Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Genetische Modifikation von Cyanobakterien durch Konjugation mit dem CyanoGate Modular Cloning Toolkit

doi: 10.3791/60451 Published: October 31, 2019
* These authors contributed equally

Summary

Hier stellen wir ein Protokoll vor, das beschreibt, wie i) einen sich selbst replizierenden Vektor mithilfe des modularen Klon-Toolkits CyanoGate zusammenstellen kann, ii) den Vektor durch Konjugation in einen cyanobakteriellen Wirt einführt und iii) transgene Cyanobakterienstämme mit einem Plattenleser oder Durchflusszytometrie.

Abstract

Cyanobakterien sind eine vielfältige Gruppe von prokaryotischen photosynthetischen Organismen, die für die nachwachsende Produktion nützlicher Industrieller verwendet werden können. Jüngste Fortschritte in der synthetischen Biologie haben zur Entwicklung mehrerer Klon-Toolkits wie CyanoGate geführt, einem standardisierten modularen Klonsystem zum Aufbau von Plasmidvektoren für die nachfolgende Transformation oder die eheliche Übertragung in Cyanobakterien. Hier skizzieren wir eine detaillierte Methode zur Zusammenstellung eines sich selbst replizierenden Vektors (z.B. mit einer fluoreszierenden Markerexpressionskassette) und der wechselförmigen Übertragung des Vektors in die cyanobakteriellen Stämme Synechocystis sp. PCC 6803 oder Synechococcus Elongatus UTEX 2973. Darüber hinaus beschreiben wir, wie die Leistung eines genetischen Teils (z. B. eines Promotors) mit einem Plattenleser oder einer Durchflusszytometrie charakterisiert werden kann.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Cyanobakterien sind autotrophe Bakterien, die für die Biosynthese einer Vielzahl von natürlichen und heterologen hochwertigenStoffwechselprodukten1,2,3,4,5, 6. Es müssen noch einige Hürden überwunden werden, um ihre wirtschaftliche Lebensfähigkeit zu erhöhen, vor allem die relativ geringen Erträge im Vergleich zu heterotrophen Bioplattformen (z. B. Escherichia coli und Hefe)7. Die jüngste Erweiterung der verfügbaren gentechnischen Werkzeuge und die Übernahme des synthetischen Biologie-Paradigmas in der zyanobakteriellen Forschung trägt dazu bei, solche Herausforderungen zu überwinden und Cyanobakterien als effiziente Biofabriken weiterzuentwickeln8, 9,10.

Die wichtigsten Ansätze zur Einführung von DNA in Cyanobakterien sind Transformation, Konjugation und Elektroporation. Die DurchTransformation oder Elektroporation auf Cyanobakterien übertragenen Vektoren sind "Selbstmordvektoren" (d. h. integrative Vektoren, die eine homologe Rekombination erleichtern), während sich selbst replizierende Vektoren durch Transformation, Konjugation oder Elektroporation. Für erstere steht ein Protokoll für technische Modellarten zur Verfügung, die für die natürliche Transformation geeignet sind11. In jüngerer Zeit wurde ein modulares Klonen (MoClo) Toolkit für Cyanobakterien namens CyanoGate entwickelt, das ein standardisiertes Golden Gate Vektormontageverfahren für die Konstruktion mit natürlicher Transformation, Elektroporation oder Konjugation12verwendet.

Golden Gate-Typ Montagetechniken sind in den letzten Jahren immer beliebter geworden, und Montagestandards und Teilebibliotheken sind jetzt für eine Vielzahl von Organismenverfügbar 13,14,15,16 ,17. Golden Gate verwendet Typ IIS-Restriktionsenzyme (z. B. BsaI, BpiI, BsmBI, BtgZI und AarI) und einen Anzug von Akzeptoren und einzigartigen Überhängen, um die richtungsweisende hierarchische Montage mehrerer Sequenzen in einer "One Pot"-Montagereaktion zu erleichtern. Typ-IIS-Restriktionsenzyme erkennen eine eindeutige asymmetrische Sequenz und schneiden einen definierten Abstand von ihren Erkennungsstellen, um einen gestaffelten "klebrigen Ende"-Schnitt (typischerweise ein 4-Nukleotid-Überhang) zu erzeugen, der anschließend genutzt werden kann, um geordnete DNA anzutreiben. Montagereaktionen15,18. Dies hat die Entwicklung großer Bibliotheken modularer Level 0-Teile (z. B. Promoter, offene Leserahmen und Terminatoren) ermöglicht, die durch eine gemeinsame Syntax definiert sind, wie z. B. der PhytoBricks-Standard19. Teile der Ebene 0 können dann leicht zu Expressionkassetten der Ebene 1 zusammengebaut werden, woraufhin komplexere Baugruppen höherer Ordnung (z. B. Multigenexpressionskonstrukte) in einem Akzeptorvektor der Wahl12,15erstellt werden können. Ein wesentlicher Vorteil der Montagetechniken vom Typ Golden Gate ist ihre Automatisierung simperbar in Hochdurchsatzanlagen wie DNA-Gießereien20,21, die das Testen komplexer experimenteller Konstruktionen ermöglichen können, die nicht leicht durch manuelle Arbeit erreicht werden können.

CyanoGate baut auf dem etablierten Plant MoClo System12,15auf. Um ein neues Teil in CyanoGate zu integrieren, muss zunächst die Teilesequenz domestiziert werden, d.h. "illegale" Erkennungsseiten für BsaI und BpiI müssen entfernt werden. Im Falle eines Teils, das für einen offenen Leserahmen kodiert (d. h. eine Codierungssequenz, CDS), können Erkennungsstellen gestört werden, indem synonyme Mutationen in der Sequenz erzeugt werden (d. h. ein Codon in eine Alternative umwandelt, die für denselben Aminosäurerest kodiert). Dies kann durch eine Vielzahl von Ansätzen erreicht werden, von der DNA-Synthese bis zur Polymerase-Kettenreaktion (PCR) Amplifikations-basierte Strategien wie Gibson-Montage22. Je nach verwendeter Expression des Hosts sollte darauf geachtet werden, die Einführung seltener Codons zu vermeiden, die die Effizienz der Übersetzung23hemmen könnten. Das Entfernen von Erkennungsstellen in Promoter- und Terminatorsequenzen ist in der Regel ein riskanteres Unterfangen, da Änderungen die Funktion beeinträchtigen können und das Teil möglicherweise nicht wie erwartet funktioniert. Beispielsweise können Änderungen an vermeintlichen Transkriptionsfaktorbindungsstellen oder der Ribosombindungsstelle innerhalb eines Promotors die Stärke und Reaktionsfähigkeit auf Induktion/Repression verändern. Ebenso können Änderungen an wichtigen Terminatorstrukturmerkmalen (z. B. GC-Rich-Stamm, Schleife und Poly-U-Schwanz) die Beendigungseffizienz ändern und die Genexpression24,25effektieren. Obwohl mehrere Online-Ressourcen zur Verfügung stehen, um die Aktivität von Promotor- und Terminatorsequenzen vorherzusagen und zu informieren, ob eine vorgeschlagene Mutation die Leistung26,27beeinflusst, sind diese Tools oft schlechte Prädiktoren für Leistung bei Cyanobakterien28,29,30.. Daher wird weiterhin die In-vivo-Charakterisierung modifizierter Teile empfohlen, um die Aktivität zu bestätigen. Um das Klonen widerspenstiger Sequenzen zu unterstützen, enthält CyanoGate einen Low Copy Cloning Acceptor Vector, der auf dem BioBrick-Vektor pSB4K512,16,31basiert. Darüber hinaus steht über die Edinburgh Genome Foundry ein "Design and Build"-Portal zur Verfügung, um beim Vector Design (dab.genomefoundry.org) zu helfen. Schließlich, und das ist am wichtigsten, CyanoGate enthält zwei Level T Akzeptor-Vektor-Designs (entspricht Level 2-Akzeptor-Vektoren)15 für die Einführung von DNA in Cyanobakterien mit Selbstmordvektoren oder breite Host-Range-Vektoren, die in der Lage sind, sich selbst zu reproduzieren in mehreren cyanobakteriellen Arten32,33,34.

Hier konzentrieren wir uns auf die Beschreibung eines Protokolls zur Erzeugung von selbstreplizierenden Vektoren der Stufe T und der genetischen Veränderung von Synechocystis PCC 6803 und Synechococcus elongatus UTEX 2973 (Synechocystis PCC 6803 und S. elongatus UTEX 2973 im Folgenden) durch Konjugation (auch bekannt als dreieltes Paarung). Der konjugale Transfer von DNA zwischen Bakterienzellen ist ein gut beschriebenes Verfahren und wurde zuvor für die Entwicklung von cyanobakteriellen Arten verwendet, insbesondere solche, die nicht natürlich kompetent sind, wie S. elongatus UTEX 297335, 36,37,38,39,40,41. Kurz gesagt, cyanobakterielle Kulturen werden mit einem E. coli-Stamm mit dem zu übertragenden Vektor (dem "Cargo"-Vektor) und Vektoren (entweder im selben E. coli-Stamm oder in zusätzlichen Stämmen) inkubiert, um eine Konjugation zu ermöglichen ("Mobilizer" und "Helfer"-Vektoren). Für die eheliche Übertragung sind vier Schlüsselvoraussetzungen erforderlich: 1) direkter Kontakt zwischen Zellen, die an der DNA-Übertragung beteiligt sind, 2) der Ladungsvektor muss mit dem Konjugationssystem kompatibel sein (d. h. er muss einen geeigneten Ursprung der Übertragung enthalten (oriT), auch bekannt als bom (Basis der Mobilität) Site), 3) ein DNA-Nickelprotein (z. B. durch das Mob-Gen kodiert), das DNA am OriT nickt, um einsträngige Übertragung der DNA in das Cyanobacterium zu initiieren, muss vorhanden und exprimiert sein von der Ladung oder den Helfervektoren, und 4) darf die übertragene DNA nicht im Empfängercyanobacterium zerstört werden (d. h. muss resistent gegen Abbau sein, z. B. durch Einschränkung endonuklease-Aktivität)35,42. Damit der Frachtvektor erhalten bleibt, muss der Ursprung der Replikation mit dem Empfänger-Cyanobacterium kompatibel sein, um die Selbstreplikation und Proliferation in Tochterzellen nach der Teilung zu ermöglichen. Um die Bedingungen 3 und 4 zu unterstützen, stehen mehrere Helfervektoren über Addgene und andere kommerzielle Quellen zur Verfügung, die für Mob kodieren, sowie mehrere Methylasen, um vor nativen Endonukleasen im Wirtcyanobacterium43zu schützen. In diesem Protokoll wurde die Konjugation durch einen MC1061 E. coli-Stamm mit Mobilisatoren und Helfervektoren pRK24 (www.addgeneorg/51950) bzw. pRL528 (www.addgene.org/58495) erleichtert. Bei der Auswahl der Vektoren, die für die eheliche Übertragung verwendet werden sollen, ist Vorsicht geboten. Im CyanoGate-Kit kodiert beispielsweise der selbstreplizierende Frachtvektor pPMQAK1-T für ein Mob-Protein12. PSEVA421-T ist jedoch nicht44, und als solcher muss mob von einem geeigneten Hilfsvektor ausgedrückt werden. Die verwendeten Vektoren sollten auch dem Zielorganismus angemessen sein. Beispielsweise erfordert eine effiziente eheliche Übertragung in Anabaena sp. PCC 7120 einen Hilfsvektor, der den Mobilizervektor vor Derverdauung schützt (z. B. pRL623, das für die drei Methylasen AvaiM, Eco47iiM und Ecot22iM kodiert45, 46.

In diesem Protokoll beschreiben wir weiter, wie die Leistung von Teilen (d. h. Promotoren) mit einem Fluoreszenzmarker mit einem Plattenleser oder einem Durchflusszytometer charakterisiert werden kann. Durchflusszytometer sind in der Lage, die Fluoreszenz auf einer einzelzelligen Basis für eine große Population zu messen. Darüber hinaus ermöglichen Durchflusszytometer es dem Benutzer, die erfassten Daten zu "torieren" und Hintergrundgeräusche zu entfernen (z. B. von Partikeln in der Kultur oder Kontamination). Im Gegensatz dazu erfassen Plattenleser eine aggregierte Fluoreszenzmessung eines bestimmten Kulturvolumens, typischerweise in mehreren Replizikern. Zu den wichtigsten Vorteilen von Plattenlesern gegenüber Zytometern zählen die niedrigeren Kosten, die höhere Verfügbarkeit und in der Regel keine Notwendigkeit für spezialsoftware für nachgelagerte Datenanalysen. Die Hauptnachteile von Plattenlesern sind die relativ geringere Empfindlichkeit im Vergleich zu Zytometern und potenzielle Probleme mit der optischen Dichte der gemessenen Kulturen. Für vergleichende Analysen müssen Plattenleserproben für jeden Brunnen normalisiert werden (z. B. zu einer Messung der Kulturdichte, typischerweise als Absorption bei der optischen Dichte bei 750 nm [OD750]), was zu Ungenauigkeiten bei proben führen kann, die zu groß sind. dicht und/oder nicht gut gemischt (z. B. wenn sie anfällig für Aggregation oder Flockung sind).

Als Überblick zeigen wir hier detailliert die Prinzipien der Erzeugung von Level 0-Teilen, gefolgt von der hierarchischen Montage mit dem CyanoGate-Kit und dem Klonen zu einem Vektor, der für die eheliche Übertragung geeignet ist. Anschließend zeigen wir den ehelichen Transferprozess, die Auswahl von axtischen transkonjuganten Stämmen, die einen fluoreszierenden Marker exdrücken, und die anschließende Erfassung von Fluoreszenzdaten mit einem Durchflusszytometer oder einem Plattenleser.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Vektormontage mit den Toolkits Plant MoClo und CyanoGate

HINWEIS: Bevor Sie mit der Vektorbaugruppe fortfahren, wird dringend empfohlen, dass benutzer sich mit den Vektorebenenstrukturen der Plant- und CyanoGate MoClo-Systeme12,15 vertrautmachen.

  1. Konstruktion von Teilen der Stufe 0
    HINWEIS: Teile der Ebene 0 können als vollständige Vektoren oder als lineare Sequenzen für die Baugruppe mit Level 0-Akzeptoren (z. B. Blöcke, IDT) synthetisiert werden. Alternativ können Sequenzen aus einer Quellschablone (z.B. einem Vektor oder gereinigter genomischer DNA) verstärkt werden. Hier wird beschrieben, wie ein neues Level 0-Teil aus einem verstärkten Produkt generiert wird. Eine Übersicht über den Golden Gate Montageprozess von Stufe 0 bis Stufe T finden Sie inAbbildung 1.
    1. Entwerfen Sie die Primer.
      1. Entscheiden Sie, welches Modul der Stufe 0 zu montieren und die entsprechenden 5- und 3-Zoll-Überhänge zu identifizieren (Tabelle 1)12,15. Überprüfen Sie die zu klonende DNA-Sequenz auf das Vorhandensein von BpiI- oder BsaI-Einschränkungssites.
        HINWEIS: Eine Sequenz, die eine dieser Sites enthält, muss domestiziert werden, indem ein oder mehrere NTs in der Einschränkungssitesequenz geändert werden. Eine Strategie, um dies mit Golden Gate-Assembly zu tun, ist in Abbildung 2beschrieben.
      2. Um eine DNA-Sequenz zu verstärken, entwerfen Sie ein geeignetes Vorwärts- und Rückwärtsgrundierungspaar. Wählen Sie für die Vorwärtsgrundierung 18 x 30 bp, die das 5-Zoll-Ende der DNA-Vorlagensequenz ergänzen. Wählen Sie für den Reverse primer 18 x 30 bp umgekehrt aus, der das 3-Zoll-Ende der DNA-Vorlagensequenz ergänzt.
        HINWEIS: Primer mit Schmelztemperaturen (Tm) von 58 bis 62 °C liefern in der Regel die konsistentesten Verstärkungsergebnisse (Abbildung 1A).
      3. Fügen Sie folgendes zum 5-Zoll-Ende der Vorwärtsgrundierung hinzu: 1) eine zufällige Zeichenfolge von 4-6 NTs am 5-Zoll-Ende der BpiI-Site, 2) der BpiI-Einschränkungsstelle (GAAGAC), 3) zwei zufälligen NTs und 4) dem in Schritt 1.1.1.1 ausgewählten 5-NTs. Fügen Sie folgendes zum 5-Zoll-Ende der umgekehrten Grundierung hinzu: 1) eine zufällige Zeichenfolge von 4-6 NTs am 5-Zoll-Ende der BpiI-Site, 2) der BpiI-Einschränkungsstelle (GAAGAC), 3) zwei zufälligen NTs und 4) dem in Schritt 1.1.1.1 ausgewählten 3-N-Überhang. Ordnen Sie nach abschlussdem die Primerpaare an.
        HINWEIS: Siehe Abbildung 1A für ein Beispiel für ein Vorwärts- und Rückwärtsgrundierungspaar.
    2. Verstärken Sie eine DNA-Sequenz aus genomischer DNA.
      1. Extrahieren Sie genomische DNA, wie in Abschnitt 5 beschrieben. Verstärken Sie Produkte nach PCR mit einer hochgradigen DNA-Polymerase (Materialtabelle).
        HINWEIS: Richten Sie z. B. PCR-Reaktionen (20 bis 50 l) gemäß den Anweisungen des Herstellers ein. Verwenden Sie 100 ng genomische DNA pro Reaktion. Verwenden Sie ein thermisches Zyklusprogramm, bestehend aus einem anfänglichen Denaturierungsschritt von 98 °C für 30 s, gefolgt von nicht mehr als 25 Zyklen Dernaturierung bei 98 °C für 10 s, Primer-Glühen bei 58 °C für 15 s und Produktverlängerung bei 72 °C für 30 s (ändern Sie letztere je nach Größe des verwendeten Produkts/Typs der DNA-Polymerase), gefolgt von einem letzten Verlängerungsschritt von 72 °C für 2 min.
      2. Wenn das PCR-Produkt gelgereinigt werden soll, führen Sie die gesamte PCR-Reaktion auf einem Agaro-Gel aus, wie in Abschnitt 6 beschrieben. Schneiden Sie das Interessesband aus dem Agarose-Gel heraus und reinigen Sie es mit einem Gel-Extraktions-Kit (Table of Materials).
      3. Alternativ zu Schritt 1.1.2.2, wenn das PCR-Produkt ohne Gelreinigung verwendet werden soll, überprüfen Sie die Bandgröße, indem Sie ein Aliquot der PCR-Reaktionsprobe (ca. 5 l) auf einem Agaro-Gel ausführen. Wenn das Gel nur das entsprechende Band und keine Hinweise auf Primer-Dimere zeigt, reinigen Sie das PCR-Produkt mit einem DNA-Reinigungskit (Tabelle der Materialien).
      4. Elute gereinigte DNA in einem kleinen Volumen von entionisiertem Wasser (z. B. 10 l), um eine hohe DNA-Konzentration zu erhalten (>20 ng/l ist in der Regel ausreichend).
    3. Montieren Sie das verstärkte DNA-Produkt (oder die Produkte, siehe Abbildung 2) in Stufe 0. Bereiten Sie einen 20-L-Reaktionsmix mit BpiI vor (Abbildung 1B) und richten Sie das Thermische Cycler-Programm wie in Tabelle 2beschrieben ein. Fahren Sie mit der E. coli-Transformation unter Verwendung von 5 l des zusammengesetzten Level 0-Reaktionsmixes fort (wie in Abschnitt 2 beschrieben).
  2. Bau von Baugruppen der Stufe 1
    1. Entscheiden Sie, welche Teile der Ebene 0 montiert werden sollen (Abbildung 1C und Tabelle 1). Wählen Sie einen geeigneten Level 1-Akzeptorvektor15.
      HINWEIS: In dieser Phase ist es wichtig zu wissen, was das endgültige Vektordesign in Level T sein wird, da sich dies auf die Wahl des Akzeptanzvektors der Stufe 1 auswirkt. Der Akzeptanzvektor der Ebene 1 (Vorwärts) (pICH47732) kann als Standard verwendet werden, wenn das Ziel darin besteht, eine einzelne Ebene 1-Baugruppe (z. B. eine Genexpressionskassette) in Level T zu haben. Wenn jedoch zwei oder mehr Baugruppen der Ebene 1 in Ebene T montiert werden sollen, müssen position und richtungsweisend für jede Baugruppe der Ebene 1 berücksichtigt werden. Bis zu sieben Level 1-Baugruppen können in einem Akzeptorvektor der Stufe T mit Level 1-Akzeptorvektoren mit entsprechenden Positionen12zusammengesetzt werden.
    2. Montieren Sie die Level 0-Teile in Ebene 1. Bereiten Sie mit BsaI einen 20-L-Reaktionsmix vor und richten Sie das Thermocycler-Programm wie in Tabelle 2beschrieben ein. Fahren Sie mit der E. coli-Transformation unter Verwendung von 5 l des zusammengesetzten Level-1-Reaktionsmixes fort (wie in Abschnitt 2 beschrieben).
  3. Bau von Baugruppen der Stufe T
    1. Entscheiden Sie, welche Baugruppen der Ebene 1 zusammenzubauen sind (Abbildung 1D). Wählen Sie einen geeigneten Level T-Akzeptorvektor aus.
      ANMERKUNG: pUC19A-T (Ampicillinresistenz) und pUC19S-T (Spectinomycin-Resistenz) sind integrative Vektoren mit hoher Kopierzahl, die sich nicht in Cyanobakterien replizieren können und in erster Linie für die genomische Integration (d. h. Knock-in oder Knock-out von Genen) über homologe Rekombination12. Die Lieferung von integrativen Vektoren kann durch natürliche Transformation in amenable cyanobacterial Arten11erfolgen. pPMQAK1-T ist ein breiter Host-Bereich, ein replizitiver Vektor, der durch eheliche Übertragung geliefert wird (Abschnitt 3).
    2. Wählen Sie einen geeigneten End-Link, um das 3-Zoll-Ende der endgültigen Ebene 1-Baugruppe auf das Level T Backbone15zu ligte.
      HINWEIS: Der erforderliche End-Link ist die gleiche Zahl wie die Position des letzten Teils. Beispielsweise erfordert ein Level-T-Vektor mit nur einem Level-1-Position 1-Teil (vorwärts oder rückwärts) End-Link 1 (pICH50872) für die Ligation in das Level T-Backbone.
    3. Montieren Sie eine oder mehrere Level 1-Baugruppen in Ebene T. Bereiten Sie einen Reaktionsmix mit BpiI und dem erforderlichen End-Link-Vektor vor und richten Sie das Thermocycler-Programm wie in Tabelle 2beschrieben ein. Fahren Sie mit der E. coli-Transformation unter Verwendung von 5 l des zusammengesetzten Level-T-Reaktionsmixes fort (wie in Abschnitt 2 beschrieben).

2. E. coli-Transformation und Vektorreinigung

  1. E. coli-Transformation (Tag 1)
    1. Auftauen Sie ein Aliquot (ca. 25 l) chemisch kompetenter E. coli-Zellen (Materialtabelle) und pipette nieren Sie vorsichtig in ein 1,5 ml-Rohr auf Eis. Fügen Sie 5 l der Baugruppenmischung (Stufe 0, 1 oder T) hinzu und inkubieren Sie die Röhre auf Eis für weitere 30 bis 60 min.
    2. Hitze-Schock-Zellen durch Inkubation der Röhre in einem Wasserbad bei 42 °C für 30 s, dann legen Sie das Rohr wieder auf Eis für 2 min. Fügen Sie Raumtemperatur (RT) super optimale Brühe mit Katabolit Repression (S.O.C.) Medium (250 l) in die Röhre. Inkubieren Sie das Rohr bei 37 °C für 1 h bei 225 U/min in einem Schüttelinkubator.
    3. Platte 40 l der Kultur auf eine LB-Agarplatte, die die entsprechende Endkonzentration von Antibiotika enthält (100 g/ml für Spectinomycin-Dihydrochlorid-Pentahydrat [Level 0], 100 g/ml Carbenicillin-Dinatrium [Level 1] oder 50 g/ml Kanamycinsulfat [ Stufe T]), 1 mM Isopropyl-Beta-D-Thiogalactopyranosid (IPTG) und 40 g/ml 5-Brom-4-Chlor-3-Indolyl--D-Galactopyranosid (X-Gal) zum blau-weißen Screening. Inkubieren Sie die Platte über Nacht bei 37 °C.
      HINWEIS: Die Menge der plattierten Kultur kann je nach Der Effizienz der E. coli-fähigen Zellen und der Ligationsreaktion variiert werden. Platte ein größeres Volumen, wenn <10 Kolonien nach der nächtlichen Inkubation beobachtet werden.
  2. Auswahl weißer Kolonien und Zubereitung flüssiger Kulturen (Tag 2)
    HINWEIS: Abhängig von den Effizienzen der Montagereaktion und der anschließenden Transformation dürfen LB-Agarplatten keine Kolonien, blauen Kolonien oder weißen Kolonien enthalten (Abbildung 3). Blaue Kolonien sind bezeichnend für Akzeptorvektoren, die keiner Einschränkung unterzogen wurden (d.h. eine funktionelle Kopie von lacZ ist noch vorhanden). Weiße Kolonien zeigen an, dass die lacZ-Expressionskassette verloren gegangen ist und durch ein Teil/eine Baugruppe ersetzt wurde.
    1. Überprüfen Sie optional, ob weiße Kolonien den erwarteten Vektor enthalten, indem Sie PCR ausführen, wie in Abschnitt 7 beschrieben.
    2. Wählen Sie einzelne weiße Kolonien (oder PCR-geprüfte Kolonien) mit einer Spitze von 10 l und übertragen Sie sie in ein 15 ml Zentrifugenrohr, das LB-Medium (5 ml) und entsprechende Antibiotikakonzentrationen (Schritt 2.1.3) enthält. Inkubieren Sie die Rohre bei 37 °C über Nacht bei 225 U/min in einem Schüttelinkubator.
  3. Plasmidvektorreinigung (Tag 3)
    1. Optional bereiten Sie einen Glycerinbestand der über Nacht E. coli-Kultur für die langfristige Kryospeicherung von Vektoren vor. Fügen Sie 500 l bakterielle Kultur zu 500 l 50% (v/v) Glycerin in einem geeigneten 1,5-2,0 ml-Rohr für die Kryospeicherung bei -80 °C hinzu. Mischen Sie sanft, indem Sie 5 x 10x invertieren. Flash-Freeze-Proben in flüssigem Stickstoff und in einem Gefrierschrank von -80 °C lagern.
    2. Spinnen Sie Kulturen in 15 ml Zentrifugenröhren bei 3.000 x g für 5 x 10 min. Entsorgen Sie den Überstand, ohne das Zellpellet zu stören. Reinigen Sie den Vektor mit einem Plasmid-Reinigungskit (Tabelle der Materialien). Elute gereinigter Vektor in 35 l entionisiertem Wasser.
      HINWEIS: Verwenden Sie niedrigere Elutionsvolumina, um die Vektorkonzentration weiter zu erhöhen. Das gleiche Eluent kann zweimal durch eine Reinigungskolonne für erhöhte Erträge gelegt werden.
    3. Messen Sie die Konzentration des Vektors im Eluent mit einem Spektralphotometer (Materialtabelle).
      ANMERKUNG: Hohe Kopien-Zahlen-Vektoren in E. coli, wie z. B. pUC19, ergeben in der Regel Erträge von 50 bis 300 ng/l. Niedrige Kopien-Zahlen-Vektoren, wie pPMQAK1-T, ergeben in der Regel Erträge von 15 bis 60 ng/L.
  4. Vektorvalidierung
    HINWEIS: Vektoren können durch Restriktionsverdauung (Schritt 2.4.1) und/oder Sequenzierung (Schritt 2.4.2) überprüft werden.
    1. Beschränken Sie den Vektor mit einem geeigneten Restriktionsenzym(n) und überprüfen Sie die erwarteten Bandgrößen, wie in Abschnitt 6 (Abbildung 4) beschrieben.
      HINWEIS: Falsche Bandgrößen weisen in der Regel auf eine fehlerhafte Baugruppe hin, in diesem Fall können mehr weiße Kolonien gesiebt oder die Montage wiederholt werden. BsaI und BpiI können verwendet werden, um die richtige Größe des Inserts für Assemblys der Ebene 0 bzw. 1 zu überprüfen. BsaI oder BpiI können in Verbindung mit einem zusätzlichen, kompatiblen Restriktionsenzym verwendet werden, das innerhalb des Inserts und/oder des Vektor-Rückgrats schneidet, um nach der Verdauung einen deutlichen Satz gut getrennter Bänder zu erzeugen.
    2. Sequenzieren Sie den Vektor durch Sanger-Sequenzierung mit einem geeigneten Primer vor der montierten Region mithilfe der kommerziellen Sequenzierungseinrichtung (Tabelle 3).
      HINWEIS: Alle neuen Level 0-Teile sollten sequenziert werden, um die erwartete Sequenzidentität zu bestätigen. Die Sequenzvalidierung von Vektoren der Stufen 1 und T ist in der Regel nicht erforderlich, wenn sie aus zuvor sequenzierten Teilen der Ebene 0 zusammengesetzt werden.

3. Erzeugung von Mutanten durch Konjugation

HINWEIS: Hier wird ein Protokoll zur ehelichen Übertragung eines sich selbst replizierenden Ladungsvektors in Synechocystis PCC 6803 oder S. elongatus UTEX 297311,47 beschrieben. Dieses Protokoll gilt für andere Modellarten (z.B. S. elongatus PCC 7942 und Synechococcus sp. PCC 7002). Alle Arbeiten mit Cyanobakterien (und zugehörigen Pufferpräparaten) sollten unter sterilen Bedingungen in einer laminaren Durchflusshaube durchgeführt werden.

  1. Wachstum der cyanobakteriellen Kultur (Tag 1)
    1. Bereiten Sie BG11 medium nach Lea-Smith et al.11und Agarplatten mit LB-BG11 und BG11+Kan50 (Abschnitt 8) vor.
    2. Richten Sie eine frische Kultur von Synechocystis PCC 6803 oder S. elongatus UTEX 2973 ein, indem Sie einen 100 ml kegelförmigen Kolben mit frischem BG11-Medium (50 ml) mit Zellen aus einer axtischen BG11-Agarplatte impfen. Synechocystis PCC 6803 Kulturen bei 30 °C, 100 mol Photonen m-2s-1 bei 100 U/min anbauen und S. elongatus UTEX 2973 bei 40 °C, 300 -mol Photonen m-2s-1 bei 100 U/min anbauen. Wachsen Kulturen bis OD750 = 0,5 bis 1,5 (in der Regel 1 bis 2 Tage).
      HINWEIS: S. llangatus UTEX 2973 Kulturen können bei 40 °C in hohen Lichtintensitäten angebaut werden (z.B. 2000 mol Photonen m-2s-1)48.
  2. Wachstum von Helfer und Fracht E. coli-Stämme (Tag 2)
    1. Impfmittel LB-Medium mit Ampicillin (Endkonzentration 100 g/ml) und Chloramphenicol (Endkonzentration 25 g/ml) mit einem MC1061 E. coli-Stamm, der die Vektoren pRK24 und pRL528 (d. h. den Helferstamm) enthält und bei 37 °C über Nacht bei 225 U/min wächst in einem schüttelten Inkubator. Wachsen Sie ein ausreichendes Volumen an Hilfsstammkultur, vorausgesetzt, 1 ml Kultur ist pro Konjugation erforderlich.
    2. Impfmittel LB (5 ml), das geeignete Antibiotika enthält, wobei die E. coli-Kultur den Ladungsvektor (d. h. einen Level-T-Vektor) trägt. Wachsen Sie die Kultur bei 37 °C über Nacht bei 225 Rpm in einem zitternden Brutkasten.
  3. Eheliche Übertragung (dreielte Paarung) (Tag 3)
    1. Bereiten Sie den E. coli Helfer und Frachtstämme vor. Zentrifugieren Sie den Helfer und die Ladung E. coli Übernachtkulturen bei 3.000 x g für 10 min bei Raumtemperatur. Entsorgen Sie den Überstand, ohne das Zellpellet zu stören.
    2. Waschen Sie das Pellet, indem Sie frisches LB-Medium ohne Antibiotika hinzufügen. Verwenden Sie das gleiche Volume wie die Anfangskultur. Setzen Sie das Pellet wieder auf, indem Sie sanft nach oben und unten pfeifen. Wirbeln Sie die Kultur nicht. Wiederholen Sie diesen Schritt 3x, um Restantibiotika aus der Nachtkultur zu entfernen.
    3. Zentrifugieren Sie die resuspendierte Kultur (wie in Schritt 3.3.1), entsorgen Sie den Überstand und setzen Sie das Volumen des LB-Mediums des ursprünglichen Kulturvolumens in die Hälfte (z. B. 2,5 ml bei einer Übernachtungskultur von 5 ml). Kombinieren Sie 450 l der Helfer-Stamm mit 450 l der Ladungsbelastung in einem 2 ml Rohr und beiseite (lassen Sie bei RT) bis Schritt 3.3.6.
    4. Bereiten Sie die cyanobakterielle Kultur vor. Verwenden Sie für jede Konjugationsreaktion 1 ml cyanobakterielle Kultur (OD750 = 0,5 -1,5).
    5. Zentrifugieren Sie das erforderliche Gesamtvolumen der cyanobakteriellen Kultur bei 1.500 x g für 10 min bei RT, dann entsorgen Sie den Überstand sorgfältig, ohne das Zellpellet zu stören. Waschen Sie das Pellet, indem Sie frisches BG11 Medium des gleichen Anfangsvolumens hinzufügen. Setzen Sie das Pellet durch sanftes Pipettieren nach oben und unten, wirbeln Sie die Kultur nicht. Wiederholen Sie diesen Schritt 3x und legen Sie die gewaschene Kultur beiseite.
    6. Fügen Sie den kombinierten E. coli-Stämmen (Helfer und Ladung) (900 l) in einem 2 ml-Rohr ein Aliquot der gewaschenen cyanobakteriellen Kultur (900 l) hinzu. Mischen Sie die Kulturen, indem Sie sanft nach oben und unten pfeifen. Wirbel nicht. Inkubieren Sie die Mischung bei RT für 30 min für Synechocystis PCC 6803 oder 2 h für S. elongatus UTEX 2973.
    7. Zentrifugieren Sie die Mischung bei 1.500 x g für 10 min bei RT. Entfernen Sie 1,6 ml des Überstandes. Setzen Sie das Pellet in den verbleibenden 200 L Desobtant wieder auf. Legen Sie einen 0,45 m Membranfilter auf eine LB-BG11 Agarplatte ohne Antibiotika (Abschnitt 8). 200 l der E.coli/cyanobakterielleKulturmischung auf der Membran mit einem sterilen Streuer oder einer sterilen gebogenen Spitze vorsichtig verteilen und die Platte mit Paraffinfolie versiegeln.
    8. Inkubieren Sie die LB-BG11-Platte mit der Membran für 24 h. Bewahren Sie Membranen mit Synechocystis PCC 6803 Kulturen bei 30 °C, 100 mol Photonen m-2s-1. Pflegen Sie Membranen mit S. llangatus UTEX 2973 Kulturen bei 40 °C in 150 mol Photonen m-2s-1.
  4. Membrantransfer
    1. Nach 24 h die Membran mit flammensterilisierten Zangen vorsichtig auf eine frische BG11-Agarplatte mit geeigneten Antibiotika (Abschnitt 8) übertragen, um sie für den Ladungsvektor auszuwählen. Versiegeln Sie die Platte mit Paraffinfolie.
    2. Inkubieren Sie die BG11 Agarplatte unter geeigneten Wachstumsbedingungen, wie oben für Synechocystis PCC 6803 oder S. elongatus UTEX 2973 beschrieben, bis Kolonien auftreten.
      HINWEIS: Kolonien erscheinen in der Regel nach 7-14 Tagen für Synechocystis PCC 6803 und 3-7 Tage für S. elongatus UTEX 2973.
  5. Auswahl der Konjuganten
    HINWEIS: Nur cyanobakterielle Kolonien, die den Ladungsvektor tragen, können auf der Membran wachsen (Abbildung 5).
    1. Wählen Sie mit einer hitzesterilen Schleife mindestens zwei einzelne Kolonien aus der Membran aus und streifen Sie auf eine neue BG11-Agarplatte mit geeigneten Antibiotika(Abbildung 5C).
      ANMERKUNG: Frisch gestreifte Kolonien können immer noch mit E. coli kontaminiert sein, die von der Konjugation übertragen werden (d. h. wenn kleine weiße Kolonien auf dem Teller zu sehen sind), so dass zwei oder drei zusätzliche Runden, die auf frische BG11-Agarplatten übertragen werden, in der Regel eine axtische zyanobakterielle Kultur zu erhalten.
    2. Bestätigen Sie das Fehlen einer E. coli-Kontamination, indem Sie einen Streifen cyanobakterieller Kultur in ein 15 ml Zentrifugenrohr impfen, das 5 ml LB-Medium enthält, und bei 37 °C über Nacht bei 225 U/min in einem Schüttelbrutzentrum inkubieren. Wählen Sie nach einer ausreichenden Wachstumsperiode (ca. 7 Tage) einzelne axtische Kolonien aus, um flüssige Kulturen für langfristige Kryospeicher oder nachfolgende Experimente einzurichten.
  6. Kryostorage von cyanobakteriellen Stämmen
    1. Wachsen Sie eine cyanobakterielle Flüssigkeitskultur in BG11 (wie in Abschnitt 3.1 beschrieben) bis OD750 = 1,5 bis 3,0. Zentrifuge 10 ml Kultur für 10 min bei 1.500 x g, entfernen Sie den Überstand und setzen Sie die Zellen in 5 ml frischem BG11 Medium wieder auf.
    2. Fügen Sie 3,5 ml Autoklav sterilisiert 50% (v/v) Glycerin für eine endgültige Glycerinkonzentration von 20 % (v/v)49hinzu. Dieser Ansatz funktioniert gut für Synechocystis PCC 6803. Alternativ können Sie 5 ml filtersterilisiertes BG11 hinzufügen, das 16 % (v/v) Dimethylsulfoxid (DMSO) enthält, und zwar für eine endgültige DMSO-Konzentration von 8 % (v/v)50. Dieser Ansatz wird für die meisten Stämme empfohlen, einschließlich S. elongatus UTEX 2973.
      VORSICHT: DMSO ist giftig und sollte mit entsprechendem Schutz behandelt werden.
    3. Mischen Sie sanft, indem Sie 5 x 10x invertieren. Subaliquot 1 ml Kultur in separate Kryospeicher kompatibel 1,5 ml Schraubkappenrohre (Tisch der Materialien). Rohre in einen -80 °C-Gefrierschrank für Kryospeicher legen. In flüssigem Stickstoff nicht einfrieren.
      HINWEIS: Es werden mindestens drei Bestände pro Stamm empfohlen.
    4. Zur Erholung ein Rohr aus dem -80 °C Gefrierschrank entfernen und die Kultur in einem 35 °C Wasserbad auftauen, während es sanft vermischt wird. Fügen Sie die aufgetaute Kultur zu 50 ml frischem BG11-Medium hinzu und wachsen Sie als flüssige Kultur (wie in Abschnitt 3.1 beschrieben).
      HINWEIS: Alternativ kann die Kultur auf einer frischen BG11 Agarplatte gestreift und angebaut werden. Transgene Kulturen mit Selektionsmarkern müssen zunächst auf BG11-Agarplatten ohne Antibiotika wiederbelebt und dann mit entsprechenden Antibiotika auf BG11-Agarplatten umgestreift werden.

4. Promoter-Charakterisierung

HINWEIS: Hier wird ein Standardansatz für die Analyse der Stärke eines Promotorteils beschrieben, indem die Expressionswerte eines Fluoreszenzmarkers (eYFP) nach einer Wachstumsperiode von 72 h mit einem Plattenleser oder einem Durchflusszytometer12gemessen werden.

  1. Kulturwachstum
    1. Richten Sie Samenkulturen ein, indem Sie 10 ml BG11-Medium mit geeigneten Antibiotika mit einer einzigen Kolonie des transgenen cyanobakteriellen Stammes impfen, der die fluoreszierende Markerexpressionskassette trägt. Bereiten Sie auch Samenkulturen für geeignete negative Kontrollstämme vor (z. B. einen Wildstamm und/oder einen transgenen Stamm, der das gleiche Vektorrückgrat trägt, aber nicht die fluoreszierende Markerexpressionskassette enthält).
      HINWEIS: Es werden mindestens vier biologische Repliken empfohlen.
    2. Wachsen Sie die Samenkulturen für 48 h oder bis OD750 = 1-1,5 unter Wachstumsbedingungen, die für den Artenstamm geeignet sind.
    3. Um den Ausdruck des Promotors im Laufe der Zeit zu verfolgen, messen Sie zuerst die OD750 jeder Saatgutkultur. Berechnen Sie die Verdünnungsanforderungen, um jede Kultur auf eine beginnende OD750 = 0,2 zu bringen. Einrichten von verdünnten Versuchskulturproben (2 ml Gesamtvolumen) in einer flachen 24-Well-Platte (Materialtabelle).
    4. Inkubieren Sie die Platte in einem Schüttelinkubator mit weißen LED-Leuchten (Materialtabelle) unter geeigneten Wachstumsbedingungen. Messen Sie die Kulturwachstumsdichte (OD750) und die verbesserte fluoreszierende Proteinfluoreszenz (eYFP) entweder mit einem Plattenleser (Abschnitt 4.2) oder einem Durchflusszytometer (Abschnitt 4.3).
      HINWEIS: Synechocystis PCC 6803 und S. elongatus UTEX 2973 Kulturen können wie in Schritt 3.1.2 angebaut werden. Es wird dringend empfohlen, die Platte unter hoher Luftfeuchtigkeit zu halten (95%) verdunsten, um eine Verdunstung der Kulturproben zu vermeiden.
  2. Plattenleser
    1. Mischen Sie die Kulturen in der 24-Well-Platte (Schritt 4.1.4) kurz mit sanfter Pipettierung. Übertragen Sie eine Unterprobe jeder Kultur auf eine schwarze 96-Well-Platte (Materialtabelle). Bei Bedarf verdünnen (100 l Endvolumen). Vermeiden Sie die Bildung von Blasen, da dies die Messgenauigkeit beeinträchtigen kann.
      HINWEIS: Es wird empfohlen, alle Messungen an Proben im BEREICH von OD750 von 0,2 bis 1,0 durchzuführen. Da die Dichte der Kulturen im 24-Well im Laufe der Zeit zunehmen wird, werden folgende Verdünnungen auf der Grundlage der erwarteten Erhöhungen der Standardwachstumsbedingungen empfohlen: keine Verdünnung bei 0 h, 1:4 bei 24 h, 1:10 bei 48 h und 1:10 bei 72 h. So zum Beispiel bei 24 h Ernte 25 l Kultur und mischen sie mit 75 l BG11 Medium.
    2. Fügen Sie zwei Leerebohrguts in die 96-Well-Platte ein (d. h. 100 l BG11 medium). Legen Sie die 96-Well-Platte in einen Plattenleser (Tabelle der Materialien). Schütteln Sie die Platte für 60 s bei 500 Rpm mit dem Orbital-Shaker im Plattenleser, um die Brunnen zu mischen.
      HINWEIS: Cyanobakterienkulturen können aggregieren und/oder flockulieren, daher ist eine gute Durchmischung vor dem Lesen für genaue Messungen entscheidend.
    3. Messen Sie OD750 und eYFP Fluoreszenz mit Anregungs-/Emissionswellenlängen bei 485 nm/520 nm.
    4. Subtrahieren Sie den Durchschnitt der OD750 Messungen der beiden Rohbrunnen von der OD750 Messung jeder Probe, die eine Cyanobakterienkultur enthält.
    5. Normalisieren Sie die Fluoreszenzwerte jeder Kulturprobe, indem Sie die eYFP-Fluoreszenzmessung (Schritt 4.2.3) durch die angepasste OD750 der Kultur (Schritt 4.2.4) dividieren. Subtrahieren Sie dann den durchschnittlichen normalisierten eYFP-Fluoreszenzwert (eYFP fluoreszenz/OD750) der biologischen Replikationen eines geeigneten Negativkontrollstamms von den transgenen Stämmen, die die eYFP-Expressionskassette tragen.
      HINWEIS: Cyanobakterien fluoreszieren natürlich durch das Vorhandensein von Pigmenten, wie Chlorophyll und Phycobiliproteine.
    6. Plotkulturwachstum im Laufe der Zeit (Abbildung 6A) und die durchschnittlichen normalisierten eYFP-Fluoreszenzwerte jeder experimentellen Kultur zu den gewünschten Zeitpunkten (z. B. 72 h; Abbildung 6B).
  3. Durchflusszytometer
    1. Wählen Sie eine kompatible Platte für das Durchfluss-Zytometer-Flüssigkeitshandling-System. Verwenden Sie beispielsweise eine rund-untere 96-Well-Platte (Materialtabelle) mit dem in diesem Protokoll verwendeten Durchflusszytometer (Materialtabelle).
    2. Mischen Sie die Kulturen in der 24-Well-Platte (Schritt 4.1.4) kurz mit sanfter Pipettierung. Verdünnung der Kulturen auf OD750 = 0,1 bis 0,2, um Düsenverstopfungen im Flüssigkeitshandlingsystem zu vermeiden. Fügen Sie der 96-Well-Platte ein entsprechendes Volumen an Kulturproben hinzu und bringen Sie ein Endvolumen von 250 l mit filtersterilisierter 1x Phosphat-gepufferter Kochsaline (PBS). Fügen Sie einen Rohbrunnen für die mittlere Lösung auf der Platte ein, die 60 l BG11 und 190 l 1x PBS enthält.
      HINWEIS: Dieses Volume wird empfohlen, falls Proben erneut ausgeführt werden müssen. Volumes, die größer als 250 l sind, werden nicht empfohlen, da das maximale Volumen jedes Bohrguts 300 l beträgt.
    3. Sobald das Durchflusszytometer einsatzbereit ist, legen Sie die 96-Well-Platte mit Kulturproben in die Flüssigkeitsabfertigungsstation. Richten Sie das Softwareprotokoll für das Durchflusszytometer ein, um die Messungen von 10.000 Einzelereignissen (z. B. Zellen) zu erfassen. Messen Sie die eYFP-Fluoreszenz mit Anregungs-/Emissionswellenlängen von 488 nm/515-545 nm. Messen Sie zuerst und überprüfen Sie den Messwert aus dem leeren Brunnen (Abbildung 7A), dann führen Sie die Proben aus.
    4. Gate die Population der Cyanobakterien-Zellen innerhalb der vorderen und seitlichen Streudatensätze, mit Ausnahme der Regionen, die mit dem leeren Lesen gemeinsam sind (Abbildung 7B). Subtrahieren Sie die durchschnittlichen eYFP-Fluoreszenzwerte der biologischen Replikationen eines geeigneten Negativkontrollstamms von den transgenen Stämmen, die die eYFP-Expressionskassette tragen (Abbildung 7C,D). Plotten Sie den Mittelwert der medianen Fluoreszenzwerte pro Zelle für jede experimentelle Kultur zu den gewünschten Zeitpunkten (z. B. 72 h; Abbildung 7E).

5. Genomische DNA-Extraktion aus Cyanobakterien

HINWEIS: Das folgende Protokoll verwendet ein kommerzielles DNA-Extraktionskit (Tabelle der Materialien).

  1. Wachsen Sie eine cyanobakterielle Flüssigkeitskultur in BG11 (wie in Abschnitt 3.1 beschrieben) bis OD750 = 1,5 bis 3,0. 10 ml Kultur bei 3.000 x g für 10 min nach unten drehen und den Überstand entsorgen. Einfrieren des Pellets durch Inkubieren der Rohre bei -20 °C für 30 min.
  2. Fügen Sie 400 l Lysepuffer (Puffer AP1) und 400 l Ribonukleaselösung (RNase A) und 50 % (w/v) Glasperlen (0,5 mm Durchmesser) hinzu. Unterbrechen Sie Proben mit einer Perlenmühle (Materialtabelle) bei 30 Hz (d. h. entsprechend 1.800 Schwingungen/min) für 6 min.
  3. Drehen Sie die Probe bei 17.000 x g für 5 min und übertragen Sie den Überstand vorsichtig in ein neues Rohr und entsorgen Sie das Pellet. Gehen Sie nach den Anweisungen des Herstellers (Tabelle der Materialien).

6. Agarose-Gel-Elektrophorese

  1. Gießen Sie ein 1% (w/v) Agarose-Gel, das 0,02% (v/v) Ethidiumbromid enthält. Laden Sie Proben und eine entsprechende DNA-Leiterreferenz.
  2. Führen Sie die Proben für 50 min bei 125 V. Prüfen Sie auf Bandtrennung auf einem ultravioletten (UV) Transilluminator.
    HINWEIS: Der Prozentsatz der Laufzeit und des Agarose-Gels kann an die erwartete Bandgröße angepasst werden. Zum Beispiel kann ein höherprozentiger Prozentsatz Agarose Gel und längere Laufzeit die Bandauflösung und Trennung von DNA-Produkten <500 bp verbessern.

7. Kolonie PCR

  1. Richten Sie einen PCR-Reaktionsmix mit einem Standard-Kit (Materialtabelle) und einer geeigneten Kombination von Primern ein (z. B. Primer, die den Montagebereich flankieren oder für Sequenzen innerhalb des Baugruppenbereichs spezifisch sind (Tabelle 3). Pipette 10 l in ein PCR-Rohr.
  2. Berühren Sie vorsichtig die Oberseite einer einzelnen weißen Kolonie mit einem sterilen Zahnstocher oder einer 10-L-Pipettenspitze und impfen Sie eine PCR-Röhre mit PCR-Reaktionsmix. Achten Sie darauf, die Kolonie zu markieren und mit dem spezifischen PCR-Rohr zu entsprechen. Rühren Sie den Reaktionsmix vorsichtig, um sicherzustellen, dass E. coli-Zellen in die Lösung vergossen werden.
  3. Verstärken Sie Produkte nach PCR. Verwenden Sie ein Programm, bestehend aus einem ersten Denaturierungsschritt von 95 °C für 60 s, 30 Runden 95 °C für 15 s, 58 °C für 15 s (einige Grad unter den Tm-Werten der Primer) , 72 °C für 30 s (30 s/kb Einsatz) , gefolgt von einem letzten Verlängerungsschritt von 72 °C für 5 min.

8. Herstellung von BG11 Medium und Platten

  1. Bereiten Sie Lagerlösungen von 100x BG11 medium, Eisen (Ammoniumferric Citrat), Spurenelemente, Phosphat (K2HPO4), Na2CO3 und TES Puffer nach Lea-Smith et al.11vor. Autoklavphosphat und Na2CO3-Bestände. Verwenden Sie 0,2 m Filter, um die TES-Puffer (pH 8.2) und NaHCO3-Lagerlösungen zu sterilisieren.
  2. Bereiten Sie 1 L von BG11 medium vor. Mischen Sie 10 ml von 100x BG11, 1 ml Spurenelemente und 1 ml Eisenvorrat und Autoklav die Lösung mit 976 ml Wasser. Sobald die Lösung auf RT abgekühlt ist, fügen Sie 1 ml Phosphatbestand, 1 ml Na2CO3-Lager und 10 ml NaHCO3hinzu und stellen Sie sich mit 1 M HCl auf pH 7,6-7,8 ein.
  3. LB-BG11 Agarplatten (1,5% [w/v])
    1. Kombinieren Sie 700 ml entionisiertes Wasser und 15 g Agar in einem Glaskolben. In einem zweiten Kolben 186 ml Wasser, 10 ml 100x BG11, 1 ml Spurenelemente und 1 ml Eisenvorrat hinzufügen. Autoclave beide Lösungen.
    2. Sobald die Lösungen auf ca. 60 °C abgekühlt sind, kombinieren und 1 ml Phosphatvorrat, 1 ml Na2CO3 Vorrat, 10 ml NaHCO3 Vorrat und 50 ml LB steriles Medium hinzufügen, was ein Endvolumen von 1 L. Gegossene Petrischalen mit 25 mL des LB-BG11 Agarmediums.
  4. BG11+Kan50 Agarplatten (1,5% [w/v])
    1. Kombinieren Sie 700 ml entionisiertes Wasser und 15 g Agar in einem Glaskolben. In einem zweiten Kolben 3 g Natriumthiosulfat (Na2S2O3), 226 ml Wasser, 10 ml 100x BG11-Bestand, 1 ml Spurenelemente und 1 ml Eisenvorrat hinzufügen. Autoclave beide Lösungen.
    2. Sobald die Lösungen auf ca. 60 °C abgekühlt sind, kombinieren und 1 ml Phosphatbestand, 1 ml Na2CO3-Lager, 10 ml TES-Pufferbestand und 10 ml NaHCO3-Lager hinzufügen, was ein Endvolumen von 1 L ergeben sollte. Kanamycinsulfat hinzufügen endkundiges Maß an Endkonzentration von 50 g/ml und gegossene Petrischalen mit 35 ml Medium.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Um den Golden Gate-Montage-Workflow zu demonstrieren, wurde eine Ausdruckskassette im Level 1 Position 1 (Forward) Akzeptorvektor (pICH47732) mit den folgenden Level 0-Teilen montiert: dem Promotor des C-Phycocyanin-Operons Pcpc560 (pC0.005), die Codierungssequenz für eYFP (pC0.008) und den Doppelabschlusszeichen TrrnB (pC0.082)12. Nach der Transformation der Montagereaktion wurden erfolgreiche Baugruppen mit dem Standard-Blau-Weiß-Screening von E. coli-Kolonien identifiziert (Abbildung 3). Die eYFP-Expressionskassette im Level 1-Vektor und der End-Link 1-Vektor (pICH50872) wurden dann zu einem Level T-Akzeptorvektor (pPMQAK1-T) zusammengesetzt, um dem Vektor cpcBA-eYFP (Abbildung 4A)zu geben. Der montierte cpcBA-eYFP-Vektor wurde durch Restriktionsverdauung überprüft (Abbildung 4B).

Die erfolgreiche eheliche Übertragung von cpcBA-eYFP oder dem leeren pPMQAK1-T-Vektor (d. h. eine negative Kontrolle ohne die eYFP-Expressionskassette) führte zu einem Wachstum von bis zu mehreren hundert Kolonien auf der Membran für Synechocystis PCC 6803 und S. longatus UTEX 2973 nach 7-14 Tagen bzw. 3 bis 7 Tagen(Abbildung 5). Einzelne Kolonien wurden gepflückt und auf frische BG11+Kan50 Agarplatten gestreift; 2-3 Re-Streaks waren erforderlich, um axtische Kulturen zu erzeugen.

Wie für den starken Pcpc560 Promotor51erwartet, waren die Werte für normalisierte eYFP-Fluoreszenz vom Plattenleser und die eYFP-Fluoreszenz pro Zelle aus dem Durchflusszytometer im Vergleich zur Negativkontrolle hoch(Abbildung 6 und Abbildung 7). Fluoreszenzwerte waren in S. elongatus UTEX 2973 höher als in Synechocystis PCC 680312.

Figure 1
Abbildung 1: Übersicht über den Golden Gate Montageprozess in CyanoGate. Die Montage einer Genexpressionskassette wird gezeigt, beginnend mit der Verstärkung einer Sequenz von Interesse von der Vorlagen-DNA bis zur Montage in einem Level-T-Vektor (Teile werden nicht maßstabsgetreu gezeichnet). (A) Entwurf von Vorwärts- und Rückwärtsgrundierungen zur Verstärkung eines CDS1-Teils aus Vorlagen-DNA (z. B. genomische oder Plasmid-DNA). Die Positionen der BpiI-Einschränkungsstellen und Überhänge, die für das Einfügen in den Akzeptorvektor erforderlich sind (d. h. 5 " und 3" der Vorlagensequenz), sind rot bzw. blau hervorgehoben. Der Buchstabe "n" gibt an, dass ein beliebiges NT an dieser Position verwendet werden kann. Die Glühbereiche der Primer mit der DNA-Schablone und ihren empfohlenen Schmelztemperaturen (Tm) sind angegeben. (B) Ebene 0 Baugruppe des PCR-Produkts in den Level 0 CDS1-Akzeptorvektor pICH41308. Die Sequenz, die von BpiI ausgeschnitten und in den Akzeptorvektor eingegliedert wird, wird blau hervorgehoben. (C) Ebene 1 Baugruppe einer Genexpressionskassette, die drei Level 0-Teile (Pro + 5U, CDS1 und 3U + Ter) in den Level 1 Position 1 (Vorwärts)-Akzeptorvektor pICH47732 mit BsaI enthält. (D) Ebene T Baugruppe der Ebene 1 Baugruppe und End-Link 1 (pICH50872, genannt "Level M End-link 1" in Engler et al.15) in einen Level T-Akzeptorvektor (z.B. pPMQAK1-T) mit BpiI. (E) Der endgültige montierte Level-T-Vektor. Abkürzungen: AmpR, Ampicillin-Widerstandskassette; CarbR, Carbenicillin Widerstandskassette; CDS1, Codierungssequenz in der Syntax15der Stufe 0 ; EL1, End-Link 1 Teil; KanR, Kanamycin-Widerstandskassette; lacZ,-galactosidase Ausdruckskassette; SpecR, Spectinomycin-Widerstandskassette. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 2
Abbildung 2: Eine PCR-basierte Domestizierungsstrategie für die Entfernung einer illegalen IIS-Einschränkungssite des Typs. (A) Schematisches Diagramm mit zwei Primerpaaren (in Grün bzw. Orange) zur Änderung einer BpiI-Site (GAAGAC) in GAGGAC in einer Proteinkodierungs-DNA-Sequenz, die für die Montage in den CDS1 Level 0-Akzeptorvektor (pICH41308) bestimmt ist. Beachten Sie, dass die Modifikation das Codon für Glutaminsäure (Glu) (d. h. GAA zu GAG) bewahrt. Obwohl die BpiI-Site im Rahmen mit dem Start-Codon angezeigt wird, funktioniert dieser Ansatz auch dann, wenn die Site nicht im Rahmen ist (d. h. solange die Site gestört und die Proteinsequenz erhalten bleibt). Die Positionen der BpiI-Beschränkungsstandorte und Überhänge in den Primern sind rot bzw. blau hervorgehoben. Die DNA-Vorlage und die übersetzte Proteinsequenz sind gelb hervorgehoben. Die Glühbereiche der Primer mit der DNA-Schablone und ihren empfohlenen Schmelztemperaturen (Tm) sind angegeben. Das orangefarbene Paar wird verwendet, um das 5-Zoll-Ende der Sequenz mit den Überhängen AATG und TGAA (Fragment 1) zu verstärken, während das grüne Paar verwendet wird, um das 3-Zoll-Ende mit den Überhängen TGAA und GCTT (Fragment 2) zu verstärken. Vor der Bestellung der Primer wurde die Genauigkeit des TGAA-Fusionsüberhangs für Fragment 1 und 2 sorgfältig geprüft52. Schlecht konstruierte Fusionsüberhänge können zu Einem Ausfall der Montage führen (d. h. keine Kolonien nach der Transformation; Abbildung 5) oder falsch positive (z. B. abgeschnittene oder fehlerhafte Assemblys). Letzteres kann gelöst werden, um eine größere Anzahl von weißen Kolonien zu scannen, um ein korrekt zusammengesetztes Konstrukt zu identifizieren. (B) Amplicons der Fragmente 1 und 2 nach Einschränkung mit BpiI während der Golden Gate Montage. (C) Die domestizierte Sequenz, die in den AKzeptorvektor Der Ebene 0 CDS1 zusammengesetzt ist. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 3
Abbildung 3: Blau-weißes Koloniescreening von E. coli-Wandlern nach Golden Gate-Montage. Die gezeigten Platten enthalten LB-Agar (1% [w/v]), ergänzt durch X-Gal, IPTG und Antibiotika in entsprechenden Konzentrationen. (A) Keine Kolonien, was auf eine fehlgeschlagene Montagereaktion und/oder E. coli-Transformation hindeutet. (B) Meist blaue Kolonien, was auf eine erfolgreiche Montage hindeutet, aber dass die Effizienz des in der Montagereaktion verwendeten Restriktionsenzyms gering war. (C) Meist weiße Kolonien, die auf eine typische, erfolgreiche Montagereaktion hinweisen. (D) Keine blauen Kolonien, was auf eine sehr effiziente Montage hinweist. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 4
Abbildung 4: Überprüfung eines zusammengesetzten Level-T-Vektors durch Einschränkungsverdauung. Die Vektoren wurden mit HindIII und BamHI verdaut. (A) Sequenzzuordnung des leeren pPMQAK1-T-Akzeptorvektors (CT.0) und der Ebene T-Baugruppe (cpcBA-eYFP) mit Komponenten der eYFP-Expressionskassette (Pcpc560-eYFP-TrrnB). Die Positionen der Restriktionsstandorte hinunddIII und BamHI sind angegeben. Nach der doppelten Verdauung werden die vorhergesagten Größen der DNA-Fragmente angezeigt: (1) 5.847 bp, (2) 2.004 bp, (3) 30 bp, (4) 374 bp, (5) 1.820 bp, (6) 1.289 bp und (7) 156 bp. (B) Ein Agarose-Gel (0,8% [w/v]) läuft bei 125 V für 60 min mit dem verdauten Level beladen T-Baugruppe (cpcBA-eYFP) mit den Bändern 1, 5 und 6, dem verdauten leeren pPMQAK1-T-Akzeptorvektor (CT.0) mit den Bändern 1 und 2 und einer DNA-Leiter (Materialtabelle). Beachten Sie, dass die Bänder 3, 4 und 7 zu klein waren, um sich auf dem Gel zu visualisieren. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 5
Abbildung 5: Wachstum der transgenen Synechocystis PCC 6803 Kolonien nach erfolgreicher Konjugation. Beispiele für Membranen nach inkubationsweise auf BG11+Kan50 Agarplatten werden gezeigt. (A) Überwucherung nach sehr effizienter Konjugation - die Synechocystis PCC 6803 Kolonien haben sich zu einem Rasen ohne einzelne Kolonien entwickelt. (B) Eine gute Konjugationseffizienz, die mehrere hundert einzelne Kolonien nach 12 Tagen zeigt. (C) Wachstum einer axtischen Dehnung nach 14 Tagen nach mehreren Runden des Erneutschlagens auf eine frische BG11+Kan50 Agarplatte. Das Fehlen einer bakteriellen Kontamination deutete darauf hin, dass das Synechocystis PCC 6803 Transkonjugant axenic war. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 6
Abbildung 6: Repräsentative Wachstumsdaten und normalisierte eYFP-Fluoreszenzwerte mit einem Plattenleser. (A) Wachstumsvergleich von Stämmen mit cpcBA-eYFP oder dem leeren pPMQAK1-T-Vektor (CT.0, Negativkontrolle) in Synechocystis PCC 6803 und S. elongatus UTEX 2973. Werte sind das Mittelwert von vier biologischen Replikationen. Synechocystis PCC 6803 und S. elongatus UTEX 2973 wurden für 72 h bei 30 °C mit Dauerlicht (100 mol Photonen m-2s-1) bzw. 40 °C mit 300 mol Photonen m-2s-1kultiviert. (B) Normalisierte eYFP-Fluoreszenzwerte für Synechocystis PCC 6803 oder S. elongatus UTEX 2973 konjugiert mit cpcBA-eYFP bei 72 h. Werte sind das Mittel - SE aus vier biologischen Replikationen. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 7
Abbildung 7: Repräsentative eYFP-Fluoreszenzwerte mit Hilfe eines Durchflusszytometers. (A) Vorwärts (FSC-H) und seitliches (SSC-H) Streudiagramm aus der "leeren" Mediumlösung (BG11 und PBS). (B) Streudiagramm für eine Synechocystis PCC 6803 Probe (rechts). Der Kreis zeigt die ausgewählte Region an, die die Cyanobakterienpopulation aus dem Rest des Probensignals gatingt. (C) Histogramm des gated-Bereichs für einen Stamm, der den leeren pPMQAK1-T-Vektor (CT.0, Negativkontrolle) trägt. (D) Histogramm des gated region für eine Sorte tragen cpcBA-eYFP. (E) eYFP-Fluoreszenzwerte pro Zelle in Synechocystis PCC 6803 und S. elongatus UTEX 2973 bei 72 h. Fluoreszenz von der Negativkontrolle wurde subtrahiert. Werte sind das Mittelwert von vier biologischen Replikationen. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Nein. Vektor-ID name beschreibung 5' Überhang 3' Überhang
1 pICH41233 für und wider promoter GGAG takt
2 pICH41295 Pro + 5U Veranstalter und 5-unübersetzte Region GGAG AATG
3 pAGM1251 Pro + 5U (f) Promoter und 5"unübersetzte Sequenz für N-Terminalfusionen GGAG CCAT
4 pICH41246 5U 5- und nicht übersetzte Region takt CCAT
5 pAGM1263 5U (f) 5" unübersetzte Sequenz für N-Terminal-Fusionen takt CCAT
6 pICH41246 5U + NT1 5- unübersetzte Region und N-Terminal-Codierungsbereich takt CCAT
7 pAGM1276 NT1 N Terminal-Tag oder Lokalisierungssignal CCAT AATG
8 pICH41258 Sp Signalpeptid AATG AGGT
9 pICH41258 NT2 N Terminal-Tag oder Lokalisierungssignal AATG AGGT
10 pAGM1287 CDS1 ns Codierungsregion ohne Stop-Codon AATG TTCG
11 pICH41308 CDS1-Stopp Codierungsbereich mit Stop-Codon AATG GCTT
12 pAGM1299 CDS2 ns Codierungsbereich - ohne Start- und Stopp-Codon AGGT TTCG
13 pICH41264 CDS2-Stopp Codierungsbereich - ohne Start und mit Stop Codon AGGT GCTT
14 pAGM1301 Ct C-Terminal-Tag oder Lokalisierungssignal TTCG GCTT
15 pICH53388 3u 3- und nicht übersetzte Region GCTT GGTA
16 pICH53399 Ter Terminator GGTA CGCT
17 pICH41276 3U + Ter 3- unübersetzte Region und Terminator GCTT CGCT
18 pICH41331 Cgm Akzeptor für komplette Genkassetten GGAG CGCT
19 pCA0.002 Pro (niedrige Kopie) Promoter, Low Copy Number Acceptor (pSC101 ori) GGAG takt
20 pCA0.001 Pro TSS Promoter auf die Transkriptionsstartseite abgeschnitten GGAG TAGC
21 Direkt zur Stufe 1 srRNA Kleine regulatorische RNA (für translationales Silencing) TAGC GTTT
22 Direkt zur Stufe 1 sgRNA Single Guide RNA (für CRISPRi) TAGC GTTT
23 pICH41295 UP FLANK Flanking-Sequenz vor der homologen Rekombinationsstelle des Ziels GGAG AATG
24 pICH41276 DOWN FLANKE Flanking-Sequenz nach dem Ziel homologe Rekombinationsstelle GCTT CGCT

Tabelle 1: Eine Liste der verfügbaren Akzeptorvektoren und Überhänge der Stufe 0. Vektoren 1-18 sind aus dem Plant MoClo Kit15. Vektoren 19-22 sind aus dem CyanoGate Kit12. Für srRNA- und sgRNA-Teile werden synthetisierte Sequenzen oder PCR-Produkte direkt zu Level 1-Akzeptorvektoren zusammengefügt. Die Vektoren 23-24 stammen aus dem Plant MoClo Kit, die mit dem CyanoGate-Kit für die Transformation durch homologe Rekombination umfunktioniert wurden.

BpiI-Montagekomponenten (Ebene 0, T) BsaI Montagekomponenten (Stufe 1)
50 bis 100 ng Akzeptorvektor 50 bis 100 ng Akzeptorvektor
Verwenden Sie für jeden einzufügenden Vektor/Teil ein 2:1-Verhältnis von insert: acceptor vector. Verwenden Sie für jeden einzufügenden Vektor/Teil ein 2:1-Verhältnis von insert: acceptor vector.
2 l 10 mM ATP (Materialtabelle) 2 l 10 mM ATP (Materialtabelle)
2 L Puffer G (Puffer für BpiI/BsaI) 2 L Puffer G (Puffer für BpiI/BsaI)
2 L BSA (10x) (Materialtabelle) 2 L BSA (10x) (Materialtabelle)
10 Stück BpiI (1 L10 U/L BpiI, Materialtabelle) 10 Stück BsaI (1 l 10 U/L BsaI, Materialtabelle)
Mit dH2O auf 20 l bringen. Mit dH2O auf 20 l bringen.
200 Stück T4 DNA-Ligase (1 l 200 U/l, Materialtabelle) 200 Stück T4 DNA-Ligase (1 l 200 U/l, Materialtabelle)
Thermocycler-Protokoll (Stufe 0, T) Thermocycler-Protokoll (Stufe 1)
37 °C für 10 min Zyklus x 5 37 °C für 10 min Zyklus x 5
16 °C für 10 min 16 °C für 10 min
37 °C für 20 min 37 °C für 20 min
65 °C für 10 min 65 °C für 10 min
16 °C (halten) 16 °C (halten)

Tabelle 2: Protokolle für Golden Gate-Baugruppen in den Stufen 0, 1 und T. Die Baugruppe in Level 0 und Level T Acceptor-Vektoren verwendet das Restriktionsenzym BpiI (links). Die Montage in Akzeptorvektoren der Stufe 1 verwendet das Restriktionsenzym BsaI (rechts). Diese Tabelle wurde von Vasudevan et al.12adaptiert.

Primer Nr. Sequenz (5'-3') Länge (bp) beschreibung
L0T vorwärts GTCTCTCTGAGCGGATACATA
TTTGAATG
28 Zur Verstärkung von Stufe 0 und Stufe T
L1 rückwärts GAACCCTGTGGTTGGCATGC
ACATAC
26 Zur Verstärkung ab Stufe 1
L1 vorwärts CTGGTGGCAGGATATTGT
GGTG
24 Zur Verstärkung ab Stufe 1
L0T rückwärts TTGAGTGAGCTGATACCGCT 20 Zur Verstärkung von Stufe 0 und Stufe T

Tabelle 3: Liste der Primer zur PCR-Validierung oder Sequenzierung von Vektoren der Stufen 0, 1 und T.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Golden Gate Montage hat mehrere Vorteile im Vergleich zu anderen Vektor-Montage-Methoden, vor allem in Bezug auf Skalierbarkeit20,21. Dennoch erfordert die Einrichtung des Golden Gate-Systems in einem Labor Zeit, um eine Vertrautheit mit den verschiedenen Teilen und Akzeptor-Vektorbibliotheken und gesamten Montageprozessen zu entwickeln. Für komplexere Baugruppen oder bei der parallelen Ausführung einer großen Anzahl komplexer Baugruppen (z. B. beim Erstellen einer Reihe von Level-T-Vektoren, die mehrere Genexpressionskassetten enthalten) ist häufig eine sorgfältige Planung erforderlich. Wir empfehlen, zunächst alle erforderlichen Kombinationen von Genexpressionskassetten aufzulisten und dann den Workflow von Level 0 zu Level T in Silico zu zuordnen. Dabei sollten Benutzer die im Plant MoClo Kit verfügbaren "Dummy"-Teile der Stufe 1 berücksichtigen, die die Montage nicht-sequentieller Level-1-Vektoren in Level T ermöglichen (z. B. können Level 1 Position 1 und Position 3 Vektoren zusammen mit dem "Dummy"-Teil montiert werden. Stufe 1 Position 2), die die Gesamtzahl der Montagereaktionen und Klonschritte reduzierenkann, die 15erforderlich sind.

Die DNA-Synthese ist in der Regel die einfachste Methode zum Erstellen neuer Level 0-Teile. Wenn jedoch klonen (z. B. aus Plasmiden oder genomischer DNA) erforderlich ist, ist die Optimierung des Designs der für die Amplifikation verwendeten Primer wichtig, um die Effizienz der nachfolgenden Level 0-Vektorbaugruppe zu maximieren. Die beiden wichtigsten Schritte im Primer-Design sind: 1) Überprüfung, ob die richtigen Überhänge enthalten sind und sich in der entsprechenden Ausrichtung für die Vorwärts- und Rückwärtsgrundierungen befinden(Abbildung 1 und Tabelle 1), und 2), um sicherzustellen, dass die Länge des Primers Sequenz, die der Vorlage ausreichend lang ist (18 x 30 bp) und dass der Tm-Wert für diese Sequenz (idealerweise 58 x 62 °C) für das Primerpaar ähnlich ist (Abbildung 1A). Wenn eine Sequenz Domestizierung erfordert, stehen mehrere Strategien zur Verfügung. Für kurze Sequenzen (z.B. <200 bp) kann ein Paar lang seit vorne und rückwärts gerichtete Primer entworfen werden, in denen die 3-A-Enden anneal zueinander (d.h. eine Überlappung von >20 bp) und nach der Verstärkung eine doppelsträngige Sequenz bilden. Bei längeren Sequenzen können separate Fragmente der Sequenz verstärkt werden, die illegale Einschränkungssites entfernen und dann mithilfe eines Golden Gate-Montageansatzes zusammengebaut werden (Abbildung 2). Wenn die Baugruppeneffizienz mit PCR-Produkten schlecht ist, können einzelne Fragmente einer Level 0-Sequenz in den universellen Akzeptorvektor der Stufe 1 (pAGM1311) geklont, validiert und dann in den entsprechenden Level 0-Akzeptorvektor15zusammengefügt werden. Für eine effiziente Golden Gate-Montage wird ein 2:1 Insert:Acceptor-Vektor-Molarenverhältnis empfohlen. Bei Baugruppen mit nur 2-3 Vektoren (z. B. zwei Level-0-Teile und einem Akzeptanzvektor der Ebene 1) führt die Kombination von jeweils 100 ng jedoch in der Regel zu erfolgreichen Baugruppen. Die Effizienz von Baugruppen nimmt tendenziell ab, wenn die Anzahl der pro Reaktion verwendeten Vektoren zunimmt, was zu einer Verringerung der Gesamtzahl der weißen Kolonien nach der Transformation führt (Abbildung 3).

Vor der Konjugation wird die Validierung von finalisierten Level-T-Vektoren durch Restriktionsverdauung und PCR empfohlen. Der wechselale DNA-Transfer ist eine gut gestochene Technik für cyanobakterielle Stämme, einschließlich derer, die nicht natürlich transformierbar sind41,45. Wichtige Schritte im Konjugationsprotokoll sind: 1) sorgfältiger Umgang mit dem Helfer E. coli-Stamm nach dem über Nacht Wachstum (z.B. Vermeiden von Wirbeln)35, 2) unter der Sorgfalt, um vollständig Spuren der Antibiotika zu entfernen, die verwendet werden, um Helfer zu wachsen und Fracht E. coli-Stämme, 3) eine angemessene Inkubationszeit für das Gemisch von Ladungs- und Hilfsstämmen und Cyanobakterien (z. B. eine längere Inkubationszeit war für S. elongatus UTEX 2973) und 4) die anfängliche Transferzeit der Zelle Mischung auf Membranen in LB-BG11 Agarplatten ohne Antibiotika für 24 h.

Isolierte cyanobakterielle Kolonien sollten sich auf der Membran innerhalb von zwei Wochen für Synechocystis PCC 6803 und S. elongatus UTEX 2973 entwickeln, sonst ist es wahrscheinlich, dass die Konjugation fehlgeschlagen ist. Mehrere Modifikationen des Protokolls konnten dann getestet werden, darunter 1) mit einer cyanobakteriellen Kultur mit einer höheren Startdichte (z. B. OD750 = 1,5-2); 2) Erhöhung der Inkubationszeit vor der Übertragung auf die Membran; und 3) Verlängerung der anfänglichen Inkubationszeit auf der Membran von 24 h auf 48 h (d. h., um mehr Zeit für die Expression des Antibiotikaresistenzgens auf dem übertragenen Vektor zu lassen). Wenn die Konjugation immer noch fehlschlägt, könnten alternative Methoden wie Elektroporation ausprobiert werden53. Die Bestätigung eines transgenen cyanobakteriellen Stammes ist axenic ist wichtig vor weiteren Experimenten. Schließlich ist es eine gute Praxis, die Größe des heterologen Vektors im transgenen cyanobakteriellen Stamm zu bestätigen. Letzteres erfordert DNA-Extraktion (Abschnitt 5), Umwandlung in E. coli und Selektion (Abschnitt 2.1) und Vektorvalidierung (Abschnitt 2.4).

Das skizzierte Promotorcharakterisierungsprotokoll verwendet kleine Kulturvolumina (d. h. 2 ml) als Mittel zur Erreichung einer Screening-Methodik mit hohem Durchsatz. Je nach verfügbarem Photobioreaktorraum könnten größere Volumina verwendet werden, was dazu beitragen würde, Probleme mit der Kulturverdunstung zu mildern. Wenn ein Hochdurchsatz-Screening mit kleinen Kulturvolumina erforderlich ist, ist es wichtig, eine hohe Luftfeuchtigkeit in der Wachstumskammer zu haben, um die Verdunstung zu hemmen. Die Verdunstung während eines Wachstumsexperiments kann die Genauigkeit und Gültigkeit von Probenmessungen beeinträchtigen. Überprüfen Sie die Kulturvolumina während und nach dem Experiment, um zu bestätigen, wie viel Verdunstung aufgetreten ist.

Bei Plattenlesermessungen ist es wichtig, Kulturen bei niedrigen Dichten, idealerweise OD750 < 1, zu messen, um die Erfassung zuverlässiger und reproduzierbarer Wachstums- und Fluoreszenzdaten zu gewährleisten. Eine lineare Beziehung zwischen Zellnummer und OD750 wird nur innerhalb eines bestimmten Bereichsbeobachtet 54. Um diesen Bereich zu ermitteln, empfehlen wir die Durchführung einer seriellen Verdünnung (z. B. von OD750 = 0,1 x 1,0) unter Verwendung eines bekannten Transformants, bei dem die eYFP-Fluoreszenz bestätigt wurde. Die Darstellung der absoluten Fluoreszenz gegen normalisierte Fluoreszenz (eYFP fluorescence/OD750) wird dazu beitragen, den linearen Arbeitsbereich von Kulturdichten zu identifizieren. Mehrere Plattenleser verfügen über eine "Gain"-Funktion, um die Empfindlichkeit des Fluoreszenzdetektors zu ändern. In diesem Fall sollte der Gain-Wert vor Beginn des Experiments auf ein angemessenes Niveau festgelegt und nicht zwischen verschiedenen experimentellen Durchläufen geändert werden, da die Daten nicht direkt vergleichbar sind.

Obwohl der Betrieb verschiedener Durchflusszytometer von Hersteller zu Hersteller variieren wird, ist es wichtig, eine leere Lesart der Medium-Lösung zu nehmen, um die Identifizierung und Gating der Zielcyanobakterienpopulation von jedem Hintergrundsignal in das Medium (Abbildung 7A,B). Danach wird die Subtraktion des Fluoreszenzwerts der negativen Kontrollprobe (z. B. ein Wildtypstamm) dazu beitragen, die native Autofluoreszenz zu entfernen (Abbildung 7C,D). Der Photomultiplier-Rohr-Spannungsparameter (PMT) in einem Durchflusszytometer hat eine ähnliche Funktion wie die Verstärkung in einem Plattenleser, d.h. die Erhöhung oder Verringerung der Empfindlichkeit des Detektors auf die Intensität des Fluoreszenzsignals. Wie beim Plattenleser sollte die PMT-Spannung vor Beginn des Experiments55auf ein entsprechendes Niveau eingestellt werden. Einmal eingestellt, sollte der PMT-Spannungswert zwischen verschiedenen Experimentellen Durchläufen beibehalten werden, oder die Daten sind nicht direkt vergleichbar.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts zu verraten.

Acknowledgments

Die Autoren danken dem PHYCONET Biotechnology and Biological Sciences Research Council (BBSRC) Network in Industrial Biotechnology and Bioenergy (NIBB) und dem Industrial Biotechnology Innovation Centre (IBioIC) für die finanzielle Unterstützung. GARG, AASO und AP würdigen die finanzielle Unterstützung aus dem BBSRC EASTBIO CASE PhD-Programm (Grant-Nummer BB/M010996/1), dem Consejo Nacional de Ciencia y Tecnologa (CONACYT) PhD-Programm und dem IBioIC-BBSRC Collaborative Training Partnership (CTP) PhD-Programm, in dieser reihenfolge. Wir danken Conrad Mullineaux (Queen Mary University of London) und Poul Eric Jensen und Julie Annemarie Zita Zedler (Universität Kopenhagen) für Plasmidvektor- und Protokollbeiträge und Beratung.

Materials

Name Company Catalog Number Comments
5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal) Thermo Fisher Scientific R0404 Used in 2.1.3.
Adenosine 5′-triphosphate (ATP) disodium salt Sigma-Aldrich A2383 Used in Table 2.
Agar (microbiology tested) Sigma-Aldrich A1296-500g Used in 8.3.
Agarose Bioline BIO-41026 Used in 6.
Attune NxT Flow Cytometer Thermo Fisher Scientific - Used in 4.3.1.
Bovine Serum Albumin (BSA) Sigma-Aldrich A2153 Used in Table 2.
BpiI (BbsI) Thermo Fisher Scientific ER1011 Used in Table 2.
BsaI (Eco31I) Thermo Fisher Scientific ER0291 Used in Table 2.
Carbenicillin disodium VWR International A1491.0005 Used in 2.1.3.
Corning Costar TC-Treated flat-bottom 24 well plates Sigma-Aldrich CLS3527 Used in 4.1.3.
Dimethyl Sulfoxide (DMSO) Thermo Fisher Scientific BP231-100 Used in 3.6.2.
DNeasy Plant Mini Kit Qiagen 69104 DNA extraction kit. Used in 5.
FLUOstar Omega Microplate reader BMG Labtech - Used in 4.2.2.
GeneJET Plasmid Miniprep Kit Thermo Fisher Scientific K0503 Plasmid purification kit. Used in step 2.3.2.
Glass beads (0.5 mm diameter) BioSpec Products 11079105 Used in 5.2.
Glycerol Thermo Fisher Scientific 10021083 Used in 2.3.1, 3.6.2.
Isopropyl-beta-D-thiogalactopyranoside (IPTG) Thermo Fisher Scientific 10356553 Used in 2.1.3.
Kanamycin sulphate (Gibco) Thermo Fisher Scientific 11815-024 Used in 2.1.3.
Membrane filters (0.45 μm) MF-Millipore HAWP02500 Used in 3.3.7
Microplates, 96-well, flat-bottom (Chimney Well) µCLEAR Greiner Bio-One 655096 Used in 4.2.1.
Monarch DNA Gel Extraction Kit New England Biolabs T1020S Used in 1.1.2.2.
Monarch PCR DNA Cleanup Kit New England Biolabs T1030 DNA purification kit. Used in 1.1.2.3.
Multitron Pro incubator with LEDs Infors HT - Shaking incubator with white LED lights. Used in 4.1.4.
MyTaq DNA Polymerase Bioline BIO-21108 Used in 7.1.
NanoDrop One Thermo Fisher Scientific ND-ONE-W Used in 2.3.3.
One Shot TOP10 chemically competent E. coli Thermo Fisher Scientific C404010 Used in 2.1.1.
Phosphate buffer saline (PBS) solution (10X concentrate) VWR International K813 Used in 4.3.2.
Q5High-Fidelity DNA Polymerase New England Biolabs M0491S Used in 1.1.2.1.
Quick-Load 1 kb DNA Ladder New England Biolabs N0468S Used in Figure 4.
Screw-cap tubes (1.5 ml) Starstedt 72.692.210 Used in 3.6.3
Spectinomycin dihydrochloride pentahydrate VWR International J61820.06 Used in 2.1.3.
Sterilin Clear Microtiter round-bottom 96-well plates Thermo Fisher Scientific 612U96 Used in 4.3.1.
T4 DNA ligase Thermo Fisher Scientific EL0011 Used in Table 2.
TissueLyser II Qiagen 85300 Bead mill. Used in 5.2.

DOWNLOAD MATERIALS LIST

References

  1. Luan, G., Lu, X. Tailoring cyanobacterial cell factory for improved industrial properties. Biotechnology Advances. 36, (2), 430-442 (2018).
  2. Madsen, M. A., Semerdzhiev, S., Amtmann, A., Tonon, T. Engineering mannitol biosynthesis in Escherichia coli and Synechococcus sp. PCC 7002 using a green algal fusion protein. ACS Synthetic Biology. 7, (12), 2833-2840 (2018).
  3. Menin, B., et al. Non-endogenous ketocarotenoid accumulation in engineered Synechocystis sp. PCC 6803. Physiologia Plantarum. 166, (1), 403-412 (2019).
  4. Varman, A. M., Yu, Y., You, L., Tang, Y. J. Photoautotrophic production of D-lactic acid in an engineered cyanobacterium. Microbial Cell Factories. 12, (1), 1-8 (2013).
  5. Vavitsas, K., et al. Responses of Synechocystis sp. PCC 6803 to heterologous biosynthetic pathways. Microbial Cell Factories. 16, 140 (2017).
  6. Yang, G., et al. Photosynthetic production of sunscreen shinorine using an engineered cyanobacterium. ACS Synthetic Biology. 7, (2), 664-671 (2018).
  7. Nielsen, A. Z., et al. Extending the biosynthetic repertoires of cyanobacteria and chloroplasts. Plant Journal. 87, (1), 87-102 (2016).
  8. Nielsen, J., Keasling, J. D. Engineering cellular metabolism. Cell. 164, (6), 1185-1197 (2016).
  9. Stensjö, K., Vavitsas, K., Tyystjärvi, T. Harnessing transcription for bioproduction in cyanobacteria. Physiologia Plantarum. 162, (2), 148-155 (2018).
  10. Santos-Merino, M., Singh, A. K., Ducat, D. C. New applications of synthetic biology tools for cyanobacterial metabolic engineering. Frontiers in Bioengineering and Biotechnology. 7, 1-24 (2019).
  11. Lea-Smith, D. J., Vasudevan, R., Howe, C. J. Generation of marked and markerless mutants in model cyanobacterial species. Journal of Visualized Experiments. 111, e54001 (2016).
  12. Vasudevan, R., et al. CyanoGate: A modular cloning suite for engineering cyanobacteria based on the plant MoClo syntax. Plant Physiology. 180, (1), 39-55 (2019).
  13. Andreou, A. I., Nakayama, N. Mobius assembly: A versatile golden-gate framework towards universal DNA assembly. PLoS ONE. 13, (1), 1-18 (2018).
  14. Crozet, P., et al. Birth of a Photosynthetic Chassis: A MoClo toolkit enabling synthetic biology in the microalga Chlamydomonas reinhardtii. ACS Synthetic Biology. 7, (9), 2074-2086 (2018).
  15. Engler, C., et al. A Golden Gate modular cloning toolbox for plants. ACS Synthetic Biology. 3, (11), 839-843 (2014).
  16. Moore, S. J., et al. EcoFlex: A multifunctional MoClo kit for E. coli synthetic biology. ACS Synthetic Biology. 5, (10), 1059-1069 (2016).
  17. Pollak, B., et al. Loop assembly: a simple and open system for recursive fabrication of DNA circuits. New Phytologist. 222, (1), 628-640 (2019).
  18. Werner, S., Engler, C., Weber, E., Gruetzner, R., Marillonnet, S. Fast track assembly of multigene constructs using golden gate cloning and the MoClo system. Bioengineered Bugs. 3, (1), 38-43 (2012).
  19. Patron, N. J., et al. Standards for plant synthetic biology: a common syntax for exchange of DNA parts. New Phytologist. 208, (1), 13-19 (2015).
  20. Chao, R., Mishra, S., Si, T., Zhao, H. Engineering biological systems using automated biofoundries. Metabolic Engineering. 42, 98-108 (2017).
  21. Chambers, S., Kitney, R., Freemont, P. The Foundry: the DNA synthesis and construction Foundry at Imperial College. Biochemical Society Transactions. 44, (3), 687-688 (2016).
  22. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  23. Rosano, G. L., Ceccarelli, E. A. Rare codon content affects the solubility of recombinant proteins in a codon bias-adjusted Escherichia coli strain. Microbial Cell Factories. 8, 1-9 (2009).
  24. Cambray, G., et al. Measurement and modeling of intrinsic transcription terminators. Nucleic Acids Research. 41, (9), 5139-5148 (2013).
  25. Chen, Y. J., et al. Characterization of 582 natural and synthetic terminators and quantification of their design constraints. Nature Methods. 10, (7), 659-664 (2013).
  26. Münch, R., et al. Virtual Footprint and PRODORIC: An integrative framework for regulon prediction in prokaryotes. Bioinformatics. 21, (22), 4187-4189 (2005).
  27. Salis, H. M., Mirsky, E. A., Voigt, C. A. Automated design of synthetic ribosome binding sites to control protein expression. Nature Biotechnology. 27, (10), 946-950 (2009).
  28. Englund, E., Liang, F., Lindberg, P. Evaluation of promoters and ribosome binding sites for biotechnological applications in the unicellular cyanobacterium Synechocystis sp. PCC 6803. Scientific Reports. 6, 36640 (2016).
  29. Heidorn, T., et al. Synthetic biology in cyanobacteria engineering and analyzing novel functions. Methods in Enzymology. 497, 539-579 (2011).
  30. Thiel, K., et al. Translation efficiency of heterologous proteins is significantly affected by the genetic context of RBS sequences in engineered cyanobacterium Synechocystis sp. PCC 6803. Microbial Cell Factories. 17, 34 (2018).
  31. Liu, Q., Schumacher, J., Wan, X., Lou, C., Wang, B. Orthogonality and burdens of heterologous and gate gene circuits in E. coli. ACS Synthetic Biology. 7, (2), 553-564 (2018).
  32. Ferreira, E. A., et al. Expanding the toolbox for Synechocystis sp. PCC 6803: Validation of replicative vectors and characterization of a novel set of promoters. Synthetic Biology. (August), 1-39 (2018).
  33. Liang, F., Lindblad, P. Synechocystis PCC 6803 overexpressing RuBisCO grow faster with increased photosynthesis. Metabolic Engineering Communications. 4, 29-36 (2017).
  34. Taton, A., et al. Broad-host-range vector system for synthetic biology and biotechnology in cyanobacteria. Nucleic Acids Research. 42, (17), e136 (2014).
  35. Elhai, J., Wolk, C. P. Conjugal transfer of DNA to cyanobacteria. Methods in Enzymology. 167, (1984), 747-754 (1988).
  36. Gormley, E. P., Davies, J. Transfer of plasmid RSF1010 by conjugation from Escherichia coli to Streptomyces lividans and Mycobacterium smegmatis. Journal of Bacteriology. 173, (21), 6705-6708 (1991).
  37. Huang, H. H., Camsund, D., Lindblad, P., Heidorn, T. Design and characterization of molecular tools for a synthetic biology approach towards developing cyanobacterial biotechnology. Nucleic Acids Research. 38, (8), 2577-2593 (2010).
  38. Huang, H. H., Lindblad, P. Wide-dynamic-range promoters engineered for cyanobacteria. Journal of Biological Engineering. 7, 10 (2013).
  39. Li, S., Sun, T., Xu, C., Chen, L., Zhang, W. Development and optimization of genetic toolboxes for a fast-growing cyanobacterium Synechococcus elongatus UTEX 2973. Metabolic Engineering. 48, 163-174 (2018).
  40. Pansegrau, W., Balzer, D., Kruft, V., Lurz, R., Lanka, E. In vitro assembly of relaxosomes at the transfer origin of plasmid RP4. Proceedings of the National Academy of Sciences, USA. 87, (17), 6555-6559 (1990).
  41. Song, K., Tan, X., Liang, Y., Lu, X. The potential of Synechococcus elongatus UTEX 2973 for sugar feedstock production. Applied Microbiology and Biotechnology. 100, (18), 7865-7875 (2016).
  42. Waters, V. L., Guiney, D. G. Processes at the nick region link conjugation, T-DNA transfer and rolling circle replication. Molecular Microbiology. 9, (6), 1123-1130 (1993).
  43. Elhai, J., Vepritskiy, A., Muro-Pastor, A. M., Flores, E., Wolk, C. P. Reduction of conjugal transfer efficiency by three restriction activities of Anabaena sp. strain PCC 7120. Journal of Bacteriology. 179, (6), 1998-2005 (1997).
  44. Silva-Rocha, R., et al. The Standard European Vector Architecture (SEVA): A coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research. 41, (D1), D666-D675 (2013).
  45. Mandakovic, D., et al. CyDiv, a conserved and novel filamentous cyanobacterial cell division protein involved in septum localization. Frontiers in Microbiology. 7, (FEB), 1-11 (2016).
  46. Masukawa, H., Inoue, K., Sakurai, H., Wolk, C. P., Hausinger, R. P. Site-directed mutagenesis of the Anabaena sp. strain PCC 7120 nitrogenase active site to increase photobiological hydrogen production. Applied and Environmental Microbiology. 76, (20), 6741-6750 (2010).
  47. Yu, J., et al. Synechococcus elongatus UTEX 2973, a fast growing cyanobacterial chassis for biosynthesis using light and CO2. Scientific Reports. 5, (1), 8132 (2015).
  48. Ungerer, J., Wendt, K. E., Hendry, J. I., Maranas, C. D., Pakrasi, H. B. Comparative genomics reveals the molecular determinants of rapid growth of the cyanobacterium Synechococcus elongatus UTEX 2973. Proceedings of the National Academy of Sciences, USA. 115, (50), E11761-E11770 (2018).
  49. Lepesteur, M., Martin, J. M., Fleury, A. A comparative study of different preservation methods for phytoplankton cell analysis by flow cytometry. Marine Ecology Progress Series. 93, (1-2), 55-63 (1993).
  50. Day, J. G. Cryopreservation of cyanobacteria. Cyanobacteria: An Economic perspective. Wiley Blackwell. New York. 319-327 (2014).
  51. Zhou, J., et al. Discovery of a super-strong promoter enables efficient production of heterologous proteins in cyanobacteria. Scientific Reports. 4, 4500 (2014).
  52. Potapov, V., et al. Comprehensive profiling of four base overhang ligation fidelity by T4 DNA ligase and application to DNA assembly. ACS Synthetic Biology. 7, (11), 2665-2674 (2018).
  53. Ravindran, C. R. M., Suguna, S., Shanmugasundaram, S. Electroporation as a tool to transfer the plasmid pRL489 in Oscillatoria MKU 277. Journal of Microbiological Methods. 66, 174-176 (2006).
  54. Stevenson, K., McVey, A. F., Clark, I. B. N., Swain, P. S., Pilizota, T. General calibration of microbial growth in microplate readers. Scientific Reports. 6, 38828 (2016).
  55. Maecker, H. T., Trotter, J. Flow cytometry controls, instrument setup, and the determination of positivity. Cytometry Part A. 69, (9), 1037-1042 (2006).
Genetische Modifikation von Cyanobakterien durch Konjugation mit dem CyanoGate Modular Cloning Toolkit
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Gale, G. A. R., Schiavon Osorio, A. A., Puzorjov, A., Wang, B., McCormick, A. J. Genetic Modification of Cyanobacteria by Conjugation Using the CyanoGate Modular Cloning Toolkit. J. Vis. Exp. (152), e60451, doi:10.3791/60451 (2019).More

Gale, G. A. R., Schiavon Osorio, A. A., Puzorjov, A., Wang, B., McCormick, A. J. Genetic Modification of Cyanobacteria by Conjugation Using the CyanoGate Modular Cloning Toolkit. J. Vis. Exp. (152), e60451, doi:10.3791/60451 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter