Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

시안게이트 모듈형 복제 툴킷을 사용하여 컨쥬게이션에 의한 시아노박테리아의 유전자 변형

doi: 10.3791/60451 Published: October 31, 2019
* These authors contributed equally

Summary

여기서, 우리는 i) CyanoGate 모듈식 클로닝 툴킷을 사용하여 자가 복제 벡터를 조립하는 방법을 설명하는 프로토콜을 제시하고, ii) 컨쥬게이션에 의해 시아노박테리아 숙주에 벡터를 도입하고, iii) 형질전환 시아노박테리아 균주를 특성화한다. 플레이트 리더 또는 유세포 분석.

Abstract

시아노박테리아는 유용한 산업 상품의 재생 가능한 생산을 위해 유전자 변형될 수 있는 원핵광합성 생물의 다양한 그룹입니다. 합성 생물학의 최근 발전은 CyanoGate와 같은 여러 복제 도구 키트의 개발로 이어졌다, 시아노 박테리아로 후속 변환 또는 부부 전달을위한 플라스 미드 벡터를 구축하기위한 표준화 모듈 형 복제 시스템. 여기서 우리는 자가 복제 벡터(예를 들어, 형광 마커 발현 카세트를 운반)를 조립하기 위한 상세한 방법과 시아노박테리아 균주 시네코시스티스 sp. PCC 6803 또는 Synechococcus로 벡터의 부부 전달을 설명한다. elongatus UTEX 2973. 또한, 플레이트 리더 또는 유세포측정법을 사용하여 유전적 부분(예를 들어, 프로모터)의 성능을 특성화하는 방법을 간략하게 설명한다.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

시아노박테리아는 다양한 자연및 이종성 고부가가치 대사산물의 생합성에 사용될 수 있는 자가영양균으로1,2,3,4,5, 6. 몇몇 장애물은 여전히 그들의 상업적 생존가능성을 확장하기 위하여 극복될 필요가 있고, 특히, 이종 영양바이오 플랫폼(예를 들어, 대장균 및 효모)에 비해 상대적으로 가난한 수율은7. 최근 사용 가능한 유전 공학 도구의 확장과 시아노박테리아 연구에서 합성 생물학 패러다임의 섭취는 이러한 과제를 극복하고 효율적인 바이오 팩토리로서 시아노박테리아를 더욱 발전시키는 데 도움이 되고 있다8, 9,10.

시아노박테리아에 DNA를 도입하기 위한 주요 접근법은 형화, 이형 및 전기 천공입니다. 변형 또는 전기 천공에 의해 시아노박테리아로 전달된 벡터는 "자살" 벡터(즉, 상동 재조합을 용이하게 하는 통합 벡터)이며, 자가 복제 벡터는 시아노박테리아로 전달될 수 있습니다. 변환, 컨쥬게이션 또는 전기 천공. 전자의 경우, 프로토콜은 자연변환(11)에대한 엔지니어링 모델 종에 사용할 수 있다. 최근에는 시아노게이트(CyanoGate)라고 불리는 시아노박테리아용 모듈식 클론(MoClo) 툴킷이 자연변환, 전기화 또는컨쥬게이션(12)을이용한 엔지니어링을 위한 표준화된 골든 게이트 벡터 어셈블리 방법을 채택하는 것이 개발되었다.

골든 게이트 형 조립 기술은 최근 몇 년 동안 점점 더 인기를 끌고있다, 조립 표준 및 부품 라이브러리는 유기체의 다양한 사용할 수 있습니다13,14,15,16 ,17. 골든 게이트는 유형 IIS 제한 효소 (예를 들어, BsaI, BpiI, BsmBI, BtgZI 및 AarI)와 수용자 및 독특한 오버행을 사용하여 "하나의 냄비"어셈블리 반응에서 여러 서열의 방향 계층 적 조립을 용이하게합니다. 유형 IIS 제한 효소는 독특한 비대칭 서열을 인식하고 인식 부위로부터 정의된 거리를 절단하여 지그재그, "끈적끈적한 끝" 컷(전형적으로 4개의 뉴클레오티드 [NT] 오버행)을 생성하며, 이는 이후에 주문된 DNA를 구동하기 위해 악용될 수 있다. 어셈블리 반응15,18. 이는 PhytoBricks 표준19와같은 일반적인 구문으로 정의된 모듈식 레벨 0 부품(예: 프로모터, 오픈 판독 프레임 및 종기)의 대규모 라이브러리의 개발을 용이하게 하였다. 레벨 0 부품은 레벨 1 식 카세트로 쉽게 조립될 수 있으며, 이어서 보다 복잡한 고차 어셈블리(예를 들어, 다중 유전자 발현 구문)는 선택12,15의수락기 벡터로 구축될 수 있다. 골든 게이트 형 조립 기술의 주요 장점은 DNA 파운드리20,21과같은 고처리량 시설에서 자동화할 수 있는 편의성으로 복잡한 실험 설계를 테스트할 수 있다는 점입니다. 수동 노동으로 쉽게 달성 할 수 없습니다.

CyanoGate는 확립 된 식물 MoClo 시스템12,15에구축합니다. CyanoGate에 새로운 부품을 통합하려면 부품 시퀀스를 먼저 길들여야 합니다( 즉, BsaI 및 BpiI에 대한 "불법" 인식 사이트)를 제거해야 합니다. 개방 된 판독 프레임 (즉, 코딩 시퀀스, CDS)에 대한 부품 코딩의 경우, 인식 사이트는 서열에서 동의어 돌연변이를 생성함으로써 중단 될 수 있습니다 (즉, 동일한 아미노산 잔류물을 코딩하는 대안으로 코돈 변경). 이는 GIBSON어셈블리(22)와같은 DNA 합성에서 폴리머라제 연쇄 반응(PCR) 증폭 기반 전략에 이르는 다양한 접근법에 의해 달성될 수 있다. 사용되는 발현 숙주에 따라,번역(23)의효율성을 저해할 수 있는 희귀 코돈의 도입을 피하기 위해 주의를 기울여야 한다. 프로모터 및 터미네이터 서열에서 인식 사이트를 제거하는 것은 일반적으로 수정이 기능에 영향을 줄 수 있고 부품이 예상대로 작동하지 않을 수 있기 때문에 더 위험한 노력입니다. 예를 들어, 프로모터 내의 가용 전사 인자 결합 부위 또는 리보솜 결합 부위에 대한 변화는 유도/억압에 대한 강도 및 반응성을 변화시킬 수 있다. 마찬가지로, 주요 터미네이터 구조적 특징(예를 들어, GC 리치 스템, 루프 및 폴리-U 테일)에 대한 변형은 종결 효율 및 효과 유전자발현(24,25)을변경할 수 있다. 여러 온라인 리소스가 프로모터 및 터미네이터 서열의 활성을 예측하고 제안된 돌연변이가 성능26,27에영향을 미치는지 여부를 알려주는 데 사용할 수 있지만, 이러한 도구는 종종 예측하기가 좋지 않습니다. 시아노 박테리아28,29,30. 따라서 변형된 부품의 생체 내 특성화는 여전히 활성을 확인하는 것이 좋습니다. 리칼시트 서열의 복제를 돕기 위해, CyanoGate는 BioBrick 벡터 pSB4K512,16,31에기초한 낮은 카피 클로닝 클로닝 수용자 벡터를 포함한다. 또한 에든버러 게놈 주조를 통해 벡터 디자인(dab.genomefoundry.org)을 통해 "설계 및 빌드" 포털을 사용할 수 있습니다. 마지막으로, 가장 중요한 것은, CyanoGate는 자살 벡터를 사용하여 시아노박테리아에 DNA를 도입하기 위한 2개의 레벨 T 수용자 벡터 설계(레벨 2 수용자 벡터에해당)(15) 또는 자가 복제가 가능한 광범위한 숙주 범위 벡터를 포함한다는 것입니다. 여러 시아노 박테리아 종32,33,34.

여기서 우리는 레벨 T 자가 복제 벡터를 생성하기 위한 프로토콜을 설명하고 Synechocystis PCC 6803 및 Synechococcus 길쭉한 UTEX 2973(Synechocystis PCC 6803 및 S. elongatus의 유전자 변형) UTEX 2973 이하)에 의한 컨쥬게이션(삼자 짝짓기이라고도 함). 세균 세포 간의 DNA의 결합 전달은 잘 설명된 과정이며 이전에 는 S. longatus UTEX 297335와같이 자연적으로 유능하지 않은 종, 특히 시아노박테리아 종공학에 사용되어왔다. 36,37,38,39,40,41. 간단히 말해서, 시아노박테리아 배양체는 이식할 벡터("화물" 벡터) 및 벡터(동일한 대장균 균주 또는 추가 균주)를 운반하는 대장균 균주와 함께 배양되어 컨쥬게이션("mobilizer")을 가능하게 합니다. 및 "도우미" 벡터)를 제공합니다. 부부 전달이 발생하기 위해서는 4가지 주요 조건이 요구됩니다: 1) DNA 전달에 관여하는 세포 들 간의 직접 접촉, 2) 화물 벡터는 컨쥬게이션 시스템과 호환되어야 합니다(즉, 적절한전달(oriT)을포함해야 합니다. 또한 bom (이동성의 기초) 사이트로 알려져, 3) DNA 닉킹 단백질 (예를 들어, 마피아 유전자에 의해 코딩) 그 cyanobacterium으로 DNA의 단일 가닥 전송을 시작 하기 위해 oriT에서 DNA를 닉 존재 하 고 표현 해야 합니다. 화물 또는 도우미 벡터 들 중 하나로부터, 및 4) 이송된 DNA는 수용자 시아노박테리움에서 파괴되어서는 안 된다(즉, 제한 엔도누클리스 활성에 의한 열화에 저항해야 함)35,42. 화물 벡터가 지속되려면, 복제의 기원은 자식 복제 및 사후 분열로의 증식을 허용하기 위해 수신자 시아노박테리움과 호환되어야 한다. 조건 3 및 4를 돕기 위해, 몇몇 도우미 벡터는 호스트 시아노박테리움(43)에서 네이티브 엔도놀리스로부터 보호하기 위해 마피아뿐만 아니라 몇몇메틸라제에 인코딩하는 Addgene 및 기타 상용 소스를 통해 이용가능하다. 이 프로토콜에서, 컨쥬게이션은 각각 MC1061 대장균 균주 운반 동원기 및 도우미 벡터 pRK24(www.addgeneorg/51950) 및 pRL528(www.addgene.org/58495)에 의해 촉진되었다. 부부 전달에 사용할 벡터를 선택할 때주의를 기울여야합니다. 예를 들어, CyanoGate 키트에서 자가 복제 화물 벡터 pPMQAK1-T는 Mob단백질(12)에대해 인코딩한다. 그러나, pSEVA421-T는44가아니며, 따라서, 폭도는 적절한 도우미 벡터로부터 표현되어야 한다. 사용되는 벡터는 또한 표적 유기체에 적합해야 한다. 예를 들어, 아나바에나 sp. PCC 7120의 효율적인 부부 전달은 소화로부터 동원자 벡터를 보호하는 도우미 벡터를 필요로 합니다(예를 들어, 3개의 메틸라제 AvaiM, Eco47iiM 및 Ecot22iM)에 대해 인코딩하는 pRL623)45, 46.

이 프로토콜에서 우리는 플레이트 리더 또는 유동 세포계를 사용하여 형광 마커로 부품 (즉, 프로모터)의 성능을 특성화하는 방법을 추가로 설명합니다. 유세포계는 큰 집단을 위한 단 하나 세포 기초에 형광을 측정할 수 있습니다. 또한 유동 세포계를 사용하면 수집된 데이터를 "게이트"하고 배경 소음(예: 배양 또는 오염의 미립자 물질)을 제거할 수 있습니다. 대조적으로, 플레이트 판독기는 일반적으로 여러 복제 우물에서 주어진 배양부량의 골재 형광 측정을 획득합니다. 세포계에 비해 플레이트 판독기의 주요 장점으로는 낮은 비용, 높은 가용성 및 일반적으로 다운스트림 데이터 분석을 위한 전문 소프트웨어에 대한 요구 사항이 없습니다. 플레이트 판독기의 주요 단점은 세포계에 비해 상대적으로 낮은 감도 및 측정된 배양물의 광학 밀도에 대한 잠재적 인 문제입니다. 비교 분석의 경우, 플레이트 리더 샘플은 각 웰에 대해 정규화되어야 합니다(예: 일반적으로 750 nm [OD750]에서광학 밀도에서 흡광도로 촬영되는 배양 밀도 측정에 따르면) 너무 많은 시료의 부정확성을 초래할 수 있습니다. 조밀하거나 잘 혼합되지 않습니다 (예 : 응집 또는 응고가 발생하기 쉬운 경우).

개요로, 여기에서는 레벨 0 부품을 생성하는 원리를 자세히 설명한 다음 CyanoGate 키트를 사용하여 계층적 어셈블리를 사용하고 부부 전달에 적합한 벡터로 복제합니다. 그런 다음 부부 전이 과정, 형광 마커를 발현하는 축색 트랜스컨주간트 균주의 선택, 유세포계 또는 플레이트 리더를 사용하여 형광 데이터의 후속 획득을 입증합니다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. 플랜트 모클로 및 시아노게이트 툴킷을 사용한 벡터 어셈블리

참고 : 벡터 어셈블리를 진행하기 전에 사용자가 식물 및 CyanoGate MoClo 시스템12,15의벡터 레벨 구조에 익숙해지는 것이 좋습니다.

  1. 레벨 0 부품 의 구성
    참고: 레벨 0 파트는 전체 벡터또는 레벨 0 수락자(예: gBlocks, IDT)를 사용하여 어셈블리를 위한 선형 시퀀스로 합성할 수 있습니다. 대안적으로, 서열은 소스 템플릿(예를 들어, 벡터 또는 정제된 게놈 DNA)으로부터 증폭될 수 있다. 여기서, 증폭된 제품으로부터 새로운 레벨 0 부품을 생성하는 방법에 대해 설명한다. 레벨 0에서 레벨 T까지의 골든 게이트 어셈블리 프로세스개요가그림 1.
    1. 프라이머를 디자인합니다.
      1. 어떤 레벨 0 모듈을 조립하고 적절한 식별 결정 5′ 및 3′ 오버행(표 1)12,15. BPiI 또는 BsaI 제한 부위의 존재를 복제하기 위해 DNA 서열을 확인한다.
        참고: 이러한 사이트 중 하나를 포함하는 시퀀스는 제한 사이트 시퀀스에서 하나 이상의 NT를 수정하여 인드캐닝해야 합니다. 골든 게이트 어셈블리를 사용하여 이 작업을 수행하기 위한 전략은 그림 2에설명되어 있습니다.
      2. DNA 서열을 증폭하려면 적절한 전진 및 역방향 프라이머 쌍을 디자인합니다. 순방향 프라이머의 경우, DNA 템플릿 서열의 5′ 말단에 18-30 bp 상보를 선택한다. 역프라이머의 경우, DNA 템플릿 서열의 3′ 말단에 대한 18-30 bp 역보를 선택한다.
        참고: 58−62°C의 용융 온도(Tm)를가진 프라이머는 일반적으로 가장 일관된 증폭 결과를 제공합니다(그림1A).
      3. 다음에 다음을 추가 5′ 앞으로 프라이머의 끝: 1) 임의의 문자열 4-6 BpiI 사이트의 끝에 NTs, 2) BpiI 제한 사이트 (GAAGAC), 3) 두 개의 무작위 NTs, 그리고 4) 5′ 오버행 단계에서 선택 1.1.1.1. 다음에 다음을 추가 5′ 역 프라이머의 끝: 1) 임의의 문자열 4-6 BpiI 사이트의 끝에 NTs, 2) BpiI 제한 사이트 (GAAGAC), 3) 두 개의 무작위 NTs, 그리고 4) 3′ 오버행 단계에서 선택 1.1.1.1. 완료되면 프라이머 쌍을 주문하십시오.
        참고: 정방향 및 역방향 프라이머 쌍의 예는 그림1A를 참조하십시오.
    2. 게놈 DNA에서 DNA 서열을 증폭시.
      1. 섹션 5에 기재된 바와 같이 게놈 DNA를 추출한다. 고충실도 DNA 폴리머라제(물자표)를사용하여 PCR에 의해 제품을 증폭시다.
        참고: 예를 들어 제조업체의 지침에 따라 PCR 반응(20−50 μL)을 설정합니다. 반응당 ~100 ng의 게놈 DNA를 사용하십시오. 30초동안 98°C의 초기 변성 단계로 구성된 열 사이클링 프로그램을 사용하고, 10초동안 98°C에서 25사이클 이하의 변성, 15초동안 58°C에서 어닐링, 72°C에서 30초의 제품 확장(후자에 따라 수정)을 사용한다. 사용 된 DNA 폴리머 라제의 제품 / 유형의 크기), 2 분 동안 72 °C의 최종 연장 단계.
      2. PCR 생성물이 겔 정제될 경우, 섹션 6에 설명된 바와 같이 아가로즈 겔상에서 전체 PCR 반응을 실행한다. 관심의 밴드를 아가로즈 젤에서 잘라 젤 추출 키트(재료표)를사용하여 정화합니다.
      3. 1.1.2.2단계의 대안으로, PCR 생성물이 겔 정제 없이 사용될 경우, 아가로즈 겔상에서 PCR 반응 샘플(~5 μL)의 aliquot를 실행하여 밴드 크기를 확인한다. 겔이 적절한 밴드와 프라이머 디머의 증거만을 나타내면 DNA 정제키트(물자 표)를사용하여 PCR 생성물을 정제한다.
      4. 고이온화된 물(예를 들어, 10 μL)의 소량에서 정제된 DNA를 고온화(>20 ng/μL)를 얻기 위해 전형적으로 충분하다.
    3. 레벨 0에서 증폭된 DNA 생성물(또는 제품, 그림 2참조)을 조립합니다. BpiI(그림1B)와20 μL 반응 믹스를 준비하고 표 2에기재된 바와 같이 열 사이클러 프로그램을 설정한다. 조립된 레벨 0 반응 믹스의 5 μL을 사용하여 대장균 형질전환을 진행한다(섹션 2에 기재된 바와 같이).
  2. 레벨 1 어셈블리 구성
    1. 어셈블할 레벨 0 부품을 결정합니다(그림1C표 1). 적절한 레벨 1 수락자 벡터15를선택합니다.
      참고: 이 단계에서는 레벨 1 허용자 벡터의 선택에 영향을 미치므로 최종 벡터 디자인이 레벨 T에 어떤 영향을 미치는지 아는 것이 중요합니다. 레벨 1 위치 1(Forward) 수용자 벡터(pICH47732)는 레벨 T에서 단일 레벨 1 어셈블리(예를 들어, 유전자 발현 카세트)를 가지는 것이 목표인 경우 기본값으로 사용될 수 있다. 그러나 두 개 이상의 레벨 1 어셈블리를 레벨 T로 어셈블하려면 각 레벨 1 어셈블리의 위치와 방향을 고려해야 합니다. 레벨 1 수용자 벡터를 사용하여 레벨 T 수용자 벡터에서 최대 7개의 레벨1 어셈블리를 어셈블할 수 있습니다.
    2. 레벨 1에서 레벨 0 부품을 어셈블합니다. BsaI와 20 μL 반응 믹스를 준비하고 표 2에설명된 바와 같이 열 사이클러 프로그램을 설정한다. 조립된 레벨 1 반응 믹스의 5 μL을 사용하여 대장균 형질전환을 진행한다(섹션 2에 기재된 바와 같이).
  3. 레벨 T 어셈블리 의 구성
    1. 어셈블할 수준 1 어셈블리를 결정합니다(그림1D). 적절한 레벨 T 수락자 벡터를 선택합니다.
      참고 : pUC19A-T (암피실린 저항) 및 pUC19S-T (스펙티노 마이신 저항)는 시아노 박테리아에서 복제 할 수없는 높은 카피 수 통합 벡터이며 주로 게놈 통합 (즉, 노크 인 또는 유전자의 녹아웃)에 사용됩니다. 상동성 재조합12. 통합 벡터의 전달은 순시아노박테리아종(11)에서자연적인 형질전환에 의해 진행될 수 있다. pPMQAK1-T는 부부 전이에 의해 전달되는 광범위한 숙주 범위, 복제 벡터이다(섹션 3).
    2. 레벨 T백본15에최종 레벨 1 어셈블리의 3′ 끝을 리게이트하는 적절한 엔드 링크를 선택합니다.
      참고: 필요한 끝 링크는 최종 부품의 위치와 동일한 수입니다. 예를 들어, 레벨 1 위치 1(전진 또는 후진) 부분만 있는 레벨 T 벡터는 레벨 T 백본에 결찰을 위해 엔드 링크 1(pICH50872)이 필요합니다.
    3. 레벨 T. 레벨 T에서 하나 이상의 레벨 1 어셈블리를 조립하여 BpiI 및 필요한 엔드 링크 벡터와 반응 믹스를 준비하고 표 2에설명된 바와 같이 열 사이클러 프로그램을 설정한다. 조립된 레벨 T 반응 믹스의 5 μL을 사용하여 대장균 형질전환을 진행한다(섹션 2에 기재된 바와 같이).

2. 대장균 변환 및 벡터 정제

  1. 대장균 변형(1일째)
    1. 화학적으로 유능한 대장균 세포(물자 표)의알리쿼트(~25 μL)를 해동하고 얼음 위에 1.5 mL 튜브로 부드럽게 피펫을 피펫을 넣습니다. 조립 믹스 5 μL(레벨 0, 1 또는 T)을 넣고 튜브를 얼음 위에 30-60분 더 인큐베이션합니다.
    2. 열 충격 세포를 42°C에서 수조에서 튜브를 30초 동안 배양한 다음, 튜브를 다시 얼음 위에 2분 동안 넣은 다음, 실온(RT) 슈퍼 최적 국물을 이타볼라이트 압근(S.O.C.) 배지(250 μL)를 튜브에 넣습니다. 225 rpm에서 1시간 동안 37°C에서 튜브를 교양인인큐베이터에서 배양한다.
    3. 항생제의 적절한 최종 농도를 포함하는 LB 한천 판에 배양된 플레이트 40 μL (스펙티노마이신 디하이드로클로라이드 펜타하이드레이트 [레벨 0], 카베니실린 디소듐 100 μg/mL, 또는 카나마이신 설산염의 50 μg/mL [카나마이신 황산염의 100 μg/mL 레벨 T]), 1 mM 이소프로필-베타-D-티오갈라코피라노사이드(IPTG) 및 5-브로모-4-클로로-3-인돌릴-β-D-갈라크토피라노사이드(X-Gal)의 40 μg/mL의 청백색 스크리닝. 37 °C에서 밤새 플레이트를 배양합니다.
      참고: 도금된 배양량은 대장균 유능한 세포의 효율 및 결찰 반응에 따라 달라질 수 있다. 하룻밤 배양 후 10 개의 콜로니가 관찰되는 경우 더 큰 부피를 플레이트.
  2. 백색 식민지 의 선택 과 액체 문화의 준비 (2 일)
    참고 : 조립 반응 및 후속 변환의 효율성에 따라 LB 한천 플레이트에는 콜로니, 파란색 콜로니 또는 흰색 식민지가 포함되지 않을 수 있습니다(그림 3). 청색 콜로니는 제한을 거치지 않은 수용자 벡터를 나타냅니다(즉, lacZ의 기능적 사본은 여전히 존재합니다). 흰색 콜로니는 lacZ 식 카세트가 손실되고 부품/어셈블리로 대체되었음을 나타냅니다.
    1. 선택적으로, 흰색 콜로니섹션 7에 설명된 대로 PCR을 수행하여 예상 벡터를 포함하고 있는지 확인합니다.
    2. 10 μL 팁으로 단일 백색 콜로니 (또는 PCR 검증 콜로니)를 선택하고 LB 배지 (5 mL) 및 적절한 항생제 농도를 포함하는 15 mL 원심 분리기로 옮김 (단계 2.1.3). 37°C에서 하룻밤 동안 225 rpm에서 튜브를 교반인인큐베이터에서 배양한다.
  3. 플라스미드 벡터 정제(3일째)
    1. 선택적으로, 벡터의 장기 저온 저장을 위해 하룻밤 대장균 배양물의 글리세롤 스톡을 준비한다. -80°C에서 저온 저장을 위해 적절한 1.5-2.0 mL 튜브에 500 μL의 500 μL(v/v) 글리세롤을 첨가합니다. 5-10x를 반전시켜 부드럽게 섞으세요. 액체 질소에 있는 플래시 동결 견본및 -80°C 냉동실에 저장합니다.
    2. 15 mL 원심 분리기 튜브에서 배양액을 3,000 x g에서 5-10 분 동안 스핀 다운하십시오. 플라스미드 정제키트(표 재료)를사용하여 벡터를 정화한다. 탈이온수의 35 μL에서 정제된 벡터를 용루.
      참고: 더 낮은 용출 볼륨을 사용하여 벡터 농도를 더욱 높입니다. 동일한 용리액은 수율을 높이기 위해 정제 컬럼을 두 번 통과할 수 있습니다.
    3. 분광광도계(물자 표)를 사용하여 용리액 내의 벡터의 농도를측정합니다.
      참고: pUC19와 같은 대장균의높은 카피 수 벡터는 일반적으로 50-300 ng/μL의 수율을 제공합니다. pPMQAK1-T와 같은 낮은 카피 수 벡터는 일반적으로 15-60 ng/μL의 수율을 제공합니다.
  4. 벡터 유효성 검사
    참고: 벡터는 제한 소화(단계 2.4.1) 및/또는 시퀀싱(단계 2.4.2)으로 확인할 수 있습니다.
    1. 적절한 제한 효소를 가진 벡터의 0.5-1 μg를 제한하고 섹션 6에 설명된 대로 예상 밴드 크기를 확인합니다(그림4).
      참고: 잘못된 밴드 크기는 일반적으로 잘못된 어셈블리를 나타내며, 이 경우 더 많은 흰색 콜로니를 스크리밍하거나 어셈블리를 반복할 수 있습니다. BsaI 및 BpiI는 각각 레벨 0 및 레벨 1 어셈블리에 대한 인서팅의 정확한 크기를 검증하는 데 사용할 수 있습니다. BsaI 또는 BpiI는 소화 후 잘 분리된 밴드의 뚜렷한 세트를 생성하기 위해 삽입 및/또는 벡터 백본 내에서 절단하는 추가 호환 제한 효소와 함께 사용할 수 있습니다.
    2. 상업용 시퀀싱 시설을 사용하여 조립된 영역의 적절한 프라이머 업스트림을 사용하여 Sanger 시퀀싱에 의해 벡터를 시퀀싱합니다(표3).
      참고: 모든 새 레벨 0 파트는 예상되는 시퀀스 ID를 확인하기 위해 순서를 정해야 합니다. 레벨 1 및 T 벡터의 시퀀스 유효성 검사는 일반적으로 이전에 시퀀스된 레벨 0 파트에서 어셈블된 경우 필요하지 않습니다.

3. 컨쥬게이션에 의한 돌연변이생성

참고: 여기서, 자가 복제 화물 벡터를 Synechocystis PCC 6803 또는 S. 신장 UTEX 297311,47로 의한 부부 간 이송을 위한 프로토콜이 기재되어 있다. 이 프로토콜은 다른 모델 종(예를 들어, S. longlongatus PCC 7942 및 Synechococcus sp. PCC 7002)에 적용 가능하다. 시아노박테리아(및 관련 완충제)를 사용하는 모든 작업은 층류 후드의 멸균 조건하에서 이루어져야 합니다.

  1. 시아노박테리아 배양의 성장(1일째)
    1. Lea-Smith 외11에따라 BG11 배지를 준비하고 LB-BG11 및 BG11+Kan50(섹션 8)이 있는 한천 플레이트를 준비합니다.
    2. Synechocystis PCC 6803 또는 S. longlongatus UTEX 2973의 신선한 BG11 배지 (50 mL)의 100 mL 원추형 플라스크를 축사 BG11 한천 플레이트에서 공급받은 세포로 접종하여 신선한 배양을 설정합니다. 시네시시스성 PCC 6803 배양액을 30°C, 100°C에서 100 μmol 광자m-2s-1에서 성장시키고, 40°C에서 S. 신장 UTEX 2973, 300 μmol 광자m-2s-1을 100 rpm에서 성장시. OD750 = 0.5−1.5(일반적으로 1-2일)까지 배양을 늘입니다.
      참고: S. 장대 UTEX 2973 배양체는 40°C에서 높은 광강도(예를 들어, 2000 μmol 광자m-2s-1)48에서재배될 수 있다.
  2. 도우미 및 화물 대장균 균주의 성장 (2일째)
    1. MC1061 대장균 균주와 함께 암피실린(최종 농도 100 μg/mL) 및 클로람페니콜(최종 농도 25 μg/mL)을 함유하는 LB 배지를 접종하여 pRK24 및 pRL528(즉, 도우미 균주)을 함유하고 225 rpm에서 밤새 37°C에서 성장합니다. 흔들리는 인큐베이터에. 컨쥬게이션당 1 mL의 배양이 필요하다고 가정하면 충분한 양의 도우미 변형 배양을 키우게 됩니다.
    2. 화물 벡터를 운반하는 대장균 배양물(즉, 레벨 T 벡터)과 함께 적절한 항생제를 함유하는 LB 배지(5 mL)를 접종한다. 흔들리는 인큐베이터에서 225 rpm에서 밤새 37°C에서 배양한다.
  3. 부부 전입(삼중 부모 짝짓기) (3일째)
    1. 대장균 도우미와 화물 균주를 준비합니다. 도우미와 화물 대장균을 실온에서 10분 동안 3,000 x g에서 하룻밤 동안 배양한다. 세포 펠릿을 방해하지 않고 상급을 폐기하십시오.
    2. 항생제없이 신선한 LB 배지를 추가하여 펠릿을 씻으십시오. 초기 문화권과 동일한 볼륨을 사용합니다. 펠릿을 위아래로 부드럽게 파이펫팅하여 다시 놓습니다. 문화를 소용돌이하지 마십시오. 이 단계를 3x 반복하여 밤새 배양으로부터 잔류 항생제를 제거합니다.
    3. 재중단 배양물(3.3.1단계에서와 같이)을 원심분리하고, 상급을 폐기하고 초기 배양 량의 LB 배지의 절반으로 재중단한다(예를 들어, 하룻밤 배양량이 5 mL인 경우 2.5 mL). 도우미 균주의 450 μL과 2 mL 튜브에 450 μL의 화물 변형을 결합하고 3.3.6 단계까지 (RT에서 방치)를 따로 둡니다.
    4. 시아노박테리아 배양을 준비합니다. 각 컨쥬게이션 반응에 대해 1 mL의 시아노박테리아 배양액을 사용하십시오(OD750 = 0.5−1.5).
    5. RT에서 10 분 동안 1,500 x g의 시아노 박테리아 배양에 필요한 총 부피를 원심 분리한 다음 세포 펠릿을 방해하지 않고 상수제를 조심스럽게 버립니다. 동일한 초기 부피의 신선한 BG11 배지를 추가하여 펠릿을 세척합니다. 부드럽게 위아래로 파이펫팅하여 펠릿을 다시 일시 중단하고 배양을 소용돌이하지 마십시오. 이 단계를 3x 반복하고 세척된 배양을 따로 설정합니다.
    6. 2 mL 튜브에 결합된 대장균 균주(도우미 및 화물)(900 μL)에 세척된 시아노박테리아 배양액(900 μL)의 알리쿼트를 추가합니다. 위아래로 부드럽게 파이펫팅하여 문화를 혼합합니다. 소용돌이를 하지 마십시오. 시네시시스 PCC 6803또는 S. 롱가투스 UTEX 2973의 경우 2시간 동안 RT에서 혼합물을 30분 동안 배양한다.
    7. RT에서 10 분 동안 1,500 x g에서 혼합물을 원심 분리합니다. 상급의 나머지 ~ 200 μL에 펠릿을 다시 일시 중단. 항생제가 결여된 LB-BG11 한천 판에 0.45 μm 멤브레인 필터 1개를 놓습니다(섹션 8). 대장균/시아노박테리아 배양 혼합물을 멸균 스프레더 또는 멸균 된 구부러진 팁으로 멤브레인에 조심스럽게 200 μL을 퍼뜨리고 파라핀 필름으로 접시를 밀봉합니다.
    8. LB-BG11 플레이트를 24시간 동안 멤브레인으로 인큐베이션. 시네시스 PCC 6803 배양물30°C, 100 μmol 광자m-2s-1로멤브레인을 유지한다. 150 μmol 광자 m -2s-1에서40 °C에서 S. 신장 UTEX 2973 배양으로 멤브레인을 유지합니다.
  4. 멤브레인 이송
    1. 24시간 후, 적절한 항생제(섹션 8)를 함유하는 신선한 BG11 한천 플레이트에 화염 멸균 집게를 사용하여 멤브레인을 조심스럽게 이송하여 화물 벡터를 선택한다. 파라핀 필름으로 접시를 밀봉합니다.
    2. Synechocystis PCC 6803 또는 S. 신장 UTEX 2973에 대해 위에서 설명한 바와 같이, 콜로니가 나타날 때까지 적절한 성장 조건 하에서 BG11 한천 플레이트를 배양한다.
      참고: 콜로니는 일반적으로 시네시스 PCC 6803의 경우 7-14일, S. longatus UTEX 2973의 경우 3-7일 후에 나타납니다.
  5. 컨쥬gants의 선택
    참고 : 화물 벡터를 운반하는 시아노 박테리아 식민지 만 멤브레인에서 자랄 수 있습니다(그림 5).
    1. 열 멸균 루프를 사용하여, 막에서 적어도 2개의 개별 적인 콜로니를 선택하고 적절한 항생제를 포함하는 새로운 BG11 한천 판에 줄무늬를 놓습니다(그림 5C).
      참고 : 갓 줄무늬 콜로니는 여전히 컨쥬게이션에서 이월 된 대장균으로 오염 될 수 있습니다 (즉, 작은 흰색 식민지가 접시에 분명한 경우), 그래서 신선한 BG11 한천 접시에 다시 줄무늬의 두 개 또는 세 개의 추가 라운드는 일반적으로 축시아노박테리아 배양을 얻기 위해 필요한.
    2. 5 mL의 LB 배지를 함유하는 15 mL 원심분리관으로 시아노박테리아 배양액을 접종하고 37°C에서 밤새 225 rpm에서 배양하여 대장균 오염의 부재를 확인한다. 충분한 성장 기간 (~7 일)에 따라, 장기 저온 저장 또는 후속 실험을위한 액체 배양을 설정하는 개별 축 식민지를 선택합니다.
  6. 시아노박테리아 균주의 저온 저장
    1. OD750 = 1.5−3.0까지 BG11(섹션 3.1에 기재된 바와 같이)에서 시아노박테리아 액체 배양액을 성장시다. 원심분리기 10 mL배1,500 x g에서10분 동안 배양하고, 상체를 제거하고 신선한 BG11 배지의 5 mL에서 세포를 재중단한다.
    2. 3.5 mL의 오토클레이브 멸균 50%(v/v) 글리세롤을 첨가하여 최종 글리세롤 농도를 ~20% (v/v)49로처리합니다. 이 방법은 Synechocystis PCC 6803에 적합합니다. 또는 최종 DMSO 농도인 ~8% (v/v)50에대해 16% (v/v) 디메틸 설폭사이드(DMSO)를 함유하는 필터 살균 BG11 5 mL를 추가합니다. 이 방법은 S. longlongatus UTEX 2973을 포함하여 대부분의 균주에 권장됩니다.
      주의: DMSO는 독성이 있으므로 적절한 보호 기능을 통해 처리해야 합니다.
    3. 5-10x를 반전시켜 부드럽게 섞으세요. 수분 ~1 mL 배양 을 별도 저온 저장 호환 1.5 mL 나사 캡 튜브(재료 표). 냉동 보관을 위해 튜브를 -80°C 냉동고에 넣습니다. 액체 질소에 얼지 마십시오.
      참고: 스트레인당 최소 3개 이상의 재고를 권장합니다.
    4. 회복을 위해-80°C 냉동고에서 튜브를 제거하고 부드럽게 혼합하면서 35°C 수조에서 배양물을 해동한다. 해동 된 배양을 신선한 BG11 배지의 50 mL에 추가하고 액체 배양으로 성장합니다 (섹션 3.1에 설명된 대로).
      참고 : 또는, 문화는 줄무늬와 신선한 BG11 한천 접시에 성장 할 수있다. 선택 마커를 운반하는 형질전환 배양은 항생제없이 BG11 한천 접시에 처음에 부활한 다음 적절한 항생제로 BG11 한천 접시에 다시 기울여야합니다.

4. 프로모터 특성화

참고: 여기서 표준 접근법은 플레이트 리더 또는 유세포계12를사용하여 72시간 성장 기간을 따라 형광 마커(eYFP)의 발현 수준을 측정함으로써 프로모터 부분의 강도를 분석하기 위한 기술이다.

  1. 문화 성장
    1. 형광 마커 발현 카세트를 운반하는 형질전환 시아노박테리아 균주의 단일 콜로니와 함께 적절한 항생제를 함유하는 BG11 배지의 10 mL을 접종함으로써 종자 배양체를 설정한다. 또한 적절한 음성 대조군 균주(예를 들어, 동일한 벡터 백본을 운반하지만 형광 마커 발현 카세트가 결여된 형질전환 균주)에 대한 종자 배양체를 준비한다.
      참고: 적어도 4개의 생물학적 복제가 권장됩니다.
    2. 종자 배양액을 48시간 또는 OD 750=1−1.5까지 종자 균주에 적합한 성장 조건하에서 성장시다.
    3. 시간에 따라 프로모터 발현을 추적하기 위해, 먼저 각 종자 배양의 OD750을 측정한다. 희석 요구 사항을 계산하여 각 배상금을 시작 OD750 = 0.2로 가져옵니다. 희석된 실험 배양 시료(총 부피 2mL)를 평평한 바닥 24웰플레이트(재료 표)에설치한다.
    4. 적절한 성장 조건하에서 흰색 LED 조명(재료 표)으로흔들리는 인큐베이터에 접시를 배양하십시오. 배양 성장 밀도(OD750)및 플레이트 리더(섹션 4.2) 또는 유세포계(섹션 4.3)를 사용하여 향상된 황색 형광 단백질(eYFP) 형광을 측정하였다.
      참고: 시네시스티스 PCC 6803 및 S. 신장 UTEX 2973 배양은 3.1.2단계에서와 같이 재배할 수 있습니다. 높은 습도(95%)에서 플레이트를 유지하는 것이 좋습니다. 배양 샘플의 증발을 방지할 수 있습니다.
  2. 플레이트 리더
    1. 24웰 플레이트(4.1.4단계)의 배양양을 부드러운 파이펫팅과 간단히 섞는다. 각 배양물의 서브 샘플을 검은색 평하 96웰플레이트(재료표)로옮김을 옮김을 옮김으로 옮니다. 필요한 경우 희석하십시오 (100 μL 최종 부피). 측정 정확도를 방해할 수 있기 때문에 기포 형성을 피하십시오.
      참고: 모든 측정은 0.2−1.0의 OD750 범위의 샘플에서 수행되는 것이 좋습니다. 24-well에서 배양의 밀도는 시간이 지남에 따라 증가할 것이기 때문에, 표준 성장 조건의 예상 증가에 따라 다음과 같은 희석이 권장됩니다: 0 h에서 희석 없음, 24 h에서 1:4, 48 h에서 1:10 및 72 h에서 1:10. 그래서 예를 들어, 24시간에서 25 μL의 배양액을 BG11 배지의 75 μL과 혼합한다.
    2. 96웰 플레이트(즉, BG11 배지의 100 μL)에 2개의 블랭크 웰을 포함한다. 96웰 플레이트를 플레이트리더(재료 표)에넣습니다. 플레이트 리더의 궤도 셰이커를 사용하여 500 rpm에서 60 s용 플레이트를 흔들어 우물을 섞습니다.
      참고: 시아노박테리아 배양은 응집 및/또는 결점으로 만들 수 있으므로 정확한 측정을 위해 판독 전에 좋은 혼합이 중요합니다.
    3. 485 nm/520 nm에서 여기/방출 파장으로 OD750 및 eYFP 형광을 측정합니다.
    4. 시아노박테리아 배양을 함유하는 각 시료의 OD750 측정으로부터 2개의 블랭크 웰의 OD750 측정의 평균을 뺍니다.
    5. 각 배양 시료의 형광 값을 어창의 조정된 OD750으로 eYFP 형광 측정(단계 4.2.3)으로 나누어 정규화한다(단계 4.4). 이어서, eYFP 발현 카세트를 운반하는 형질전환 균주로부터 적절한 음성 대조군 균주의 생물학적 복제물의 평균 정규화된 eYFP 형광 값(eYFP 형광/OD750)을뺍니다.
      참고: 시아노박테리아는 엽록소와 피코빌리단백질과 같은 안료의 존재로 인해 자연적으로 형광됩니다.
    6. 시간에 따라 플롯 배양성장(도 6A)및 원하는 시점(예를 들어, 72h)에서 각 실험 배양물의 평균 정규화 된 eYFP 형광 값; 그림 6B).
  3. 유동 세포계
    1. 유세포계 액체 처리 시스템에 적합한 플레이트를 선택하십시오. 예를 들어, 이 프로토콜에 사용되는 유세포계(물자 표)와 함께 둥근 바닥 96웰플레이트(재료표)를사용한다.
    2. 24웰 플레이트(4.1.4단계)의 배양양을 부드러운 파이펫팅과 간단히 섞는다. 액체 처리 시스템의 노즐 막힘을 방지하기 위해 배양물을 OD750 = 0.1−0.2로 희석합니다. 96웰 플레이트에 적절한 양의 배양 시료를 추가하고 필터 멸균 된 1x 인산 완충 식염수 (PBS)로 250 μL의 최종 부피를 가져옵니다. BG11의 60 μL 및 1x PBS의 190 μL을 포함하는 플레이트 상에 배지 용액에 대해 블랭크 웰을 포함한다.
      참고: 샘플을 다시 실행해야 하는 경우 이 볼륨을 권장합니다. 각 웰의 최대 부피는 300 μL이기 때문에 250 μL보다 높은 볼륨은 권장되지 않습니다.
    3. 유량 세포계를 사용할 준비가 되면 액체 처리 스테이션에 배양 샘플이 있는 96웰 플레이트를 놓습니다. 유세포계에 대한 소프트웨어 프로토콜을 설정하여 10,000개의 개별 이벤트(예: 셀)의 측정값을 수집합니다. 488 nm/515−545 nm의 여기/방출 파장으로 eYFP 형광을 측정합니다. 먼저 블랭크 웰(그림 7A)에서판독값을 확인한 다음 샘플을 실행합니다.
    4. 전방 및 측면 산란 데이터 세트 내의 시아노박테리아 세포의 집단을 게이트하고, 블랭크 판독과 공통적인 영역을제외한(도 7B). eYFP 발현 카세트를 운반하는 형질전환 균주로부터 적절한 음성 대조군 균주의 생물학적 복제물의 평균 eYFP 형광 값을 뺍니다(도7C,D). 원하는 시점(예를 들어, 72h)에서 각 실험 배양에 대한 세포당 평균 형광 값의 평균을 플롯; 그림 7E).

5. 시아노박테리아에서 추출한 게놈 DNA 추출

참고: 아래 프로토콜은 상업용 DNA 추출키트(재료 표)를사용합니다.

  1. OD750 = 1.5−3.0까지 BG11(섹션 3.1에 기재된 바와 같이)에서 시아노박테리아 액체 배양액을 성장시다. 10 분 동안 3,000 x g에서 10 mL의 배양을 스핀 다운하고 상급을 버립니다. 튜브를 -20°C에서 30분 동안 배양하여 펠릿을 동결시켰다.
  2. 용해 완충액(버퍼 AP1)과 리보누클레스 용액(RNase A) 400 μL, 유리 비드 50%(w/v)를 추가합니다(직경 0.5mm). 6분 동안 30Hz(즉, 진동/분당 1,800개에 해당)에서 비드밀(재료 표)을사용하여 샘플을 중단합니다.
  3. 샘플을 17,000 x g에서 5 분 동안 회전시키고 상구체를 새 튜브로 조심스럽게 옮기고 펠릿을 버립니다. 제조업체의지침(재료 표)에따라 진행하십시오.

6. 아가로즈 젤 전기 동동

  1. 0.02% (v/v) 에티듐 브로마이드를 함유하는 아가로즈 젤을 1% (v/v) 시전한다. 시료와 적절한 DNA 사다리 참조를 로드합니다.
  2. 125V에서 50분 동안 샘플을 실행하여 자외선(UV) 트랜스일루미에이터에서 밴드 분리를 확인합니다.
    참고: 러닝 타임과 아가로즈 젤 백분율은 예상 밴드 크기에 맞게 수정할 수 있습니다. 예를 들어, 더 높은 백분율아가로즈 겔 및 더 긴 실행 시간은 DNA 제품 <500 bp의 밴드 분해 및 분리를 향상시킬 수 있다.

7. 식민지 PCR

  1. 표준키트(재료 표)와프라이머의 적절한 조합을 사용하여 PCR 반응 믹스를 설정합니다(예를 들어, 조립 영역 측면 또는 조립 영역 내의 서열에 특이적인 프라이머(표3). 피펫 10 μL을 PCR 튜브에 넣습니다.
  2. 멸균 이쑤시개 또는 10 μL 파이펫 팁으로 단일 흰색 콜로니의 상단을 부드럽게 터치하고 PCR 반응 믹스를 포함하는 PCR 튜브를 접종합니다. 식민지를 표시하고 특정 PCR 튜브와 일치하도록주의하십시오. 대장균 세포가 용액내로 흘러 들어갈 수 있도록 반응 믹스를 부드럽게 저어줍니다.
  3. PCR로 제품을 증폭합니다. 60s의 경우 95°C, 15s의 경우 95°C의 30회, 15초의 경우 58°C(프라이머의Tm 값보다 적은 도) 및 30초의 경우 72°C(인서삽입30s/kb)의 초기 변성 단계로 구성된 프로그램을 사용하십시오. , 5 분 동안 72 °C의 최종 연장 단계.

8. BG11 배지 및 플레이트 준비

  1. Lea-Smith 외11에따라 100x BG11 배지, 철(암모늄 페릭 구연산), 미량 원소, 인산염(K2 HPO4),Na2CO3 및 TES 버퍼의 재고 용액을 준비한다. 오토클레이브 인산염 및 Na2CO3 주식. 0.2 μm 필터를 사용하여 TES 버퍼(pH 8.2) 및 NaHCO3 스톡 솔루션을 필터링합니다.
  2. BG11 배지 1L를 준비합니다. 100x BG11, 미량 원소 1mL, 철 스톡 1mL의 10mL를 혼합하고 976 mL의 물로 용액을 오토클레이브하십시오. 용액이 RT로 냉각되면 인산염 스톡 1 mL, Na2CO3 스톡 1 mL 및 NaHCO3의10 mL을 추가하고 1 M HCl으로 pH 7.6−7.8로 조정하십시오.
  3. LB-BG11 한천 플레이트 (1.5% [w/v])
    1. 700 mL의 탈이온수와 15 g의 한천을 유리 플라스크에 섞습니다. 두 번째 플라스크에 186 mL의 물, 100x BG11의 10 mL, 미량 원소 1 mL 및 철 스톡 1 mL을 추가하십시오. 두 솔루션을 모두 자동화합니다.
    2. 용액이 약 60 °C로 냉각되면, 그들을 결합하고 인산염 주식 1 mL, Na2CO3 스톡 1 mL, NaHCO3 스톡 10 mL 및 LB 멸균 매체 50 mL을 추가하면 25 L. Cast Petri 접시의 최종 부피를 제공해야합니다. LB-BG11 한천 배지의 mL.
  4. BG11+칸50 한천 플레이트 (1.5% [w/v])
    1. 700 mL의 탈이온수와 15 g의 한천을 유리 플라스크에 섞습니다. 두 번째 플라스크에 티오술페이트 나트륨 3 g (Na2S2O3),물 226 mL, 100x BG11 스톡 100mL, 미량 원소 1 mL 및 철 스톡 1 mL을 추가합니다. 두 솔루션을 모두 자동화합니다.
    2. 용액이 약 60 °C로 냉각되면, 그들을 결합하고 인산염 주식 1 mL, Na2CO3 스톡 1 mL, TES 완충 주식 10 mL, NaHCO3 스톡의 10 mL을 추가하면 최종 부피를 1 L. 카나마이신 설페이트 추가 50 μg/mL의 최종 농도에 매체의 35 mL와 페트리 접시를 캐스팅.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

골든 게이트 조립 워크플로우를 입증하기 위해, 식 카세트는 다음 레벨 0 부품을 포함하는 레벨 1 위치 1(Forward) 수용자 벡터(pICH47732)로 조립되었다: C-피코시아닌 오페론 P cpc560(pC0.005)의 프로모터, eYFP(pC0.008) 및 이중 종결자 T rrnB(pC0.082)에 대한 코딩 시퀀스(pC0.082)(12). 조립 반응의 변형 후, 성공적인 어셈블리는 대장균 콜로니의 표준 청백색 스크리닝을 사용하여 확인되었습니다(그림3). 레벨 1 벡터 및 엔드 링크 1 벡터(pICH50872)에서의 eYFP 발현 카세트를 다음 레벨 T 수용기 벡터(pPMQAK1-T)로 조립하여 벡터 cpcBA-eYFP(도4A)를부여하였다. 조립된 cpcBA-eYFP벡터는 제한 소화에 의해 확인되었다(도4B).

cpcBA-eYFP또는 빈 pPMQAK1-T 벡터(즉, eYFP 발현 카세트가 결여된 음성 대조군)의 성공적인 부부 전적은 시네시스 PCC 6803에 대한 멤브레인상에 최대 수백 개의 콜로니의 성장을 초래하고 S. 신장 UTEX 2973 후 7-14 일 및 3-7 일, 각각(그림 5). 개별 식민지를 따고 신선한 BG11 + Kan50 한천 접시에 줄무늬; 2-3 다시 줄무늬는 축배양을 생성하는 데 필요했다.

강한Ppc560 프로모터(51)에 대한 예상대로, 유세포계로부터의 플레이트 리더 및 eYFP 형광의 정상화에 대한 값은 음의 대조군(도 6 및 그림 7). 형광값은 시네시시스 PCC 680312보다 S. 신장 UTEX 2973에서 더 높았다.

Figure 1
그림 1: 시아노게이트의 골든 게이트 조립 공정 개요. 유전자 발현 카세트의 조립은 템플릿 DNA로부터 레벨 T 벡터의 조립에 대한 관심 서열의 증폭으로부터 시작하여 도시된다(부품은 스케일에 그려지지 않는다). (A)템플릿 DNA(예를 들어, 게놈 또는 플라스미드 DNA)로부터 CDS1 부분의 증폭을 위한 전진 및 역방향 프라이머의 설계. 수락기 벡터에 삽입하는 데 필요한 BpiI 제한 사이트 및 오버행의 위치(즉, 템플릿 시퀀스의 5′ 및 3′)는 각각 빨간색과 파란색으로 강조 표시됩니다. 문자 "n"은 모든 NT가 이 위치에서 사용될 수 있음을 나타냅니다. DNA 템플릿과 그들의 권장 용융 온도 (Tm)와프라이머의 어닐링 영역이 표시됩니다. (B)레벨 0 CDS1 수락기 벡터 pICH41308에 PCR 제품의 레벨 0 조립체. BpiI에 의해 절제되고 수용자 벡터로 결찰될 서열은 파란색으로 강조 표시됩니다. (C)BsaI를 사용하여 레벨 1 위치 1(forward) 수용자 벡터 pICH47732로 3개의 레벨 0 부분(Pro+ 5U, CDS1 및 3U + Ter)을 포함하는 유전자 발현 카세트를 레벨 1 조립체. (D)레벨 1 어셈블리및 엔드 링크 1의 레벨 T 어셈블리(pICH50872, Engler 등 에서 "레벨 M 엔드 링크 1"이라고함)를BpiI를 사용하여 레벨 T 수용기 벡터(예를 들어, pPMQAK1-T)로 한다. (E)최종 어셈블된 레벨 T 벡터입니다. 약어: AmpR, 암피실린 저항 카세트; 탄수화물, 카르베니실린 저항 카세트; CDS1, 레벨 0 구문15에서코딩 시퀀스; EL1, 엔드 링크 1 부품; 칸르, 카나마이신 저항 카세트; lacZα,β-갈락토시다아제 발현 카세트; SpecR, 스펙토마이신 저항 카세트. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 2
그림 2: 불법 유형 IIS 제한 사이트의 제거를 위한 PCR 기반 가정 화 전략. (a)CDS1 레벨 0 수용자 벡터(pICH41308)로 조립하기 위한 단백질 코딩 DNA 서열에서 GAGGAC에 BpiI 부위(GAAGAC)를 개량하기 위한 2개의 프라이머 쌍(각각 녹색 및 주황색)을 나타낸 회로도 도면. 수정은 글루탐산 (Glu)에 대한 코동을 보존합니다 (즉, GAA에서 GAG까지). BpiI 사이트는 시작 코돈과 프레임에 도시되지만, 이 접근법은 사이트가 프레임에 없는 경우에도 작동합니다(즉, 사이트가 중단되고 단백질 서열이 보존되는 한). 프라이머의 BpiI 제한 사이트 및 돌출부 위치는 각각 빨간색과 파란색으로 강조 표시됩니다. DNA 템플릿 및 번역된 단백질 서열은 노란색으로 강조 표시됩니다. DNA 템플릿과 그들의 권장 용융 온도 (Tm)와프라이머의 어닐링 영역이 표시됩니다. 주황색 쌍은 오버행 AATG및 TGAA (조각 1)와 시퀀스의 5′끝을 증폭하는 데 사용되며, 녹색 쌍은 3′끝을 오버행 TGAA 및 GCTT (단편 2)로 증폭하는 데 사용됩니다. 프라이머를 주문하기 전에, 조각 1 및 2에 대한 TGAA 융합 오버행의 충실도는 신중하게52를확인하였습니다. 제대로 설계되지 않은 융합 오버행은 조립 실패로 이어질 수 있습니다 (즉, 변환 후 식민지없음; 그림 5) 또는 거짓 긍정(예: 잘린 어셈블리 또는 잘못된 어셈블리) 후자는 올바르게 조립된 구수를 식별하기 위해 더 많은 수의 백색 콜로니를 스크리닝하여 해결할 수 있습니다. (B)골든 게이트 조립 시 BpiI로 제한 한 후 조각 1 및 2의 앰플리온. (C)레벨 0 CDS1 수락기 벡터로 조립된 길들여진 시퀀스. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 3
그림 3: 골든 게이트 조립 후 대장균 변질제의 청백색 식민지 스크리닝. 표시된 플레이트에는 적절한 농도에서 X-Gal, IPTG 및 항생제로 보충된 LB 한천(1% [w/v])이 포함되어 있습니다. (A)결속이 없고, 조립 반응 및/또는 대장균 변형을 암시한다. (b)대부분 청색 콜로니가 성공적인 조립을 나타내지만, 조립 반응에 사용되는 제한 효소의 효율은 낮았다. (C)주로 백색 콜로니, 전형적인 성공적인 조립 반응을 나타낸다. (D)매우 효율적인 조립을 나타내는 파란색 콜로니가 없습니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 4
그림 4: 제한 소화에 의한 조립된 레벨 T 벡터의 검증. 벡터를 힌드III 및 밤시로 소화하였다. (a)빈 pPMQAK1-T 수용기 벡터(CT.0) 및 레벨 T 어셈블리(cpcBA-eYFP)의 시퀀스 맵은 eYFP 발현 카세트의 성분을 나타낸다(Pcpc560-eYFP-TrrnB). HindIII 및 BamHI에 대한 제한 사이트의 위치가 표시됩니다. 이중 소화 후, DNA 단편의 예측 된 크기가 표시됩니다 : (1) 5,847 bp, (2) 2,004 bp, (3) 30 bp, (4) 374 bp, (5) 1,820 bp, (6) 1,289 bp 및 (7) 156 bp.(B)아가로즈 젤 (0.8% [w/v])) 125 V에서 60분 동안 소화된 레벨로 적재됨 T어셈블리(cpcBA-eYFP)는 밴드 1, 5 및 6을 나타낸, 밴드 1 및 2 및 DNA 사다리를 나타내는 소화된 빈 pPMQAK1-T 수용기 벡터(CT.0)를나타낸다(재료표). 밴드 3, 4 및 7은 젤을 시각화하기에 는 너무 작았습니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 5
그림 5: 성공적인 컨쥬게이션 에 이어 형질전환 시네시시스 PCC 6803 콜로니의 성장. BG11+Kan50 한천 플레이트에 인큐베이션한 후 막의 예가 도시되어 있다. (A)매우 효율적인 컨쥬게이션 에 따른 과성장 - Synechocystis PCC 6803 식민지는 개별 식민지가없는 잔디밭으로 발전했습니다. (B)12일 후에 수백 개의 개별 콜로니를 나타내는 양호한 활용 효율. (C)신선한 BG11+Kan50 한천 플레이트에 여러 차례 재줄무늬를 두드려14일 후 축균균의 성장. 세균 오염의 부재는 Synechocystis PCC 6803 트랜스컨주간트가 축색이었다는 것을 나타냈다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 6
도 6: 플레이트 리더를 이용한 대표적인 성장 데이터 및 정규화된 eYFP 형광 값. (a) 시네시시스PCC 6803 및 S. 신장UTEX 2973에서 cpcBA-eYFP또는 빈 pPMQAK1-T 벡터(CT.0, 음성 대조군)를 운반하는 균주의 성장 비교. 값은 4개의 생물학적 복제물로부터 ±SE를 의미한다. 시네시스 PCC 6803 및 S. 신장 UTEX 2973은 연속광(100 μmol 광자 m-2s-1)과함께 30°C에서 72시간 동안 배양하였고(100 μmol 광자m-1)및 40°C와 300 μmol 광자m-2s-1을각각 배양하였다. (B) 시네시시스 PCC 6803 또는 S. 신장 UTEX 2973에 대한 정규화된 eYFP 형광 값은 72h에서 cpcBA-eYFP와공액으로 결합된 값은 4개의 생물학적 복제물로부터 ±SE를 의미한다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 7
도 7: 유세포계를 이용한 대표적인 eYFP 형광 값. (A) "빈" 매체 용액(BG11 및 PBS)으로부터 의 방향(FSC-H) 및 측면(SSC-H) 분산형 플롯을전달합니다. (B) 시네시스 PCC 6803 샘플(오른쪽)에 대한 분산형 플롯. 원은 샘플 신호의 나머지 부분에서 시아노박테리아 집단을 게이팅하는 선택된 영역을 나타낸다. (C)빈 pPMQAK1-T 벡터를 운반하는 균주에 대한 게이트 된 영역의 히스토그램 (CT.0, 음성 대조군). (D)cpcBA-eYFP를 운반하는 균주에 대한 게이트 영역의 히스토그램. (e)eYFP 형광값은 시네시스 PCC 6803 및 S. 신장 UTEX 2973에서 72시간에서 세포당 형광을 빼게 되었다. 값은 4개의 생물학적 복제물로부터 ±SE를 의미한다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

아니요. 벡터 ID 이름 설명 5' 오버행 3' 오버행
1 pICH41233 프로 발기인 개그 (것)가있는 전술
2 pICH41295 프로 + 5U 프로모터 및 5î 번역되지 않은 영역 개그 (것)가있는 AATG
3 pAGM1251 프로 + 5U (f) N 말단 융합을 위한 프로모터 및 5î 번역되지 않은 시퀀스 개그 (것)가있는 CCAT
4 pICH41246 5u 5 전술 CCAT
5 pAGM1263 5U (f) 5′ N 터미널 융합에 대 한 번역 되지 않은 시퀀스 전술 CCAT
6 pICH41246 5U + NT1 5~번역되지 않은 지역 및 N 터미널 코딩 영역 전술 CCAT
7 pAGM1276 NT1 N 터미널 태그 또는 지역화 신호 CCAT AATG
8 pICH41258 Sp 신호 펩티드 AATG AGGT
9 pICH41258 NT2 N 터미널 태그 또는 지역화 신호 AATG AGGT
10 pAGM1287 CDS1 ns 정지 코돈없이 코딩 영역 AATG TTCG
11 pICH41308 CDS1 정류장 스톱 코돈이 있는 코딩 영역 AATG GCTT
12 pAGM1299 CDS2 ns 코딩 영역 - 코돈 시작 및 중지 없이 AGGT TTCG
13 pICH41264 CDS2 정류장 코딩 영역 - 시작없이 정지 코돈 AGGT GCTT
14 pAGM1301 코네티컷 C 터미널 태그 또는 지역화 신호 TTCG GCTT
15 pICH53388 3U 3 GCTT GGTA
16 pICH53399 Ter 터미네이터 GGTA CGCT
17 pICH41276 3U + 테르 3 GCTT CGCT
18 pICH41331 Cgm 완전한 유전자 카세트용 수락기 개그 (것)가있는 CGCT
19 pCA0.002 프로 (낮은 사본) 프로모터, 낮은 카피 번호 수락자 (pSC101 ori) 개그 (것)가있는 전술
20 pCA0.001 프로 TSS 전사 시작 부위로 잘린 프로모터 개그 (것)가있는 태그 ("tagc"
21 1층으로 직항 srRNA 작은 조절 RNA (번역 침묵용) 태그 ("tagc" GTTT
22 1층으로 직항 sgRNA 단일 가이드 RNA (CRISPRi용) 태그 ("tagc" GTTT
23 pICH41295 업 플랭크 대상 상동 재조합 사이트의 측면 시퀀스 상류 개그 (것)가있는 AATG
24 pICH41276 다운 플랭크 대상 상동 재조합 사이트의 측면 시퀀스 다운스트림 GCTT CGCT

표 1: 사용 가능한 수준 0 수락자 벡터 및 오버행 의 목록입니다. 벡터 1-18은 식물 MoClo 키트15에서입니다. 벡터 19-22는 시아노게이트키트(12)로부터이다. srRNA 및 sgRNA 부품의 경우, 합성된 서열 또는 PCR 제품은 레벨 1 수용자 벡터로 직접 조립됩니다. 벡터 23−24는 CyanoGate 키트를 사용하여 상동 재조합에 의해 변형을 위해 재사용된 플랜트 MoClo 키트에서 나온 것입니다.

BpiI 어셈블리 부품(레벨 0, T) BsaI 어셈블리 부품(레벨 1)
수용자 벡터의 50-100 ng 수용자 벡터의 50-100 ng
삽입할 각 벡터/부품에 대해 2:1 비율의 삽입: 허용자 벡터를 사용합니다. 삽입할 각 벡터/부품에 대해 2:1 비율의 삽입: 허용자 벡터를 사용합니다.
2 μL 10 mM ATP(재료 표) 2 μL 10 mM ATP(재료 표)
2 μL 버퍼 G(BpiI/BsaI용 버퍼) 2 μL 버퍼 G(BpiI/BsaI용 버퍼)
2 μL BSA (10x)(재료 표) 2 μL BSA (10x)(재료 표)
10 단위 BpiI (1 μL10 U/μL BpiI, 재료 표) 10 단위 BsaI (1 μL 10 U/μL BsaI, 재료 표)
dH 2O로 20μL로 가져오십시오. dH 2O로 20μL로 가져오십시오.
200 단위 T4 DNA 리가제 (1 μL 200 U/μL, 재료 표) 200 단위 T4 DNA 리가제 (1 μL 200 U/μL, 재료 표)
열자전거 프로토콜(레벨 0, T) 열자전거 프로토콜(레벨 1)
37 °C ( 10 분) 사이클 x 5 37 °C ( 10 분) 사이클 x 5
16 °C ( 10 분) 16 °C ( 10 분)
37 °C ( 20 분) 37 °C ( 20 분)
65 °C ( 10 분) 65 °C ( 10 분)
16 °C (보류) 16 °C (보류)

표 2: 레벨 0, 1 및 T의 골든 게이트 어셈블리에 대한 프로토콜입니다. 레벨 0 및 레벨 T 수용기 벡터에서 조립은 제한 효소 BpiI(왼쪽)를 사용합니다. 레벨 1 수용자 벡터에서 조립효소 BsaI(오른쪽)를 사용한다. 이 표는 바수데반 외12에서채택되었습니다.

프라이머 번호 시퀀스 (5'-3') 길이(bp) 설명
L0T 포워드 GTCTCATGAGCGGATACATA
TTTGAATG
28 레벨 0 및 레벨 T에서 증폭용
L1 역방향 가크트그그트그캣GC
아카스타크
26 레벨 1에서 증폭용
L1 포워드 CTGGGG카가ATATGT
GGTG
24 레벨 1에서 증폭용
L0T 역방향 TTGAGTGAGCT가타타크GCT 20 레벨 0 및 레벨 T에서 증폭용

표 3: 레벨 0, 1 및 T 벡터의 PCR 유효성 검사 또는 시퀀싱을 위한 프라이머 목록입니다.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

골든 게이트 어셈블리는 다른 벡터 어셈블리 방법에 비해 몇 가지 장점이 있으며, 특히 확장성20,21의측면에서. 그럼에도 불구하고 랩에서 골든 게이트 시스템을 설정하려면 다양한 부품과 수용자 벡터 라이브러리 및 전체 조립 프로세스에 익숙해지는 데 시간이 필요합니다. 더 복잡한 어셈블리를 위해 또는 많은 수의 복잡한 어셈블리를 병렬로 수행할 때(예: 여러 유전자 발현 카세트를 포함하는 레벨 T 벡터 제품군 만들기)에 신중한 계획이 필요한 경우가 많습니다. 먼저 필요한 모든 유전자 발현 카세트 조합을 나열한 다음 레벨 0에서 실리코 수준 T로 워크플로를 매핑하는 것이 좋습니다. 이 과정에서 사용자는 레벨 T에서 순차적이지 않은 레벨 1 벡터를 조립할 수 있는 플랜트 MoClo 키트에서 사용할 수 있는 레벨 1 "더미" 부품을 고려해야 합니다(예: 레벨 1 위치 1 및 위치 3 벡터는 "더미" 부품과 함께 조립할 수 있음) 레벨 1 위치 2), 이는15에필요한 조립 반응 및 복제 단계의 전체 수를 감소시킬 수 있다.

DNA 합성은 일반적으로 새로운 레벨 0 부품을 구축하기위한 가장 간단한 방법입니다. 그러나, 복제가 필요한 경우(예를 들어, 플라스미드 또는 게놈 DNA로부터), 증폭에 사용되는 프라이머의 설계를 최적화하는 것은 후속 레벨 0 벡터 어셈블리의 효율을 극대화하는 데 중요하다. 프라이머 설계에서 가장 중요한 두 단계는 다음과 같습니다: 1) 올바른 오버행이 포함되어 있고 전진 및 역방향 프라이머에 적합한 배향에 있는지 확인하는것(도 1표 1)및 2) 프라이머의 길이를 보장합니다. 템플릿에 대한 어닐레가 충분히 긴 서열(18−30 bp)이고 이 서열에 대한 Tm 값이 프라이머 쌍(이상적으로 58−62°C)과 유사하다는 서열(도1A). 시퀀스에 국내화가 필요한 경우 몇 가지 전략을 사용할 수 있습니다. 짧은 서열(예를 들어, <200 bp)의 경우, 한 쌍의 긴 전진 및 역방향 프라이머는 3′가 서로 어닐을 종료하는 설계될 수 있습니다(즉, >20 bp의 중첩) 증폭 후 이중 연선 서열을 형성합니다. 더 긴 서열의 경우, 서열의 별도의 단편은 불법 제한 사이트를 제거한 다음 골든 게이트 어셈블리 접근법을 사용하여 조립되도록 증폭될 수있다(그림 2). PCR 제품을 사용한 조립 효율이 낮은 경우, 레벨 0 서열의 개별 프래그먼트를 레벨 1 범용 수용기 벡터(pAGM1311)로 복제하고, 검증한 다음, 적절한 레벨 0 수용기벡터(15)로함께 조립될 수 있다. 효율적인 골든 게이트 어셈블리를 위해 2:1 인서트를:수용기 벡터 몰 비율을 권장합니다. 그러나 2-3개의 벡터(예: 두 개의 레벨 0 파트와 레벨 1 수용자 벡터)의 어셈블리의 경우 각 벡터의 ~100ng를 정기적으로 결합하면 일반적으로 성공적인 어셈블리가 발생합니다. 어셈블리의 효율은 반응당 사용되는 벡터 수가 증가함에 따라 감소하는 경향이 있으며, 그 결과 변환 후 백색 콜로니의 총 수가 감소합니다(그림3).

컨쥬게이션에 앞서 제한 다이제스트 및 PCR에 의한 최종 레벨 T 벡터의 유효성 검사를 권장합니다. 부부 DNA 전달은 자연적으로 변형되지 않는 것을 포함하여 시아노박테리아 균주에 대한 잘 구형 기술이다41,45. 활용 프로토콜의 중요한 단계는 다음과 같습니다 : 1) 도우미 대장균 균주의 주의 처리 는 밤새 성장 (예를 들어, 소용돌이를 피하십시오)35,2) 도우미를 성장하는 데 사용되는 항생제의 흔적을 완전히 제거하기 위해 주의를 기울이고 화물 대장균 균주, 3) 화물 및 도우미 균주와 시아노박테리아의 혼합물에 대한 적절한 잠복기(예를 들어, 더 긴 잠복기는 S. longatus UTEX 2973에 중요하였다), 및 4) 세포의 초기 이송 기간 24 시간 동안 항생제가 결여된 LB-BG11 한천 플레이트의 멤브레인에 혼합물.

분리된 시아노박테리아 콜로니는 Synechocystis PCC 6803 및 S. longlongatus UTEX 2973에 대한 2주 이내에 막에서 개발되어야 하며, 그렇지 않으면 컨쥬게이션이 실패했을 가능성이 높습니다. 프로토콜에 대한 몇 가지 변형은 1)더 높은 시작 밀도를 가진 시아노박테리아 배양재를 사용하여(예를 들어, OD750 = 1.5−2)를 포함하여 시험될 수 있었다; 2) 멤브레인으로 이송하기 전에 잠복기를 증가; 및 3) 막에 대한 초기 잠복기를 24시간에서 48시간으로 연장한다(즉, 이송된 벡터에 대한 항생제 내성 유전자의 발현에 더 많은 시간을 허용한다). 컨쥬게이션이 여전히 실패하면 전기 천공과 같은 대체 방법을 시도 할 수있습니다 53. 형질전환 시아노박테리아 균주가 축세포균을 확인하는 것은 추가 실험에 앞서 중요하다. 마지막으로, 형질전환 시아노박테리아 균주에서 이종 벡터의 크기를 확인하는 것이 좋다. 후자는 DNA 추출(섹션 5), 대장균 및 선택(섹션 2.1) 및 벡터 유효성 검사(섹션 2.4)로의 변환이 필요합니다.

개략적인 프로모터 특성화 프로토콜은 높은 처리량 스크리닝 방법론을 달성하기 위한 수단으로 작은 배양량(즉, 2 mL)을 사용합니다. 사용 가능한 광생물 반응기 공간에 따라 더 큰 볼륨을 사용할 수 있으며, 이는 배양 증발 문제를 완화하는 데 도움이 될 것입니다. 소량의 배양량을 가진 높은 처리량 스크리닝이 필요한 경우, 증발을 억제하기 위해 성장 챔버 내에 높은 습도를 가져야 합니다. 성장 실험 중 증발은 시료 측정의 정확성과 타당성에 해로울 수 있습니다. 실험 중 및 실험 후 배양 량을 확인하여 얼마나 많은 증발이 발생했는지 확인하십시오.

플레이트 리더 측정의 경우 안정적이고 재현 가능한 성장 및 형광 데이터를 수집하기 위해 낮은 밀도(이상적으로 OD750 < 1)에서 배양을 측정하는 것이 중요합니다. 셀 번호와 OD750 사이의 선형 관계는 특정범위(54)내에서만 관찰된다. 이 범위를 설정하려면 eYFP 형광이 확인된 알려진 형질변형을 사용하여 직렬 희석(예: OD750 = 0.1-1.0)을 수행하는 것이 좋습니다. 정규화된 형광(eYFP 형광/OD750)에대해 절대 형광을 플로팅하면 배양 밀도의 선형 작동 범위를 식별하는 데 도움이 됩니다. 몇몇 플레이트 판독기에는 형광 검출기의 감도를 수정하는 "게인" 기능이 포함되어 있습니다. 이 경우 게인 값은 실험을 시작하기 전에 적절한 수준으로 설정되어야 하며 서로 다른 실험 실행 간에 변경되지 않거나 데이터가 직접 비교되지 않아야 합니다.

상이한 유동 세포계의 작동은 제조사마다 다를 수 있지만, 임의의 배경 신호로부터 대상 시아노박테리아 집단의 식별 및 게이팅을 용이하게 하기 위해 배지 용액의 빈 판독을 하는 것이 중요하다. 매체(그림 7A, B). 이에 따라, 음의 대조군 샘플(예를 들어, 야생형 균주)의 형광 값의 빼기는 네이티브 자가형광을 제거하는 데 도움이 될것이다(도 7C,D). 유세포계의 광증배기 튜브(PMT) 전압 파라미터는 플레이트 리더의 이득, 즉 형광 신호의 강도에 대한 검출기의 감도를 증가 또는 감소시키는 것과 유사한 기능을 갖는다. 플레이트 리더와 마찬가지로 PMT 전압은 실험55를시작하기 전에 적절한 수준으로 설정되어야 합니다. 일단 설정되면, PMT 전압 값은 다른 실험 실행 사이에 유지되어야하거나 데이터는 직접 비교되지 않습니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 공개 할 것이 없다.

Acknowledgments

저자는 산업 생명 공학 및 생명 에너지 (NIBB)의 PHYCONET 생명 공학 및 생물 과학 연구 위원회 (BBSRC) 네트워크와 금융 지원을위한 산업 생명 공학 혁신 센터 (IBioIC)에 감사드립니다. GARG, AASO 및 AP는 BBSRC EASTBIO CASE 박사 프로그램(보조금 번호 BB/M010996/1), 콘세조 나시오날 드 시엔시아 y 테크놀로지아(CONACYT) 박사 프로그램, IBioIC-BBSRC 협력 교육 파트너십(CTP) 박사 프로그램, 각각. 콘래드 멀리노(런던 퀸 메리 대학교) 및 폴 에릭 젠슨과 줄리 안네마리 지타 제들러(코펜하겐 대학교)에게 플라스미드 벡터 및 프로토콜 기여와 조언에 감사드립니다.

Materials

Name Company Catalog Number Comments
5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal) Thermo Fisher Scientific R0404 Used in 2.1.3.
Adenosine 5′-triphosphate (ATP) disodium salt Sigma-Aldrich A2383 Used in Table 2.
Agar (microbiology tested) Sigma-Aldrich A1296-500g Used in 8.3.
Agarose Bioline BIO-41026 Used in 6.
Attune NxT Flow Cytometer Thermo Fisher Scientific - Used in 4.3.1.
Bovine Serum Albumin (BSA) Sigma-Aldrich A2153 Used in Table 2.
BpiI (BbsI) Thermo Fisher Scientific ER1011 Used in Table 2.
BsaI (Eco31I) Thermo Fisher Scientific ER0291 Used in Table 2.
Carbenicillin disodium VWR International A1491.0005 Used in 2.1.3.
Corning Costar TC-Treated flat-bottom 24 well plates Sigma-Aldrich CLS3527 Used in 4.1.3.
Dimethyl Sulfoxide (DMSO) Thermo Fisher Scientific BP231-100 Used in 3.6.2.
DNeasy Plant Mini Kit Qiagen 69104 DNA extraction kit. Used in 5.
FLUOstar Omega Microplate reader BMG Labtech - Used in 4.2.2.
GeneJET Plasmid Miniprep Kit Thermo Fisher Scientific K0503 Plasmid purification kit. Used in step 2.3.2.
Glass beads (0.5 mm diameter) BioSpec Products 11079105 Used in 5.2.
Glycerol Thermo Fisher Scientific 10021083 Used in 2.3.1, 3.6.2.
Isopropyl-beta-D-thiogalactopyranoside (IPTG) Thermo Fisher Scientific 10356553 Used in 2.1.3.
Kanamycin sulphate (Gibco) Thermo Fisher Scientific 11815-024 Used in 2.1.3.
Membrane filters (0.45 μm) MF-Millipore HAWP02500 Used in 3.3.7
Microplates, 96-well, flat-bottom (Chimney Well) µCLEAR Greiner Bio-One 655096 Used in 4.2.1.
Monarch DNA Gel Extraction Kit New England Biolabs T1020S Used in 1.1.2.2.
Monarch PCR DNA Cleanup Kit New England Biolabs T1030 DNA purification kit. Used in 1.1.2.3.
Multitron Pro incubator with LEDs Infors HT - Shaking incubator with white LED lights. Used in 4.1.4.
MyTaq DNA Polymerase Bioline BIO-21108 Used in 7.1.
NanoDrop One Thermo Fisher Scientific ND-ONE-W Used in 2.3.3.
One Shot TOP10 chemically competent E. coli Thermo Fisher Scientific C404010 Used in 2.1.1.
Phosphate buffer saline (PBS) solution (10X concentrate) VWR International K813 Used in 4.3.2.
Q5High-Fidelity DNA Polymerase New England Biolabs M0491S Used in 1.1.2.1.
Quick-Load 1 kb DNA Ladder New England Biolabs N0468S Used in Figure 4.
Screw-cap tubes (1.5 ml) Starstedt 72.692.210 Used in 3.6.3
Spectinomycin dihydrochloride pentahydrate VWR International J61820.06 Used in 2.1.3.
Sterilin Clear Microtiter round-bottom 96-well plates Thermo Fisher Scientific 612U96 Used in 4.3.1.
T4 DNA ligase Thermo Fisher Scientific EL0011 Used in Table 2.
TissueLyser II Qiagen 85300 Bead mill. Used in 5.2.

DOWNLOAD MATERIALS LIST

References

  1. Luan, G., Lu, X. Tailoring cyanobacterial cell factory for improved industrial properties. Biotechnology Advances. 36, (2), 430-442 (2018).
  2. Madsen, M. A., Semerdzhiev, S., Amtmann, A., Tonon, T. Engineering mannitol biosynthesis in Escherichia coli and Synechococcus sp. PCC 7002 using a green algal fusion protein. ACS Synthetic Biology. 7, (12), 2833-2840 (2018).
  3. Menin, B., et al. Non-endogenous ketocarotenoid accumulation in engineered Synechocystis sp. PCC 6803. Physiologia Plantarum. 166, (1), 403-412 (2019).
  4. Varman, A. M., Yu, Y., You, L., Tang, Y. J. Photoautotrophic production of D-lactic acid in an engineered cyanobacterium. Microbial Cell Factories. 12, (1), 1-8 (2013).
  5. Vavitsas, K., et al. Responses of Synechocystis sp. PCC 6803 to heterologous biosynthetic pathways. Microbial Cell Factories. 16, 140 (2017).
  6. Yang, G., et al. Photosynthetic production of sunscreen shinorine using an engineered cyanobacterium. ACS Synthetic Biology. 7, (2), 664-671 (2018).
  7. Nielsen, A. Z., et al. Extending the biosynthetic repertoires of cyanobacteria and chloroplasts. Plant Journal. 87, (1), 87-102 (2016).
  8. Nielsen, J., Keasling, J. D. Engineering cellular metabolism. Cell. 164, (6), 1185-1197 (2016).
  9. Stensjö, K., Vavitsas, K., Tyystjärvi, T. Harnessing transcription for bioproduction in cyanobacteria. Physiologia Plantarum. 162, (2), 148-155 (2018).
  10. Santos-Merino, M., Singh, A. K., Ducat, D. C. New applications of synthetic biology tools for cyanobacterial metabolic engineering. Frontiers in Bioengineering and Biotechnology. 7, 1-24 (2019).
  11. Lea-Smith, D. J., Vasudevan, R., Howe, C. J. Generation of marked and markerless mutants in model cyanobacterial species. Journal of Visualized Experiments. 111, e54001 (2016).
  12. Vasudevan, R., et al. CyanoGate: A modular cloning suite for engineering cyanobacteria based on the plant MoClo syntax. Plant Physiology. 180, (1), 39-55 (2019).
  13. Andreou, A. I., Nakayama, N. Mobius assembly: A versatile golden-gate framework towards universal DNA assembly. PLoS ONE. 13, (1), 1-18 (2018).
  14. Crozet, P., et al. Birth of a Photosynthetic Chassis: A MoClo toolkit enabling synthetic biology in the microalga Chlamydomonas reinhardtii. ACS Synthetic Biology. 7, (9), 2074-2086 (2018).
  15. Engler, C., et al. A Golden Gate modular cloning toolbox for plants. ACS Synthetic Biology. 3, (11), 839-843 (2014).
  16. Moore, S. J., et al. EcoFlex: A multifunctional MoClo kit for E. coli synthetic biology. ACS Synthetic Biology. 5, (10), 1059-1069 (2016).
  17. Pollak, B., et al. Loop assembly: a simple and open system for recursive fabrication of DNA circuits. New Phytologist. 222, (1), 628-640 (2019).
  18. Werner, S., Engler, C., Weber, E., Gruetzner, R., Marillonnet, S. Fast track assembly of multigene constructs using golden gate cloning and the MoClo system. Bioengineered Bugs. 3, (1), 38-43 (2012).
  19. Patron, N. J., et al. Standards for plant synthetic biology: a common syntax for exchange of DNA parts. New Phytologist. 208, (1), 13-19 (2015).
  20. Chao, R., Mishra, S., Si, T., Zhao, H. Engineering biological systems using automated biofoundries. Metabolic Engineering. 42, 98-108 (2017).
  21. Chambers, S., Kitney, R., Freemont, P. The Foundry: the DNA synthesis and construction Foundry at Imperial College. Biochemical Society Transactions. 44, (3), 687-688 (2016).
  22. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  23. Rosano, G. L., Ceccarelli, E. A. Rare codon content affects the solubility of recombinant proteins in a codon bias-adjusted Escherichia coli strain. Microbial Cell Factories. 8, 1-9 (2009).
  24. Cambray, G., et al. Measurement and modeling of intrinsic transcription terminators. Nucleic Acids Research. 41, (9), 5139-5148 (2013).
  25. Chen, Y. J., et al. Characterization of 582 natural and synthetic terminators and quantification of their design constraints. Nature Methods. 10, (7), 659-664 (2013).
  26. Münch, R., et al. Virtual Footprint and PRODORIC: An integrative framework for regulon prediction in prokaryotes. Bioinformatics. 21, (22), 4187-4189 (2005).
  27. Salis, H. M., Mirsky, E. A., Voigt, C. A. Automated design of synthetic ribosome binding sites to control protein expression. Nature Biotechnology. 27, (10), 946-950 (2009).
  28. Englund, E., Liang, F., Lindberg, P. Evaluation of promoters and ribosome binding sites for biotechnological applications in the unicellular cyanobacterium Synechocystis sp. PCC 6803. Scientific Reports. 6, 36640 (2016).
  29. Heidorn, T., et al. Synthetic biology in cyanobacteria engineering and analyzing novel functions. Methods in Enzymology. 497, 539-579 (2011).
  30. Thiel, K., et al. Translation efficiency of heterologous proteins is significantly affected by the genetic context of RBS sequences in engineered cyanobacterium Synechocystis sp. PCC 6803. Microbial Cell Factories. 17, 34 (2018).
  31. Liu, Q., Schumacher, J., Wan, X., Lou, C., Wang, B. Orthogonality and burdens of heterologous and gate gene circuits in E. coli. ACS Synthetic Biology. 7, (2), 553-564 (2018).
  32. Ferreira, E. A., et al. Expanding the toolbox for Synechocystis sp. PCC 6803: Validation of replicative vectors and characterization of a novel set of promoters. Synthetic Biology. (August), 1-39 (2018).
  33. Liang, F., Lindblad, P. Synechocystis PCC 6803 overexpressing RuBisCO grow faster with increased photosynthesis. Metabolic Engineering Communications. 4, 29-36 (2017).
  34. Taton, A., et al. Broad-host-range vector system for synthetic biology and biotechnology in cyanobacteria. Nucleic Acids Research. 42, (17), e136 (2014).
  35. Elhai, J., Wolk, C. P. Conjugal transfer of DNA to cyanobacteria. Methods in Enzymology. 167, (1984), 747-754 (1988).
  36. Gormley, E. P., Davies, J. Transfer of plasmid RSF1010 by conjugation from Escherichia coli to Streptomyces lividans and Mycobacterium smegmatis. Journal of Bacteriology. 173, (21), 6705-6708 (1991).
  37. Huang, H. H., Camsund, D., Lindblad, P., Heidorn, T. Design and characterization of molecular tools for a synthetic biology approach towards developing cyanobacterial biotechnology. Nucleic Acids Research. 38, (8), 2577-2593 (2010).
  38. Huang, H. H., Lindblad, P. Wide-dynamic-range promoters engineered for cyanobacteria. Journal of Biological Engineering. 7, 10 (2013).
  39. Li, S., Sun, T., Xu, C., Chen, L., Zhang, W. Development and optimization of genetic toolboxes for a fast-growing cyanobacterium Synechococcus elongatus UTEX 2973. Metabolic Engineering. 48, 163-174 (2018).
  40. Pansegrau, W., Balzer, D., Kruft, V., Lurz, R., Lanka, E. In vitro assembly of relaxosomes at the transfer origin of plasmid RP4. Proceedings of the National Academy of Sciences, USA. 87, (17), 6555-6559 (1990).
  41. Song, K., Tan, X., Liang, Y., Lu, X. The potential of Synechococcus elongatus UTEX 2973 for sugar feedstock production. Applied Microbiology and Biotechnology. 100, (18), 7865-7875 (2016).
  42. Waters, V. L., Guiney, D. G. Processes at the nick region link conjugation, T-DNA transfer and rolling circle replication. Molecular Microbiology. 9, (6), 1123-1130 (1993).
  43. Elhai, J., Vepritskiy, A., Muro-Pastor, A. M., Flores, E., Wolk, C. P. Reduction of conjugal transfer efficiency by three restriction activities of Anabaena sp. strain PCC 7120. Journal of Bacteriology. 179, (6), 1998-2005 (1997).
  44. Silva-Rocha, R., et al. The Standard European Vector Architecture (SEVA): A coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research. 41, (D1), D666-D675 (2013).
  45. Mandakovic, D., et al. CyDiv, a conserved and novel filamentous cyanobacterial cell division protein involved in septum localization. Frontiers in Microbiology. 7, (FEB), 1-11 (2016).
  46. Masukawa, H., Inoue, K., Sakurai, H., Wolk, C. P., Hausinger, R. P. Site-directed mutagenesis of the Anabaena sp. strain PCC 7120 nitrogenase active site to increase photobiological hydrogen production. Applied and Environmental Microbiology. 76, (20), 6741-6750 (2010).
  47. Yu, J., et al. Synechococcus elongatus UTEX 2973, a fast growing cyanobacterial chassis for biosynthesis using light and CO2. Scientific Reports. 5, (1), 8132 (2015).
  48. Ungerer, J., Wendt, K. E., Hendry, J. I., Maranas, C. D., Pakrasi, H. B. Comparative genomics reveals the molecular determinants of rapid growth of the cyanobacterium Synechococcus elongatus UTEX 2973. Proceedings of the National Academy of Sciences, USA. 115, (50), E11761-E11770 (2018).
  49. Lepesteur, M., Martin, J. M., Fleury, A. A comparative study of different preservation methods for phytoplankton cell analysis by flow cytometry. Marine Ecology Progress Series. 93, (1-2), 55-63 (1993).
  50. Day, J. G. Cryopreservation of cyanobacteria. Cyanobacteria: An Economic perspective. Wiley Blackwell. New York. 319-327 (2014).
  51. Zhou, J., et al. Discovery of a super-strong promoter enables efficient production of heterologous proteins in cyanobacteria. Scientific Reports. 4, 4500 (2014).
  52. Potapov, V., et al. Comprehensive profiling of four base overhang ligation fidelity by T4 DNA ligase and application to DNA assembly. ACS Synthetic Biology. 7, (11), 2665-2674 (2018).
  53. Ravindran, C. R. M., Suguna, S., Shanmugasundaram, S. Electroporation as a tool to transfer the plasmid pRL489 in Oscillatoria MKU 277. Journal of Microbiological Methods. 66, 174-176 (2006).
  54. Stevenson, K., McVey, A. F., Clark, I. B. N., Swain, P. S., Pilizota, T. General calibration of microbial growth in microplate readers. Scientific Reports. 6, 38828 (2016).
  55. Maecker, H. T., Trotter, J. Flow cytometry controls, instrument setup, and the determination of positivity. Cytometry Part A. 69, (9), 1037-1042 (2006).
시안게이트 모듈형 복제 툴킷을 사용하여 컨쥬게이션에 의한 시아노박테리아의 유전자 변형
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Gale, G. A. R., Schiavon Osorio, A. A., Puzorjov, A., Wang, B., McCormick, A. J. Genetic Modification of Cyanobacteria by Conjugation Using the CyanoGate Modular Cloning Toolkit. J. Vis. Exp. (152), e60451, doi:10.3791/60451 (2019).More

Gale, G. A. R., Schiavon Osorio, A. A., Puzorjov, A., Wang, B., McCormick, A. J. Genetic Modification of Cyanobacteria by Conjugation Using the CyanoGate Modular Cloning Toolkit. J. Vis. Exp. (152), e60451, doi:10.3791/60451 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter