niveau 1-samlinger i niveau T. Forbered en reaktionsblanding med bpii og den påkrævede slut-link-vektor, og Indstil det termiske variator-program som beskrevet i tabel 2. Fortsæt til E. coli -transformation med 5 μl af det samlede niveau T-reaktions mix (som beskrevet i punkt 2).

2. E. coli transformation og vektor rensning

  1. E. coli -transformation (dag 1)
    1. Afrimning en alikvot (~ 25 μL) kemisk kompetente E. coli -celler (tabel over materialer) og forsigtigt pipetteres i et 1,5 ml rør på is. Der tilsættes 5 μL af montage blandingen (niveau 0, 1 eller T), og røret inkubates på is i yderligere 30 − 60 minutter.
    2. Varmechok celler ved at inkube røret i et vandbad ved 42 °C i 30 s, Placer derefter røret tilbage på isen i 2 min. Tilføj rumtemperatur (RT) super optimal bouillon med katabolit undertrykkelse (S.O.C.) medium (250 μL) til røret. Inkubér røret ved 37 °C i 1 time ved 225 rpm i en ryste inkubator.
    3. Plade 40 μL af kulturen på en LB-agar plade, der indeholder den relevante endelige koncentration af antibiotika (100 μg/mL for Spectinomycin dihydrochlorid pentahydrat [niveau 0], 100 μg/mL carbenicillin dinatrium [niveau 1] eller 50 μg/mL kanamycin sulfat [ Niveau T]), 1 mM isopropyl-beta-D-thiogalactopyranosid (IPTG) og 40 μg/mL 5-brom-4-chloro-3-indolyl-β-D-galactopyranosid (X-gal) til blåhvid screening. Pladen inkubates natten over ved 37 °C.
      Bemærk: mængden af kultur belagt kan varieres afhængigt af effektiviteten af E. coli kompetente celler og ligations reaktionen. Plade en større volumen, hvis < 10 kolonier observeres efter natten inkubation.
  2. Udvælgelse af hvide kolonier og tilberedning af flydende kulturer (dag 2)
    Bemærk: afhængigt af effektiviteten af monterings reaktionen og den efterfølgende omdannelse må LB-agarpladerne ikke indeholde kolonier, blå kolonier eller hvide kolonier (figur 3). Blå kolonier er tegn på acceptor vektorer, der ikke har undergået begrænsninger (dvs. en funktionel kopi af LacZ er stadig til stede). Hvide kolonier indikerer, at LacZ -udtryks kassetten er gået tabt og erstattet af en del/samling.
    1. Valider eventuelt, at hvide kolonier indeholder den forventede vektor ved at udføre PCR som beskrevet i afsnit 7.
    2. Vælg enkelt hvide kolonier (eller PCR-kontrollerede kolonier) med 10 μL spids og Overfør til et 15 mL centrifugeglas indeholdende LB-medium (5 mL) og passende antibiotika koncentrationer (trin 2.1.3). Inkubér rørene ved 37 °C natten over ved 225 rpm i en ryste inkubator.
  3. Plasmid Vector rensning (dag 3)
    1. Eventuelt forberede en glycerol bestand af natten E. coli kultur for langsigtet kryolagring af vektorer. Tilsæt 500 μL bakteriekultur til 500 μL 50% (v/v) glycerol i et passende 1,5 − 2,0 mL rør til kryoopbevaring ved-80 °C. Bland forsigtigt ved at invertere 5 − 10x. Flash-fryse prøver i flydende nitrogen og opbevares i a-80 °C fryser.
    2. Spin ned kulturer i 15 mL centrifugeglas ved 3.000 x g i 5 − 10 min. kassér supernatanten uden at forstyrre celle pellet. Rense vektoren ved hjælp af en plasmid rensning Kit (tabel over materialer). Elute oprenset vektor i 35 μL deioniseret vand.
      Bemærk: Brug lavere elueringsvolumener til at øge vektor koncentrationen yderligere. Den samme elueringsvæske kan sættes gennem en rensning kolonne to gange for øget udbytte.
    3. Mål koncentrationen af vektoren i eluet ved hjælp af et spektrofotometer (tabel over materialer).
      Bemærk: høj kopi-nummer vektorer i E. coli, såsom pUC19, giver typisk udbytter på 50 − 300 ng/μl. lav kopi-nummer vektorer, såsom PPMQAK1-T, giver typisk udbytter på 15 − 60 ng/μl.
  4. Vektor validering
    Bemærk: vektorer kan verificeres ved at begrænse fordøjelsen (trin 2.4.1) og/eller sekvensering (trin 2.4.2).
    1. Begræns 0,5 − 1 μg vektor med et passende restriktionsenzym (er), og kontroller de forventede bånd størrelser som beskrevet i punkt 6 (figur 4).
      Bemærk: forkerte bånd størrelser indikerer typisk fejlagtig samling, i hvilket tilfælde flere hvide kolonier kan screenes eller samlingen kan gentages. BsaI og BpiI kan bruges til at validere den korrekte størrelse af indsatsen for henholdsvis niveau 0-og niveau 1-samlinger. BsaI eller BpiI kan anvendes sammen med et yderligere, kompatibelt begrænsnings enzym, der skærer inden i skæret og/eller vektor rygraden for at fremstille et særskilt sæt veladskilte bånd efter fordøjelsen.
    2. Sekvens af vektor ved sanger sekvensering ved hjælp af en passende primer opstrøms for den samlede region ved hjælp af kommerciel sekvensering facilitet (tabel 3).
      Bemærk: alle nye niveau 0-dele skal sorteres for at bekræfte den forventede sekvens identitet. Sekvens validering af niveau 1-og T-vektorer er normalt ikke påkrævet, hvis den er samlet fra tidligere sekvenserede niveau 0-dele.

3. generering af mutanter ved konjugering

Bemærk: Her beskrives en protokol for konjugal overførsel af en selvkopierende last vektor til synechocystis PCC 6803 eller S. elongatus utex 297311,47 . Denne protokol gælder for andre model arter (f. eks. S. elongatus pcc 7942 og Synechococcus sp. PCC 7002). Alt arbejde med cyanobakterier (og tilhørende buffer præparater) bør udføres under sterile forhold i en laminar flow hætte.

  1. Vækst i cyanobakteriel kulturen (dag 1)
    1. Forbered BG11 medium ifølge Lea-Smith et al.11, og agar plader med lb-BG11 og BG11 + Kan50 (afsnit 8).
    2. Indstil en frisk kultur af synechocystis PCC 6803 eller S. elongatus utex 2973 ved at inokulere en 100 ml konisk kolbe med frisk BG11 medium (50 ml) med celler, der stammer fra en axeniske BG11 agar plade. Grow Synechocystis pcc 6803 kulturer ved 30 °c, 100 μmol fotoner m-2s-1 ved 100 rpm og Grow s. Elongatus utex 2973 ved 40 °c, 300 μmol fotoner m-2s-1 ved 100 rpm. Dyrke kulturer indtil OD750 = 0.5 − 1.5 (typisk 1 − 2 dage).
      Bemærk: S. elongatus utex 2973-kulturer kan dyrkes ved 40 °c i høj lysintensiteter (f. eks. 2000 μmol fotoner m-2S-1)48.
  2. Vækst af hjælpe-og last E. coli -stammer (dag 2)
    1. Inoculate LB-medium indeholdende ampicillin (endelig koncentration 100 μg/mL) og chloramphenicol (slutkoncentration 25 μg/mL) med en MC1061 E. coli -stamme indeholdende vektorer PRK24 og pRL528 (dvs. hjælper stammen) og vokse ved 37 °c natten over ved 225 rpm i en ryste inkubator. Vokse op en tilstrækkelig mængde af hjælper stammekultur, forudsat 1 mL af kultur er påkrævet pr konjugering.
    2. Inoculate LB medium (5 mL) indeholdende passende antibiotika med E. coli kultur transporterer lasten vektor (dvs., en niveau T vektor). Dyrk kulturen ved 37 °C natten over ved 225 rpm i en ryste inkubator.
  3. Conjugal Transfer (Tri-forældre parring) (dag 3)
    1. Forbered E. coli -hjælperen og last stammerne. Centrifuger hjælperen og lasten E. coli overnight kulturer ved 3.000 x g i 10 minutter ved stuetemperatur. Kassér supernatanten uden at forstyrre celle pellet.
    2. Skyl pellet ved at tilføje frisk LB medium uden antibiotika. Brug samme volumen som den oprindelige kultur. Resuspendere pellet ved forsigtigt pipettering op og ned. Må ikke vortex kulturen. Gentag dette trin 3x for at fjerne resterende antibiotika fra overnight kultur.
    3. Centrifugeres den opslæmmede kultur (som i trin 3.3.1), kassér supernatanten og resuspension i halvdelen af mængden af LB-medium for den oprindelige kultur mængde (f. eks. 2,5 mL, hvis natkulturen var 5 mL). Kombiner 450 μL af hjælpe stammen med 450 μL af last stammen i et 2 mL rør, og sæt den til side (orlov ved RT) indtil trin 3.3.6.
    4. At forberede cyanobakteriel kulturen. For hver konjugeret reaktion anvendes 1 mL cyanobakteriel kultur (OD750 = 0,5 − 1,5).
    5. Den påkrævede totale volumen af cyanobakteriel kulturen centrifugeres ved 1.500 x g i 10 minutter ved rt, hvorefter supernatanten kasseres forsigtigt uden at forstyrre celle pellet. Du vasker pellet ved at tilføje frisk BG11 medium af samme oprindelige volumen. Resuspendere pellet ved forsigtigt pipettering op og ned, ikke vortex kulturen. Gentag dette trin 3x og sæt den vaskede kultur til side.
    6. Der tilsættes en alikvot vasket cyanobakterial kultur (900 μL) til de kombinerede E. coli -stammer (hjælper og last) (900 μl) i et 2 ml rør. Bland kulturerne ved forsigtigt at pipettere op og ned. Må ikke vortex. Blandingen inkubates ved RT i 30 minutter for Synechocystis pcc 6803 eller 2 h for S. elongatus utex 2973.
    7. Blandingen centrifugeres ved 1.500 x g i 10 minutter ved rt. Fjern 1,6 ml af supernatanten. Resuspension af pellet i de resterende ~ 200 μL supernatant. Et 0,45 μm membranfilter placeres på en LB-BG11 agar plade, som mangler antibiotika (afsnit 8). Spænd forsigtigt 200 μL af E. coli/cyanobakterial kultur blandingen på membranen med en steril sprederen eller en steril Bendt spids, og forsegl pladen med paraffin folie.
    8. Inkuber LB-BG11 pladen med membranen i 24 timer. vedligehold membraner med Synechocystis pcc 6803 kulturer ved 30 °c, 100 μmol fotoner m-2s-1. Bevar membraner med s. elongatus utex 2973 kulturer ved 40 °c i 150 μmol fotoner m-2S-1.
  4. Membran overførsel
    1. Efter 24 timer overføres membranen forsigtigt med flamme steriliseret tang til en frisk BG11 agar plade med passende antibiotika (afsnit 8) for at vælge til last vektoren. Forsegl pladen med paraffin folie.
    2. BG11 agar pladen inkubates under passende vækstbetingelser, som beskrevet ovenfor for Synechocystis pcc 6803 eller S. elongatus utex 2973, indtil kolonierne optræder.
      Bemærk: kolonier vises typisk efter 7 − 14 dage for Synechocystis pcc 6803 og 3 − 7 dage for S. elongatus utex 2973.
  5. Udvælgelse af conjugants
    Bemærk: kun cyanobakteriale kolonier, der bærer last vektoren, vil kunne vokse på membranen (figur 5).
    1. Ved hjælp af en steril varme løkke skal du vælge mindst to individuelle kolonier fra membranen og stribe på en ny BG11 agar plade, der indeholder passende antibiotika (figur 5C).
      Bemærk: frisk stribede kolonier kan stadig være forurenet med E. coli fremført fra konjugering (dvs. Hvis små hvide kolonier er tydelige på pladen), så to eller tre yderligere runder af re-streaking på friske BG11 agar plader typisk er for at opnå en axeniske cyanobakteriel kultur.
    2. Bekræft fravær af E. coli -kontaminering ved at inokulere en stribe cyanobakteriel kultur i et 15 ml centrifugeglas, der indeholder 5 ml lb-medium og inkuberer ved 37 °c natten over ved 225 rpm i en ryste inkubator. Efter en tilstrækkelig vækstperiode (~ 7 dage), plukke individuelle axeniske kolonier til at oprette flydende kulturer for langvarig kryostorage eller efterfølgende eksperimenter.
  6. Kryooplagring af cyanobakteriale stammer
    1. Dyrke en cyanobakteriel flydende kultur i BG11 (som beskrevet i afsnit 3,1) indtil OD750 = 1.5 − 3,0. 10 mL af kulturen centrifugeres i 10 minutter ved 1.500 x g, fjernes supernatanten og resuspenderes cellerne i 5 ml frisk BG11 medium.
    2. Der tilsættes 3,5 mL autoklave steriliseret 50% (v/v) glycerol for en endelig glycerol koncentration på ~ 20% (v/v)49. Denne fremgangsmåde fungerer godt for Synechocystis pcc 6803. Alternativt tilsættes 5 mL filter steriliseret BG11 indeholdende 16% (v/v) dimethylsulfoxid (DMSO) for en endelig DMSO-koncentration på ~ 8% (v/v)50. Denne fremgangsmåde anbefales til de fleste stammer, herunder S. elongatus utex 2973.
      Advarsel: DMSO er giftigt og bør håndteres med passende beskyttelse.
    3. Bland forsigtigt ved at invertere 5 − 10x. Subaliquot ~ 1 mL kultur i separate kryostorage-kompatible 1,5 mL skruelåg (tabel over materialer). Placer rørene i a-80 °C fryser til kryostorage. Må ikke blinke fryse i flydende nitrogen.
      Bemærk: der anbefales mindst tre bestande pr. stamme.
    4. Til nyttiggørelse, fjerne et rør fra-80 °C fryser og tø kulturen i en 35 °C vandbad mens forsigtigt blande. Tilsæt den optøede kultur til 50 mL frisk BG11 medium og vokse som en flydende kultur (som beskrevet i punkt 3,1).
      Bemærk: Alternativt kan kulturen strippet og dyrkes på en frisk BG11 agar plade. Transgene kulturer, der bærer selektions markører, skal først genoplives på BG11 agar plader uden antibiotika og derefter restreaked på BG11 agar plader med passende antibiotika.

4. initiativtageren karakterisering

Bemærk: Her beskrives en standardtilgang til analyse af styrken af en promotor-del ved at måle udtryks niveauerne for en fluorescerende markør (eYFP) efter en 72 h vækstperiode ved hjælp af enten en plade læser eller et flow flowcytometer12.

  1. Vækst i kulturen
    1. Oprette frøkulturer ved at inokulere 10 mL BG11 medium indeholdende passende antibiotika med en enkelt koloni af den transgene cyanobakteriale stamme bærer fluorescerende markør Expression kassette. Også forberede frøkulturer til passende negative kontrol stammer (f. eks en vildtype stamme og/eller en transgene stamme bærer den samme vektor backbone, men mangler den fluorescerende markør Expression kassette).
      Bemærk: der anbefales mindst fire biologiske replikater.
    2. Dyrke frøkulturer for 48 h eller indtil OD750 = 1 − 1.5 under vækstbetingelser passende for arten stamme.
    3. For at spore arrangøren udtryk over tid, først måle OD750 af hver frøkultur. Beregn fortyndings behovet for at bringe hver kultur til en start-OD750 = 0,2. Der opsættes fortyndede eksperimentelle kultur prøver (2 mL samlet volumen) i en flad bund 24-brønd plade (tabel over materialer).
    4. Indinkubér pladen i en ryste inkubator med hvide LED-lamper (tabel over materialer) under passende vækstbetingelser. Mål kultur vækst tæthed (OD750) og forstærket gult fluorescerende protein (eyfp) Fluorescens ved hjælp af enten en plade læser (punkt 4,2) eller et flow flowcytometer (afsnit 4,3).
      Bemærk: Synechocystis pcc 6803 og S. elongatus utex 2973 kulturer kan dyrkes som i trin 3.1.2. Det anbefales kraftigt, at pladen opretholdes under en høj luftfugtighed (95%) for at undgå fordampning af kultur prøverne.
  2. Plade læser
    1. Bland kort kulturerne i 24-brønd pladen (trin 4.1.4) med blid pipettering. Overfør en delprøve af hver kultur til en sort flad bund 96-brønd plade (tabel over materialer). Fortyndes om nødvendigt (100 μL endelig volumen). Undgå dannelsen af bobler, da dette kan forstyrre målenøjagtigheden.
      Bemærk: det anbefales, at alle målinger udføres på prøver i et OD750 -område på 0,2 − 1,0. Da tætheden af kulturerne i 24-brønden vil stige med tiden, anbefales følgende fortyndinger baseret på de forventede stigninger i standard vækstbetingelser: ingen fortynding ved 0 h, 1:4 ved 24 h, 1:10 ved 48 h og 1:10 ved 72 h. Så for eksempel, ved 24 h høst 25 μL af kultur og blandes med 75 μL af BG11 medium.
    2. Medtag to blanke brønde i 96-brønd pladen (dvs. 100 μL af BG11 medium). Sæt 96-brønd pladen i en plade læser (tabel over materialer). Ryst pladen for 60 s ved 500 rpm ved hjælp af orbital shaker i plade læseren for at blande brøndene.
      Bemærk: Cyanobakteriale kulturer kan aggregere og/eller flokkulering, så god blanding er kritisk før læsning for nøjagtige målinger.
    3. Mål OD750 og eyfp fluorescens med excitation/emission bølgelængder ved 485 nm/520 nm.
    4. Gennemsnittet af OD750 -målingerne af de to blanke brønde trækkes fra OD750 -målingen af hver prøvebrønd, der indeholder cyanobakterier kulturen.
    5. Normalisere fluorescens værdierne for hver enkelt dyrknings prøve ved at dividere Øjesæt fluorescens måling (trin 4.2.3) med den justerede OD750 af kulturen (trin 4.2.4). Træk derefter den gennemsnitlige normaliserede eYFP-fluorescens værdi (eYFP fluorescens/OD750) af de biologiske replikater af en passende negativ kontrol stamme fra de transgene stammer, der bærer eyfp-udtryks kassetten.
      Bemærk: cyanobakterier naturligt fluorescerer på grund af tilstedeværelsen af pigmenter, såsom klorofyl og phycobiliproteiner.
    6. Afbild kultur vækst over tid (figur 6a) og den gennemsnitlige normaliserede eyfp-fluorescens værdier for hver forsøgs kultur på de ønskede tidspunkter (f. eks. 72 h; Figur 6B).
  3. Flow flowcytometer
    1. Vælg en kompatibel plade til flow flowcytometer væske håndteringssystemet. Brug for eksempel en rund bund 96-brønd plade (tabel over materialer) med flowcytometer (tabel over materialer), der anvendes i denne protokol.
    2. Bland kort kulturerne i 24-brønd pladen (trin 4.1.4) med blid pipettering. Fortynd kulturer til OD750 = 0,1 − 0,2 for at undgå dyseblokeringer i væske håndteringssystemet. Tilsæt en passende mængde kultur prøve til 96-brønd pladen og Bring den endelige volumen på 250 μL med filter steriliseret 1x fosfat-bufferet saltvand (PBS). Der skal være en blank brønd til den mellemste opløsning på pladen med 60 μL BG11 og 190 μL 1x PBS.
      Bemærk: dette volumen anbefales, hvis der er behov for at køreprøver igen. Volumener, der er højere end 250 μL, anbefales ikke, da den maksimale volumen på hver brønd er 300 μL.
    3. Når flowcytometer er klar til brug, skal du placere 96-brønd pladen med kultur prøver i væske håndterings stationen. Konfigurer software protokollen for flowcytometer til at indsamle målinger af 10.000 individuelle hændelser (f. eks. celler). Mål eYFP fluorescens med excitation/emission bølgelængder på 488 nm/515 − 545 nm. Første måle og kontrollere læsningen fra blank brønd (figur 7A), derefter køreprøverne.
    4. Dørs populationen af cyanobakterier celler inden for frem-og side scatter datasæt, bortset fra regioner, som er fælles med blind aflæsning (figur 7B). De gennemsnitlige fluorescens værdier for eYFP trækkes fra de biologiske replikater af en passende negativ kontrol stamme fra de transgene stammer, der bærer eYFP-udtryks kassetten (figur 7C, D). Afbild gennemsnittet af de mediane fluorescens værdier pr. celle for hver forsøgs kultur på de ønskede tidspunkter (f. eks. 72 h; Figur 7E).

5. genomisk DNA-ekstraktion fra cyanobakterier

Bemærk: nedenstående protokol bruger et kommercielt DNA-ekstraktions udstyr (tabel over materialer).

  1. Dyrke en cyanobakteriel flydende kultur i BG11 (som beskrevet i afsnit 3,1) indtil OD750 = 1.5 − 3,0. Spin ned 10 mL kultur ved 3.000 x g i 10 min. og kassér supernatanten. Du fryser pellet ved at inkuberere rørene ved-20 °C i 30 minutter.
  2. Der tilsættes 400 μL lyse buffer (buffer AP1) og 400 μL ribonucleaseopløsning (RNase A) og 50% (w/v) glasperler (0,5 mm diameter). Afbryde prøver ved hjælp af en perle mølle (tabel over materialer) ved 30 Hz (dvs. svarende til 1.800 svingninger/min) i 6 min.
  3. Drej prøven på 17.000 x g i 5 minutter og Overfør forsigtigt supernatanten til et nyt rør og kassér pellet. Fortsæt i henhold til producentens anvisninger (tabel over materialer).

6. agrose gel elektroforese

  1. Støbt en 1% (w/v) agopstået gel indeholdende 0,02% (v/v) ethidium bromid. Læg prøver og en passende DNA-stigen reference.
  2. Kør prøverne til 50 min ved 125 V. Kontrollér, om båndet er adskilt på en ultraviolet (UV) transilluminator.
    Bemærk: løbetiden og agrose gel procenten kan ændres, så den passer til den forventede bånd størrelse. For eksempel kan en højere procentdel agopstået gel og længere driftstiden forbedre bandet opløsning og adskillelse af DNA-produkter < 500 BP.

7. koloni PCR

  1. Oprette en PCR-reaktionsblanding ved hjælp af et standardsæt (tabel over materialer) og en passende kombination af primere (f. eks. primere, der flankerer samlings området eller er specifikke for sekvenser i montageområdet (tabel 3). Der afpipetteres 10 μL i et PCR-rør.
  2. Berør forsigtigt toppen af en enkelt hvid koloni med et sterilt tandstikker eller 10 μL pipettespids og inokulere et PCR-rør, der indeholder PCR-reaktions sammensætning. Pas på at markere kolonien og matche med den specifikke PCR tube. Rør forsigtigt reaktionsblandingen for at sikre, at E. coli -cellerne udgydt i opløsningen.
  3. Amplificere produkter ved PCR. Brug et program bestående af en Initial denaturering trin på 95 °C for 60 s, 30 runder af 95 °C for 15 s, 58 °C for 15 s (få grader under Tm værdier af Primers), 72 °c for 30 s (30 s/KB af INSERT) , efterfulgt af et endeligt forlængelses trin på 72 °C i 5 min.

8. fremstilling af BG11 medium og plader

  1. Udarbejde stamopløsninger af 100x BG11 medium, jern (ammonium jerncitrat), sporstoffer, fosfat (K2HPO4), na2Co3 og tes buffer i henhold til Lea-Smith et al.11. Autoklave phosphat og na2co3 bestande. Brug 0,2 μm filtre til at filtrere sterilisere TES buffer (pH 8,2) og NaHCO3 stamopløsninger.
  2. Forbered 1 L af BG11 medium. Bland 10 mL 100x BG11, 1 mL sporstoffer og 1 mL jern bestand og autoklave opløsningen med 976 mL vand. Når opløsningen er afkølet til RT, tilsættes 1 mL fosfat lager, 1 mL na2co3 -bestand og 10 ml NaHCO3og justeres til pH 7.6 − 7.8 med 1 M HCL.
  3. LB-BG11 agar plader (1,5% [w/v])
    1. Der kombineres 700 mL deioniseret vand og 15 g agar i en glas kolbe. I en anden kolbe tilsættes 186 mL vand, 10 mL 100x BG11, 1 mL sporstoffer og 1 mL jern lager. Autoklave begge opløsninger.
    2. Når løsningerne er kølet ned til ca. 60 °C, kombineres de, og der tilsættes 1 mL fosfat lager, 1 mL na2co3 -bestand, 10 ml NaHCO3 -bestand og 50 ml lb-sterilt medium, som skal give et endeligt volumen på 1 L. støbte Petri skåle med 25 mL LB-BG11 agar medium.
  4. BG11 + Kan50 agar plader (1,5% [w/v])
    1. Der kombineres 700 mL deioniseret vand og 15 g agar i en glas kolbe. I en anden kolbe tilsættes 3 g natriumthiosulfat (na2S2O3), 226 ml vand, 10 ml 100x BG11 bestand, 1 ml sporstoffer og 1 ml jern bestand. Autoklave begge opløsninger.
    2. Når løsningerne er kølet ned til ca. 60 °C, kombineres de, og der tilsættes 1 mL fosfat lager, 1 mL na2co3 -bestand, 10 ml tes-bufferlager og 10 ml NaHCO3 -bestand, som skal give et endeligt volumen på 1 L. Tilsæt kanamycin sulfat til en endelig koncentration på 50 μg/mL og støbte Petri skåle med 35 mL medium.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

For at demonstrere den gyldne Gate assembly arbejdsgang, en Expression kassette blev samlet i niveau 1 position 1 (fremad) acceptor vektor (pICH47732), der indeholder følgende niveau 0 dele: promotoren af C-phycocyanin operon Pcpc560 (PC 0,005), kodnings sekvensen for eYFP (pC 0.008) og den dobbelte Terminator TrrnB (PC 0.082)12. Efter omdannelsen af samlings reaktionen blev vellykkede forsamlinger identificeret ved hjælp af standard blåhvidt screening af E. coli -kolonier (figur 3). EYFP-udtryks kassetten i niveau 1-vektoren og slut-link 1-vektoren (pICH50872) blev derefter samlet til en level T acceptor-vektor (pPMQAK1-T) for at give vektoren Cpcba-Eyfp (figur 4a). Den samlede Cpcba-eyfp-vektor blev verificeret ved en begrænsning af fordøjelsen (figur 4B).

Vellykket konjugat overførsel af Cpcba-eyfp eller den tomme PPMQAK1-T-vektor (dvs. en negativ kontrol, der manglede eyfp-udtryks kassetten) resulterede i en vækst på op til flere hundrede kolonier på membranen for Synechocystis PCC 6803 og S. elongatus utex 2973 efter henholdsvis 7 − 14 dage og 3 − 7 dage (figur 5). Individuelle kolonier blev plukket og stribede på friske BG11 + Kan50 agar plader; 2 − 3 re-striber var forpligtet til at generere axeniske kulturer.

Som forventet for den stærke Pcpc560 Promoter51var værdierne for den normaliserede eyfp-fluorescens fra plade læseren og eyfp fluorescens pr. celle fra flow flowcytometer høje sammenlignet med den negative kontrol (figur 6 og Figur 7). Fluorescens værdier var højere i S. elongatus utex 2973 end i Synechocystis PCC 680312.

Figure 1
Figur 1: oversigt over Golden Gate-samlingsprocessen i Cyanogat. Samling af en genekspressions kassette er vist, begyndende fra forstærkning af en sekvens af interesse fra Template DNA til samling i en niveau T vektor (dele er ikke trukket til skala). A) udformning af fremad-og bakgrundere til forstærkning af en CDS1-del fra Template DNA (f. eks. genomisk eller PLASMID-DNA). Placeringen af BpiI restriktionssteder og udhæng, der kræves til indsættelse i acceptoren vektor (dvs., 5 ′ og 3 ′ af skabelonen sekvens) er fremhævet med rødt og blåt, hhv. Bogstavet "n" angiver, at alle NT kan bruges på denne position. Udglødnings områderne for primere med DNA-skabelonen og deres anbefalede smeltetemperaturer (Tm) er indikeret. B) niveau 0 montering af PCR-produktet i niveau 0 CDS1 acceptor Vector pICH41308. Den sekvens, der vil blive fjernet af BpiI og ligeret ind i acceptor vektor er fremhævet med blåt. C) niveau 1-samling af en genekspressions kassette, der indeholder tre niveau 0-dele (Pro + 5U, CDS1 og 3U + ter) i niveau 1 position 1 (fremad) acceptor vektor pICH47732 ved hjælp af bsai. D) niveau t-samling af niveau 1-samlingen og end-link 1 (pICH50872, kaldet "level M end-link 1" i Engler et al.15) til en level t acceptor vektor (f. eks. pPMQAK1-t) ved hjælp af bpii. E) det endelige monterede niveau T-vektor. Forkortelser: AmpR, ampicillin modstand kassette; CarbR, carbenicillin resistens kassette; CDS1, kodning sekvens i niveau 0 syntaks15; EL1, slut-link 1 del; KanR, kanamycin modstands kassette; Laczα, β-galactosidase-udtryks kassette; Spekr, Spectinomycin modstand kassette. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2: en PCR-baseret domesticering strategi for fjernelse af en ulovlig type IIS restriktion site. (A) skematisk diagram, der viser to primer-par (henholdsvis grøn og orange) for modificering af et BpiI-sted (gaagac) til gaggac i en protein KODNINGS-DNA-sekvens beregnet til montering i CDS1 level 0 acceptor vektor (pICH41308). Bemærk, at ændringen bevarer codon for glutaminsyre (Glu) (dvs. GAA til GAG). Selv om BpiI site er vist i ramme med start codon, denne fremgangsmåde vil arbejde, selv om webstedet ikke er i ramme (dvs., så længe stedet er forstyrret, og protein sekvens bevaret). Placeringen af BpiI restriktions stederne og udhæng i primere er fremhævet med henholdsvis rødt og blåt. DNA-skabelonen og den oversatte protein sekvens er fremhævet med gult. Udglødnings områderne for primere med DNA-skabelonen og deres anbefalede smeltetemperaturer (Tm) er indikeret. Det orange par bruges til at forstærke 5 ′ enden af sekvensen med udhæng AATG og TGAA (fragment 1), mens det grønne par bruges til at forstærke 3 ′ enden med udhæng TGAA og GCTT (fragment 2). Før prierne blev bestilt, blev TGAA-fusions overhænget for fragment 1 og 2 omhyggeligt kontrolleret52. Dårligt designede fusions udhæng kan føre til montage svigt (dvs. ingen kolonier efter omdannelse; Figur 5) eller falske positiver (f. eks. afkortede eller fejlagtige samlinger). Sidstnævnte kan løses være screening et større antal hvide kolonier til at identificere en korrekt samlet konstruktion. (B) amplicons af fragmenter 1 og 2 efter begrænsning med bpii under Golden Gate montering. C) den domesticerede sekvens samlet i niveau 0 CDS1 acceptor vektor. Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3: blå-hvid koloni screening af E. coli transformerede efter Golden Gate assembly. De viste plader indeholder LB-agar (1% [w/v]) suppleret med X-gal, IPTG og antibiotika ved passende koncentrationer. A) ingen kolonier, hvilket tyder på en mislykket samlings reaktion og/eller E. coli -transformation. B) for det meste blå kolonier, hvilket indikerer en vellykket samling, men at effektiviteten af restriktions enzymet, der anvendes i samlings reaktionen, var lav. C) for det meste hvide kolonier, der indikerer en typisk, vellykket samlings reaktion. D) ingen blå kolonier, der indikerer meget effektiv montage. Venligst klik her for at se en større version af dette tal.

Figure 4
Figur 4: verifikation af et samlet niveau T vektor ved begrænsning fordøjelse. Vektorerne blev fordøjet med HindIII og BamHI. (A) sekvens kort over Tom PPMQAK1-T acceptor Vector (CT. 0) og niveau T assembly (cpcba-eyfp), der viser komponenterne i eyfp-udtryks kassetten (PCpc560-eyfp-TrrnB). Positionerne for restriktions stederne for HindIII og BamHI er angivet. Efter dobbelt fordøjelse angives de forventede størrelser af DNA-fragmenterne: (1) 5.847 BP, (2) 2.004 BP, (3) 30 BP, (4) 374 BP, (5) 1.820 BP, (6) 1.289 BP, og (7) 156 BP. (B) en agrose gel (0,8% [w/v]) kører ved 125 v for 60 min lastet med det fordøjet niveau T-samling (Cpcba-eyfp), der viser bånd 1, 5 og 6, den Ford øjede tomme PPMQAK1-T acceptor VEKTOR (CT. 0), som viser bands 1 og 2 og en DNA-stige (tabel over materialer). Bemærk, at bands 3, 4 og 7 var for små til at visualisere på gelen. Venligst klik her for at se en større version af dette tal.

Figure 5
Figur 5: vækst af transgene Synechocystis pcc 6803 kolonier efter vellykket konjugering. Der vises eksempler på membraner efter inkubation på BG11 + Kan50 agar-plader. (A) overvækst efter meget effektiv konjugering- Synechocystis PCC 6803 kolonier har udviklet sig til en græsplæne uden individuelle kolonier. (B) en god konjugering effektivitet viser flere hundrede individuelle kolonier efter 12 dage. (C) vækst af en axenisk stamme efter 14 dage efter flere runder af re-streaking på en frisk BG11 + Kan50 agar plade. Fravær af bakteriel kontaminering indikerede, at Synechocystis pcc 6803 transconjugant var axenic. Venligst klik her for at se en større version af dette tal.

Figure 6
Figur 6: repræsentative vækstdata og normaliserede eYFP-fluorescens værdier ved hjælp af en plade læser. A) vækst sammenligning af stammer, der bærer cpcba-eyfp, eller den tomme pPMQAK1-T-vektor (CT. 0, negativ kontrol) i synechocystis PCC 6803 og S. elongatus utex 2973. Værdier er midlerne ± SE fra fire biologiske replikater. Synechocystis PCC 6803 og S. elongatus utex 2973 blev dyrket i 72 h ved 30 °c med kontinuerlig lys (100 μmol fotoner m-2s-1) og 40 °c med henholdsvis 300 μmol fotoner m-2s-1. (B) normaliserede eyfp-fluorescens værdier for Synechocystis PCC 6803 eller S. elongatus Utex 2973 konjugeret med cpcba-eyfp ved 72 h. værdier er midlerne ± Se fra fire biologiske replikater. Venligst klik her for at se en større version af dette tal.

Figure 7
Figur 7: repræsentative eYFP-fluorescens værdier ved hjælp af et flow-cytometer. (A) fremad (FSC-h) og side (SSC-h) scatter plot fra "blank" medium opløsning (BG11 og PBS). (B) punktplot for en Synechocystis PCC 6803 prøve (højre). Cirklen angiver den valgte region, som gating cyanobakterier populationen fra resten af prøvesignalet. (C) histogram af gated region for en stamme transporterer den tomme PPMQAK1-T VEKTOR (CT. 0, negativ kontrol). D) histogrammet for det indhegnet område for en stamme, der bærer cpcba-eyfp. E) Fluorescens værdier for eyfp pr. celle i Synechocystis PCC 6803 og S. elongatus Utex 2973 ved 72 h. fluorescens fra den negative kontrol er blevet fratrukket. Værdier er midlerne ± SE fra fire biologiske replikater. Venligst klik her for at se en større version af dette tal.

Nej. Vektor-ID Navn Beskrivelse 5 ' overhæng 3 ' overhæng
1 pICH41233 Pro Promotor GGAG Takt
2 pICH41295 Pro + 5U Promotor og 5 ˈ ikke oversat region GGAG AATG
3 pAGM1251 Pro + 5U (f) Promotor og 5 ˈ uoversat sekvens for N-terminal fusioner GGAG CCAT
4 pICH41246 5u 5 ˈ ikke oversat region Takt CCAT
5 pAGM1263 5U (f) 5 ′ uoversat sekvens for N terminal fusioner Takt CCAT
6 pICH41246 5U + NT1 5 ˈ ikke-oversat region og N-terminal kodnings område Takt CCAT
7 pAGM1276 NT1 N terminal mærke eller lokaliserings signal CCAT AATG
8 pICH41258 Sp Signal peptid AATG AGGT
9 pICH41258 NT2 N terminal mærke eller lokaliserings signal AATG AGGT
10 pAGM1287 CDS1 NS Kodning region uden stop codon AATG TTCG
11 pICH41308 CDS1 stop Kodning region med stop codon AATG GCTT
12 pAGM1299 CDS2 NS Kodning region-uden start og stop codon AGGT TTCG
13 pICH41264 CDS2 stop Kodning region-uden start og med stop codon AGGT GCTT
14 pAGM1301 Ct C Terminal-mærke eller lokaliserings signal TTCG GCTT
15 pICH53388 3U 3 ˈ ikke oversat region GCTT GGTA
16 pICH53399 Ter Terminator GGTA CGCT
17 pICH41276 3U + ter 3 ˈ ikke oversat region og Terminator GCTT CGCT
18 pICH41331 Cgm Acceptor for komplette genkassetter GGAG CGCT
19 pCA 0,002 Pro (lav kopi) Promoter, lav kopi nummer acceptor (pSC101 Ori) GGAG Takt
20 pCA 0,001 Pro TSS Promotor afkortet til transskription start site GGAG TAGC
21 Direkte til niveau 1 srRNA Lille Regulatoriske RNA (til translationel hæmning) TAGC GTTT
22 Direkte til niveau 1 sgRNA Single guide RNA (til CRISPRi) TAGC GTTT
23 pICH41295 OP FLANKE Flanking sekvens opstrøms for Target homolog rekombinationside GGAG AATG
24 pICH41276 NEDAD-FLANKE Flanking sekvens nedstrøms for Target homologe rekombinationside GCTT CGCT

Tabel 1: en liste over tilgængelige niveau 0 acceptor vektorer og udhæng. Vektorer 1 − 18 er fra planten MoClo kit15. Vektorer 19 − 22 er fra CyanoGate kit12. For srRNA-og sgRNA-dele samles syntetiserede sekvenser eller PCR-produkter direkte i niveau 1 acceptor vektorer. Vektorer 23 − 24 er fra anlægget MoClo kit, der er blevet re-purposed til omdannelse ved homologe rekombination ved hjælp af CyanoGate kit.

BpiI-montagekomponenter (niveau 0, T) BsaI-montagekomponenter (niveau 1)
50 − 100 ng, i, acceptor Vector 50 − 100 ng, i, acceptor Vector
For hver vektor/del at indsætte, brug en 2:1 forholdet mellem INSERT: acceptor vektor. For hver vektor/del at indsætte, brug en 2:1 forholdet mellem INSERT: acceptor vektor.
2 μL 10 mM ATP (tabel over materialer) 2 μL 10 mM ATP (tabel over materialer)
2 μL buffer G (buffer til BpiI/BsaI) 2 μL buffer G (buffer til BpiI/BsaI)
2 μL BSA (10x) (tabel over materialer) 2 μL BSA (10x) (tabel over materialer)
10 enheder BpiI (1 μL10 U/μL BpiI, tabel over materialer) 10 enheder BsaI (1 μL 10 U/μL BsaI, tabel over materialer)
Medbring 20 μL med dH2O. Medbring 20 μL med dH2O.
200 enheder T4 DNA-ubiquitinligase (1 μL 200 U/μL, tabel over materialer) 200 enheder T4 DNA-ubiquitinligase (1 μL 200 U/μL, tabel over materialer)
Termo cycler protokol (niveau 0, T) Termo cycler protokol (niveau 1)
37 °C i 10 min cyklus x 5 37 °C i 10 min cyklus x 5
16 °C i 10 min 16 °C i 10 min
37 °C i 20 min 37 °C i 20 min
65 °C i 10 min 65 °C i 10 min
16 °C (hold) 16 °C (hold)

Tabel 2: protokoller for Golden Gate-samlinger i niveau 0, 1 og T. Samling i niveau 0 og niveau T acceptor vektorer bruger restriktion enzym BpiI (venstre). Samling i niveau 1 acceptor vektorer bruger restriktion enzym BsaI (højre). Denne tabel er blevet tilpasset fra Vasudevan et al.12.

Primer No. Sekvens (5 '-3 ') Længde (BP) Beskrivelse
L0T fremad GTCTCATGAGCGGATACATA
TTTGAATG
28 Til forstærkning fra niveau 0 og niveau T
L1 omvendt GAACCCTGTGGTTGGCATGC
ACATAC
26 Til forstærkning fra niveau 1
L1 fremad CTGGTGGCAGGATATATTGT
GGTG
24 Til forstærkning fra niveau 1
L0T omvendt TTGAGTGAGCTGATACCGCT 20 Til forstærkning fra niveau 0 og niveau T

Tabel 3: liste over primere til PCR-validering eller sekvensering af niveau 0-, 1-og T-vektorer.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Golden Gate assembly har flere fordele i forhold til andre vektor montage metoder, især med hensyn til skalerbarhed20,21. Ikke desto mindre, opsætning af Golden Gate system i et laboratorium kræver tid til at udvikle et kendskab til de forskellige dele og acceptor vektor biblioteker og samlede montageprocesser. Omhyggelig planlægning er ofte nødvendig for mere komplekse samlinger eller ved udførelse af et stort antal komplekse samlinger parallelt (f. eks. at lave en suite af niveau T-vektorer, der indeholder flere genekspressions kassetter). Vi anbefaler, at du først oplister alle de påkrævede genudtryks kassette kombinationer og derefter knytter arbejdsprocessen fra niveau 0 til niveau T i silico. Under denne proces bør brugerne overveje de niveau 1 "dummy"-dele, der er tilgængelige i plante MoClo-sættet, som giver mulighed for samling af ikke-sekventielle niveau 1-vektorer i niveau T (f. eks. niveau 1 position 1 og position 3 vektorer kan samles sammen med "dummy" del Niveau 1 position 2), som kan reducere det samlede antal monterings reaktioner og klonings trin, der kræves15.

DNA-syntese er typisk den enkleste metode til at bygge nye niveau 0-dele. Men når kloning er påkrævet (f. eks. fra plasmider eller genomisk DNA), er det vigtigt at optimere designet af primere, som anvendes til forstærkning, for at maksimere effektiviteten af efterfølgende niveau 0-vektor samling. De to mest kritiske trin i primer design er: 1) kontrol af, at de korrekte udhæng er inkluderet og er i den rette retning for frem og tilbage-primere (figur 1 og tabel 1), og 2) at sikre, at længden af primer sekvens, at anneals til skabelonen er tilstrækkelig lang (18 − 30 BP), og at Tm værdien for denne sekvens (ideelt 58 − 62 °c) er den samme for primer pair (figur 1A). Hvis en sekvens kræver domesticering, flere strategier er tilgængelige. For korte sekvenser (f. eks. < 200 BP) kan et par lange fremad-og omvendte primere konstrueres, hvor 3 ′ ender anneal til hinanden (dvs. en overlapning af > 20 BP) og danner en dobbelt strandede sekvens efter forstærkning. For længere sekvenser, kan separate fragmenter af sekvensen forstærkes, at fjerne ulovlige restriktioner sites og derefter samles ved hjælp af en Golden Gate assembly tilgang (figur 2). Hvis samlings effektiviteten med PCR-produkter er dårlig, kan individuelle fragmenter af en niveau 0-sekvens klones i niveau 1 Universal acceptor-vektoren (pAGM1311), valideres og derefter samles i det relevante niveau 0 acceptor Vector15. En 2:1 indsætte: acceptor vektor Molar ratio anbefales til effektiv Golden Gate assembly. Men for samlinger af kun 2-3 vektorer (f. eks to niveau 0 dele og en level 1 acceptor vektor), kombinere ~ 100 ng af hver regelmæssigt typisk resulterer i vellykkede forsamlinger. Effektiviteten af samlinger har tendens til at falde, da antallet af vektorer, der anvendes pr. reaktion stiger, hvilket resulterer i en reduktion i det samlede antal hvide kolonier efter omdannelse (figur 3).

Forud for konjugering anbefales validering af færdiggjorte niveau T-vektorer ved begrænsnings Digest og PCR. Konjugal DNA overførsel er en velstablished teknik til cyanobakteriale stammer, herunder dem, der ikke naturligt kan udklappe41,45. Vigtige trin i konjugering protokollen omfatter: 1) omhyggelig håndtering af hjælperen E. coli stamme efter overnight vækst (f. eks undgå vortexing)35, 2) at sørge for helt at fjerne spor af de antibiotika, der anvendes til at vokse hjælper og Last E. coli stammer, 3) en passende inkubationsperiode for blandingen af last og hjælpe stammer og cyanobakterier (f. eks. en længere inkubationsperiode var kritisk for S. elongatus utex 2973) og 4) den indledende overførselsperiode for cellen blanding på membraner i LB-BG11 agar plader mangler antibiotika for 24 h.

Isolerede cyanobakteriale kolonier bør udvikle sig på membranen inden for to uger for Synechocystis pcc 6803 og S. elongatus utex 2973, ellers er det sandsynligt, at konjugering er mislykket. Flere ændringer af protokollen kan derefter testes, herunder 1) ved hjælp af en cyanobakteriel kultur med en højere start tæthed (f. eks. OD750 = 1.5 − 2); 2) forøgelse inkubationstiden før overførsel til membranen; og 3) udvidelse af den indledende inkubationsperiode på membranen fra 24 h til 48 h (dvs. for at give mere tid til ekspression af antibiotikaresistens genet på den overførte vektor). Hvis konjugering stadig mislykkes, alternative metoder såsom elektro poration kunne prøves53. At bekræfte en transgene cyanobakteriel stamme er axeniske er vigtig før yderligere eksperimenter. Endelig er det god praksis at bekræfte størrelsen af den heterologøse vektor i den transgene cyanobakteriale stamme. Sidstnævnte kræver DNA-ekstraktion (afsnit 5), omdannelse til E. coli og udvælgelse (afsnit 2,1) og vektor validering (afsnit 2,4).

Den skitserede arrangørens karakteriserings protokol bruger små kultur volumener (dvs. 2 mL) som et middel til at opnå en høj gennemløbs screeningsmetode. Større volumener kan anvendes afhængigt af den foto bioreaktor plads til rådighed, hvilket ville bidrage til at afbøde kulturen fordampning spørgsmål. Hvis der kræves høj gennemløbs screening med små dyrknings mængder, er det vigtigt at have høj luftfugtighed i vækst kammeret for at hæmme fordampningen. Fordampning under et vækst eksperiment kan være til skade for nøjagtigheden og validiteten af prøvemålinger. Kontroller kultur volumener under og efter forsøget for at bekræfte, hvor meget fordampning der er forekommet.

Ved måling af plade læseren er det vigtigt at måle kulturer ved lave tætheder, ideelt set OD750 < 1, for at sikre erhvervelse af pålidelige og reproducerbare vækst-og fluorescens data. En lineær sammenhæng mellem celle nummer og OD750 observeres kun inden for et bestemt interval54. For at fastlægge dette interval anbefaler vi, at du udfører en seriel fortynding (f. eks. fra OD750 = 0,1 − 1,0) ved hjælp af en kendt transformant, hvor der er bekræftet eyfp-fluorescens. Afbildning af absolut fluorescens mod normaliseret fluorescens (eYFP fluorescens/OD750) vil bidrage til at identificere det lineære arbejds område af kultur tæthederne. Flere plade læsere omfatter en "Gain" funktion til at ændre følsomheden af Fluorescensdetektor. I dette tilfælde skal Gain-værdien indstilles til et passende niveau, før eksperimentet påbegyndes og ikke ændres mellem forskellige eksperimentelle kørsler, eller dataene vil ikke være direkte sammenlignelige.

Selv om driften af forskellige strømnings cytometre vil variere mellem fabrikanterne, er det vigtigt at tage en blind aflæsning af den mellemstore opløsning for at lette identifikationen og gating af den mål cyanobakteriale population fra ethvert baggrunds signal i mediet (figur 7A, B). Efter dette vil subtraktion af fluorescens værdien af den negative kontrolprøve (f. eks. en vildtype stamme) bidrage til at fjerne naturlig Auto luorescens (figur 7C, D). Den Photomultiplier Tube (PMT) spændings parameter i et flow flowcytometer har en lignende funktion til Gain i en plade læser, dvs, øge eller mindske følsomheden af detektoren til intensiteten af fluorescens signalet. Som med plade læseren skal PMT-spændingen indstilles til et passende niveau, før eksperimentet påbegyndes55. Når den er indstillet, skal PMT-spændingsværdien opretholdes mellem forskellige eksperimentelle kørsler, eller dataene vil ikke være direkte sammenlignelige.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har intet at afsløre.

Acknowledgments

Forfatterne er taknemmelig for PHYCONET bioteknologi og biologisk Sciences Research Council (BBSRC) netværk i industriel bioteknologi og Bioenergy (NIBB) og Industrial Biotechnology innovation Center (IBioIC) for økonomisk støtte. GARG, AASO og AP anerkender støtte fra BBSRC EASTBIO-PhD-programmet (tilskudsnummer BB/M010996/1), Consejo Nacional de Ciencia y Tecnología (CONACYT) ph. d.-programmet og IBioIC-BBSRC-programmet for samarbejdende Trænings partnerskab (CTP), Henholdsvis. Vi takker Conrad Mullineaux (Queen Mary University of London), og Poul Eric Jensen og Julie Annemarie Zita Zedler (Københavns Universitet) for plasmid vektor og protokol bidrag og rådgivning.

Materials

Name Company Catalog Number Comments
5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal) Thermo Fisher Scientific R0404 Used in 2.1.3.
Adenosine 5′-triphosphate (ATP) disodium salt Sigma-Aldrich A2383 Used in Table 2.
Agar (microbiology tested) Sigma-Aldrich A1296-500g Used in 8.3.
Agarose Bioline BIO-41026 Used in 6.
Attune NxT Flow Cytometer Thermo Fisher Scientific - Used in 4.3.1.
Bovine Serum Albumin (BSA) Sigma-Aldrich A2153 Used in Table 2.
BpiI (BbsI) Thermo Fisher Scientific ER1011 Used in Table 2.
BsaI (Eco31I) Thermo Fisher Scientific ER0291 Used in Table 2.
Carbenicillin disodium VWR International A1491.0005 Used in 2.1.3.
Corning Costar TC-Treated flat-bottom 24 well plates Sigma-Aldrich CLS3527 Used in 4.1.3.
Dimethyl Sulfoxide (DMSO) Thermo Fisher Scientific BP231-100 Used in 3.6.2.
DNeasy Plant Mini Kit Qiagen 69104 DNA extraction kit. Used in 5.
FLUOstar Omega Microplate reader BMG Labtech - Used in 4.2.2.
GeneJET Plasmid Miniprep Kit Thermo Fisher Scientific K0503 Plasmid purification kit. Used in step 2.3.2.
Glass beads (0.5 mm diameter) BioSpec Products 11079105 Used in 5.2.
Glycerol Thermo Fisher Scientific 10021083 Used in 2.3.1, 3.6.2.
Isopropyl-beta-D-thiogalactopyranoside (IPTG) Thermo Fisher Scientific 10356553 Used in 2.1.3.
Kanamycin sulphate (Gibco) Thermo Fisher Scientific 11815-024 Used in 2.1.3.
Membrane filters (0.45 μm) MF-Millipore HAWP02500 Used in 3.3.7
Microplates, 96-well, flat-bottom (Chimney Well) µCLEAR Greiner Bio-One 655096 Used in 4.2.1.
Monarch DNA Gel Extraction Kit New England Biolabs T1020S Used in 1.1.2.2.
Monarch PCR DNA Cleanup Kit New England Biolabs T1030 DNA purification kit. Used in 1.1.2.3.
Multitron Pro incubator with LEDs Infors HT - Shaking incubator with white LED lights. Used in 4.1.4.
MyTaq DNA Polymerase Bioline BIO-21108 Used in 7.1.
NanoDrop One Thermo Fisher Scientific ND-ONE-W Used in 2.3.3.
One Shot TOP10 chemically competent E. coli Thermo Fisher Scientific C404010 Used in 2.1.1.
Phosphate buffer saline (PBS) solution (10X concentrate) VWR International K813 Used in 4.3.2.
Q5High-Fidelity DNA Polymerase New England Biolabs M0491S Used in 1.1.2.1.
Quick-Load 1 kb DNA Ladder New England Biolabs N0468S Used in Figure 4.
Screw-cap tubes (1.5 ml) Starstedt 72.692.210 Used in 3.6.3
Spectinomycin dihydrochloride pentahydrate VWR International J61820.06 Used in 2.1.3.
Sterilin Clear Microtiter round-bottom 96-well plates Thermo Fisher Scientific 612U96 Used in 4.3.1.
T4 DNA ligase Thermo Fisher Scientific EL0011 Used in Table 2.
TissueLyser II Qiagen 85300 Bead mill. Used in 5.2.

DOWNLOAD MATERIALS LIST

References

  1. Luan, G., Lu, X. Tailoring cyanobacterial cell factory for improved industrial properties. Biotechnology Advances. 36, (2), 430-442 (2018).
  2. Madsen, M. A., Semerdzhiev, S., Amtmann, A., Tonon, T. Engineering mannitol biosynthesis in Escherichia coli and Synechococcus sp. PCC 7002 using a green algal fusion protein. ACS Synthetic Biology. 7, (12), 2833-2840 (2018).
  3. Menin, B., et al. Non-endogenous ketocarotenoid accumulation in engineered Synechocystis sp. PCC 6803. Physiologia Plantarum. 166, (1), 403-412 (2019).
  4. Varman, A. M., Yu, Y., You, L., Tang, Y. J. Photoautotrophic production of D-lactic acid in an engineered cyanobacterium. Microbial Cell Factories. 12, (1), 1-8 (2013).
  5. Vavitsas, K., et al. Responses of Synechocystis sp. PCC 6803 to heterologous biosynthetic pathways. Microbial Cell Factories. 16, 140 (2017).
  6. Yang, G., et al. Photosynthetic production of sunscreen shinorine using an engineered cyanobacterium. ACS Synthetic Biology. 7, (2), 664-671 (2018).
  7. Nielsen, A. Z., et al. Extending the biosynthetic repertoires of cyanobacteria and chloroplasts. Plant Journal. 87, (1), 87-102 (2016).
  8. Nielsen, J., Keasling, J. D. Engineering cellular metabolism. Cell. 164, (6), 1185-1197 (2016).
  9. Stensjö, K., Vavitsas, K., Tyystjärvi, T. Harnessing transcription for bioproduction in cyanobacteria. Physiologia Plantarum. 162, (2), 148-155 (2018).
  10. Santos-Merino, M., Singh, A. K., Ducat, D. C. New applications of synthetic biology tools for cyanobacterial metabolic engineering. Frontiers in Bioengineering and Biotechnology. 7, 1-24 (2019).
  11. Lea-Smith, D. J., Vasudevan, R., Howe, C. J. Generation of marked and markerless mutants in model cyanobacterial species. Journal of Visualized Experiments. 111, e54001 (2016).
  12. Vasudevan, R., et al. CyanoGate: A modular cloning suite for engineering cyanobacteria based on the plant MoClo syntax. Plant Physiology. 180, (1), 39-55 (2019).
  13. Andreou, A. I., Nakayama, N. Mobius assembly: A versatile golden-gate framework towards universal DNA assembly. PLoS ONE. 13, (1), 1-18 (2018).
  14. Crozet, P., et al. Birth of a Photosynthetic Chassis: A MoClo toolkit enabling synthetic biology in the microalga Chlamydomonas reinhardtii. ACS Synthetic Biology. 7, (9), 2074-2086 (2018).
  15. Engler, C., et al. A Golden Gate modular cloning toolbox for plants. ACS Synthetic Biology. 3, (11), 839-843 (2014).
  16. Moore, S. J., et al. EcoFlex: A multifunctional MoClo kit for E. coli synthetic biology. ACS Synthetic Biology. 5, (10), 1059-1069 (2016).
  17. Pollak, B., et al. Loop assembly: a simple and open system for recursive fabrication of DNA circuits. New Phytologist. 222, (1), 628-640 (2019).
  18. Werner, S., Engler, C., Weber, E., Gruetzner, R., Marillonnet, S. Fast track assembly of multigene constructs using golden gate cloning and the MoClo system. Bioengineered Bugs. 3, (1), 38-43 (2012).
  19. Patron, N. J., et al. Standards for plant synthetic biology: a common syntax for exchange of DNA parts. New Phytologist. 208, (1), 13-19 (2015).
  20. Chao, R., Mishra, S., Si, T., Zhao, H. Engineering biological systems using automated biofoundries. Metabolic Engineering. 42, 98-108 (2017).
  21. Chambers, S., Kitney, R., Freemont, P. The Foundry: the DNA synthesis and construction Foundry at Imperial College. Biochemical Society Transactions. 44, (3), 687-688 (2016).
  22. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  23. Rosano, G. L., Ceccarelli, E. A. Rare codon content affects the solubility of recombinant proteins in a codon bias-adjusted Escherichia coli strain. Microbial Cell Factories. 8, 1-9 (2009).
  24. Cambray, G., et al. Measurement and modeling of intrinsic transcription terminators. Nucleic Acids Research. 41, (9), 5139-5148 (2013).
  25. Chen, Y. J., et al. Characterization of 582 natural and synthetic terminators and quantification of their design constraints. Nature Methods. 10, (7), 659-664 (2013).
  26. Münch, R., et al. Virtual Footprint and PRODORIC: An integrative framework for regulon prediction in prokaryotes. Bioinformatics. 21, (22), 4187-4189 (2005).
  27. Salis, H. M., Mirsky, E. A., Voigt, C. A. Automated design of synthetic ribosome binding sites to control protein expression. Nature Biotechnology. 27, (10), 946-950 (2009).
  28. Englund, E., Liang, F., Lindberg, P. Evaluation of promoters and ribosome binding sites for biotechnological applications in the unicellular cyanobacterium Synechocystis sp. PCC 6803. Scientific Reports. 6, 36640 (2016).
  29. Heidorn, T., et al. Synthetic biology in cyanobacteria engineering and analyzing novel functions. Methods in Enzymology. 497, 539-579 (2011).
  30. Thiel, K., et al. Translation efficiency of heterologous proteins is significantly affected by the genetic context of RBS sequences in engineered cyanobacterium Synechocystis sp. PCC 6803. Microbial Cell Factories. 17, 34 (2018).
  31. Liu, Q., Schumacher, J., Wan, X., Lou, C., Wang, B. Orthogonality and burdens of heterologous and gate gene circuits in E. coli. ACS Synthetic Biology. 7, (2), 553-564 (2018).
  32. Ferreira, E. A., et al. Expanding the toolbox for Synechocystis sp. PCC 6803: Validation of replicative vectors and characterization of a novel set of promoters. Synthetic Biology. (August), 1-39 (2018).
  33. Liang, F., Lindblad, P. Synechocystis PCC 6803 overexpressing RuBisCO grow faster with increased photosynthesis. Metabolic Engineering Communications. 4, 29-36 (2017).
  34. Taton, A., et al. Broad-host-range vector system for synthetic biology and biotechnology in cyanobacteria. Nucleic Acids Research. 42, (17), e136 (2014).
  35. Elhai, J., Wolk, C. P. Conjugal transfer of DNA to cyanobacteria. Methods in Enzymology. 167, (1984), 747-754 (1988).
  36. Gormley, E. P., Davies, J. Transfer of plasmid RSF1010 by conjugation from Escherichia coli to Streptomyces lividans and Mycobacterium smegmatis. Journal of Bacteriology. 173, (21), 6705-6708 (1991).
  37. Huang, H. H., Camsund, D., Lindblad, P., Heidorn, T. Design and characterization of molecular tools for a synthetic biology approach towards developing cyanobacterial biotechnology. Nucleic Acids Research. 38, (8), 2577-2593 (2010).
  38. Huang, H. H., Lindblad, P. Wide-dynamic-range promoters engineered for cyanobacteria. Journal of Biological Engineering. 7, 10 (2013).
  39. Li, S., Sun, T., Xu, C., Chen, L., Zhang, W. Development and optimization of genetic toolboxes for a fast-growing cyanobacterium Synechococcus elongatus UTEX 2973. Metabolic Engineering. 48, 163-174 (2018).
  40. Pansegrau, W., Balzer, D., Kruft, V., Lurz, R., Lanka, E. In vitro assembly of relaxosomes at the transfer origin of plasmid RP4. Proceedings of the National Academy of Sciences, USA. 87, (17), 6555-6559 (1990).
  41. Song, K., Tan, X., Liang, Y., Lu, X. The potential of Synechococcus elongatus UTEX 2973 for sugar feedstock production. Applied Microbiology and Biotechnology. 100, (18), 7865-7875 (2016).
  42. Waters, V. L., Guiney, D. G. Processes at the nick region link conjugation, T-DNA transfer and rolling circle replication. Molecular Microbiology. 9, (6), 1123-1130 (1993).
  43. Elhai, J., Vepritskiy, A., Muro-Pastor, A. M., Flores, E., Wolk, C. P. Reduction of conjugal transfer efficiency by three restriction activities of Anabaena sp. strain PCC 7120. Journal of Bacteriology. 179, (6), 1998-2005 (1997).
  44. Silva-Rocha, R., et al. The Standard European Vector Architecture (SEVA): A coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research. 41, (D1), D666-D675 (2013).
  45. Mandakovic, D., et al. CyDiv, a conserved and novel filamentous cyanobacterial cell division protein involved in septum localization. Frontiers in Microbiology. 7, (FEB), 1-11 (2016).
  46. Masukawa, H., Inoue, K., Sakurai, H., Wolk, C. P., Hausinger, R. P. Site-directed mutagenesis of the Anabaena sp. strain PCC 7120 nitrogenase active site to increase photobiological hydrogen production. Applied and Environmental Microbiology. 76, (20), 6741-6750 (2010).
  47. Yu, J., et al. Synechococcus elongatus UTEX 2973, a fast growing cyanobacterial chassis for biosynthesis using light and CO2. Scientific Reports. 5, (1), 8132 (2015).
  48. Ungerer, J., Wendt, K. E., Hendry, J. I., Maranas, C. D., Pakrasi, H. B. Comparative genomics reveals the molecular determinants of rapid growth of the cyanobacterium Synechococcus elongatus UTEX 2973. Proceedings of the National Academy of Sciences, USA. 115, (50), E11761-E11770 (2018).
  49. Lepesteur, M., Martin, J. M., Fleury, A. A comparative study of different preservation methods for phytoplankton cell analysis by flow cytometry. Marine Ecology Progress Series. 93, (1-2), 55-63 (1993).
  50. Day, J. G. Cryopreservation of cyanobacteria. Cyanobacteria: An Economic perspective. Wiley Blackwell. New York. 319-327 (2014).
  51. Zhou, J., et al. Discovery of a super-strong promoter enables efficient production of heterologous proteins in cyanobacteria. Scientific Reports. 4, 4500 (2014).
  52. Potapov, V., et al. Comprehensive profiling of four base overhang ligation fidelity by T4 DNA ligase and application to DNA assembly. ACS Synthetic Biology. 7, (11), 2665-2674 (2018).
  53. Ravindran, C. R. M., Suguna, S., Shanmugasundaram, S. Electroporation as a tool to transfer the plasmid pRL489 in Oscillatoria MKU 277. Journal of Microbiological Methods. 66, 174-176 (2006).
  54. Stevenson, K., McVey, A. F., Clark, I. B. N., Swain, P. S., Pilizota, T. General calibration of microbial growth in microplate readers. Scientific Reports. 6, 38828 (2016).
  55. Maecker, H. T., Trotter, J. Flow cytometry controls, instrument setup, and the determination of positivity. Cytometry Part A. 69, (9), 1037-1042 (2006).
Genetisk modifikation af cyanobakterier ved konjugering ved hjælp af det modulære Cyanogat klonings værktøjssæt
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Gale, G. A. R., Schiavon Osorio, A. A., Puzorjov, A., Wang, B., McCormick, A. J. Genetic Modification of Cyanobacteria by Conjugation Using the CyanoGate Modular Cloning Toolkit. J. Vis. Exp. (152), e60451, doi:10.3791/60451 (2019).More

Gale, G. A. R., Schiavon Osorio, A. A., Puzorjov, A., Wang, B., McCormick, A. J. Genetic Modification of Cyanobacteria by Conjugation Using the CyanoGate Modular Cloning Toolkit. J. Vis. Exp. (152), e60451, doi:10.3791/60451 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter