Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Anvendelse af fryseoptøede embryoner til højeffektiv produktion af genetisk modificerede mus

doi: 10.3791/60808 Published: April 2, 2020
* These authors contributed equally

Summary

Her præsenterer vi en modificeret metode til kryopræservering af encellede embryoner samt en protokol, der kobler brugen af fryseoptøede embryoner og elektroporation til effektiv generation af genetisk modificerede mus.

Abstract

Brugen af genetisk modificerede (GM) mus er blevet afgørende for at forstå genfunktionen og dechifrere de underliggende mekanismer i menneskelige sygdomme. CRISPR/Cas9-systemet giver forskerne mulighed for at ændre genomet med hidtil uset effektivitet, troskab og enkelhed. Udnyttelse af denne teknologi, forskere søger en hurtig, effektiv og nem protokol til at generere GM-mus. Her introducerer vi en forbedret metode til kryopræservering af encellede embryoner, der fører til en højere udviklingsrate af fryseoptøede embryoner. Ved at kombinere det med optimerede elektroporationsbetingelser giver denne protokol mulighed for generering af knockout- og knock-in-mus med høj effektivitet og lave mosaikhastigheder inden for kort tid. Desuden viser vi en trinvis forklaring på vores optimerede protokol, der dækker FREMSTILLING AF CRISPR-reagenser, in vitro-befrugtning, kryopræservering og optøning af encellede embryoner, elektroporation af CRISPR-reagenser, musegenerering og genotyping af grundlæggerne. Ved hjælp af denne protokol, forskere bør være i stand til at forberede GM mus med uovertruffen lethed, hastighed, og effektivitet.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Det grupperede regelmæssigt interspacerede korte palindromiske gentagelser (CRISPR)/CRISPR-associeret protein 9 (Cas9) er et videnskabeligt gennembrud, der giver hidtil uset målrettet modifikation i genomet1. CRISPR/Cas9-systemet består af Cas9-protein og guide RNA (gRNA) med to molekylære komponenter: et målspecifikt CRISPR RNA (crRNA) og et transaktiverende CRISPR RNA (tracrRNA)2. En gRNA dirigerer Cas9 protein til den specifikke locus i genomet, 20 nukleotider supplerer crRNA, og støder op til protospacer tilstødende motiv (PAM). Cas9-proteinet binder sig til målsekvensen og inducerer dobbeltstrengede brud (DSB'er), der repareres ved enten fejltilbøjelige nonhomologe endesammenføjning (NHEJ) eller high fidelity homology-rettet reparation (HDR)3,4,5. Den NHEJ fører til indsættelser og / og sletninger (indels), og dermed til gentab af funktion, når en kodning sekvens er målrettet. HDR fører til præcis genomredigering i nærværelse af en reparationsskabelon , der indeholder homologisekvenser3,4,5. NHEJ og HDR er blevet udnyttet til at generere knockout og knock-in mus, henholdsvis.

Mens CRISPR/Cas9-systemet har accelereret genereringen af GM-mus markant med fremragende effektivitet og troskab, støder forskere, der anvender disse metoder, ofte på tekniske udfordringer. For det første kræver konventionelle protokoller mikroinjektion for at indføre CRISPR-redigeringsværktøjerne i pronucleusen af befrugtede æg6,7. Denne teknik er tidskrævende og kræver normalt omfattende træning. Flere grupper erstattede således mikroinjektion med elektroporation8,9,10,11,12,13. Men i de tidlige elektroporationsprotokoller blev der anvendt friske embryoner til elektroporation. Dette forårsagede et andet problem, fordi det er vanskeligt at forberede friske embryoner før hvert eksperiment14.

For nylig har vi og andre kombineret brugen af fryse-optøet embryoner og elektroporation til genom redigering, som letter dannelsen af GM mus15,16. Denne protokol gør det muligt for forskere uden avancerede embryo manipulation færdigheder til hurtigt at generere dyremodeller af menneskelige sygdomme med høj effektivitet. Protokollen reducerer også de praktiske udfordringer i at generere GM-mus, såsom genetisk heterogenitet i grundlæggerne16. For at overvinde mosaicism udfører vi elektroporationen af CRISPR-reagenser inden for 1 time efter embryooptøning for at sikre, at redigeringsker før den første replikering af genomet. En anden forbedring omfatter brugen af Cas9 protein i stedet for Cas9 mRNA til at reducere uønsket mosaicism17. Desuden har vi udviklet en optimal metode til en-celle embryo kryopræservering, der øger udviklingen til to-celle fase16: brug af føtale kvæg serum (FBS) dramatisk forbedrer overlevelsen af fryse-optøet oocytter efter befrugtning, måske ved den samme mekanisme, der gør fryse-optøet ubefrugtede oocytter mere modstandsdygtige18.

Her præsenterer vi en omfattende protokol for generering af GM-mus ved hjælp af fryseoptøede embryoner, herunder den modificerede metode til kryopræservering af encellede C57BL/6J-embryoner. Det omfatter 1) gRNA design, CRISPR reagens forberedelse og samling; 2) IVF, kryopræservering, og optøning af encellede embryoner; 3) Elektroporation af CRISPR-reagenser til fryseoptøede embryoner; 4) Embryo overførsel til oviduct af pseudogravide kvindelige mus; og 5) Genotyping og sekvens analyse af F0 grundlægger dyr.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Al dyrepleje og alle procedurer, der blev udført i denne undersøgelse, blev udført i overensstemmelse med reglerne og forskrifterne i vejledningen for pleje og brug af laboratoriedyr. Den eksperimentelle protokol blev godkendt af Animal Care Committee of Laboratory Animals of University of Toyama, University of Tokyo, Jichi University og Max Planck Florida Institute for Neuroscience. Oplysninger om alle reagenser findes i materialetabellen.

1. DESIGN af CRISPR-reagenser

  1. crRNA-design
    1. Besøg CRISPR direkte19 (https://crispr.dbcls.jp/) for at designe specifikke crRNA'er med reducerede off-target sites.
      BEMÆRK: Der er mange andre nyttige værktøjer til at designe crRNA20 (https://bioinfogp.cnb.csic.es/tools/wereview/crisprtools/).
    2. Indsæt målnukleotidsekvensen, og foretag følgende ændringer:
      PAM-sekvenskrav = NGG
      Specificitetskontrol = Mus (Mus musculus) genom, GRCm38/mm10 (dec. 2011)
      BEMÆRK: Som et eksempel, at generere Tyrosinase (Tyr) knockout mus, exon 2 (nukleotid sekvens fra 9476-9692) blev målrettet.
    3. Klik på Design, og markér Vis kun meget specifik destinationfor at få meget specifikke hits .
    4. For at reducere potentielle off-target effekter, skal du vælge målsekvensen med den laveste værdi i kolonnerne "12 mer+PAM" og "8 mer+PAM".
      BEMÆRK: I disse kolonner ,("1") angiver, at sekvensen har kun én perfekt match med det tilsigtede mål websted og tal større end én angiver tilstedeværelsen af potentielle off-target sites.
    5. De resulterende oligonukleotider skal bestilles hos crRNA-syntesevirksomheder (supplimentær tabel 1).
      BEMÆRK: For exon 2 Tyr-genet blev følgende målsekvens anvendt: GGACCACTATTACGTAATCC med +TGG som PAM-sekvens (Figur 2A).
  2. Single strand oligodeoxynucleotid (ssODN) design til HDR-medieret redigering eksperimenter (dvs. knock-in mus generation).
    1. Design ssODN længden til at være omkring 80-180 bp herunder 30-60 nukleotid (nt) homologi arme på begge sider.
      BEMÆRK: En ssODN på 75-85 nt længde, herunder en 30-35 nt homology arm og supplerer gRNA, viste høj knock-in redigering effektivitet21.
    2. Indsæt den tilsigtede modifikation og tavse mutation ved PAM-sekvensen eller, hvis det ikke er muligt, på den 5′-nabobase af PAM for at blokere opskæringen efter genomredigering.
      BEMÆRK: CrRNA og ssODN, der anvendes i denne undersøgelse, er anført i supplerende tabel 1.

2. In vitro-befrugtning, embryokryopræservering og fryseoptøning

  1. In vitro-befrugtning
    1. Superovulat C57BL/6J hunmus (4 eller 8 uger gamle) ved IP-injektion med gravid mare serum gonadotropin (PMSG) efterfulgt af injektion med 7,5 IE humant choriongonadotropin (hCG) efter 48 timer.
      BEMÆRK: Antallet af ægløsning oocytter kan øges med omkring 3x ved hjælp af ultra-superovulation22.
    2. Fjern cauda epididymides fra seksuelt modne C57BL/6J hanmus (3-5 måneder gamle).
      BEMÆRK: Det er muligt at indsamle spermatozoer uden at ofre de mandlige mus.
    3. Ekstrakt blodpropper i spermatozoer med en dissekerennål og inkuber dem i en 200 μL2 dråbe human tubalvæske (HTF) i CO 2-inkubator en 1,5 timer for capacitation.
    4. Hent cumulus-oocytkomplekser (CoCs) fra oviducts 16-18 h efter hCG injektion og inkubere dem i en frisk 200 μL dråbe HTF medium dækket med paraffin væske i en CO2 inkubator (5% CO2, 37 °C) for højst 2 timer.
      BEMÆRK: Det er at foretrække at ofre musene ved cervikal dislokation under anæstesi, fordi eutanasi via CO2 indånding påvirker IVF og embryo udvikling23.
    5. Der tilsættes 1-5 μL sædsuspension fra inkubationsmediets grænse til 200 μL-dråben HTF-medium,2 der indeholder p-piller, og der inkuberes i en CO 2-inkubator i 3 timer.
    6. Vask oocytter med kalium-suppleret simplex optimering medium (KSOM) 3x at fjerne resterende sæd celler og cumulus celler.
    7. Kontroller pronuclear dannelse og kvaliteten af en-celle embryoner ved hjælp af en omvendt mikroskop.
  2. Kryopræservering af encellede embryoner
    1. Inkubere encellede embryoner i en 200 μL dråbe HTF indeholdende 20% FBS (ikke dækket2 med paraffinvæske) i 10 minutter i en CO 2-inkubator.
    2. 20-100 embryoner overføres til 50 μL 1 M dimethylsulfoxid (DMSO) opløsning24.
    3. 5 μL af en opløsning, der indeholder 100 embryoner, overføres til bunden af en kryorør og afkøles i 5 minutter ved 0 °C ved hjælp af en køler eller på is.
    4. Der tilsættes 45 μL DAP213 (2 M dimethylsulfoxid, 1 M acetamid og 3 M propylenglycol) langsomt langs rørvæggen, rørene skal slibes, og rørene holdes i 5 minutter i en køler eller på is ved 0 °C.
      BEMÆRK: Dækslerne må ikke fastgøres for stramt, så de let kan fjernes under prøveoptøning.
    5. Opbevar rørene hurtigt i flydende nitrogen.
  3. Optøning af embryoner
    1. Åbn låget på kryorøret, kassér det resterende flydende kvælstof, og der tilsættes 900 μL 0,25 M saccharoseopløsning, der er forvarmet til 37 °C.
      BEMÆRK: 0,25 M saccharoseopløsningen skal opvarmes til 37 °C på forhånd, da brugen af kold opløsning mindsker embryonens levedygtighed efter optøning.
    2. Pipet hurtigt for 10x og overføre indholdet af kryorøret i en plastik skål.
      BEMÆRK: Pipetteringen skal udføres omhyggeligt, så der ikke dannes bobler, og embryonerne beskadiges.
    3. Vask morfologisk normale befrugtede oocytter 2x i KSOM medium dækket med paraffin væske og holde dem i en CO2 inkubator indtil elektroporation.

3. Samling og elektroporation af CRISPR-reagenser

BEMÆRK: Til elektroporation brugte vi en platinpladeelektrode (højde: 0,5 mm, længde: 10 mm, bredde: 3 mm, mellemrum: 1 mm) og en elektroporator af ettrinstypen, der tidligere blev beskrevet8 (Materialetabel). En to-trins type elektroporator kan bruges for (Tabel af materialer).

  1. Forberedelse og samling af CRISPR-reagenser
    1. Bestil CRISPR-reagenser (dvs. crRNA, tracrRNA og Cas9-protein) og ssODN, hvis der udføres HDR-medieretredigeringseksperimenter ( Materialetabel og supplerende tabel 1).
    2. Klargør glødeopløsningen på følgende måde.
      1. Der fremstilles 1 μg/μL crRNA og 1 μg/μL tracrRNA i Reduceret Serum Minimal Essential Medium-opløsning (Materialetabel), og der tilsættes 6 μL af hver opløsning til 42 μL af nukleleasefri buffer.
      2. Blandingen inkuberes i tørvarmeren ved 95 °C i 3 min. og afkøles ved RT i 5 min.
      3. 1 μg/μL HiFi Cas9-protein fortyndet i Opti-MEM I og tilsættes 6 μL til den foregående blanding for et samlet volumen på 60 μL.
      4. Ved udførelse af HDR-medieret redigeringseksperimenter tilsættes 6 μL 1 μg/μL ssODN. Da det endelige volumen skal være 60 μL, skal der anvendes 36 μL nucleasefrit vand i trin 3.1.2.1.
        BEMÆRK: Den endelige koncentration af crRNA, tracrRNA, Cas9 protein og ssODN vil være 100 ng/μL.
      5. Op til 100 embryoner overføres til 25 μL af den endelige blanding (RNP-kompleks) i et hulsglas, og de inkuberes ved 37 °C i 10 min.
  2. Elektroporation
    1. Fyld elektrodehullet med 6 μL af den nye blanding af CRISPR-reagenser, og tilsæt 20-25 embryoner til blandingen.
      BEMÆRK: Det er vigtigt at undgå enhver kontakt mellem embryonerne og elektroporationselektroden, som kan beskadige embryoner under elektriske impulser.
    2. Elektroporationen udføres ved følgende forhold for en elektroporator af typen et trin:
      Spænding: 25 V, Pulsretning (Pd) +
      TIL: 3 ms, OFF: 97 ms
      Gentager: 5x
      BEMÆRK: Elektroporation bør udføres ikke mere end 1 time efter optøning for at sikre genomredigering sker før den første DNA-replikation for at forhindre mosaicism.
    3. For en elektroporator af totrinstypen skal du indstille betingelserne på følgende måde:
      Poring Pulse = 40V, Pd +
      ON = 1 eller 2,5 ms; Pulsinterval = 50 ms
      Gentagelser: 4x, Henfald 10%

      Transfer Pulse = 5 eller 7V; Pd +/-.
      TIL: 50 ms; Pulsinterval = 50 ms.
      Gentager = 5x; Henfald = 40%.
      BEMÆRK: Det er vigtigt at justere lydstyrken for at opretholde impedans inden for det specifikke område, der er angivet af producenten.
    4. Embryonerne 3x vaskes med modificeret Krebs-Ringer Bicarbonatbuffer 2 (M2) efterfulgt af to vaske med en dråbe KSOM-medium dækket med paraffinvæske.
    5. Inkuberde de vaskede embryoner (i KSOM2 medium) i en CO 2-inkubator natten over til yderligere transplantation.

4. Overførsel af embryoner

  1. Forbered pseudogravide hunmus. Mate ICR hunmus (3-6 måneder) med vasektomiserede hanmus 1 dag før embryonoverførslen (ET).
    BEMÆRK: Mus skal kontrolleres næste morgen for et copulatory stik. Musene med et stik betragtes pseudogravid og kan bruges til ET.
  2. Aspiratluft og KSOM (uden paraffinvæske) i alternative intervaller på 2-3 mm i en glaskapillær som markør for vellykket implantation.
  3. Der indsættes 20-24 embryoner i en 200 μL dråbe KSOM (uden paraffinvæske) og der trækkes 10-12 embryoner ind i glaskapillaret til implantation i hver oviduk.
  4. Bedøve de kvindelige mus ved isofluran (indånding) eller en IP-injektion af en opløsning, der kombinerer medetomidin/midazolam/butorphanol (0,3 mg/kg, 4,0 mg/kg og 5,0 mg/kg). Placer den bestøvede mus på dens ventrale side på en varmepude. Beskyt øjnene af den bestøvede mus med en fugtgivende gel.
  5. Barber langs den nederste del af den dorsale midterlinje og desinficere området med povidon jod efterfulgt af med 70% ethanol.
  6. Lav et langt ~1 cm snit parallelt med rygmidterlinjen.
  7. Tag oviduket og sted på en steril plast drapere. Hold det fugtigt ved hjælp af varm steril saltvand.
  8. Placer oviduket under stereoskopisk mikroskop.
  9. Lav et hul i væggen af oviduket mellem infundibulum og ampulla et par millimeter opstrøms for ampulla af microspring saks.
  10. Sæt spidsen af glaskapillary, der indeholder embryonerne, ind i hullet, og blidt i kapillærholderens mundstykke for at bortvise embryonerne, indtil der er en luftboble i ampullaen.
    BEMÆRK: Der overføres mellem 10-12 embryoner pr. oviduk.
  11. Træk glaskapillær en del af ovidukvæggen tilbage, og skub det reproduktive organ forsigtigt tilbage i kropshulen.
  12. Gentag den foregående proces for at indføre embryonerne i den anden oviduk.
  13. Når ET-proceduren er afsluttet, sutureres peritoneum med et simpelt afbrudt suturmønster (50, absorberbare, flettede syntetiske suturer) og derefter huden med et enkelt afbrudt mønster eller et nedgravet subkutikulært afbrudt stingmønster (60 ikke-absorberbare, monosyntetiske suturer).
  14. Hold musen varm på en 37 °C varmeplade, indtil den kommer sig efter anæstesi.
  15. Overvåg dyrets sundhed dagligt i 7 dage efter operationen.

5. Genosoping og sekvensanalyse

  1. Genomisk DNA-ekstraktion
    BEMÆRK: Vi brugte NucleoSpin væv DNA ekstraktion kits til at udtrække genomiske DNA fra mus ørevæv efter producentens anbefalinger.
    1. 180 μL buffer T1 og 25 μL Proteinase K-opløsning tilsættes til prøven og blandes ved vortexing i 10 s.
    2. Inkuber ved 56 °C i 2 timer, eller indtil der opnås fuldstændig lysis. Vortex for 10 s hver 30 min af inkubationen.
    3. Der tilsættes 200 μL buffer B3, vortex kraftigt i 30 s, og der inkuberes ved 70 °C i 10 min.
    4. Der tilsættes 210 μL 100% ethanol til prøven og vortex kraftigt.
    5. For hver prøve anbringes en vævskolonne i et opsamlingsrør, og prøven påføres kolonnen.
    6. Der centrifugeres i 1 min ved 11.000 x g,gennemstrømningen kasseres, og kolonnen anbringes tilbage i opsamlingsrøret.
    7. Der tilsættes 500 μL Buffer BW for at vaske prøven (1. vask), centrifugeres i 1 min ved 11.000 x g,gennemstrømningen kasseres, og kolonnen anbringes tilbage i opsamlingsrøret.
    8. Der tilsættes 600 μL buffer B5 til kolonnen (2. vask), centrifuger i 1 min ved 11.000 x g,før smid gennemløbsstrømmen, og kolonnen anbringes tilbage i opsamlingsrøret.
    9. Kolonnen centrifugeres i 1 min ved 11.000 x g for at tørre silicamembranen og anbringes NucleoSpin vævskolonnen i et 1,5 ml mikrocentrifugerør.
    10. Der tilsættes 100 μL buffer BE, inkuberes ved stuetemperatur i 1 min. g
  2. PCR-forstærkning og rensning
    1. Design primerne ved hjælp af primer3 plus hjemmeside (https://primer3plus.com/) for at forstærke en 400-500 bp sekvens omkring den målrettede locus.
    2. Design en ny PCR-protokol, og test den empirisk.
    3. Rens PCR-produktet for at fjerne de uønskede enzymer, nukleotider, primere og bufferkomponenter. En standardrensningsmetode kan anvendes som følger.
      1. Der tilsættes 50 μL fenol til 50 μL af PCR-produkterne, og der blandes ved vortexing.
      2. Centrifuger i 1 min ved 11.000 x g, og overfør det øverste gennemsigtige lag til et nyt rør.
      3. Der tilsættes 120 μL 99,5% ethanol og 20 μL 5 M ammoniumacetat og vortex i 30 s.
      4. Hold ved RT i 10 min og centrifuger ved 11.000 x g i 10 min.
      5. Supernatanten kasseres, og DNA-pelleten vaskes med 1 ml 70% ethanol.
      6. Pelletsen tørres ved RT i 10 min og opløses i 10 μL RNase frit vand.
        BEMÆRK: PCR kolonne-baserede rensning kits recommented fordi fenol er giftigt for mennesker.
  3. Sanger sekvensering
    1. Kør DNA-kvantificeringsanalyse (se Materialetabel) for at kvantificere den rensede PCR-amplicon.
    2. Send PCR-produkter og sekvenseringsprimer(er) til en sekvenstjenesteudbyder.
    3. Analysér sekvensen ved hjælp af de tilgængelige online websteder.
      BEMÆRK: I denne undersøgelse blev CRISP-ID25 (http:/crispid.gbiomed.kuleuven.be/) anvendt til sekvensanalyse.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Vores modificerede metode til kryopræservering af encellede embryoner, herunder inkubation i HTF, der indeholder 20% FBS i 10 min efterfulgt af kryopræservering i 1 M DMSO og DAP213 opløsning, forbedrede udviklingshastigheden af fryseoptøede embryoner i tocellestadiet(Figur 1, p = 0,009, Student's t-test). De fryseoptøede embryoner blev anvendt til fremstilling af GM-mus, og elektroporationsforholdene blev optimeret: fem gentagelser af 25 V med 3 ms impulser og 97 ms intervaller ved hjælp af en elektroporator som beskrevet i afsnittet protokol. Anvendeligheden af protokollen blev kontrolleret ved generering af albino Tyrosinase gen (Tyr) knockout mus (Figur 2). For at gøre dette blev gRNA-målretning exon 2 designet (figur 2A), og CRISPR-reagenser blev fremstillet som beskrevet i afsnittet protokol. Redigeringsværktøjerne blev elektropoleret inden for 1 time af embryooptøning for at sikre genomredigering fandt sted før den første replikation af genomet og forhindrede dermed mosaicism hos grundlæggerne (Figur 2B). Alle de genererede mus var albino, og kun én mus var mosaik, med en frakke med hvide og sorte pletter (Figur 2C). Alle albinomus, der huser to forskellige mutantalleler (heterozygot mutation), undtagen en mus, der kun har én allel (homozygotmutation), er vist i figur 2E. Det kan konkluderes, at vores metode kan give en redigering effektivitet på næsten 100% med en lav mosaik sats som bekræftet af sekventering analyse samt pels farve (Figur 2C-E).

Dernæst blev reproducerbarheden af protokollen kontrolleret af genereringen af flere linjer knockout og knock-in mus. Som vist i tabel 1kan protokollen generere knockout- og knock-in-mus med høj effektivitet og lave mosaikhastigheder. De fleste af de genererede F0 mus blev parret med vilde type C57BL/6J mus for at bekræfte germline transmission af mutant alleler til F1 generationer. Som forventet var alle F1-afkommet af homozygote F0-mus heterozygote og indeholdt én mutant allel og en vild type allel. Der blev ikke observeret forskellige mutationer mellem genotypebestemmelse af grundlæggerne og deres generationer. Den beskrevne protokol genererede GM-mus inden for kort tid (dvs. ~ 4 uger) som vist i protokollens arbejdsgang i figur 3.

Figure 1
Figur 1: Føtal kvægserum (FBS) forbedrede udviklingshastigheden for de fryseoptøede embryoner med to celler. Antallet af FBS+ embryoner var 286 (forsøget blev gentaget 3x), og antallet af FBS-embryoner var 272 (forsøget blev gentaget 3x). Data præsenteres som gennemsnit ± SEM. Dette tal er gengivet fra Darwish M et al.16 med tilladelse. Klik her for at se en større version af dette tal.

Figure 2
Figur 2: Generation af Tyr knockout mus med høj effektivitet og lav mosaik sats. Dette tal er ændret fra Darwish M et al.16 med tilladelse. (A) Skematisk illustration, der viser udformningen af gRNA. PAM-sekvensen vises med rødt. (B) Illustration, der viser tidspunktet for elektroporation for fryse-optøet embryoner, det gule symbol repræsenterer elektroporation tid. (C) Repræsentative billeder af de genererede Tyr knockout mus. (D) Sekvensanalyse af forskellige alleler af Tyr knockout mus. Målsekvensen er mærket med rødt, og bindestreger angiver sletningen af nukleotider i de mutante alleler. WT = vild type M = mutant allel. (E) En repræsentativ del af kromatogrammet på albinomusen, der indeholder M1-allelen, vises i D. Klik her for at se en større version af dette tal.

Figure 3
Figur 3: Arbejdsgang for protokollen for generering af GM-mus. Det første skridt var forberedelsen af kryopræparerede embryoner. Kvindelige C57BL/6J mus blev superægret, først ved PMSG injektion, derefter 48 h senere ved hCG injektion. CoCs blev indsamlet 16 h senere og udsat for IVF med spermatozoer indsamlet fra mandlige C57BL/6J mus. Befrugtede oocytter blev kryopræservering og opbevaret i flydende nitrogen, indtil det var nødvendigt. Det andet trin omfattede optøning af embryoner og elektroporation. Kryopræparerede embryoner blev optøet, og CRISPR-reagenser (dvs. tracrRNA, crRNA og Cas9-protein) blev samlet og elektropoleret inden for 1 time efter optøning af embryonerne. Det tredje trin omfattede embryooverførsel og fødsel af mus. Dagen efter elektroporation, to-celle embryoner blev overført til oviduct af pseudogravide kvindelige mus til at generere genetisk modificerede mus, der senere blev genotyped ved hjælp af Sanger sekventering at bekræfte redigering effektivitet. Den tid og indsats, der kræves for at forberede befrugtede oocytter før hvert eksperiment (trin 1) kan forkortes, hvis et stort antal kryoreserverede embryoner forberedes på forhånd. Dette tal er tilpasset fra Darwish M et al.16Klik her for at se en større version af dette tal.

Mutant mus Elektropolerede embryoner 2-cellede embryoner Overførte embryoner Hvalpe (%) Mutantmus(%) Nr. af mosaik mus
Tyr KO 124 84 48 12 (25) 100 1
Glrb KO 151 94 40 6 (15) 100 0
Slc39a6 KO 48 25 25 5 (20) 100 0
Bag3 KI 233 84 20 3 (15) 50 1
Camk2a KI 124 70 70 14 (20) 64.3 0

Tabel 1: Produktion af flere linjer GM-mus med fryseoptøet embryoner med C57BL/6J baggrund.

Supplerende tabel 1. Klik her for at downloade denne tabel.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Den beskrevne protokol giver mulighed for generering af GM-mus med høj effektivitet og lave mosaikhastigheder (tabel 1). Det gør det nemt for forskere uden avancerede embryomanipulationsevner at skabe mutantmus, fordi det udnytter de nyeste og mest nyttige fremskridt inden for både reproduktionsteknik og genomredigeringsteknologier: CRISPR/Cas9 ribonucleoprotein (RNP) og elektroporation til fryseoptøede embryoner. Disse fremskridt lettede og fremskyndede generationen af GM-musene. Som beskrevet i figur 3tager det ~4 uger at generere GM-musene. Sammenlignet med andre protokoller ved hjælp af lignende tilgange26,vores metode er overlegen med hensyn til effektivitet, fødselstal, og mosaicism.

Inkubationen af encellede embryoner i FBS før kryopræserveringen er afgørende for at forbedre embryonernes udviklingshastighed. Elektroporationsforholdene for de kryopræparerede embryoner, der er beskrevet i protokollen, gør det muligt at gå på kompromis mellem CRISPR-reagensernes redigeringseffektivitet og embryonernes overlevelse. Faktisk kan hårdere eller mildere forhold påvirke udviklingen af embryoner og redigering effektivitet, henholdsvis16. Tidspunktet for elektroporationen (figur 2B) er afgørende for at overvinde mosaikken i stiftere og sikre, at genommodifikation sker i nærværelse af kun to alleler. Dette er i overensstemmelse med tidligere rapporter, der viser, at elektroporation i den tidlige fase kan producere ikke-mosaikmutanter17. Hertil kommer, at brugen af RNP i stedet for gRNA / mRNA nedsætter mosaik sats og forbedrer redigering effektivitet17.

Den beskrevne protokol har flere fordele. For det første genererer den mutantmusene inden for kort tid (~4 uger). For det andet er det en yderst effektiv og robust protokol. flere linjer knockout (KO) og knock-in (KI) mus blev genereret med høje mutationshastigheder (KO = 100%, KI = 50 til 64,3%). For det tredje er det praktisk og omkostningseffektivt. Brugen af komplet syntetisk crRNA, tracrRNA, ssODN og Cas9 protein eliminerer behovet for kedelig forberedelse af Cas9 vektorer og in vitro transskription. I stedet giver det forskerne mulighed for blot at bruge kommercielle reagenser og standardudstyr. For det fjerde bruger det ikke mikroinjektion, hvilket kræver høje tekniske færdigheder. For det femte reducerer det mosaikken i grundlæggerne, og dermed fører til mere effektiv germline transmission af de redigerede alleler, overvinde den komplicerede genotypiske analyse af mosaik mus. Endelig er denne protokol effektiv med C57BL/6J indavlet stamme, som undgår brugen af F1 hybrider, og dermed behovet for at udføre mange backcrosses at slippe af med genetisk kompleksitet. Genotypebestemmelse af F1 generationer bekræftede nøjagtig germline transmission. Det anbefales dog ikke at studere F0-musenes fænotyper på grund af allelkompleksitet og vildledende forudsigelse af genotypebestemmelse af efterfølgende generation ekstrapoleret fra genotypeerne af F0-stifterne14,27.

Det er af største betydning at udnytte anvendelsen af de fryseoptøede embryoner til genomredigering af ikke-menneskelige primater og store dyr som svin og får, som ikke altid er let tilgængelige. Metoderne til embryofrysning varierer meget afhængigt af dyrearterne. Derfor mener vi, at vores kryopræserveringsprotokol måske kun gælder for mus. På den anden side, vores protokol er potentielt gældende for brug af tekniske nuklatermer andre end Cas9 til generering af GM mus, fordi elektroporation tidligere er blevet rapporteret til at indføre andre nuklase såsom Cas12a i fosteret effektivt28,29.

En begrænsning af protokollen er den præcise integration af en lang transgene til genomet, som anses for vanskeligt i elektroporation-baserede protokoller. Der blev imidlertid rapporteret om en mulig løsning: Integrationen af transgenes op 4,9 Kb i musegenomet blev udført med succes ved at kombinere elektroporation med et adeno-associeret virus (AAV)-medieret HDR donor delivery system30, hvilket bekræfter en tidligere publikation31. Den potentielle forekomst af off-target bivirkninger er også et stort problem med brugen af CRISPR/Cas9-teknologi. Vi har ikke udført helgenssekvensaf de redigerede mus for at udelukke den potentielle off-target-effekt. Vi har dog brugt CRISPR-værktøjer, der er blevet rapporteret, til at reducere off-target-effekten, såsom RNP32. Desuden brugte vi en high-fidelity Cas9 variant, der reducerer off-target redigering uden at ofre on-target ydeevne33. Også, vi designet gRNAs ved hjælp af CRISPRdirect software (https://crispr.dbcls.jp), hvilket bør resultere i målsekvenser med minimeret off-target sites19. For at bekræfte genotype-fænotype kausalitet og afhjælpe bekymringer om off-target effekter, forskere bør generere flere redigerede mus af samme genotype ved hjælp af forskellige gRNAs eller udføre backcrossing af de genererede mus i flere generationer.

Knockout musene genereret ved hjælp af NHEJ mekanisme og frameshift mutationer er blevet udbredt og viser relevante fænotyper. Der kan dog eksistere afkortet restprotein på grund af enten reindledning af oversættelse eller spring af den redigerede exon34,35. Derfor, for præcist at fortolke fænotyper, karakterisering af resterende protein funktion eller udtryk er nødvendig. Genereringen af komplette genknockoutmus, der bruger mere end ét gRNA, ville være et godt alternativ. Der bør dog lægges særlig vægt på at bekræfte, at genet ikke indeholder introniske områder, der er transskriberet med ikke-kodende RNA'er, hvilket kan have regulerende funktioner og dermed komplicere fænotypiske analyser.

I denne undersøgelse viser vi en simpel protokol, hvorved mange forskere kan generere genetisk modificerede mus i 4 uger eller mindre. Ved at kombinere brugen af fryseoptøede embryoner og elektroporation gør vi udarbejdelsen af musemodeller af menneskelige sygdomme let, hurtig og effektiv.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ingen relevante finansielle oplysninger.

Acknowledgments

Vi vil gerne takke Hitomi Sawada og Elizabeth Garcia for dyrepleje. Dette arbejde blev støttet af KAKENHI (15K20134, 17K11222, 16H06276 og 16K01946) og Hokugin Research Grant (til H.N.), og Jichi Medical University Young Investigator Award (til H.U.). Otsuka Toshimi Scholarship Foundation støttede M.D.

Materials

Name Company Catalog Number Comments
0.25 M Sucrose ARK Resource Co., Ltd. (Kumamoto, Japan) SUCROSE
1 M DMSO ARK Resource Co., Ltd. (Kumamoto, Japan) 1M DMSO
Butorphanol Meiji Seika Pharma Co., Ltd. (Tokyo, Japan) Vetorphale 5mg
Cas9 protein: Alt-R® S.p. HiFi Cas9 Nuclease 3NLS Integrated DNA Technologies, Inc. (Coralville, IA) 1081060
C57BL/6J mice Japan SLC (Hamamatsu, Japan) N/A
DAP213 ARK Resource Co., Ltd. (Kumamoto, Japan) DAP213
FBS Sigma-Aldrich, Inc. (St. Louis, MO) ES-009-C
hCG MOCHIDA PHARMACEUTICAL CO., LTD (Tokyo, Japan) HCG Mochida 3000
HTF ARK Resource Co., Ltd. (Kumamoto, Japan) HTF
ICR mice Japan SLC (Hamamatsu, Japan) N/A
Isoflurane Petterson Vet Supply, Inc. (Greeley, CO) 07-893-1389
KSOM ARK Resource Co., Ltd. (Kumamoto, Japan) KSOM
LN2 Tank Chart Industries (Ball Ground, GA) XC 34/18
M2 ARK Resource Co., Ltd. (Kumamoto, Japan) M2
Medetomidine Nippon Zenyaku Kogyo Co.,Ltd. (Koriyama, Japan) 1124401A1060
Microscope Nikon Co. (Tokyo, Japan) SMZ745T
Midazolam Sandoz K.K. (Tokyo, Japan) 1124401A1060
Nuclease free buffer Integrated DNA Technologies, Inc. (Coralville, IA) 1072570
Nucleospin DNA extraction kit Takara Bio Inc (Kusatsu, Japan) 740952 .5
One-hole slide glass Matsunami Glass Ind., Ltd. (Kishiwada, Japan) S339929
One-step type Electroporator BEX Co., Ltd. (Tokyo, Japan) CUY21EDIT II
Paraffin Liquid NACALAI TESQUE Inc. (Kyoto, Japan) SP 26137-85
Platinum plate electrode BEX Co., Ltd. (Tokyo, Japan) LF501PT1-10, GE-101
PMSG ASKA Animal Health Co., Ltd (Tokyo, Japan) SEROTROPIN 1000
Povidone iodide Professional Disposables International, Inc. (Orangeburg, NY) C12400
Reduced-Serum Minimal Essential Medium: OptiMEM I Sigma-Aldrich, Inc. (St. Louis, MO) 22600134
Two-step type Electroporator Nepa Gene Co., Ltd. (Ichikawa, Japan) NEPA21

DOWNLOAD MATERIALS LIST

References

  1. Wang, H., et al. One-step generation of mice carrying mutations in multiple genes by CRISPR/cas-mediated genome engineering. Cell. 153, (4), 910-918 (2013).
  2. Jinek, M., et al. A programmable dual-RNA - guided DNA endonuclease in adaptive bacterial immunity. Science. 337, (6096), 816-822 (2012).
  3. Mali, P., et al. RNA-guided human genome engineering via Cas9. Science. 339, (6121), 823-826 (2013).
  4. Cong, L., et al. Multiplex genome engineering using CRISPR/VCas systems. Science. 339, (6121), 819-823 (2013).
  5. Doudna, J. A., Charpentier, E. The new frontier of genome engineering with CRISPR-Cas9. Science. 346, (6213), 1258096 (2014).
  6. Mashiko, D., et al. Generation of mutant mice by pronuclear injection of circular plasmid expressing Cas9 and single guided RNA. Scientific Reports. 3, 3355 (2013).
  7. Yen, S. T., et al. Somatic mosaicism and allele complexity induced by CRISPR/Cas9 RNA injections in mouse zygotes. Developmental Biology. 393, (1), 3-9 (2014).
  8. Kaneko, T., Mashimo, T. Simple genome editing of rodent intact embryos by electroporation. PLoS ONE. 10, (11), 1-7 (2015).
  9. Qin, W., et al. Efficient CRISPR/cas9-mediated genome editing in mice by zygote electroporation of nuclease. Genetics. 200, (2), 423-430 (2015).
  10. Kaneko, T., Sakuma, T., Yamamoto, T., Mashimo, T. Simple knockout by electroporation of engineered endonucleases into intact rat embryos. Scientific Reports. 4, 6382 (2014).
  11. Hashimoto, M., Takemoto, T. Electroporation enables the efficient mRNA delivery into the mouse zygotes and facilitates CRISPR/Cas9-based genome editing. Scientific Reports. 5, 11315 (2015).
  12. Chen, S., Lee, B., Lee, A. Y. F., Modzelewski, A. J., He, L. Highly efficient mouse genome editing by CRISPR ribonucleoprotein electroporation of zygotes. Journal of Biological Chemistry. 291, (28), 14457-14467 (2016).
  13. Modzelewski, A. J., et al. Efficient mouse genome engineering by CRISPR-EZ technology. Nature Protocols. 13, (6), 1253-1274 (2018).
  14. Teixeira, M., et al. Electroporation of mice zygotes with dual guide RNA/Cas9 complexes for simple and efficient cloning-free genome editing. Scientific Reports. 8, 474 (2018).
  15. Nakagawa, Y., et al. Production of knockout mice by DNA microinjection of various CRISPR/Cas9 vectors into freeze-thawed fertilized oocytes. BMC Biotechnology. 15, (1), 1-10 (2015).
  16. Darwish, M., et al. Rapid and high-efficient generation of mutant mice using freeze-thawed embryos of the C57BL/6J strain. Journal of Neuroscience Methods. 317, 149-156 (2019).
  17. Hashimoto, M., Yamashita, Y., Takemoto, T. Electroporation of Cas9 protein/sgRNA into early pronuclear zygotes generates non-mosaic mutants in the mouse. Developmental Biology. 418, (1), 1-9 (2016).
  18. Sakamoto, W., Kaneko, T., Nakagata, N. Use of frozen-thawed oocytes for efficient production of normal offspring from cryopreserved mouse spermatozoa showing low fertility. Comparative Medicine. 55, (2), 136-139 (2005).
  19. Naito, Y., Hino, K., Bono, H., Ui-Tei, K. CRISPRdirect: Software for designing CRISPR/Cas guide RNA with reduced off-target sites. Bioinformatics. 31, (7), 1120-1123 (2015).
  20. Torres-Perez, R., Garcia-Martin, J. A., Montoliu, L., Oliveros, J. C., Pazos, F. WeReview: CRISPR Tools-Live Repository of Computational Tools for Assisting CRISPR/Cas Experiments. Bioengineering. 6, (3), 63 (2019).
  21. Okamoto, S., Amaishi, Y., Maki, I., Enoki, T., Mineno, J. Highly efficient genome editing for single-base substitutions using optimized ssODNs with Cas9-RNPs. Scientific Reports. 9, 4811 (2019).
  22. Takeo, T., Nakagata, N. Superovulation using the combined administration of inhibin antiserum and equine chorionic gonadotropin increases the number of ovulated oocytes in C57BL/6 female mice. PLoS ONE. 10, (5), 1-11 (2015).
  23. Wuri, L., Agca, C., Agca, Y. Euthanasia via CO2 inhalation causes premature cortical granule exocytosis in mouse oocytes and influences in vitro fertilization and embryo development. Molecular Reproduction and Development. 86, (7), 825-834 (2019).
  24. Nakagata, N. High survival rate of unfertilized mouse oocytes after vitrification. Journal of Reproduction and Fertility. 87, (2), 479-483 (1989).
  25. Dehairs, J., Talebi, A., Cherifi, Y., Swinnen, J. V. CRISP-ID: Decoding CRISPR mediated indels by Sanger sequencing. Scientific Reports. 6, 28973 (2016).
  26. Nakagawa, Y., Sakuma, T., Takeo, T., Nakagata, N., Yamamoto, T. Electroporation-mediated genome editing in vitrified/warmed mouse zygotes created by ivf via ultra-superovulation. Experimental Animals. 67, (4), 535-543 (2018).
  27. Nakajima, K., Nakajima, T., Takase, M., Yaoita, Y. Generation of albino Xenopus tropicalis using zinc-finger nucleases. Development Growth and Differentiation. 54, (9), 777-784 (2012).
  28. Hur, J. K., et al. Targeted mutagenesis in mice by electroporation of Cpf1 ribonucleoproteins. Nature Biotechnology. 34, 807-808 (2016).
  29. Dumeau, C. E., et al. Introducing gene deletions by mouse zygote electroporation of Cas12a/Cpf1. Transgenic Research. 28, (5-6), 525-535 (2019).
  30. Chen, S., et al. CRISPR-READI: Efficient Generation of Knockin Mice by CRISPR RNP Electroporation and AAV Donor Infection. Cell Reports. 27, (13), 3780-3789 (2019).
  31. Mizuno, N., et al. Intra-embryo Gene Cassette Knockin by CRISPR/Cas9-Mediated Genome Editing with Adeno-Associated Viral Vector. iScience. 9, 286-297 (2018).
  32. Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. Highly Efficient RNA-guide genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Research. 24, (6), 1012-1019 (2014).
  33. Vakulskas, C. A., et al. A high-fidelity Cas9 mutant delivered as a ribonucleoprotein complex enables efficient gene editing in human hematopoietic stem and progenitor cells. Nature Medicine. 24, (8), 1216-1224 (2018).
  34. Rodriguez-Rodriguez, J. A., et al. Distinct Roles of RZZ and Bub1-KNL1 in Mitotic Checkpoint Signaling and Kinetochore Expansion. Current Biology. 28, (21), 3422-3429 (2018).
  35. Smits, A. H., et al. Biological Plasticity Rescues Target Activity in CRISPR Knockouts. Nature Methods. 16, 1087-1093 (2019).
Anvendelse af fryseoptøede embryoner til højeffektiv produktion af genetisk modificerede mus
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Nishizono, H., Darwish, M., Uosaki, H., Masuyama, N., Seki, M., Abe, H., Yachie, N., Yasuda, R. Use of Freeze-thawed Embryos for High-efficiency Production of Genetically Modified Mice. J. Vis. Exp. (158), e60808, doi:10.3791/60808 (2020).More

Nishizono, H., Darwish, M., Uosaki, H., Masuyama, N., Seki, M., Abe, H., Yachie, N., Yasuda, R. Use of Freeze-thawed Embryos for High-efficiency Production of Genetically Modified Mice. J. Vis. Exp. (158), e60808, doi:10.3791/60808 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter