Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Gebruik van gevriesde embryo's voor hoogrendementproductie van genetisch gemodificeerde muizen

doi: 10.3791/60808 Published: April 2, 2020
* These authors contributed equally

Summary

Hier presenteren we een aangepaste methode voor cryopreservatie van eencellige embryo's, evenals een protocol dat het gebruik van gevriesontdooide embryo's en elektroporatie koppelt voor de efficiënte generatie van genetisch gemodificeerde muizen.

Abstract

Het gebruik van genetisch gemodificeerde (GM) muizen is cruciaal geworden voor het begrijpen van de genfunctie en het ontcijferen van de onderliggende mechanismen van menselijke ziekten. Het CRISPR/Cas9-systeem stelt onderzoekers in staat om het genoom te wijzigen met ongekende efficiëntie, trouw en eenvoud. Gebruikmakend van deze technologie, onderzoekers zijn op zoek naar een snelle, efficiënte en eenvoudige protocol voor het genereren van GM muizen. Hier introduceren we een verbeterde methode voor cryopreservatie van eencellige embryo's die leidt tot een hogere ontwikkelingsgraad van de invriesontdooide embryo's. Door het te combineren met geoptimaliseerde elektroporatieomstandigheden, maakt dit protocol het mogelijk om binnen korte tijd knock-out- en knock-in muizen te genereren met een hoog rendement en lage mozaïeksnelheden. Verder tonen we een stapsgewijze uitleg van ons geoptimaliseerde protocol, dat betrekking heeft op CRISPR reagensvoorbereiding, in vitro fertilisatie, cryopreservatie en ontdooiing van eencellige embryo's, elektroporatie van CRISPR-reagentia, muisgeneratie en genotypering van de oprichters. Met behulp van dit protocol moeten onderzoekers gm-muizen met ongeëvenaard gemak, snelheid en efficiëntie kunnen voorbereiden.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Het geclusterde regelmatig interspaced korte palindromische repeats (CRISPR)/CRISPR-geassocieerd eiwit 9 (Cas9) systeem is een wetenschappelijke doorbraak die ongekende gerichte modificatie in het genoom1biedt. Het CRISPR/Cas9 systeem bestaat uit Cas9 eiwit- en gidsRNA (gRNA) met twee moleculaire componenten: een doelspecifiek CRISPR RNA (crRNA) en een transactiverend CRISPR RNA (tracrRNA)2 . Een gRNA stuurt het Cas9-eiwit naar de specifieke locus in het genoom, 20 nucleotiden complementair aan crRNA en grenzend aan het protospacer aangrenzende motief (PAM). Het Cas9-eiwit bindt zich aan de doelsequentie en induceert dubbele strengbreuken (DSB's) die worden gerepareerd door ofwel foutgevoelige nonhomologe end joining (NHEJ) of high fidelity homologie-gerichte reparatie (HDR)3,4,5. NHEJ leidt tot invoegingen of/en schrappingen (indels), en vandaar tot genverlies van functie wanneer een codageopeenvolging wordt gericht. De HDR leidt tot nauwkeurige genoombewerking in aanwezigheid van een reparatiesjabloon met homologiesequenties3,4,5. De NHEJ en HDR zijn ingezet om respectievelijk knock-out- en knock-in muizen te genereren.

Terwijl het CRISPR/Cas9-systeem de generatie GM-muizen met een uitstekende werkzaamheid en trouw aanzienlijk heeft versneld, stuiten wetenschappers die deze methoden toepassen vaak op technische uitdagingen. Ten eerste vereisen conventionele protocollen micro-injectie voor de introductie van de CRISPR-bewerkingsinstrumenten in de kern van bevruchte eieren6,7. Deze techniek is tijdrovend en vereist meestal uitgebreide training. Zo vervingen verschillende groepen micro-injectie door elektroporatie8,9,10,11,12,13. In de vroege elektroporatieprotocollen werden echter verse embryo's gebruikt voor elektroporatie. Dit veroorzaakte een ander probleem, omdat het bereiden van verse embryo's voor elk experiment moeilijk is14.

Onlangs hebben wij en anderen het gebruik van gevriesontdooide embryo's en elektroporatie voor genoombewerking gecombineerd, wat de generatie gm-muizen15,16vergemakkelijkt. Dit protocol stelt onderzoekers zonder geavanceerde embryomanipulatievaardigheden in staat om snel diermodellen van menselijke ziekten met een hoge efficiëntie te genereren. Het protocol vermindert ook aanzienlijk praktische uitdagingen bij het genereren van GM muizen, zoals genetische heterogeniteit in de oprichters16. Om mosaicisme te overwinnen, voeren we de elektroporatie van CRISPR-reagentia uit binnen 1 uur na het ontdooien van embryo's om ervoor te zorgen dat bewerking plaatsvindt vóór de eerste replicatie van het genoom. Een andere verbetering omvat het gebruik van Cas9-eiwit in plaats van Cas9 mRNA om ongewenst mozaïekisme te verminderen17. Verder ontwikkelden we een optimale methode voor eencellige embryo cryopreservatie die de ontwikkelingsgraad verhoogt tot de tweecellige fase16: het gebruik van foetaal runderserum (FBS) verbetert de overleving van vriesontdooide eicellen na de bevruchting drastisch, misschien door hetzelfde mechanisme dat bevriesde onbevruchte eicellen maakt18.

Hier presenteren we een uitgebreid protocol voor de generatie van GM muizen met behulp van gevriesontdooide embryo's, met inbegrip van de gewijzigde methode voor cryopreservatie van eencellige C57BL/6J embryo's. Het omvat 1) gRNA-ontwerp, CRISPR reagensvoorbereiding en montage; 2) IVF, cryopreservatie en ontdooiing van embryo's uit één cel; 3) Elektroporatie van CRISPR-reagentia in ontdooide embryo's; 4) Embryotransfer in het eicel van pseudozwangere vrouwelijke muizen; en 5) Genotypering en sequentieanalyse van de F0-oprichtersdieren.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Alle dierverzorging en procedures die in dit onderzoek werden uitgevoerd, werden uitgevoerd volgens de regels en voorschriften van de Gids voor de Zorg en Het Gebruik van Proefdieren. Het experimentele protocol werd goedgekeurd door het Animal Care Committee of Laboratory Animals van de Universiteit van Toyama, de Universiteit van Tokio, de Jichi University en het Max Planck Florida Institute for Neuroscience. Informatie over alle reagentia is te zien in de Materiaaltafel.

1. CRISPR reagentia ontwerp

  1. crRNA-ontwerp
    1. Bezoek CRISPR direct19 (https://crispr.dbcls.jp/) om specifieke crRNA's te ontwerpen met gereduceerde off-target sites.
      OPMERKING: Er zijn veel andere handige tools om de crRNA20 (https://bioinfogp.cnb.csic.es/tools/wereview/crisprtools/) te ontwerpen.
    2. Voeg de doelnucleotide-reeks in en breng de volgende wijzigingen aan:
      PAM sequentie vereiste = NGG
      Specificiteitscontrole = Muis (Mus musculus) genoom, GRCm38/mm10 (december 2011)
      OPMERKING: Als voorbeeld, om Tyrosinase (Tyr) knock-out muizen te genereren, exon 2 (nucleotide sequentie van 9476-9692) was gericht.
    3. Klik op Ontwerpen markeer voor zeer specifieke hits Alleen hoogspecifiek doel weergeven.
    4. Om potentiële effecten buiten het doel te verminderen, kiest u de doelvolgorde met de laagste waarde in de kolommen "12 mer+PAM" en "8 mer+PAM".
      OPMERKING: In deze kolommen geeft ("1") aan dat de reeks slechts één perfecte overeenkomst heeft met de beoogde doellocatie en dat getallen groter dan één de aanwezigheid van potentiële locaties buiten het doel aangeven.
    5. Bestel de resulterende oligonucleotiden bij crRNA synthesebedrijven (Supplimentary Table 1).
      OPMERKING: Voor het exon 2 Tyr-gen werd de volgende doelsequentie gebruikt: GGACCACTATTACGTAATCC, met +TGG als PAM-sequentie (figuur 2A).
  2. Single streng oligodeoxynucleotide (ssODN) ontwerp voor HDR-gemedieerde bewerkingsexperimenten (d.w.z. knock-in muizengeneratie).
    1. Ontwerp de ssODN-lengte tot ongeveer 80-180 bp, inclusief 30-60 nucleotide (nt) homologiearmen aan beide zijden.
      OPMERKING: Een ssODN van 75-85 nt lengte, met inbegrip van een 30-35 nt homologie arm en complementair aan de gRNA, toonde hoge knock-in bewerkingsefficiëntie21.
    2. Plaats de beoogde modificatie en stille mutatie op de PAM-sequentie of, indien niet mogelijk, op de 5 'naburige basis van PAM om de recutting te blokkeren na genoombewerking.
      OPMERKING: Het crRNA en ssODN dat in dit onderzoek wordt gebruikt, zijn opgenomen in aanvullende tabel 1.

2. In vitro fertilisatie, cryopreservatie van embryo's en vriesontdooiing

  1. In vitro fertilisatie
    1. Superovulate C57BL/6J vrouwelijke muizen (4 of 8 weken oud) door IP-injectie met zwangere merrieserum gonadotropine (PMSG) gevolgd door injectie met 7,5 IE menselijke chorionic gonadotropine (hCG) na 48 uur.
      OPMERKING: Het aantal geovuleerde eicellen kan met ongeveer 3x worden verhoogd met behulp van ultra-superovulatie22.
    2. Verwijder de cauda epididymides van seksueel volwassen C57BL/6J mannelijke muizen (3-5 maanden oud).
      LET OP: Het is mogelijk om spermatozoa te verzamelen zonder de mannelijke muizen op te offeren.
    3. Haal stolsels spermatozoa met een ontledende naald en incubeer ze in een 200 μL-druppel menselijke tubale vloeistof (HTF) in CO2-incubator voor 1,5 uur voor capacitation.
    4. Verzamel cumulus-eicelcomplexen (COC's) uit de eiducten 16-18 uur na de hCG-injectie en incubeer ze in een verse 200 μL-druppel HTF-medium bedekt met paraffinevloeistof in een CO2-incubator (5% CO2, 37 °C) voor niet meer dan 2 uur.
      OPMERKING: Het verdient de voorkeur om de muizen op te2 offeren door cervicale dislocatie onder narcose, omdat euthanasie via CO 2-inhalatie van invloed is op IVF en embryoontwikkeling23.
    5. Voeg 1-5 μL spermasuspensie toe vanaf de grens van het incubatiemedium tot de 200 μL-daling van HTF-medium met COC's en incubeer ze gedurende 3 uur in een CO2-incubator.
    6. Was de eicellen met kalium-aangevuld simplex optimalisatie medium (KSOM) 3x om resterende sperma en cumulus cellen te verwijderen.
    7. Controleer de pronucleaire vorming en de kwaliteit van eencellige embryo's met behulp van een omgekeerde microscoop.
  2. Cryopreservatie van eencellige embryo's
    1. Incubeer embryo's uit één cel in een 200 μL-druppel HTF met 20% FBS (niet2 bedekt met paraffinevloeistof) gedurende 10 min in een CO 2-incubator.
    2. Breng 20-100 embryo's over tot 50 μL van 1 M dimethylsulfoxide (DMSO) oplossing24.
    3. Breng 5 μL van een oplossing met 100 embryo's over in de bodem van een cryobuis en koel gedurende 5 min bij 0 °C met behulp van een koelmachine of op ijs.
    4. Voeg 45 μL DAP213 (2 M dimethylsulfoxide, 1 M paracetamol en 3 M propyleenglycol) oplossing langzaam langs de buiswand, kap de buizen, en houd 5 min in een koeler of op ijs op 0 °C.
      LET OP: Maak de doppen niet te stevig vast om ze gemakkelijk te verwijderen tijdens het ontdooien van het monster.
    5. Bewaar buizen snel in vloeibare stikstof.
  3. Embryo ontdooien
    1. Open het deksel van de cryobuis, gooi de resterende vloeibare stikstof weg en voeg 900 μL van 0,25 M sacharoseoplossing voorverwarmd toe tot 37 °C.
      LET OP: De 0,25 M sacharoseoplossing moet van tevoren worden opgewarmd tot 37 °C, omdat het gebruik van koude oplossing de levensvatbaarheid van embryo's na het ontdooien vermindert.
    2. Pipet snel voor 10x en breng de inhoud van de cryotube in een plastic schotel.
      LET OP: De pipettering moet zorgvuldig worden uitgevoerd, zodat er geen bellen worden gegenereerd en de embryo's beschadigen.
    3. Was de morfologische normale bevruchte eicellen 2x in KSOM medium bedekt met paraffinevloeistof en bewaar ze in een CO2-incubator tot elektroporatie.

3. Assemblage en elektroporatie van CRISPR-reagentia

OPMERKING: Voor elektroporratie gebruikten we een platinaplaatelektrode (hoogte: 0,5 mm, lengte: 10 mm, breedte: 3 mm, opening: 1 mm) en een elektroporator van één stap die eerder8 werd beschreven (Tabel van materialen). Een elektroporator van het type twee stappen kan ook worden gebruikt (Tabel van materialen).

  1. Voorbereiding en assemblage van CRISPR-reagentia
    1. Bestel CRISPR-reagentia (d.w.z. crRNA, tracrRNA en Cas9-eiwit) en ssODN bij het uitvoeren van HDR-gemedieerde bewerkingsexperimenten(Tabel van materialen en aanvullende tabel 1).
    2. Bereid de annealing oplossing als volgt voor.
      1. Bereid 1 μg/μL crRNA en 1 μg/μL tracrRNA voor in Reduced-Serum Minimal Essential Medium solution (Table of Materials)en voeg 6 μL van elke oplossing toe aan 42 μL van de nucleasevrije buffer.
      2. Incubeer het mengsel in de droge kachel bij 95 °C gedurende 3 min en koel af bij RT gedurende 5 min.
      3. Bereid 1 μg/μL HiFi Cas9 eiwit verdund in Opti-MEM I en voeg 6 μL toe aan het vorige mengsel voor een totaal volume van 60 μL.
      4. Voeg bij het uitvoeren van hdr-gemedieerde bewerkingsexperimenten 6 μL van 1 μg/μL ssODN toe. Omdat het uiteindelijke volume 60 μL moet zijn, gebruikt u 36 μL nucleasevrij water in stap 3.1.2.1.
        OPMERKING: De uiteindelijke concentratie crRNA, tracrRNA, Cas9-eiwit en ssODN zal 100 ng/μL zijn.
      5. Breng tot 100 embryo's over tot 25 μL van het uiteindelijke mengsel (RNP-complex) in een schuifglas met één gat en incubeer ze bij 37 °C gedurende 10 min.
  2. Elektroporatie
    1. Vul het elektrodegat met 6 μL van het nieuwe mengsel van CRISPR-reagentia en voeg 20-25 embryo's toe aan het mengsel.
      OPMERKING: Het is belangrijk om elk contact tussen de embryo's en de elektroporatieelektrode te vermijden, die embryo's kan beschadigen tijdens elektrische pulsen.
    2. Voer de elektroporratie uit onder de volgende voorwaarden voor een elektroporator van één stap:
      Spanning: 25 V, Pulsrichting (Pd) +
      AAN: 3 ms, UIT: 97 ms
      Herhalingen: 5x
      OPMERKING: Elektroporatie mag niet meer dan 1 uur na ontdooiing worden uitgevoerd om ervoor te zorgen dat genoombewerking plaatsvindt vóór de eerste DNA-replicatie om mosaicisme te voorkomen.
    3. Stel voor een elektroporator in twee stappen de voorwaarden als volgt in:
      Poring Pulse = 40V, Pd +
      ON = 1 of 2,5 ms; Pulsinterval = 50 ms
      Herhalingen: 4x, Verval 10%

      OverdrachtPulse = 5 of 7V; Pd +/-.
      OP: 50 ms; Pulsinterval = 50 ms.
      Herhalingen = 5x; Verval = 40%.
      OPMERKING: Het is belangrijk om het volume aan te passen om de impedantie te behouden binnen het specifieke bereik dat door de fabrikant is opgegeven.
    4. Was de embryo's 3x met gemodificeerd Krebs-Ringer Bicarbonaat Buffer 2 (M2) medium gevolgd door twee wasbeurten met een druppel KSOM medium bedekt met paraffinevloeistof.
    5. Incubeer de gewassen embryo's (in KSOM medium) in een CO2 incubator 's nachts voor verdere transplantatie.

4. Embryotransfer

  1. Bereid pseudozwangere vrouwelijke muizen voor. Mate ICR vrouwelijke muizen (3-6 maanden) met vasectomized mannelijke muizen 1 dag voor de embryotransfer (ET).
    LET OP: Muizen moeten de volgende ochtend worden gecontroleerd op een copulatory plug. De muizen met een stekker worden beschouwd als pseudozwanger en kunnen worden gebruikt voor ET.
  2. Aanzuigen lucht en KSOM (zonder paraffine vloeistof) in alternatieve intervallen van 2-3 mm in een glazen capillaire als een marker voor succesvolle implantatie.
  3. Introduceer 20-24 embryo's in een 200 μL-druppel KSOM (zonder paraffinevloeistof) en trek 10-12 embryo's in de glazen capillaire voor implantatie in elk oelater.
  4. Verdoven van de vrouwelijke muizen door isofluraan (inademing) of een IP-injectie van een oplossing die medetomidine/midazolam/butorphanol (respectievelijk 0,3 mg/kg, 4,0 mg/kg en 5,0 mg/kg) combineert. Plaats de verdoofde muis op zijn ventrale kant op een verwarmingskussen. Bescherm de ogen van de verdoofde muis met een hydraterende gel.
  5. Scheer langs het onderste deel van de ruglijn en desinfecteer het gebied met povidone jodium gevolgd door met 70% ethanol.
  6. Maak een lange ~ 1 cm incisie parallel aan de ruglijn middellijn.
  7. Neem de oviduct en plaats op een steriele plastic gordijnen. Houd het vochtig met behulp van warme steriele zoutlijn.
  8. Plaats het oviduct onder de stereoscopische microscoop.
  9. Maak een gat in de wand van de oviduct tussen het infundibulum en ampulla een paar millimeter stroomopwaarts van de ampulla door microspring schaar.
  10. Plaats de punt van de glazen capillaire met de embryo's in het gat en blaas zachtjes in het mondstuk van de capillaire houder om de embryo's te verdrijven totdat er een luchtbel zichtbaar is in de ampulla.
    LET OP: Breng tussen 10-12 embryo's per oenoduct over.
  11. Trek de glazen capillaire uit de oviduct wand en duw het voortplantingsorgaan voorzichtig terug in de lichaamsholte.
  12. Herhaal het vorige proces om de embryo's in het andere eibuis te introduceren.
  13. Bij het voltooien van de ET-procedure, hechting van het peritoneum met een eenvoudige onderbroken hechtingspatroon (50, absorbeerbare, gevlochten synthetische hechtingen) en vervolgens de huid met een eenvoudig onderbroken patroon of een begraven onderhuids onderbroken steekpatroon (60 niet-absorberende, monosynthetische hechtingen).
  14. Houd de muis warm op een 37 °C opwarmingplaat totdat deze herstelt van anesthesie.
  15. Controleer de gezondheid van het dier dagelijks gedurende 7 dagen na de operatie.

5. Genotypering en sequentieanalyse

  1. Genomische DNA-extractie
    OPMERKING: We gebruikten NucleoSpin weefsel DNA extractie kits om het genoom DNA te extraheren uit muizen oorweefsel na de aanbevelingen van de fabrikant.
    1. Voeg 180 μL Buffer T1 en 25 μL Proteinase K-oplossing toe aan het monster en meng door vortexing voor 10 s.
    2. Incubeer bij 56 °C gedurende 2 uur of tot volledige lysis is verkregen. Vortex voor 10 s om de 30 min van de incubatie.
    3. Voeg 200 μL buffer B3, vortex krachtig toe voor 30 s en incubeer bij 70 °C gedurende 10 min.
    4. Voeg 210 μL ethanol van 100% aan het monster en vortex krachtig toe.
    5. Plaats voor elk monster één weefselkolom in een verzamelbuis en breng het monster aan op de kolom.
    6. Centrifugeer gedurende 1 min op 11.000 x g,gooi de flowthrough weg en plaats de kolom terug in de opvangbuis.
    7. Voeg 500 μL Buffer BW toe om het monster te wassen (1e wasbeurt), centrifugeer gedurende 1 min bij 11.000 x g,gooi de flowthrough weg en plaats de kolom terug in de opvangbuis.
    8. Voeg 600 μL buffer B5 toe aan de kolom (2e wasbeurt), centrifugeer gedurende 1 min bij 11.000 x g,gooi de flowthrough weg en plaats de kolom terug in de opvangbuis.
    9. Centrifugeer de kolom gedurende 1 min op 11.000 x g om het silicamembraan te drogen en plaats de NucleoSpin-weefselkolom in een 1,5 mL-microcentrifugebuis.
    10. Voeg 100 μL buffer BE toe, incubeer bij kamertemperatuur gedurende 1 min en centrifugeer 1 min bij 11.000 x g.
  2. PCR-versterking en zuivering
    1. Ontwerp de primers met behulp van de primer3 plus website (https://primer3plus.com/) om een 400-500 bp sequentie rond de beoogde locus te versterken.
    2. Ontwerp een nieuw PCR-protocol en test het empirisch.
    3. Zuiver het PCR-product om de ongewenste enzymen, nucleotiden, primers en buffercomponenten te verwijderen. Een standaard zuiveringsmethode kan als volgt worden gebruikt.
      1. Voeg 50 μL fenol toe aan 50 μL van de PCR-producten en meng door vortexing.
      2. Centrifugeer gedurende 1 min op 11.000 x g en breng de bovenste transparante laag over op een nieuwe buis.
      3. Voeg 120 μL van 99,5% ethanol en 20 μL van 5 M ammoniumacetaat en vortex toe gedurende 30 s.
      4. Houd bij RT gedurende 10 min en centrifugeer op 11.000 x g gedurende 10 min.
      5. Gooi de supernatant weg en was de DNA-pellet met 1 mL van 70% ethanol.
      6. Droog de pellet 10 min op RT en los op in 10 μL RNase vrij water.
        OPMERKING: PCR kolom-gebaseerde zuivering kits worden recommented omdat fenol giftig is voor de mens.
  3. Sanger sequencing
    1. Voer DNA-kwantificeringsanalyse uit (zie Tabel van materialen)om de gezuiverde PCR-amplicon te kwantificeren.
    2. Stuur PCR-producten(en) en sequencing primer(s) naar een sequencing-serviceprovider.
    3. Analyseer de volgorde met behulp van de beschikbare online websites.
      OPMERKING: In deze studie werd CRISP-ID25 (http:/crispid.gbiomed.kuleuven.be/) gebruikt voor sequentieanalyse.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Onze gewijzigde methode voor cryopreservatie van eencellige embryo's, inclusief incubatie in HTF met 20% FBS voor 10 min gevolgd door cryopreservatie in 1 M DMSO en DAP213 oplossing, verbeterde de ontwikkelingsgraad van de invriezen ontdooide embryo's in de tweecellige fase (Figuur 1, p = 0,009, Student's t-test). De ontdooide embryo's werden gebruikt voor de productie van GM-muizen en elektroporratieomstandigheden werden geoptimaliseerd: vijf herhalingen van 25 V met 3 ms-pulsen en intervallen van 97 ms met behulp van een elektroporator zoals beschreven in de sectie Protocol. De toepasbaarheid van het protocol werd gecontroleerd door de generatie van albino Tyrosinase gen (Tyr) knock-out muizen (Figuur 2). Hiervoor werd gRNA targeting exon 2 ontworpen (figuur 2A) en crispr reagents werden voorbereid zoals beschreven in de sectie Protocol. De bewerkingsinstrumenten werden geëlektroereerd binnen 1 uur na het ontdooien van embryo's om ervoor te zorgen dat genoombewerking plaatsvond vóór de eerste replicatie van het genoom en zo mosaicisme bij de oprichters voorkwamen (figuur 2B). Alle gegenereerde muizen waren albino, en slechts een muis was mozaïek, met een jas met witte en zwarte vlekken (Figuur 2C). Alle albino muizen herbergen twee verschillende mutant allelen (heterozygoot mutatie) behalve een muis herbergen slechts een allel (homozygoot mutatie) worden weergegeven in figuur 2E. Geconcludeerd kan worden dat onze methode een bewerkingsefficiëntie van bijna 100% kan bieden met een laag mozaïekpercentage, zoals bevestigd door sequencinganalyse en vachtkleur (Figuur 2CE).

Vervolgens werd de reproduceerbaarheid van het protocol gecontroleerd door het genereren van verschillende lijnen van knock-out- en knock-in muizen. Zoals weergegeven in tabel 1,kan het protocol genereren knock-out en knock-in muizen met een hoge efficiëntie en lage mozaïek tarieven. De meeste van de gegenereerde F0 muizen werden gepaard met wilde type C57BL / 6J muizen om de kiembaan overdracht van mutant allelen te bevestigen aan de F1 generaties. Zoals verwacht, alle F1 nakomelingen van de homozygoot F0 muizen waren heterozygoot, met een mutant allel en een wild type allel. Er werden geen ongelijksoortige mutaties waargenomen tussen genotypering van de oprichters en hun generaties. Het beschreven protocol genereerde GM muizen binnen een korte tijd (dat wil zeggen ~ 4 weken) zoals weergegeven in de workflow van het protocol in figuur 3.

Figure 1
Figuur 1: Foetaal runderserum (FBS) heeft de ontwikkelingsgraad van de invriesembryo's in twee cellen verbeterd. Het aantal FBS+ embryo's was 286 (het experiment werd 3x herhaald) en het aantal FBS-embryo's was 272 (het experiment werd 3x herhaald). Gegevens worden gepresenteerd als gemiddelde ± SEM. Dit cijfer is gereproduceerd van Darwish M et al.16 met toestemming. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 2
Figuur 2: Generatie tyr knock-out muizen met een hoge efficiëntie en een laag mozaïektarief. Dit cijfer is gewijzigd van Darwish M et al.16 met toestemming. (A) Schematische illustratie met het ontwerp van gRNA. De PAM-volgorde wordt in het rood weergegeven. (B) Illustratie met de timing van elektroporatie voor de ontdooide embryo's, het gele symbool staat voor elektroporatie tijd. (C) Representatieve beelden van de gegenereerde Tyr knock-out muizen. (D) Sequentie analyse van verschillende allelen van de Tyr knock-out muizen. De doelvolgorde is gelabeld in rood en streepjes geven de schrapping van nucleotiden in de gemuteerde allelen aan. WT = wild type M = gemuteerd allel. (E) Een representatief deel van het chromatogram van de albino muis met het M1 allel wordt weergegeven in D. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 3
Figuur 3: Workflow van het protocol voor de generatie van GM muizen. De eerste stap was de voorbereiding van huilende embryo's. Vrouwelijke C57BL/6J muizen werden superovulated, eerst door PMSG injectie, dan 48 h later door hCG injectie. COC's werden verzameld 16 uur later en onderworpen aan IVF met spermatozoa verzameld van mannelijke C57BL/6J muizen. Bevruchte eicellen werden cryopreserved en opgeslagen in vloeibare stikstof tot nodig. De tweede stap was het ontdooien van de embryo's en elektroporatie. Cryopreserved embryo's werden ontdooid en CRISPR reagentia (d.w.z. tracrRNA, crRNA, en Cas9 eiwit) werden geassembleerd en geëlektroerd binnen 1 uur na het ontdooien van de embryo's. De derde stap omvatte embryotransfer en de geboorte van muizen. De dag na de elektroporatie werden tweecellige embryo's overgebracht naar het eiduct van pseudozwangere vrouwelijke muizen om genetisch gemodificeerde muizen te genereren die later genotyped werden met behulp van Sanger sequencing om de bewerkingsefficiëntie te bevestigen. De tijd en moeite die nodig zijn voor de voorbereiding van bevruchte eicellen voor elk experiment (stap 1) kan worden ingekort als een groot aantal cryopreserved embryo's is voorbereid op voorhand. Dit cijfer is aangepast van Darwish M et al.16Klik hier om een grotere versie van dit cijfer te bekijken.

Gemuteerde muizen Geëlektrorated embryo's 2-cel embryo's Overgedragen embryo's Pups (%) Gemuteerde muizen(%) Geen mozaïekmuizen
Tyr KO 124 84 48 12 (25) 100 1
Glrb KO 151 94 40 6 (15) 100 0
Slc39a6 KO 48 25 25 5 (20) 100 0
Bag3 KI 233 84 20 3 (15) 50 1
Camk2a KI 124 70 70 14 (20) 64.3 0

Tabel 1: Productie van verschillende lijnen van GM-muizen met behulp van gevriesontdooide embryo's met C57BL/6J achtergrond.

Aanvullende tabel 1. Klik hier om deze tabel te downloaden.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Het beschreven protocol maakt het mogelijk voor de generatie van GM muizen met een hoog rendement en lage mozaïek tarieven (Tabel 1). Het stelt onderzoekers zonder geavanceerde embryomanipulatievaardigheden in staat om mutantmuizen gemakkelijk te maken omdat het gebruik maakt van de nieuwste en meest nuttige vooruitgang in zowel reproductieve engineering- als genoombewerkingstechnologieën: CRISPR/Cas9 ribonucleoprotein (RNP) en elektroporatie in gevriesde embryo's. Deze vooruitgang vergemakkelijkte en versnelde de generatie van de gm-muizen. Zoals beschreven in figuur 3,duurt het ~ 4 weken om de GM muizen te genereren. Vergeleken met andere protocollen met behulp van soortgelijke benaderingen26,onze methode is superieur in termen van de efficiëntie, geboortecijfer, en mosaicisme.

De incubatie van eencellige embryo's in FBS vóór de cryopreservatie is van cruciaal belang voor het verbeteren van de ontwikkelingsgraad van de embryo's. De elektroporatievoorwaarden van de in het protocol beschreven cryopreserved embryo's maken een compromis mogelijk tussen de bewerkingsefficiëntie van CRISPR-reagentia en de overleving van de embryo's. Hardere of mildere omstandigheden kunnen immers van invloed zijn op de ontwikkelingsgraad van de embryo's en de bewerkingsefficiëntie, respectievelijk16. De timing van de elektroporatie (figuur 2B) is van cruciaal belang om het mosaicisme bij de oprichters te overwinnen en ervoor te zorgen dat genoommodificatie plaatsvindt in aanwezigheid van slechts twee allelen. Dit komt overeen met eerdere rapporten waaruit blijkt dat elektroporatie in een vroeg stadium niet-mozaïekmutanten kunnen produceren17. Bovendien vermindert het gebruik van RNP in plaats van gRNA/mRNA de mozaïeksnelheid en verbetert het bewerkingsrendement17.

Het beschreven protocol biedt verschillende voordelen. Ten eerste, het genereert de mutant muizen binnen een korte tijd (~ 4 weken). Ten tweede is het een zeer efficiënt en robuust protocol; verschillende lijnen van knock-out (KO) en knock-in (KI) muizen werden gegenereerd met hoge mutatiepercentages (KO = 100%, KI = 50 tot 64,3%). Ten derde is het handig en kosteneffectief. Het gebruik van volledige synthetische crRNA, tracrRNA, ssODN, en Cas9 eiwit elimineert de noodzaak voor vervelende voorbereiding van de Cas9 vectoren en in vitro transcriptie. In plaats daarvan, het stelt onderzoekers in staat om gewoon gebruik maken van commerciële reagentia en standaard apparatuur. Ten vierde gebruikt het geen micro-injectie, wat hoge technische vaardigheden vereist. Ten vijfde vermindert het het mozaïek bij oprichters, en leidt dus tot een efficiëntere kiembaanoverdracht van de bewerkte allelen, waardoor de ingewikkelde genotypic-analyse van de mozaïekmuizen wordt overgenomen. Ten slotte is dit protocol efficiënt met de C57BL/6J inteeltstam, die het gebruik van F1-hybriden vermijdt, en dus de noodzaak om talrijke backcrosses uit te voeren om zich te ontdoen van genetische complexiteit. De genotypering van F1-generaties bevestigde een nauwkeurige kiembaantransmissie. Het wordt echter afgeraden om de fenotypes van de F0-muizen te bestuderen als gevolg van allelecomplexiteit en de misleidende voorspelling van genotypering van de daaropvolgende generatie geëxtrapoleerd uit de genotypering van F0-oprichters14,27.

Het is van het grootste belang gebruik te maken van het gebruik van de gevriesde embryo's in de genoombewerking van niet-menselijke primaten en grote dieren zoals varkens en schapen, die niet altijd direct beschikbaar zijn. De methoden voor het invriezen van embryo's verschillen sterk afhankelijk van de diersoorten. Daarom denken we dat ons cryopreservatieprotocol alleen van toepassing is op muizen. Aan de andere kant is ons protocol mogelijk van toepassing op het gebruik van andere engineeringnucleases dan Cas9 voor de generatie van GM-muizen, omdat elektroporatie eerder is gemeld om andere nucleases zoals Cas12a efficiënt in het embryo te introduceren28,29.

Een beperking van het protocol is de precieze integratie van een lange transgeen in het genoom, dat wordt beschouwd als moeilijk in elektroporatie-gebaseerde protocollen. Er werd echter één mogelijke oplossing gemeld: de integratie van transgenen tot 4,9 Kb in het muisgenoom werd met succes uitgevoerd door elektroporatie te combineren met een adeno-geassocieerd virus (AAV)-gemedieerde HDR-donorleveringssysteem30, wat een eerdere publicatie31bevestigt. Ook het mogelijke optreden van off-target bijwerkingen is een grote zorg met het gebruik van CRISPR / Cas9-technologie. We hebben geen hele genoomsequencing van de bewerkte muizen uitgevoerd om het potentiële off-target effect uit te sluiten. We hebben echter CRISPR-tools gebruikt die zijn gerapporteerd om het off-target effect te verminderen, zoals RNP32. Bovendien gebruikten we een high-fidelity Cas9-variant die off-target bewerking aanzienlijk vermindert zonder in te boeten op on-target prestaties33. Ook hebben we gRNAs ontworpen met behulp van CRISPRdirect-software (https://crispr.dbcls.jp), wat moet resulteren in doelsequenties met geminimaliseerde off-target sites19. Om de genotype-fenotype causaliteit te bevestigen en de zorgen over off-target effecten te verlichten, moeten onderzoekers verschillende bewerkte muizen van hetzelfde genotype genereren met behulp van verschillende gRNAs of het overschrijden van de gegenereerde muizen gedurende meerdere generaties uitvoeren.

De knock-out muizen gegenereerd met behulp van de NHEJ mechanisme en frameshift mutaties zijn op grote schaal gebruikt en tonen relevante fenotypes. Er kan echter afgekapt resteiwit bestaan als gevolg van een herinitiatie van de vertaling of het overslaan van de bewerkte exon34,35. Daarom is het noodzakelijk om de fenotypes nauwkeurig te interpreteren, dat er een karakterisering van de restfunctie of expressie nodig is. De generatie van volledige gen knock-out muizen met behulp van meer dan een gRNA zou een goed alternatief zijn. Er moet echter bijzondere aandacht worden besteed aan de bevestiging dat het gen geen intronic-regio's bevat die zijn getranscribeerd naar niet-coderende RNA's, die regelgevende functies kunnen hebben en dus de fenotypische analyse zouden kunnen bemoeilijken.

In deze studie tonen we een eenvoudig protocol waarmee veel onderzoekers genetisch gemodificeerde muizen kunnen genereren in 4 weken of minder. Door het gebruik van gevriesontdooide embryo's en elektroporatie te combineren, maken we de voorbereiding van muismodellen van menselijke ziekten eenvoudig, snel en efficiënt.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben geen relevante financiële informatie.

Acknowledgments

We willen Hitomi Sawada en Elizabeth Garcia bedanken voor de verzorging van dieren. Dit werk werd ondersteund door KAKENHI (15K20134, 17K11222, 16H06276 en 16K01946) en Hokugin Research Grant (naar H.N.), en Jichi Medical University Young Investigator Award (naar H.U.). De Otsuka Toshimi Scholarship Foundation steunde MD.

Materials

Name Company Catalog Number Comments
0.25 M Sucrose ARK Resource Co., Ltd. (Kumamoto, Japan) SUCROSE
1 M DMSO ARK Resource Co., Ltd. (Kumamoto, Japan) 1M DMSO
Butorphanol Meiji Seika Pharma Co., Ltd. (Tokyo, Japan) Vetorphale 5mg
Cas9 protein: Alt-R® S.p. HiFi Cas9 Nuclease 3NLS Integrated DNA Technologies, Inc. (Coralville, IA) 1081060
C57BL/6J mice Japan SLC (Hamamatsu, Japan) N/A
DAP213 ARK Resource Co., Ltd. (Kumamoto, Japan) DAP213
FBS Sigma-Aldrich, Inc. (St. Louis, MO) ES-009-C
hCG MOCHIDA PHARMACEUTICAL CO., LTD (Tokyo, Japan) HCG Mochida 3000
HTF ARK Resource Co., Ltd. (Kumamoto, Japan) HTF
ICR mice Japan SLC (Hamamatsu, Japan) N/A
Isoflurane Petterson Vet Supply, Inc. (Greeley, CO) 07-893-1389
KSOM ARK Resource Co., Ltd. (Kumamoto, Japan) KSOM
LN2 Tank Chart Industries (Ball Ground, GA) XC 34/18
M2 ARK Resource Co., Ltd. (Kumamoto, Japan) M2
Medetomidine Nippon Zenyaku Kogyo Co.,Ltd. (Koriyama, Japan) 1124401A1060
Microscope Nikon Co. (Tokyo, Japan) SMZ745T
Midazolam Sandoz K.K. (Tokyo, Japan) 1124401A1060
Nuclease free buffer Integrated DNA Technologies, Inc. (Coralville, IA) 1072570
Nucleospin DNA extraction kit Takara Bio Inc (Kusatsu, Japan) 740952 .5
One-hole slide glass Matsunami Glass Ind., Ltd. (Kishiwada, Japan) S339929
One-step type Electroporator BEX Co., Ltd. (Tokyo, Japan) CUY21EDIT II
Paraffin Liquid NACALAI TESQUE Inc. (Kyoto, Japan) SP 26137-85
Platinum plate electrode BEX Co., Ltd. (Tokyo, Japan) LF501PT1-10, GE-101
PMSG ASKA Animal Health Co., Ltd (Tokyo, Japan) SEROTROPIN 1000
Povidone iodide Professional Disposables International, Inc. (Orangeburg, NY) C12400
Reduced-Serum Minimal Essential Medium: OptiMEM I Sigma-Aldrich, Inc. (St. Louis, MO) 22600134
Two-step type Electroporator Nepa Gene Co., Ltd. (Ichikawa, Japan) NEPA21

DOWNLOAD MATERIALS LIST

References

  1. Wang, H., et al. One-step generation of mice carrying mutations in multiple genes by CRISPR/cas-mediated genome engineering. Cell. 153, (4), 910-918 (2013).
  2. Jinek, M., et al. A programmable dual-RNA - guided DNA endonuclease in adaptive bacterial immunity. Science. 337, (6096), 816-822 (2012).
  3. Mali, P., et al. RNA-guided human genome engineering via Cas9. Science. 339, (6121), 823-826 (2013).
  4. Cong, L., et al. Multiplex genome engineering using CRISPR/VCas systems. Science. 339, (6121), 819-823 (2013).
  5. Doudna, J. A., Charpentier, E. The new frontier of genome engineering with CRISPR-Cas9. Science. 346, (6213), 1258096 (2014).
  6. Mashiko, D., et al. Generation of mutant mice by pronuclear injection of circular plasmid expressing Cas9 and single guided RNA. Scientific Reports. 3, 3355 (2013).
  7. Yen, S. T., et al. Somatic mosaicism and allele complexity induced by CRISPR/Cas9 RNA injections in mouse zygotes. Developmental Biology. 393, (1), 3-9 (2014).
  8. Kaneko, T., Mashimo, T. Simple genome editing of rodent intact embryos by electroporation. PLoS ONE. 10, (11), 1-7 (2015).
  9. Qin, W., et al. Efficient CRISPR/cas9-mediated genome editing in mice by zygote electroporation of nuclease. Genetics. 200, (2), 423-430 (2015).
  10. Kaneko, T., Sakuma, T., Yamamoto, T., Mashimo, T. Simple knockout by electroporation of engineered endonucleases into intact rat embryos. Scientific Reports. 4, 6382 (2014).
  11. Hashimoto, M., Takemoto, T. Electroporation enables the efficient mRNA delivery into the mouse zygotes and facilitates CRISPR/Cas9-based genome editing. Scientific Reports. 5, 11315 (2015).
  12. Chen, S., Lee, B., Lee, A. Y. F., Modzelewski, A. J., He, L. Highly efficient mouse genome editing by CRISPR ribonucleoprotein electroporation of zygotes. Journal of Biological Chemistry. 291, (28), 14457-14467 (2016).
  13. Modzelewski, A. J., et al. Efficient mouse genome engineering by CRISPR-EZ technology. Nature Protocols. 13, (6), 1253-1274 (2018).
  14. Teixeira, M., et al. Electroporation of mice zygotes with dual guide RNA/Cas9 complexes for simple and efficient cloning-free genome editing. Scientific Reports. 8, 474 (2018).
  15. Nakagawa, Y., et al. Production of knockout mice by DNA microinjection of various CRISPR/Cas9 vectors into freeze-thawed fertilized oocytes. BMC Biotechnology. 15, (1), 1-10 (2015).
  16. Darwish, M., et al. Rapid and high-efficient generation of mutant mice using freeze-thawed embryos of the C57BL/6J strain. Journal of Neuroscience Methods. 317, 149-156 (2019).
  17. Hashimoto, M., Yamashita, Y., Takemoto, T. Electroporation of Cas9 protein/sgRNA into early pronuclear zygotes generates non-mosaic mutants in the mouse. Developmental Biology. 418, (1), 1-9 (2016).
  18. Sakamoto, W., Kaneko, T., Nakagata, N. Use of frozen-thawed oocytes for efficient production of normal offspring from cryopreserved mouse spermatozoa showing low fertility. Comparative Medicine. 55, (2), 136-139 (2005).
  19. Naito, Y., Hino, K., Bono, H., Ui-Tei, K. CRISPRdirect: Software for designing CRISPR/Cas guide RNA with reduced off-target sites. Bioinformatics. 31, (7), 1120-1123 (2015).
  20. Torres-Perez, R., Garcia-Martin, J. A., Montoliu, L., Oliveros, J. C., Pazos, F. WeReview: CRISPR Tools-Live Repository of Computational Tools for Assisting CRISPR/Cas Experiments. Bioengineering. 6, (3), 63 (2019).
  21. Okamoto, S., Amaishi, Y., Maki, I., Enoki, T., Mineno, J. Highly efficient genome editing for single-base substitutions using optimized ssODNs with Cas9-RNPs. Scientific Reports. 9, 4811 (2019).
  22. Takeo, T., Nakagata, N. Superovulation using the combined administration of inhibin antiserum and equine chorionic gonadotropin increases the number of ovulated oocytes in C57BL/6 female mice. PLoS ONE. 10, (5), 1-11 (2015).
  23. Wuri, L., Agca, C., Agca, Y. Euthanasia via CO2 inhalation causes premature cortical granule exocytosis in mouse oocytes and influences in vitro fertilization and embryo development. Molecular Reproduction and Development. 86, (7), 825-834 (2019).
  24. Nakagata, N. High survival rate of unfertilized mouse oocytes after vitrification. Journal of Reproduction and Fertility. 87, (2), 479-483 (1989).
  25. Dehairs, J., Talebi, A., Cherifi, Y., Swinnen, J. V. CRISP-ID: Decoding CRISPR mediated indels by Sanger sequencing. Scientific Reports. 6, 28973 (2016).
  26. Nakagawa, Y., Sakuma, T., Takeo, T., Nakagata, N., Yamamoto, T. Electroporation-mediated genome editing in vitrified/warmed mouse zygotes created by ivf via ultra-superovulation. Experimental Animals. 67, (4), 535-543 (2018).
  27. Nakajima, K., Nakajima, T., Takase, M., Yaoita, Y. Generation of albino Xenopus tropicalis using zinc-finger nucleases. Development Growth and Differentiation. 54, (9), 777-784 (2012).
  28. Hur, J. K., et al. Targeted mutagenesis in mice by electroporation of Cpf1 ribonucleoproteins. Nature Biotechnology. 34, 807-808 (2016).
  29. Dumeau, C. E., et al. Introducing gene deletions by mouse zygote electroporation of Cas12a/Cpf1. Transgenic Research. 28, (5-6), 525-535 (2019).
  30. Chen, S., et al. CRISPR-READI: Efficient Generation of Knockin Mice by CRISPR RNP Electroporation and AAV Donor Infection. Cell Reports. 27, (13), 3780-3789 (2019).
  31. Mizuno, N., et al. Intra-embryo Gene Cassette Knockin by CRISPR/Cas9-Mediated Genome Editing with Adeno-Associated Viral Vector. iScience. 9, 286-297 (2018).
  32. Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. Highly Efficient RNA-guide genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Research. 24, (6), 1012-1019 (2014).
  33. Vakulskas, C. A., et al. A high-fidelity Cas9 mutant delivered as a ribonucleoprotein complex enables efficient gene editing in human hematopoietic stem and progenitor cells. Nature Medicine. 24, (8), 1216-1224 (2018).
  34. Rodriguez-Rodriguez, J. A., et al. Distinct Roles of RZZ and Bub1-KNL1 in Mitotic Checkpoint Signaling and Kinetochore Expansion. Current Biology. 28, (21), 3422-3429 (2018).
  35. Smits, A. H., et al. Biological Plasticity Rescues Target Activity in CRISPR Knockouts. Nature Methods. 16, 1087-1093 (2019).
Gebruik van gevriesde embryo's voor hoogrendementproductie van genetisch gemodificeerde muizen
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Nishizono, H., Darwish, M., Uosaki, H., Masuyama, N., Seki, M., Abe, H., Yachie, N., Yasuda, R. Use of Freeze-thawed Embryos for High-efficiency Production of Genetically Modified Mice. J. Vis. Exp. (158), e60808, doi:10.3791/60808 (2020).More

Nishizono, H., Darwish, M., Uosaki, H., Masuyama, N., Seki, M., Abe, H., Yachie, N., Yasuda, R. Use of Freeze-thawed Embryos for High-efficiency Production of Genetically Modified Mice. J. Vis. Exp. (158), e60808, doi:10.3791/60808 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter