Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

استخدام الأجنة المذابة بالتجميد لإنتاج الفئران المعدلة وراثياً بكفاءة عالية

doi: 10.3791/60808 Published: April 2, 2020
* These authors contributed equally

Summary

هنا، نقدم طريقة معدلة للحفظ بالتبريد للأجنة ذات الخلية الواحدة، فضلا عن بروتوكول يُشبه استخدام الأجنة المذابة بالتجميد والكهربية من أجل الجيل الفعال من الفئران المعدلة وراثيا.

Abstract

أصبح استخدام الفئران المعدلة وراثياً أمراً حاسماً لفهم وظيفة الجينات وفك رموز الآليات الأساسية للأمراض البشرية. يسمح نظام CRISPR/Cas9 للباحثين بتعديل الجينوم بكفاءة وإخلاص وبساطة لم يسبق لها مثيل. تسخير هذه التكنولوجيا ، والباحثين يبحثون عن بروتوكول سريع وفعال وسهل لتوليد الفئران المعدلة وراثيا. هنا نقدم طريقة محسنة للحفظ بالتبريد للأجنة ذات الخلية الواحدة التي تؤدي إلى معدل نمو أعلى للأجنة المذابة بالتجميد. من خلال الجمع بين ذلك مع ظروف الكهربة الأمثل ، يسمح هذا البروتوكول بتوليد فئران بالضربة القاضية وتدق بكفاءة عالية ومعدلات فسيفساء منخفضة في غضون وقت قصير. وعلاوة على ذلك، نعرض شرحا خطوة بخطوة لبروتوكولنا الأمثل، الذي يغطي إعداد كاشف CRISPR، وفي الإخصاب في المختبر، والحفاظ على التبريد وذوبان الأجنة من خلية واحدة، والكهرباء من الكواشف CRISPR، وتوليد الماوس، والنماذج الجينية للمؤسسين. باستخدام هذا البروتوكول، يجب أن يكون الباحثون قادرين على إعداد فئران جنرال موتورز بسهولة وسرعة وكفاءة لا مثيل لها.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

المجمعة بانتظام متباعدة قصيرة palindromic يكرر (CRISPR) / CRISPR المرتبطة بروتين 9 (Cas9) النظام هو اختراق العلمية التي توفر التعديل المستهدف لم يسبق له مثيل في الجينوم1. يتكون نظام CRISPR/Cas9 من بروتين Cas9 ودليل RNA (gRNA) مع اثنين من المكونات الجزيئية: الحمض النووي الريبي CRISPR المحدد (crRNA) وCRISPR RNA عبر التنشيط (tracrRNA)2 . وgRNA يوجه بروتين Cas9 إلى مكان محدد في الجينوم، 20 النيوكليوتيدات المكملة لcrRNA، والمتاخمة للعزر البروتوساتير المجاورة (PAM). يرتبط بروتين Cas9 بالتسلسل المستهدف ويحفز فواصل حبلا مزدوجة (DSBs) التي يتم إصلاحها إما عن طريق الانضمام إلى النهاية غير المتجانسة المعرضة للخطأ (NHEJ) أو إصلاح توجيه homology عالي الدقة (HDR)3،4،5. ويؤدي دليل النهيج إلى عمليات إدراج أو/وحذف (indels)، وبالتالي إلى فقدان الجينات للوظيفة عندما يتم استهداف تسلسل الترميز. HDR يؤدي إلى تحرير الجينوم دقيقة في وجود قالب إصلاح يحتوي على تسلسل homology3،4،5. وقد تم تسخير NHEJ وHDR لتوليد الفئران بالضربة القاضية وتدق في، على التوالي.

في حين أن نظام CRISPR/Cas9 قد سرّع بشكل ملحوظ من توليد فئران جنرال موتورز ذات الفعالية والإخلاص المتميزين، فإن العلماء الذين يطبقون هذه الأساليب غالبًا ما يواجهون تحديات تقنية. أولاً، تتطلب البروتوكولات التقليدية الحقن المجهري لإدخال أدوات تحرير CRISPR في النواة الأولية للبويضات المخصبة6،7. هذه التقنية تستغرق وقتا طويلا وعادة ما تتطلب تدريبا مكثفا. وهكذا، عدة مجموعات استبدال الحقن المجهري مع الكهربة8،9،10،11،12،13. ومع ذلك ، في بروتوكولات الكهربة المبكرة تم استخدام الأجنة الطازجة للتكهرب. وهذا تسبب في مشكلة أخرى ، لأن إعداد الأجنة الطازجة قبل كل تجربة أمر صعب14.

في الآونة الأخيرة قمنا نحن وآخرون بالجمع بين استخدام الأجنة المذابة بالتجميد والكهرباء لتحرير الجينوم ، مما يسهل توليد الفئران المعدلة وراثيا15،16. ويمكّن هذا البروتوكول الباحثين الذين لا يملكون مهارات متقدمة في التلاعب بالأجنة من توليد نماذج الحيوانات بسرعة من الأمراض البشرية بكفاءة عالية. البروتوكول يقلل أيضا بشكل كبير من التحديات العملية في توليد الفئران المعدلة وراثيا، مثل عدم التجانس الجيني في المؤسسين16. للتغلب على الفسيفساء ، نقوم بإجراء الكهربورة لكواشف CRISPR في غضون ساعة واحدة بعد إذابة الجنين لضمان حدوث التحرير قبل النسخ المتماثل الأول للجينوم. تحسين آخر يشمل استخدام بروتين Cas9 بدلا من Cas9 مرنا للحد من الفسيفساء غير المرغوب فيها17. وعلاوة على ذلك، قمنا بتطوير طريقة مثالية للحفاظ على التبريد الجنين يخلية واحدة أن يزيد من معدل النمو إلى المرحلة الثانية من الخلية16: استخدام مصل الأبقار الجنينية (FBS) يحسن بشكل كبير بقاء البويضات المذابة بالتجميد بعد الإخصاب، وربما من خلال نفس الآلية التي تجعل البويضات غير المخصبة المذابة بالتجميد أكثر مرونة18.

نقدم هنا بروتوكولًا شاملًا لتوليد فئران المعدلة وراثياً باستخدام أجنة مذابة بالتجميد، بما في ذلك الطريقة المعدلة للحفظ بالتبريد لأجنة C57BL/6J ذات الخلية الواحدة. ويشمل 1) تصميم gRNA، إعداد كاشف CRISPR والتجميع؛ 2) التلقيح الاصطناعي، والحفاظ على التبريد، وذوبان الأجنة من خلية واحدة؛ 3) الكهربية من الكواشف CRISPR في الأجنة المذابة بالتجميد؛ 4) نقل الجنين إلى أوفيقناة الفئران الأنثوية الحامل للحوامل؛ 5) Genotyping وتحليل تسلسل الحيوانات مؤسس F0.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

وقد تم إجراء جميع الرعاية والإجراءات الحيوانية التي أجريت في هذه الدراسة وفقا لقواعد ولوائح دليل رعاية واستخدام الحيوانات المختبرية. تمت الموافقة على البروتوكول التجريبي من قبل لجنة رعاية الحيوانات من الحيوانات المختبرية من جامعة توياما، جامعة طوكيو، جامعة جيتشي، ومعهد ماكس بلانك فلوريدا لعلم الأعصاب. يتم عرض معلومات حول جميع الكواشف في جدول المواد.

1. تصميم الكواشف CRISPR

  1. تصميم crRNA
    1. قم بزيارة CRISPR Direct19 (https://crispr.dbcls.jp/) لتصميم crRNAs محددة مع مواقع مخفضة خارج الهدف.
      ملاحظة: هناك العديد من الأدوات المفيدة الأخرى لتصميم crRNA20 (https://bioinfogp.cnb.csic.es/tools/wereview/crisprtools/).
    2. إدراج تسلسل النيوكليوتيدات الهدف وإجراء التغييرات التالية:
      متطلبات تسلسل PAM = NGG
      التحقق من التحديد = الجينوم الماوس (Musculus) ، GRCm38/mm10 (ديسمبر 2011)
      ملاحظة: على سبيل المثال، لتوليد تيروزيناز (تير) الفئران بالضربة القاضية، تم استهداف exon 2 (تسلسل النيوكليوتيدات من 9476-9692).
    3. انقر فوق التصميم، وللحصول على زيارات محددة للغاية ، علامة إظهار هدف محدد للغاية فقط.
    4. للحد من الآثار المحتملة خارج الهدف، اختر التسلسل المستهدف بأقل قيمة في أعمدة"12 mer+PAM"و"8 mer+PAM".
      ملاحظة: في هذه الأعمدة، ("1") يشير إلى أن التسلسل له تطابق مثالي واحد فقط مع الموقع المستهدف المقصود والأرقام أكبر من واحد تشير إلى وجود مواقع محتملة خارج الهدف.
    5. ترتيب oligonucleotides الناتجة من شركات تجميع crRNA(جدول Supplimentary 1).
      ملاحظة: بالنسبة لجين Exon 2 Tyr ، تم استخدام تسلسل الهدف التالي: GGACCACTATTACGTATATCC ، مع +TGG كتسلسل PAM(الشكل 2A).
  2. تصميم oligodeoxynucleotide (ssODN) واحد حبلا ً لتجارب التحرير بوساطة HDR (أي توليد الفئران المنبهة).
    1. تصميم طول ssODN ليكون حوالي 80-180 bp بما في ذلك 30-60 النيوكليوتيدات (nt) الأسلحة homology على كلا الجانبين.
      ملاحظة: أظهر ssODN من 75-85 nt طول، بما في ذلك ذراع 30-35 nt homology ومكملة لgRNA، عالية طرق في كفاءة التحرير21.
    2. إدراج التعديل المقصود والطفرة الصامتة في تسلسل PAM أو، إن لم يكن ذلك ممكنا، في قاعدة 5' المجاورة من PAM لمنع إعادة القطع بعد تحرير الجينوم.
      ملاحظة: يتم سرد crRNA و ssODN المستخدمة في هذه الدراسة في الجدول التكميلي 1.

2. الإخصاب في المختبر، والحفاظ على التبريد الجنين، وذوبان التجميد

  1. الإخصاب في المختبر
    1. Superovulate C57BL/6J الفئران الإناث (4 أو 8 أسابيع من العمر) عن طريق حقن IP مع الحوامل mare مصل gonadotropin (PMSG) تليها الحقن مع 7.5 وحدة دولية gonadotropin الإنسان الكوريوري (hCG) بعد 48 ساعة.
      ملاحظة: يمكن زيادة عدد البويضات البويضة بنحو 3x باستخدام فائقة الإباضة22.
    2. إزالة epididymides cauda من الفئران الذكور C57BL/6J ناضجة جنسيا (3-5 أشهر من العمر).
      ملاحظة: من الممكن جمع الحيوانات المنوية دون التضحية بالفئران الذكور.
    3. استخراج جلطات الحيوانات المنوية مع إبرة تشريح واحتضان لهم في قطرة 200 ميكرولتر من السائل البوقي البشري (HTF) في حاضنة CO2 لمدة 1.5 ساعة للcapacitation.
    4. جمع مجمعات cumulus-oocyte (COCs) من oviducts 16-18 ساعة بعد حقن hCG واحتضانها في قطرة جديدة 200 ميكرولتر من متوسط HTF مغطاة بسائل البارافين في حاضنة CO2 (5٪ CO2، 37 درجة مئوية) لمدة لا تزيد عن 2 ساعة.
      ملاحظة: من الأفضل التضحية بالفئران عن طريق خلع عنق الرحم تحت التخدير لأن القتل الرحيم عن طريق استنشاق CO2 يؤثر على التلقيح الاصطناعي وتطور الجنين23.
    5. أضف 1-5 ميكرولتر من تعليق الحيوانات المنوية من حدود وسيط الحضانة إلى قطرة 200 ميكرولتر من متوسط HTF الذي يحتوي على COCs واحتضانها في حاضنة CO2 لمدة 3 ساعة.
    6. غسل البويضات مع البوتاسيوم المكمل بسيطة الأمثل المتوسطة (KSOM) 3x لإزالة الحيوانات المنوية المتبقية وخلايا الكمون.
    7. تحقق من التكوين النووي والصف من الأجنة خلية واحدة باستخدام المجهر مقلوب.
  2. الحفظ بالتبريد للأجنة ذات الخلية الواحدة
    1. احتضان أجنة ذات خلية واحدة في قطرة 200 ميكرولتر من HTF تحتوي على 20٪ FBS (غير مغطاة بسائل البارافين) لمدة 10 دقيقة في حاضنة CO2.
    2. نقل 20-100 جنين إلى 50 ميكرولتر من محلول 1 M ثنائي ميثيل سلفوكسيد (DMSO)24.
    3. نقل 5 ميكرولتر من محلول يحتوي على 100 جنين إلى قاع أنبوب التبريد وبارد لمدة 5 دقيقة عند 0 درجة مئوية باستخدام مبرد أو على الجليد.
    4. أضف محلول 45 ميكرولتر من DAP213 (2 M dimethyl sulfoxide، 1 M acetamide، و 3 M البروبيلين غليكول) محلول ببطء على طول جدار الأنبوب، وغطاء الأنابيب، والحفاظ على لمدة 5 دقيقة في المبرد أو على الجليد في 0 درجة مئوية.
      ملاحظة: لا تربط القبعات بإحكام شديد لإزالتها بسهولة أثناء ذوبان العينة.
    5. تخزين الأنابيب بسرعة في النيتروجين السائل.
  3. إذابة الجنين
    1. افتح غطاء الأنبوب الجليدي، وتخلص من النيتروجين السائل المتبقي، وأضف 900 ميكرولتر من محلول السكروز 0.25 متر متسخين مسبقًا إلى 37 درجة مئوية.
      ملاحظة: يجب تسخين محلول السكروز بـ 0.25 متر إلى 37 درجة مئوية مقدمًا لأن استخدام محلول البارد يقلل من صلاحية الجنين بعد الذوبان.
    2. Pipet بسرعة ل10x ونقل محتويات cryotube إلى طبق من البلاستيك.
      ملاحظة: يجب إجراء الأنابيب بعناية، بحيث لا يتم إنشاء فقاعات وتلف الأجنة.
    3. غسل البويضات المخصبة الطبيعية المورفولوجية 2x في متوسط KSOM مغطاة بسائل البارافين والاحتفاظ بها في حاضنة CO2 حتى الكهربة.

3- تجميع الكواشف كريسبر وكهربة هالكات كريسبر

ملاحظة: للكهرباء، استخدمنا لوحة كهربائية البلاتين (الارتفاع: 0.5 ملم، الطول: 10 ملم، العرض: 3 ملم، الفجوة: 1 ملم) وكهربائي من نوع خطوة واحدة التي وصفت سابقا8 (جدول المواد). ويمكن استخدام كهربائي من خطوتين أيضا(جدول المواد).

  1. إعداد وتجميع كواشف CRISPR
    1. اطلب الكواشف CRISPR (أي crRNA و tracrRNA وبروتين Cas9) وssODN إذا كان إجراء تجارب تحرير بوساطة HDR(جدول المواد والجدول التكميلي 1).
    2. إعداد حل الصلب على النحو التالي.
      1. قم بإعداد 1 ميكروغرام/ميكرولتر كرنا و1 ميكروغرام/ميكرولتر رزرا في محلول متوسط أساسي الحد الأدنى من المصل(جدول المواد)،وإضافة 6 ميكرولتر من كل محلول إلى 42 ميكرولتر من المخزن المؤقت الخالي من النوليس.
      2. احتضان الخليط في سخان جاف في 95 درجة مئوية لمدة 3 دقيقة وبارد في RT لمدة 5 دقيقة.
      3. قم بإعداد 1 ميكروغرام/ميكرولتر HiFi Cas9 بروتين مخفف في Opti-MEM I وإضافة 6 ميكرولتر إلى الخليط السابق لحجم إجمالي قدره 60 ميكرولتر.
      4. في إجراء تجارب التحرير بوساطة HDR، أضف 6 ميكرولتر من 1 ميكروغرام/ميكرولتر ssODN. لأن الحجم النهائي يجب أن يكون 60 ميكرولتر، استخدم 36 ميكرولتر من المياه الخالية من النوكلفيفيفي الخطوة 3.1.2.1.
        ملاحظة: سيكون التركيز النهائي للكرنا، الركرورنا، بروتين Cas9، وsssODN 100 نانوغرام/ميكرولتر.
      5. نقل ما يصل إلى 100 جنين إلى 25 ميكرولتر من الخليط النهائي (مجمع RNP) في زجاج شريحة حفرة واحدة واحتضانها عند 37 درجة مئوية لمدة 10 دقيقة.
  2. الكهربية
    1. ملء الفجوة القطب مع 6 μL من الخليط الجديد من الكواشف CRISPR وإضافة 20-25 الأجنة إلى الخليط.
      ملاحظة: من المهم تجنب أي تلامس بين الأجنة وقطب الكهرباء، الذي يمكن أن يضر بالأجنة أثناء النبضات الكهربائية.
    2. إجراء الكهربية في الشروط التالية لكهربائي من نوع خطوة واحدة:
      الجهد: 25 V، اتجاه النبض (Pd) +
      على: 3 مللي ثانية، إيقاف: 97 مللي ثانية
      يكرر: 5x
      ملاحظة: يجب إجراء الكهربة لا يزيد عن 1 ساعة بعد الذوبان لضمان تحرير الجينوم يحدث قبل تكرار الحمض النووي الأول لمنع الفسيفساء.
    3. للحصول على جهاز كهربائي من خطوتين، قم بتعيين الشروط على النحو التالي:
      نبض البورينغ = 40V، PD +
      ON = 1 أو 2.5 مللي ثانية؛ فاصل النبض = 50 مللي ثانية
      يكرر: 4x، تسوس 10٪

      نقل نبض = 5 أو 7V؛ PD +/-.
      على: 50 مللي ثانية; نبض الفاصل الزمني = 50 مللي ثانية.
      يكرر = 5x; الاضمحلال = 40٪.
      ملاحظة: من المهم ضبط مستوى الصوت من أجل الحفاظ على المعاوقة ضمن النطاق المحدد المحدد من قبل الشركة المصنعة.
    4. اغسل الأجنة 3x مع مخطط Krebs-Ringer Bicarbonate Buffer 2 (M2) متوسط تليها اثنين يغسل مع قطرة من متوسط KSOM مغطاة السائل البارافين.
    5. احتضان الأجنة المغسولة (في وسط KSOM) في حاضنة CO2 بين عشية وضحاها لمزيد من الزرع.

4- نقل الأجنة

  1. إعداد الفئران الإناث الحوامل. ماتي ICR الفئران الإناث (3-6 أشهر) مع الفئران الذكور الأسهر 1 قبل يوم من نقل الجنين (ET).
    ملاحظة: يجب فحص الفئران في صباح اليوم التالي للحصول على قابس copulatory. الفئران مع المكونات تعتبر زائفة ويمكن استخدامها لET.
  2. يُستنشق الهواء وKSOM (بدون سائل البارافين) في فترات زمنية بديلة من 2-3 مم في الشعيرات الدموية الزجاجية كعلامة للزرع الناجح.
  3. أدخل 20-24 جنينًا في قطرة 200 ميكرولتر من KSOM (بدون سائل البارافين) ورسم 10-12 جنينًا في الشعيرات الدموية الزجاجية لزرعها في كل أوفيقناة.
  4. تُسْكِر الفئران الإناث بواسطة إيزوفلوران (الاستنشاق) أو حقن IP لمحلول يجمع بين الميديتوميدين/ميدازولام/بوتيليبيول (0.3 ملغم/كغ، 4.0 ملغم/كغ، و5.0 ملغم/كغ على التوالي). ضع الماوس المُسجّس على الجانب البطني على وسادة تدفئة. حماية عيون الماوس بالحساسية مع هلام ترطيب.
  5. القمّة على طول الجزء السفلي من خط الوسط الظهري وتطهير المنطقة باليود البوفيدون تليها مع الإيثانول 70٪.
  6. جعل طويلة ~ 1 سم شق بالتوازي مع خط الوسط الظهري.
  7. أخرج يوفيكت وضع على الستائر البلاستيكية المعقمة. يبقيه رطبة باستخدام المالحة المعقمة الدافئة.
  8. ضع الأوفيقناة تحت المجهر المجسمة.
  9. جعل حفرة في جدار أوفيقناة بين infundibulum وampulla بضعة ملليمترات المنبع من ampulla بواسطة مقص microspring.
  10. أدخل طرف الشعيرات الدموية الزجاجية التي تحتوي على الأجنة في الحفرة ونفخ بلطف في لسان حال حامل الشعيرات الدموية لطرد الأجنة حتى تظهر فقاعة الهواء في الأمبولة.
    ملاحظة: نقل بين 10-12 الأجنة لكل أوفيقناة.
  11. سحب الشعيرات الدموية الزجاجية من جدار أوفيقناة ودفع الجهاز التناسلي بلطف مرة أخرى إلى تجويف الجسم.
  12. كرر العملية السابقة لإدخال الأجنة في أوفيقناة أخرى.
  13. عند الانتهاء من إجراء ET، خياطة الجيوم مع نمط خياطة متقطعة بسيطة (50، القابلة للامتصاص، الغرز الاصطناعية مضفر) ومن ثم الجلد مع نمط بسيط متقطع أو نمط غرزة متقطعة تحت الجلد مدفونة (60 غير قابل للامتصاص، وغرز أحادية التركيب).
  14. الحفاظ على الماوس دافئة على لوحة الاحترار 37 درجة مئوية حتى يتعافى من التخدير.
  15. مراقبة صحة الحيوان يوميا لمدة 7 أيام بعد الجراحة.

5- الطباعة الجينية وتحليل التسلسل

  1. استخراج الحمض النووي الجينومي
    ملاحظة: استخدمنا مجموعات استخراج الحمض النووي للأنسجة NucleoSpin لاستخراج الحمض النووي الجينومي من أنسجة الأذن الفئران بعد توصيات الشركة المصنعة.
    1. إضافة 180 ميكرولتر من T1 المخزن المؤقت و 25 ميكرولتر من محلول Proteinase K إلى العينة ومزيج عن طريق الدوامة لمدة 10 s.
    2. احتضان في 56 درجة مئوية لمدة 2 ساعة أو حتى يتم الحصول على الانزل الكامل. دوامة لمدة 10 s كل 30 دقيقة من الحضانة.
    3. إضافة 200 ميكرولتر من المخزن المؤقت B3، دوامة بقوة لمدة 30 ق، واحتضان في 70 درجة مئوية لمدة 10 دقيقة.
    4. إضافة 210 ميكرولتر من الإيثانول 100٪ إلى العينة والدوامة بقوة.
    5. لكل عينة، ضع عمود نسيج واحد في أنبوب تجميع وطبق العينة على العمود.
    6. الطرد المركزي لمدة دقيقة واحدة في 11،000 × ز، والتخلص من flowthrough ، ووضع العمود مرة أخرى في أنبوب جمع.
    7. أضف 500 ميكرولتر من وزن الكتلة العازلة (المخزن) لغسل العينة (غسل 1)، الطرد المركزي لمدة دقيقة واحدة عند 11000 x ز،تخلص من التدفق ووضع العمود مرة أخرى في أنبوب المجموعة.
    8. أضف 600 ميكرولتر من المخزن المؤقت B5 إلى العمود (الغسيل الثاني)، والطرد المركزي لمدة دقيقة واحدة عند 11000 × ز،وتخلص من التدفق، واضع العمود مرة أخرى في أنبوب المجموعة.
    9. طرد العمود لمدة دقيقة واحدة عند 11,000 × ز لتجفيف غشاء السيليكا ووضع عمود أنسجة نيوكليوسبين في أنبوب طرد مركزي دقيق على بعد 1.5 مل.
    10. أضف 100 ميكرولتر من العازلة BE، واحتضان في درجة حرارة الغرفة لمدة دقيقة واحدة، ثم الطرد المركزي 1 دقيقة في 11،000 × غرام.
  2. تضخيم وتنقية PCR
    1. تصميم التمهيديات باستخدام التمهيدي3 بالإضافة إلى الموقع (https://primer3plus.com/) من أجل تضخيم تسلسل 400-500 bp المحيطة locus المستهدفة.
    2. تصميم بروتوكول PCR جديد واختباره تجريبيا.
    3. تنقية منتج PCR لإزالة الإنزيمات غير المرغوب فيها، النيوكليوتيدات، التمهيديات، والمكونات العازلة. ويمكن استخدام طريقة تنقية القياسية على النحو التالي.
      1. أضف 50 ميكرولتر من الفينول إلى 50 ميكرولتر من منتجات PCR ويخلط عن طريق الدوامة.
      2. الطرد المركزي لمدة دقيقة واحدة في 11،000 × ز ونقل الطبقة العليا شفافة إلى أنبوب جديد.
      3. أضف 120 ميكرولتر من الإيثانول بنسبة 99.5٪ و 20 ميكرولتر من خلات الأمونيوم ودوامة 5 M لمدة 30 s.
      4. يُحفظ في RT لمدة 10 دقيقة والطرد المركزي عند 11,000 × ز لمدة 10 دقيقة.
      5. تخلص من supernatant واغسل بيليه الحمض النووي بـ 1 مل من الإيثانول بنسبة 70٪.
      6. تجفيف بيليه في RT لمدة 10 دقيقة وتذوب في 10 ميكرولتر من المياه الحرة RNase.
        ملاحظة: يتم إعادة تعليق مجموعات تنقية أعمدة PCR لأن الفينول سام للبشر.
  3. تسلسل Sanger
    1. تشغيل تحليل قياس الحمض النووي (انظر جدول المواد)لتحديد أمبير PCR المنقى.
    2. إرسال منتج (منتجات) PCR والتمهيدي التسلسلي إلى موفر خدمة التسلسل.
    3. تحليل التسلسل باستخدام المواقع المتاحة على الانترنت.
      ملاحظة: في هذه الدراسة، تم استخدام CRISP-ID25 (http:/crispid.gbiomed.kuleuven.be/) لتحليل التسلسل.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

لدينا طريقة معدلة للحفظ بالتبريد من الأجنة خلية واحدة، بما في ذلك الحضانة في HTF تحتوي على 20٪ FBS لمدة 10 دقيقة تليها الحفظ بالتبريد في 1 M DMSO وDAP213 حل، وتحسين معدل النمو للأجنة المذابة بالتجميد في مرحلة الخليةين(الشكل 1،p = 0.009، اختبار T للطالب). تم استخدام الأجنة المذابة بالتجميد لإنتاج فئران جنرال موتورز وتم تحسين ظروف الكهربة: خمسة تكرارات من 25 فولت مع 3 مللي ثانية من البقول و97 مللي ثانية باستخدام الكهربورات كما هو موضح في قسم البروتوكول. تم التحقق من انطباق البروتوكول من قبل جيل من جين المهبينتييناز (تير) الفئران خروج المغلوب(الشكل 2). وللقيام بذلك، تم تصميم gRNA استهداف exon 2(الشكل 2A)وتم إعداد الكواشف CRISPR على النحو المبين في قسم البروتوكول. تم تقييم أدوات التحرير الكهربائية في غضون ساعة واحدة من ذوبان الجنين لضمان تحرير الجينوم قبل النسخ المتماثل الأول للجينوم وبالتالي منع الفسيفساء في المؤسسين(الشكل 2B). كانت جميع الفئران المولدة المهق ، وكان فأر واحد فقط هو الفسيفساء ، مع معطف مع بقع بيضاء وسوداء(الشكل 2C). جميع الفئران المهق إيواء اثنين من الأليل المتحولة المختلفة (طفرة heterozygous) باستثناء فأر واحد يضم أليل واحد فقط (طفرة homozygous) تظهر في الشكل 2E. ويمكن استنتاج أن طريقتنا يمكن أن توفر كفاءة التحرير من 100٪ تقريبا مع معدل فسيفساء منخفضة كما أكد تحليل التسلسل، فضلا عن لون معطف(الشكل 2C-E).

بعد ذلك ، تم فحص استنساخ البروتوكول من خلال توليد عدة أسطر من الفئران بالضربة القاضية وتدق. كما هو مبين في الجدول 1، يمكن للبروتوكول توليد خروج المغلوب وضرب في الفئران مع كفاءة عالية ومعدلات فسيفساء منخفضة. تم تزاوج معظم الفئران F0 المتولدة مع الفئران البرية من النوع C57BL/6J لتأكيد انتقال الخط الجرثومي للأليس المتحولة إلى أجيال F1. كما هو متوقع ، كانت جميع ذرية F1 من الفئران f0 homozygous هيرتوزيغوس ، تحتوي على أليل متحولة واحدة وأليل من النوع البري. لم تلاحظ أي طفرات متباينة بين الطباعة الجينية للمؤسسين وأجيالهم. قام البروتوكول الموصوف بإنشاء فئران جنرال موتورز في غضون وقت قصير (أي حوالي 4 أسابيع) كما هو موضح في سير عمل البروتوكول في الشكل 3.

Figure 1
الشكل 1: مصل الأبقار الجنينية (FBS) حسّن معدل نمو مرحلة الخلايا اللتين تألفان من الأجنة المذابة بالتجميد. كان عدد أجنة FBS+ 286 (تكررت التجربة 3x)، وكان عدد الأجنة FBS 272 (تكررت التجربة 3x). وتقدم البيانات على أنها متوسط ± SEM. هذا الرقم مستنسخ من درويش م وآخرون16 بإذن. يرجى الضغط هنا لعرض نسخة أكبر من هذا الرقم.

Figure 2
الشكل 2: جيل من الفئران خروج المغلوب تير مع كفاءة عالية ومعدل فسيفساء منخفضة. يتم تعديل هذا الرقم من درويش م وآخرون16 بإذن. (أ)رسم توضيحي تخطيطي يوضح تصميم gRNA. يتم عرض تسلسل PAM باللون الأحمر. (ب)التوضيح الذي يبين توقيت الكهربة للأجنة المذابة بالتجميد ، يمثل الرمز الأصفر وقت الكهربة. (C)صور تمثيلية للفئران التي تم إنشاؤها خروج المغلوب تير. (D)تحليل تسلسل أليليس مختلفة من الفئران خروج المغلوب تير. يتم تسمية تسلسل الهدف باللون الأحمر وتشير شرطات إلى حذف النيوكليوتيدات في الألزل المتحولة. WT = نوع البرية M = أليل متحولة. (E)يظهر جزء تمثيلي من الكروماتوغرام من الماوس المهق الذي يحتوي على أليل M1 في D. يرجى النقر هنا لعرض نسخة أكبر من هذا الرقم.

Figure 3
الشكل 3: سير العمل من البروتوكول لتوليد الفئران جنرال موتورز. وكانت الخطوة الأولى هي إعداد الأجنة المحفوظة بالتبريد. تم تراكب الفئران C57BL/6J الإناث ، أولاً عن طريق حقن PMSG ، ثم 48 ساعة لاحقًا عن طريق حقن hCG. تم جمع COCs 16 ساعة في وقت لاحق وخضع للتلقيح الاصطناعي مع الحيوانات المنوية التي تم جمعها من الفئران C57BL/6J الذكور. تم الحفاظ على البويضات المخصبة وتخزينها في النيتروجين السائل حتى الحاجة. وشملت الخطوة الثانية إذابة الأجنة والكهربية. تم إذابة الأجنة المحفوظة بالتبريد وتم تجميع الكواشف CRISPR (أي التراخرنا وcrRNA وبروتين Cas9) وصعقها بالكهرباء في غضون ساعة واحدة بعد إذابة الأجنة. وشملت الخطوة الثالثة نقل الأجنة وولادة الفئران. في اليوم التالي للكهرباء، تم نقل أجنة من خليتين إلى قناة أوفيمنمنة فئران أنثى حامل ة زائفة لتوليد فئران معدلة وراثياتم في وقت لاحق تم كتابتها جينيا باستخدام تسلسل Sanger لتأكيد كفاءة التحرير. يمكن تقصير الوقت والجهد اللازمين لإعداد البويضات المخصبة قبل كل تجربة (الخطوة 1) إذا تم إعداد عدد كبير من الأجنة المحفوظة بالتبريد مسبقًا. تم تكييف هذا الرقم من درويش م وآخرون16يرجى الضغط هنا لعرض نسخة أكبر من هذا الرقم.

الفئران المتحولة أجنة كهربائية أجنة ذات خلايا 2 الأجنة المنقولة الجراء (في المائة) الفئران المتحولة (٪ ) لا من الفئران الفسيفساء
تير كو 124 84 48 12 (25) 100 1
جالرب كو 151 94 40 6 (15) 100 0
Slc39a6 KO 48 25 25 5 (20) 100 0
Bag3 KI 233 84 20 3 (15) 50 1
Camk2a KI 124 70 70 14 (20) 64.3 0

الجدول 1: إنتاج عدة خطوط من فئران جنرال موتورز باستخدام أجنة مذابة بالتجميد من خلفية C57BL/6J.

الجدول التكميلي 1- الرجاء الضغط هنا لتحميل هذا الجدول.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

يسمح البروتوكول الموصوف بتوليد فئران جنرال موتورز ذات كفاءة عالية ومعدلات فسيفساء منخفضة(الجدول 1). فهو يمكّن الباحثين الذين لا يتمتعون بمهارات متقدمة في التلاعب بالأجنة من إنشاء فئران متحولة بسهولة لأنها تستفيد من أحدث التطورات وأكثرها فائدة في كل من الهندسة الإنجابية وتقنيات تحرير الجينوم: CRISPR/Cas9 ribonucleoprotein (RNP) والكهربية في أجنة مذابة بالتجميد. وقد سهلت هذه التطورات وعجلت بتوليد فئران جنرال موتورز. كما هو موضح في الشكل 3، يستغرق الأمر حوالي 4 أسابيع لتوليد الفئران المعدلة وراثيا. بالمقارنة مع بروتوكولات أخرى باستخدام نهج مماثلة26، لدينا طريقة متفوقة من حيث الكفاءة ، ومعدل المواليد ، والفسيفساء.

حضانة الأجنة ذات الخلية الواحدة في FBS قبل الحفظ بالتبريد أمر بالغ الأهمية لتحسين معدل نمو الأجنة. تسمح ظروف الكهربة للأجنة المحفوظة في التبريد، الموضحة في البروتوكول، بالتوصل إلى حل وسط بين كفاءة تحرير الكواشف كريسبر وبقاء الأجنة. في الواقع ، قد تؤثر الظروف الأكثر قسوة أو أخف على معدل نمو الأجنة وكفاءة التحرير ، على التوالي16. توقيت الكهربية(الشكل 2B)أمر بالغ الأهمية للتغلب على الفسيفساء في المؤسسين وضمان أن يحدث تعديل الجينوم في وجود اثنين فقط من الكل. وهذا يتسق مع التقارير السابقة التي تبين أن الكهربية في مرحلة مبكرة يمكن أن تنتج المسوخ غير الفسيفساء17. وبالإضافة إلى ذلك، فإن استخدام RNP بدلا من gRNA / مرنا يقلل من معدل الفسيفساء ويحسن كفاءة التحرير17.

يتميز البروتوكول الموصوف بعدة مزايا. أولا ، فإنه يولد الفئران متحولة في غضون وقت قصير (~ 4 أسابيع). ثانياً، إنه بروتوكول يتسم بالكفاءة العالية والقوة؛ والثاني هو بروتوكول يتسم بالكفاءة العالية والمتانة. تم إنشاء عدة خطوط من خروج المغلوب (KO) وضرب في (KI) الفئران مع معدلات طفرة عالية (KO = 100٪، KI = 50 إلى 64.3٪). ثالثاً، إنه ملائم وفعال من حيث التكلفة. استخدام crRNA الاصطناعية كاملة، tracrRNA، ssODN، وبروتين Cas9 يلغي الحاجة إلى إعداد مملة من ناقلات Cas9 والنسخ في المختبر. وبدلاً من ذلك، فإنه يسمح للباحثين ببساطة باستخدام الكواشف التجارية والمعدات القياسية. رابعاً، لا يستخدم الحقن المجهري، الذي يتطلب مهارات تقنية عالية. خامسا ، فإنه يقلل من الفسيفساء في المؤسسين ، وبالتالي يؤدي إلى نقل أكثر كفاءة الجرثومية من alleles تحريرها ، والتغلب على تحليل genotypic معقدة من الفئران الفسيفساء. وأخيرا، هذا البروتوكول فعال مع سلالة متأصلة C57BL/6J، الذي يتجنب استخدام الهجينة F1، وبالتالي الحاجة إلى تنفيذ العديد من الكروسان للتخلص من التعقيد الوراثي. أكدت الطباعة الجينية لأجيال الفورمولا 1 انتقال دقيق للجراثيم. ومع ذلك، فمن غير المستحسن لدراسة الأنماط الظاهرية للفئران F0 بسبب تعقيد أليل والتنبؤ المضلل من genotyping من الجيل اللاحق استقراء من genotyping من مؤسسي F014،27.

ومن الأهمية الأساسية تسخير استخدام الأجنة المذابة بالتجميد في تحرير جينوم الرئيسيات غير البشرية والحيوانات الكبيرة مثل الخنازير والأغنام، التي لا تتوفر دائما بسهولة. تختلف طرق تجميد الأجنة بشكل كبير اعتمادًا على الأنواع الحيوانية. لذلك ، نعتقد أن بروتوكول الحفاظ على التبريد لدينا قد ينطبق فقط على الفئران. من ناحية أخرى ، يمكن تطبيق بروتوكولنا لاستخدام nucleases الهندسية بخلاف Cas9 لتوليد الفئران المعدلة وراثيا ، لأنه تم الإبلاغ سابقًا عن الكهربية لإدخال nucleases أخرى مثل Cas12a في الجنين بكفاءة28،29.

أحد قيود البروتوكول هو التكامل الدقيق لجين طويل في الجينوم ، والذي يعتبر صعبًا في البروتوكولات القائمة على الكهربية. ومع ذلك، تم الإبلاغ عن حل محتمل واحد: تم دمج ترانسجين تصل 4.9 كيلوبايت في جينوم الماوس بنجاح عن طريق الجمع بين الكهربية مع الفيروس الأدينو المرتبطة (AAV) بوساطة HDR نظام تسليم المانحة30،مما يؤكد منشور سابق31. أيضا، حدوث المحتملة من الآثار الجانبية خارج الهدف هو مصدر قلق كبير مع استخدام تكنولوجيا CRISPR/Cas9. لم نقوم بتسلسل الجينوم الكامل للفئران المنتَكَلة لاستبعاد التأثير المحتمل خارج الهدف. ومع ذلك، فقد استخدمنا أدوات CRISPR التي تم الإبلاغ عنها لتقليل التأثير غير المستهدف، مثل RNP32. وعلاوة على ذلك، استخدمنا متغير Cas9 عالية الدقة التي تقلل بشكل كبير من التحرير خارج الهدف دون التضحية على الهدف الأداء33. أيضا، قمنا بتصميم gRNAs باستخدام برنامج CRISPRdirect (https://crispr.dbcls.jp)، والتي ينبغي أن تؤدي إلى تسلسل الهدف مع مواقع غير مستهدفة أقل19. لتأكيد السببية النمط الجيني والنمط الظاهري وتخفيف المخاوف حول الآثار غير المستهدفة ، يجب على الباحثين إنشاء العديد من الفئران التي تم تحريرها من نفس النمط الجيني باستخدام gRNAs مختلفة أو إجراء عبور خلفي للفئران المتولدة لعدة أجيال.

الفئران خروج المغلوب ولدت باستخدام آلية NHEJ والطفرات frameshift وقد استخدمت على نطاق واسع وتظهر الأنماط الظاهرية ذات الصلة. ومع ذلك، قد يكون البروتين المتبقي مبتورة موجودة إما لإعادة بدء الترجمة أو تخطي exonتحرير34،35. لذلك ، لتفسير الأنماط الظاهرية بدقة ، من الضروري وصف وظيفة البروتين المتبقي أو التعبير. جيل الجينات الكاملة خروج المغلوب الفئران باستخدام أكثر من gRNA واحد سيكون بديلا جيدا. ومع ذلك، ينبغي إيلاء اهتمام خاص للتأكد من أن الجين لا يحتوي على مناطق intronic منسوخة إلى الحمض النووي الريبي غير الترميز، والتي قد يكون لها وظائف تنظيمية وبالتالي تعقيد التحليل الفينوتيب.

في هذه الدراسة، نعرض بروتوكولًا بسيطًا يمكن للعديد من الباحثين من خلاله توليد فئران معدلة وراثياً في 4 أسابيع أو أقل. من خلال الجمع بين استخدام الأجنة المذابة بالتجميد والكهربية ، فإننا نقدم إعداد نماذج الفئران من الأمراض البشرية سهلة وسريعة وفعالة.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

وليس لدى أصحاب البلاغ أي إقرارات مالية ذات صلة.

Acknowledgments

نود أن نشكر هيتومي ساوادا وإليزابيث غارسيا على رعاية الحيوانات. تم دعم هذا العمل من قبل KAKENHI (15K20134 ، 17K11222 ، 16H06276 و 16K01946) ومنحة هوكينجين للأبحاث (إلى H.N) ، وجائزة الباحث الشاب بجامعة جيتشي الطبية (إلى H.U. ). دعمت مؤسسة أوتسوكا توشيمي للمنح الدراسية ماجستير في التعليم.

Materials

Name Company Catalog Number Comments
0.25 M Sucrose ARK Resource Co., Ltd. (Kumamoto, Japan) SUCROSE
1 M DMSO ARK Resource Co., Ltd. (Kumamoto, Japan) 1M DMSO
Butorphanol Meiji Seika Pharma Co., Ltd. (Tokyo, Japan) Vetorphale 5mg
Cas9 protein: Alt-R® S.p. HiFi Cas9 Nuclease 3NLS Integrated DNA Technologies, Inc. (Coralville, IA) 1081060
C57BL/6J mice Japan SLC (Hamamatsu, Japan) N/A
DAP213 ARK Resource Co., Ltd. (Kumamoto, Japan) DAP213
FBS Sigma-Aldrich, Inc. (St. Louis, MO) ES-009-C
hCG MOCHIDA PHARMACEUTICAL CO., LTD (Tokyo, Japan) HCG Mochida 3000
HTF ARK Resource Co., Ltd. (Kumamoto, Japan) HTF
ICR mice Japan SLC (Hamamatsu, Japan) N/A
Isoflurane Petterson Vet Supply, Inc. (Greeley, CO) 07-893-1389
KSOM ARK Resource Co., Ltd. (Kumamoto, Japan) KSOM
LN2 Tank Chart Industries (Ball Ground, GA) XC 34/18
M2 ARK Resource Co., Ltd. (Kumamoto, Japan) M2
Medetomidine Nippon Zenyaku Kogyo Co.,Ltd. (Koriyama, Japan) 1124401A1060
Microscope Nikon Co. (Tokyo, Japan) SMZ745T
Midazolam Sandoz K.K. (Tokyo, Japan) 1124401A1060
Nuclease free buffer Integrated DNA Technologies, Inc. (Coralville, IA) 1072570
Nucleospin DNA extraction kit Takara Bio Inc (Kusatsu, Japan) 740952 .5
One-hole slide glass Matsunami Glass Ind., Ltd. (Kishiwada, Japan) S339929
One-step type Electroporator BEX Co., Ltd. (Tokyo, Japan) CUY21EDIT II
Paraffin Liquid NACALAI TESQUE Inc. (Kyoto, Japan) SP 26137-85
Platinum plate electrode BEX Co., Ltd. (Tokyo, Japan) LF501PT1-10, GE-101
PMSG ASKA Animal Health Co., Ltd (Tokyo, Japan) SEROTROPIN 1000
Povidone iodide Professional Disposables International, Inc. (Orangeburg, NY) C12400
Reduced-Serum Minimal Essential Medium: OptiMEM I Sigma-Aldrich, Inc. (St. Louis, MO) 22600134
Two-step type Electroporator Nepa Gene Co., Ltd. (Ichikawa, Japan) NEPA21

DOWNLOAD MATERIALS LIST

References

  1. Wang, H., et al. One-step generation of mice carrying mutations in multiple genes by CRISPR/cas-mediated genome engineering. Cell. 153, (4), 910-918 (2013).
  2. Jinek, M., et al. A programmable dual-RNA - guided DNA endonuclease in adaptive bacterial immunity. Science. 337, (6096), 816-822 (2012).
  3. Mali, P., et al. RNA-guided human genome engineering via Cas9. Science. 339, (6121), 823-826 (2013).
  4. Cong, L., et al. Multiplex genome engineering using CRISPR/VCas systems. Science. 339, (6121), 819-823 (2013).
  5. Doudna, J. A., Charpentier, E. The new frontier of genome engineering with CRISPR-Cas9. Science. 346, (6213), 1258096 (2014).
  6. Mashiko, D., et al. Generation of mutant mice by pronuclear injection of circular plasmid expressing Cas9 and single guided RNA. Scientific Reports. 3, 3355 (2013).
  7. Yen, S. T., et al. Somatic mosaicism and allele complexity induced by CRISPR/Cas9 RNA injections in mouse zygotes. Developmental Biology. 393, (1), 3-9 (2014).
  8. Kaneko, T., Mashimo, T. Simple genome editing of rodent intact embryos by electroporation. PLoS ONE. 10, (11), 1-7 (2015).
  9. Qin, W., et al. Efficient CRISPR/cas9-mediated genome editing in mice by zygote electroporation of nuclease. Genetics. 200, (2), 423-430 (2015).
  10. Kaneko, T., Sakuma, T., Yamamoto, T., Mashimo, T. Simple knockout by electroporation of engineered endonucleases into intact rat embryos. Scientific Reports. 4, 6382 (2014).
  11. Hashimoto, M., Takemoto, T. Electroporation enables the efficient mRNA delivery into the mouse zygotes and facilitates CRISPR/Cas9-based genome editing. Scientific Reports. 5, 11315 (2015).
  12. Chen, S., Lee, B., Lee, A. Y. F., Modzelewski, A. J., He, L. Highly efficient mouse genome editing by CRISPR ribonucleoprotein electroporation of zygotes. Journal of Biological Chemistry. 291, (28), 14457-14467 (2016).
  13. Modzelewski, A. J., et al. Efficient mouse genome engineering by CRISPR-EZ technology. Nature Protocols. 13, (6), 1253-1274 (2018).
  14. Teixeira, M., et al. Electroporation of mice zygotes with dual guide RNA/Cas9 complexes for simple and efficient cloning-free genome editing. Scientific Reports. 8, 474 (2018).
  15. Nakagawa, Y., et al. Production of knockout mice by DNA microinjection of various CRISPR/Cas9 vectors into freeze-thawed fertilized oocytes. BMC Biotechnology. 15, (1), 1-10 (2015).
  16. Darwish, M., et al. Rapid and high-efficient generation of mutant mice using freeze-thawed embryos of the C57BL/6J strain. Journal of Neuroscience Methods. 317, 149-156 (2019).
  17. Hashimoto, M., Yamashita, Y., Takemoto, T. Electroporation of Cas9 protein/sgRNA into early pronuclear zygotes generates non-mosaic mutants in the mouse. Developmental Biology. 418, (1), 1-9 (2016).
  18. Sakamoto, W., Kaneko, T., Nakagata, N. Use of frozen-thawed oocytes for efficient production of normal offspring from cryopreserved mouse spermatozoa showing low fertility. Comparative Medicine. 55, (2), 136-139 (2005).
  19. Naito, Y., Hino, K., Bono, H., Ui-Tei, K. CRISPRdirect: Software for designing CRISPR/Cas guide RNA with reduced off-target sites. Bioinformatics. 31, (7), 1120-1123 (2015).
  20. Torres-Perez, R., Garcia-Martin, J. A., Montoliu, L., Oliveros, J. C., Pazos, F. WeReview: CRISPR Tools-Live Repository of Computational Tools for Assisting CRISPR/Cas Experiments. Bioengineering. 6, (3), 63 (2019).
  21. Okamoto, S., Amaishi, Y., Maki, I., Enoki, T., Mineno, J. Highly efficient genome editing for single-base substitutions using optimized ssODNs with Cas9-RNPs. Scientific Reports. 9, 4811 (2019).
  22. Takeo, T., Nakagata, N. Superovulation using the combined administration of inhibin antiserum and equine chorionic gonadotropin increases the number of ovulated oocytes in C57BL/6 female mice. PLoS ONE. 10, (5), 1-11 (2015).
  23. Wuri, L., Agca, C., Agca, Y. Euthanasia via CO2 inhalation causes premature cortical granule exocytosis in mouse oocytes and influences in vitro fertilization and embryo development. Molecular Reproduction and Development. 86, (7), 825-834 (2019).
  24. Nakagata, N. High survival rate of unfertilized mouse oocytes after vitrification. Journal of Reproduction and Fertility. 87, (2), 479-483 (1989).
  25. Dehairs, J., Talebi, A., Cherifi, Y., Swinnen, J. V. CRISP-ID: Decoding CRISPR mediated indels by Sanger sequencing. Scientific Reports. 6, 28973 (2016).
  26. Nakagawa, Y., Sakuma, T., Takeo, T., Nakagata, N., Yamamoto, T. Electroporation-mediated genome editing in vitrified/warmed mouse zygotes created by ivf via ultra-superovulation. Experimental Animals. 67, (4), 535-543 (2018).
  27. Nakajima, K., Nakajima, T., Takase, M., Yaoita, Y. Generation of albino Xenopus tropicalis using zinc-finger nucleases. Development Growth and Differentiation. 54, (9), 777-784 (2012).
  28. Hur, J. K., et al. Targeted mutagenesis in mice by electroporation of Cpf1 ribonucleoproteins. Nature Biotechnology. 34, 807-808 (2016).
  29. Dumeau, C. E., et al. Introducing gene deletions by mouse zygote electroporation of Cas12a/Cpf1. Transgenic Research. 28, (5-6), 525-535 (2019).
  30. Chen, S., et al. CRISPR-READI: Efficient Generation of Knockin Mice by CRISPR RNP Electroporation and AAV Donor Infection. Cell Reports. 27, (13), 3780-3789 (2019).
  31. Mizuno, N., et al. Intra-embryo Gene Cassette Knockin by CRISPR/Cas9-Mediated Genome Editing with Adeno-Associated Viral Vector. iScience. 9, 286-297 (2018).
  32. Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. Highly Efficient RNA-guide genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Research. 24, (6), 1012-1019 (2014).
  33. Vakulskas, C. A., et al. A high-fidelity Cas9 mutant delivered as a ribonucleoprotein complex enables efficient gene editing in human hematopoietic stem and progenitor cells. Nature Medicine. 24, (8), 1216-1224 (2018).
  34. Rodriguez-Rodriguez, J. A., et al. Distinct Roles of RZZ and Bub1-KNL1 in Mitotic Checkpoint Signaling and Kinetochore Expansion. Current Biology. 28, (21), 3422-3429 (2018).
  35. Smits, A. H., et al. Biological Plasticity Rescues Target Activity in CRISPR Knockouts. Nature Methods. 16, 1087-1093 (2019).
استخدام الأجنة المذابة بالتجميد لإنتاج الفئران المعدلة وراثياً بكفاءة عالية
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Nishizono, H., Darwish, M., Uosaki, H., Masuyama, N., Seki, M., Abe, H., Yachie, N., Yasuda, R. Use of Freeze-thawed Embryos for High-efficiency Production of Genetically Modified Mice. J. Vis. Exp. (158), e60808, doi:10.3791/60808 (2020).More

Nishizono, H., Darwish, M., Uosaki, H., Masuyama, N., Seki, M., Abe, H., Yachie, N., Yasuda, R. Use of Freeze-thawed Embryos for High-efficiency Production of Genetically Modified Mice. J. Vis. Exp. (158), e60808, doi:10.3791/60808 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter