Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Utilisation d’embryons décongelés par le gel pour la production à haut rendement de souris génétiquement modifiées

doi: 10.3791/60808 Published: April 2, 2020
* These authors contributed equally

Summary

Ici, nous présentons une méthode modifiée pour la cryoconservation des embryons à une cellule ainsi qu’un protocole qui couple l’utilisation d’embryons dégelés et l’électroporation pour la génération efficace de souris génétiquement modifiées.

Abstract

L’utilisation de souris génétiquement modifiées (GM) est devenue cruciale pour comprendre la fonction génétique et déchiffrer les mécanismes sous-jacents des maladies humaines. Le système CRISPR/Cas9 permet aux chercheurs de modifier le génome avec une efficacité, une fidélité et une simplicité sans précédent. Exploitant cette technologie, les chercheurs sont à la recherche d’un protocole rapide, efficace et facile pour générer des souris GM. Ici, nous introduisons une méthode améliorée pour la cryoconservation des embryons à une cellule qui conduit à un taux de développement plus élevé des embryons gongés. En le combinant avec des conditions d’électroporation optimisées, ce protocole permet la génération de souris knock-in et knock-in avec une efficacité élevée et de faibles taux de mosaïque dans un court laps de temps. De plus, nous montrons une explication étape par étape de notre protocole optimisé, couvrant la préparation des réactifs CRISPR, la fécondation in vitro, la cryoconservation et le dégel des embryons à une cellule, l’électroporation des réactifs CRISPR, la génération de souris et le génotypage des fondateurs. Grâce à ce protocole, les chercheurs devraient être en mesure de préparer les souris GM avec une facilité, une vitesse et une efficacité inégalées.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Le système de répétitions palindromiques courtes et interpatiales groupées régulièrement interpatial (CRISPR)/CRISPR-associé à la protéine 9 (Cas9) est une percée scientifique qui apporte une modification ciblée sans précédent dans le génome1. Le système CRISPR/Cas9 est composé de protéines Cas9 et d’ARN guide (ARN) avec deux composants moléculaires : un ARN CRISPR (crRNA) spécifique à la cible et un ARN CRISPR (tracrRNA) transactivant2 . Un ARN dirige la protéine Cas9 vers le locus spécifique du génome, 20 nucléotides complémentaires au crRNA et adjacents au motif adjacent au protoespacer (PAM). La protéine Cas9 se lie à la séquence cible et induit des pauses à double brin (DSB) qui sont réparées soit par l’assemblage fin non-homologous sujet aux erreurs (NHEJ) ou la réparation à haute fidélité dirigée par homologie (HDR)3,4,5. Le NHEJ conduit à des insertions ou / et des suppressions (indels), et donc à la perte de gène de la fonction quand une séquence de codage est ciblée. Le HDR conduit à l’édition précise du génome en présence d’un modèle de réparation contenant des séquences d’homologie3,4,5. Le NHEJ et le HDR ont été exploités pour générer des souris knock-in et knock-in, respectivement.

Alors que le système CRISPR/Cas9 a nettement accéléré la génération de souris GM avec une efficacité et une fidélité exceptionnelles, les scientifiques qui appliquent ces méthodes rencontrent souvent des défis techniques. Tout d’abord, les protocoles conventionnels nécessitent une microinjection pour l’introduction des outils d’édition CRISPR dans le pronucléus des œufs fécondés6,7. Cette technique prend beaucoup de temps et nécessite généralement une formation approfondie. Ainsi, plusieurs groupes ont remplacé la microinjection par électroporation8,9,10,11,12,13. Cependant, dans les protocoles d’électroporation précoces des embryons frais ont été employés pour l’électroporation. Cela a causé un autre problème, parce que la préparation d’embryons frais avant chaque expérience est difficile14.

Récemment, nous et d’autres avons combiné l’utilisation d’embryons décongelés par le gel et l’électroporation pour l’édition du génome, ce qui facilite la génération de souris GM15,16. Ce protocole permet aux chercheurs qui n’ont pas de compétences avancées en matière de manipulation d’embryons de générer rapidement des modèles animaux de maladies humaines avec une grande efficacité. Le protocole réduit également considérablement les défis pratiques dans la génération de souris GM, telles que l’hétérogénéité génétique dans les fondateurs16. Pour surmonter le mosaïsme, nous effectuons l’électroporation des réactifs CRISPR dans les 1 h après le dégel de l’embryon pour nous assurer que l’édition se produit avant la première réplication du génome. Une autre amélioration comprend l’utilisation de la protéine Cas9 au lieu de Cas9 mRNA pour réduire le mosaïsme indésirable17. En outre, nous avons développé une méthode optimale pour la cryoconservation d’embryon à cellule unique qui augmente le taux de développement au stade16à deux cellules : l’utilisation du sérum bovin fœtal (FBS) améliore considérablement la survie des ovocytes dégelés après la fécondation, peut-être par le même mécanisme qui rend les ovocytes non fécondés dégelés plusrésistants 18.

Nous présentons ici un protocole complet pour la génération de souris GM utilisant des embryons gongés, y compris la méthode modifiée pour la cryoconservation des embryons C57BL/6J à une cellule. Il comprend 1) conception d’ARN, préparation et assemblage de réactifs CRISPR; 2) FIV, cryoconservation et décongélation d’embryons à une cellule; 3) Électroporation des réactifs CRISPR en embryons décongelés par le gel; 4) Transfert d’embryon dans l’oviducte des souris femelles pseudo-enceintes ; et 5) Analyse de génotypage et de séquence des animaux fondateurs de F0.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Tous les soins et procédures des animaux effectués dans le présent travail ont été entrepris conformément aux règles et règlements du Guide pour le soin et l’utilisation des animaux de laboratoire. Le protocole expérimental a été approuvé par le Comité de soins aux animaux de laboratoire des animaux de laboratoire de l’Université de Toyama, l’Université de Tokyo, l’Université Jichi et le Max Planck Florida Institute for Neuroscience. Des informations sur tous les réactifs sont indiquées dans la Table des Matériaux.

1. Conception des réactifs CRISPR

  1. conception de crRNA
    1. Visitez CRISPR direct19 (https://crispr.dbcls.jp/) pour concevoir des ARC spécifiques avec des sites hors cible réduits.
      REMARQUE : Il existe de nombreux autres outils utiles pour concevoir le crRNA20 (https://bioinfogp.cnb.csic.es/tools/wereview/crisprtools/).
    2. Insérez la séquence de nucléotide cible et modifiez les modifications suivantes :
      Exigence de séquence PAM - NGG
      Vérification de spécificité - Génome de souris (Mus musculus), GRCm38/mm10 (déc, 2011)
      REMARQUE : À titre d’exemple, pour générer des souris knock-out Tyrosinase (Tyr), exon 2 (séquence nucléotide de 9476-9692) a été ciblé.
    3. Cliquez sur la conception, et pour les hits très spécifiques, marquez Afficher la cible hautement spécifique seulement.
    4. Pour réduire les effets hors cible potentiels, choisissez la séquence cible avec la valeur la plus basse dans les colonnes de "12 mer-PAM" et "8 mer-PAM".
      REMARQUE : Dans ces colonnes, («1») indique que la séquence n’a qu’un seul match parfait avec le site cible prévu et que des nombres supérieurs à un indiquent la présence de sites hors cible potentiels.
    5. Commandez les oligonucleotides résultants des sociétés de synthèse de crRNA(tableau supplimentaire 1).
      REMARQUE : Pour le gène exon 2 Tyr, la séquence cible suivante a été utilisée : GGACCACTATTACGTAATCC, avec TGG comme séquence PAM(figure 2A).
  2. Conception d’oligodeoxynucleotide à brin unique (ssODN) pour les expériences d’édition à médiation HDR (c.-à-d. la génération de souris knock-in).
    1. Concevez la longueur ssODN pour être d’environ 80-180 bp, y compris 30-60 nucléotides (nt) bras homologiques des deux côtés.
      REMARQUE : Un ssODN de 75-85 longueur de nt, y compris un bras d’homologie de 30-35 nt et complémentaire à l’ARN g, a montré l’efficacité d’édition de frappe-dans haut21.
    2. Insérez la modification prévue et la mutation silencieuse à la séquence PAM ou, si ce n’est possible, à la base voisine de 5 degrés pam pour bloquer la recoupage après l’édition du génome.
      REMARQUE : Le crRNA et le ssODN utilisés dans cette étude sont énumérés dans le tableau supplémentaire 1.

2. Fécondation in vitro, cryoconservation d’embryons et gel-dégel

  1. Fécondation in vitro
    1. Superovulate C57BL/6J souris femelles (4 ou 8 semaines-vieux) par injection IP avec la jument enceinte gonadotropin (PMSG) suivie par injection avec 7.5 GONadotropin chorionique humain d’IU (hCG) après 48 h.
      REMARQUE: Le nombre d’ocytes ovoculés peut être augmenté d’environ 3x en utilisant l’ultra-superovulation22.
    2. Retirez les épididymides de cauda des souris mâles C57BL/6J sexuellement matures (3-5 mois).
      REMARQUE : Il est possible de recueillir des spermatozoïdes sans sacrifier les souris mâles.
    3. Extraire des caillots de spermatozoïdes avec une aiguille disséquée et les incuber dans une goutte de 200 l de liquide tubaire humain (HTF) dans l’incubateur de CO2 pendant 1,5 h pour la capacitation.
    4. Recueillir les complexes de cumulus-oocytes (COC) des oviductes 16-18 h après l’injection de hCG et les incuber dans une goutte fraîche de 200 L de milieu HTF recouvert de liquide de paraffine dans un incubateur de CO2 (5% DE CO2, 37 oC) pour pas plus de 2 h.
      REMARQUE : Il est préférable de sacrifier les souris par dislocation cervicale sous anesthésie parce que l’euthanasie par inhalation de CO2 affecte la FIV et le développement d’embryons23.
    5. Ajoutez une suspension de sperme de 1 à 5 l de la limite du milieu d’incubation à la goutte de 200 L de milieu HTF contenant des COC et les incuber dans un incubateur de CO2 pendant 3 h.
    6. Laver les ocytes avec le milieu d’optimisation simplex (KSOM) 3x supplémenté de potassium pour enlever le reste des spermatozoïdes et des cellules cumulus.
    7. Vérifiez la formation pronucléaire et la qualité des embryons à une cellule à l’aide d’un microscope inversé.
  2. Cryoconservation d’embryons à une cellule
    1. Incuber des embryons à une cellule dans une goutte de 200 L de HTF contenant 20% FBS (non couvert de liquide de paraffine) pendant 10 min dans un incubateur de CO2.
    2. Transférer 20 à 100 embryons à 50 lil de la solution de sulfoxide de diméthyle (DMSO)24.
    3. Transférer 5 l’une d’une solution contenant 100 embryons dans le fond d’un cryotube et laisser refroidir pendant 5 min à 0 oC à l’aide d’un refroidisseur ou sur la glace.
    4. Ajouter 45 L de DAP213 (2 M de sulfoxide de diméthyle, 1 M d’acétaure et 3 M de propylène glycol) lentement le long de la paroi du tube, plafonner les tubes et garder pendant 5 minutes dans un refroidisseur ou sur la glace à 0 oC.
      REMARQUE : Ne fixez pas les bouchons trop étroitement pour les enlever facilement pendant la décongélation de l’échantillon.
    5. Conservez rapidement les tubes dans de l’azote liquide.
  3. Dégel d’embryons
    1. Ouvrez le couvercle du cryotube, jetez le reste de l’azote liquide et ajoutez 900 L de solution de saccharose de 0,25 M préchauffée à 37 oC.
      REMARQUE : La solution de saccharose de 0,25 M doit être réchauffée à 37 oC à l’avance parce que l’utilisation d’une solution froide diminue la viabilité de l’embryon après la décongélation.
    2. Pipet rapidement pour 10x et transférer le contenu du cryotube dans un plat en plastique.
      REMARQUE : Le tuyauterie doit être effectué avec soin, de sorte qu’aucune bulle n’est générée et n’endommage les embryons.
    3. Laver les ocytes fertilisés morphologiquement normaux 2x dans le milieu KSOM recouverts de liquide de paraffine et les conserver dans un incubateur de CO2 jusqu’à l’électroporation.

3. Assemblage et électroporation des réactifs CRISPR

REMARQUE : Pour l’électroporation, nous avons utilisé une électrode de plaque de platine (hauteur : 0,5 mm, longueur : 10 mm, largeur : 3 mm, écart : 1 mm) et un électroporateur de type en une étape qui était décrit précédemment8 (tableau des matériaux). Un électroporateur de type en deux étapes peut également être utilisé(Tableau des matériaux).

  1. Préparation et assemblage des réactifs CRISPR
    1. Commandez des réactifs CRISPR (c.-à-d. crRNA, tracrRNA et protéine Cas9) et ssODN si vous effectuez des expériences d’édition hdR(tableau des matériaux et tableau supplémentaire 1).
    2. Préparer la solution d’annealing comme suit.
      1. Préparer 1 g/L crRNA et 1 g/L tracrRNA dans la solution minimale minimale moyenne(tableau des matériaux),et ajouter 6 l de chaque solution à 42 lil du tampon sans nucléase.
      2. Incuber le mélange dans le chauffe-eau sec à 95 oC pendant 3 minutes et laisser refroidir à RT pendant 5 min.
      3. Préparer la protéine HiFi Cas9 diluée dans opti-MEM I et ajouter 6 l au mélange précédent pour un volume total de 60 ll.
      4. Dans l’exécution d’expériences d’édition HDR-négociées, ajouter 6 'L de 1 'g/L ssODN. Étant donné que le volume final doit être de 60 l, utilisez 36 L d’eau sans nucléase dans l’étape 3.1.2.1.
        REMARQUE : La concentration finale de crRNA, tracrRNA, protéine Cas9 et ssODN sera de 100 ng/L.
      5. Transférer jusqu’à 100 embryons à 25 lil du mélange final (complexe RNP) dans un verre à glissière d’un trou et les incuber à 37 oC pendant 10 min.
  2. Électroporation
    1. Remplissez l’écart d’électrode avec 6 l de nouveau mélange de réactifs CRISPR et ajoutez 20 à 25 embryons au mélange.
      REMARQUE : Il est important d’éviter tout contact entre les embryons et l’électrode d’électroporation, qui peut endommager les embryons pendant les impulsions électriques.
    2. Effectuer l’électroporation aux conditions suivantes pour un électroporateur de type en une étape:
      Tension: 25 V, Direction de l’impulsion (Pd)
      ON: 3 ms, OFF: 97 ms
      Répétitions: 5x
      REMARQUE : L’électroporation ne doit pas être effectuée plus de 1 h après la décongélation pour s’assurer que l’édition du génome se produit avant la première réplication de l’ADN pour prévenir le mosaïsme.
    3. Pour un électroporateur de type en deux étapes, définissez les conditions comme suit :
      Poring Pulse 40V,
      ON 1 ou 2,5 ms; Intervalle d’impulsion 50 ms
      Répétitions: 4x, Decay 10%

      Impulsion de transfert 5 ou 7V; /-.
      ON: 50 ms; Intervalle d’impulsion 50 ms.
      Répétitions 5x; Désintégration de 40%.
      REMARQUE : Il est important d’ajuster le volume afin de maintenir l’impédance dans la plage spécifique spécifiée par le fabricant.
    4. Laver les embryons 3x avec le milieu modifié de bicarbonate de bicarbonate Krebs-Ringer Buffer 2 (M2) suivi de deux lavages avec une goutte de milieu KSOM recouverte de liquide de paraffine.
    5. Incuber les embryons lavés (dans le milieu KSOM) dans un incubateur de CO2 pendant la nuit pour une transplantation ultérieure.

4. Transfert d’embryons

  1. Préparez des souris femelles pseudo-enceintes. Mate souris femelles ICR (3-6 mois) avec souris mâles vasectomisées 1 jour avant le transfert d’embryon (ET).
    REMARQUE : Les souris doivent être vérifiées le lendemain matin pour une prise copulatoire. Les souris avec un bouchon sont considérés comme pseudo-employés et peuvent être utilisés pour ET.
  2. Aspirer l’air et KSOM (sans liquide de paraffine) dans des intervalles alternatifs de 2 à 3 mm dans un capillaire en verre comme marqueur pour une implantation réussie.
  3. Introduisez 20 à 24 embryons dans une goutte de KSOM de 200 L (sans liquide de paraffine) et puisez 10 à 12 embryons dans le capillaire de verre pour l’implantation dans chaque oviducte.
  4. Anesthésiez les souris femelles par isoflurane (inhalation) ou une injection IP d’une solution combinant la méméomidine/midazolam/butorphanol (0,3 mg/kg, 4,0 mg/kg et 5,0 mg/kg respectivement). Placez la souris anesthésiée sur son côté ventral sur un coussin chauffant. Protégez les yeux de la souris anesthésiée avec un gel hydratant.
  5. Raser le long de la partie inférieure de la ligne médiane dorsale et désinfecter la zone avec de l’iode de povidone suivi par 70% d’éthanol.
  6. Faire une longue incision de 1 cm parallèle à la ligne médiane dorsale.
  7. Sortez l’oviducte et placez-le sur un drapé en plastique stérile. Gardez-le humide à l’aide de saline stérile chaude.
  8. Placer l’oviducte sous le microscope stéréoscopique.
  9. Faire un trou dans la paroi de l’oviducte entre l’infundibulum et l’ampulla quelques millimètres en amont de l’ampulla par des ciseaux à microsévrage.
  10. Insérez la pointe du capillaire de verre contenant les embryons dans le trou et soufflez doucement dans l’embout buccal du support capillaire pour expulser les embryons jusqu’à ce qu’une bulle d’air soit visible dans l’ampulla.
    REMARQUE : Transférer entre 10 et 12 embryons par oviducte.
  11. Retirez le capillaire de verre de la paroi oviducte et repoussez doucement l’organe reproducteur dans la cavité du corps.
  12. Répétez le processus précédent pour introduire les embryons dans l’autre oviducte.
  13. À la fin de la procédure ET, suture du péritoine avec un motif de suture interrompu simple (50, absorbable, sutures synthétiques tressées) puis la peau avec un modèle interrompu simple ou un modèle de point interrompu sous-cuticulaire enterré (60 sutures nonabsorbables et monosynthétiques).
  14. Garder la souris au chaud sur une plaque chauffante de 37 oC jusqu’à ce qu’elle se rétablisse de l’anesthésie.
  15. Surveillez la santé de l’animal tous les jours pendant 7 jours après la chirurgie.

5. Analyse de génylographie et de séquence

  1. Extraction de l’ADN génomique
    REMARQUE : Nous avons utilisé des kits d’extraction d’ADN de tissu de nucléoSpin pour extraire l’ADN génomique des tissus d’oreille de souris suivant les recommandations du fabricant.
    1. Ajouter 180 L de tampon T1 et 25 L de la solution Proteinase K à l’échantillon et mélanger en vortexing pour 10 s.
    2. Incuber à 56 oC pour 2 h ou jusqu’à ce que la lyse complète soit obtenue. Vortex pour 10 s toutes les 30 minutes de l’incubation.
    3. Ajouter 200 l’un de tampon B3, le vortex vigoureusement pendant 30 s et incuber à 70 oC pendant 10 min.
    4. Ajouter 210 L d’éthanol à 100 % à l’échantillon et le vortex vigoureusement.
    5. Pour chaque échantillon, placez une colonne de tissu dans un tube de collecte et appliquez l’échantillon à la colonne.
    6. Centrifugeuse pendant 1 min à 11 000 x g,jetez le flowthrough, et placez la colonne dans le tube de collecte.
    7. Ajouter 500 l de tampon BW pour laver l’échantillon (1er lavage), centrifugeuse pendant 1 min à 11 000 x g,jeter le flowthrough et remettre la colonne dans le tube de collecte.
    8. Ajoutez 600 L de tampon B5 à la colonne (2e lavage), centrifugeuse pendant 1 min à 11 000 x g,jetez le flowthrough et remettez la colonne dans le tube de collecte.
    9. Centrifuge la colonne pendant 1 min à 11 000 x g pour sécher la membrane de silice et placer la colonne de tissu NucleoSpin dans un tube de microcentrifuge de 1,5 mL.
    10. Ajouter 100 l de tampon BE, incuber à température ambiante pendant 1 min, puis centrifugeuse 1 min à 11 000 x g.
  2. Amplification et purification PCR
    1. Concevez les amorces à l’aide du site Web primez3 plus (https://primer3plus.com/) afin d’amplifier une séquence de 400 à 500 bp entourant le locus ciblé.
    2. Concevez un nouveau protocole PCR et testez-le empiriquement.
    3. Purifiez le produit PCR pour enlever les enzymes indésirables, les nucléotides, les amorces et les composants tampons. Une méthode de purification standard peut être utilisée comme suit.
      1. Ajouter 50 L de phénol à 50 L des produits PCR et mélanger par vortexing.
      2. Centrifugeuse pendant 1 min à 11 000 x g et transférer la couche transparente supérieure dans un nouveau tube.
      3. Ajouter 120 L d’éthanol de 99,5 % et 20 ll d’acétate et de vortex d’ammonium de 5 M pour 30 s.
      4. Conserver à RT pendant 10 min et centrifugeuse à 11 000 x g pendant 10 min.
      5. Jetez le supernatant et lavez la boulette d’ADN avec 1 ml d’éthanol de 70 %.
      6. Séchez la pastille à RT pendant 10 min et dissolvez-vous dans 10 L d’eau libre de RNase.
        REMARQUE : Les kits de purification basés sur les colonnes PCR sont recommentés parce que le phénol est toxique pour l’homme.
  3. Séquençage sanger
    1. Exécutez l’analyse de quantification de l’ADN(voir Tableau des matériaux ) pour quantifier l’amplicon purifié de PCR.
    2. Envoyez le produit PCR et l’apprêt de séquençage à un fournisseur de services de séquençage.
    3. Analyser la séquence à l’aide des sites Web en ligne disponibles.
      REMARQUE : Dans cette étude, CRISP-ID25 (http:/crispid.gbiomed.kuleuven.be/) a été utilisé pour l’analyse de séquence.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Notre méthode modifiée de cryoconservation d’embryons à une cellule, y compris l’incubation dans le HTF contenant 20 % de FBS pendant 10 min suivie d’une cryoconservation dans la solution 1 M DMSO et DAP213, a amélioré le taux de développement des embryons dégelés au stade des deux cellules(figure 1,p - 0,009, test de l’étudiant). Les embryons décongelés ont été utilisés pour la production de souris GM et les conditions d’électroporation ont été optimisées : cinq répétitions de 25 V avec des impulsions de 3 ms et 97 ms intervalles utilisant un électroporator tel que décrit dans la section protocole. L’applicabilité du protocole a été vérifiée par génération de souris à élimination directe du gène Albino Tyrosinase (Tyr)(figure 2). Pour ce faire, l’exon de ciblage de l’ARN 2 a été conçu(figure 2A) et les réactifs CRISPR ont été préparés comme décrit dans la section protocole. Les outils d’édition ont été électropolés dans un rayon de 1 h de décongélation de l’embryon pour s’assurer que l’édition du génome a eu lieu avant la première réplication du génome et ainsi empêché le mosaïsme chez les fondateurs (figure 2B). Toutes les souris générées étaient albinos, et une seule souris était mosaïque, avec un manteau avec des taches blanches et noires(figure 2C). Toutes les souris albinos hébergeant deux allèles mutants différents (mutation hétérozygote) à l’exception d’une souris n’hébergeant qu’un seul allèle (mutation homozygote) sont montrées dans la figure 2E. On peut conclure que notre méthode peut fournir une efficacité d’édition de près de 100% avec un faible taux de mosaïque comme confirmé par l’analyse de séquençage ainsi que la couleur du pelage(figure 2C-E).

Ensuite, la reproductibilité du protocole a été vérifiée par la génération de plusieurs lignes de knock-in souris. Comme le montre le tableau 1, le protocole peut générer des souris knock-in knock-in avec une efficacité élevée et de faibles taux de mosaïque. La plupart des souris F0 générées ont été accouplées avec des souris de type sauvage C57BL/6J pour confirmer la transmission germinale des allèles mutants aux générations F1. Comme prévu, toute la progéniture F1 des souris homozygous F0 étaient hétérozygotes, contenant un allèle mutant et un allèle de type sauvage. Aucune mutation disparate n’a été observée entre le génotypage des fondateurs et de leurs générations. Le protocole décrit a généré des souris GM dans un court laps de temps (c.-à-d., 4 semaines) comme le montre le flux de travail du protocole dans la figure 3.

Figure 1
Figure 1 : Le sérum bovin fœtal (FBS) a amélioré le taux de développement à deux cellules des embryons décongelés par le gel. Le nombre d’embryons FBS était de 286 (l’expérience a été répétée 3x), et le nombre d’embryons FBS était de 272 (l’expérience a été répétée 3x). Les données sont présentées comme moyennes et SEM. Ce chiffre est reproduit de Darwish M et coll.16 avec permission. S’il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Figure 2
Figure 2 : Génération de souris à élimination directe de Tyr avec un taux d’efficacité élevé et un faible taux de mosaïque. Ce chiffre est modifié de Darwish M et coll.16 avec permission. (A) Illustration schématique montrant la conception de l’ARN. La séquence PAM est affichée en rouge. (B) Illustration montrant le moment de l’électroporation pour les embryons décongelés, le symbole jaune représente le temps d’électroporation. (C) Images représentatives des souris À élimination directe Tyr générées. (D) Analyse de séquence de différents allèles des souris à élimination directe de Tyr. La séquence cible est étiquetée en rouge et les tirets indiquent la suppression des nucléotides dans les allèles mutants. WT - type sauvage M - allèle mutant. (E) Une partie représentative du chromatogramme de la souris albinos contenant l’allèle M1 est indiquée dans D. S’il vous plaît cliquez ici pour voir une version plus grande de cette figure.

Figure 3
Figure 3 : Flux de travail du protocole pour la génération de souris GM. La première étape a été la préparation d’embryons cryoconservés. Les souris femelles de C57BL/6J ont été surovulées, d’abord par injection de PMSG, puis 48 h plus tard par injection de hCG. Les COC ont été recueillis 16 h plus tard et soumis à la FIV avec des spermatozoa prélevés sur des souris mâles C57BL/6J. Les ocytes fertilisés ont été cryoconservés et stockés dans de l’azote liquide jusqu’à ce que nécessaire. La deuxième étape comprenait la décongélation des embryons et l’électroporation. Des embryons cryoconservés ont été décongelés et des réactifs CRISPR (c.-à-d. tracrRNA, crRNA et protéine Cas9) ont été assemblés et électropolés dans un rayon de 1 h après la décongélation des embryons. La troisième étape comprenait le transfert d’embryons et la naissance de souris. Le lendemain de l’électroporation, des embryons à deux cellules ont été transférés à l’oviducteur de souris femelles pseudo-enceintes pour générer des souris génétiquement modifiées qui ont été plus tard génotyped utilisant sanger séquençage pour confirmer l’efficacité d’édition. Le temps et les efforts nécessaires à la préparation des ocytes fécondés avant chaque expérience (étape 1) peuvent être raccourcis si un grand nombre d’embryons cryoconservés sont préparés à l’avance. Ce chiffre est adapté de Darwish M et coll.16S’il vous plaît cliquez ici pour voir une version plus grande de ce chiffre.

Souris mutantes Embryons électroporés Embryons à 2 cellules Embryons transférés Chiots (%) Souris mutantes (%) Pas de souris mosaïques
Tyr KO 124 84 48 12 (25) 100 1
Glrb KO 151 94 40 6 (15) 100 0
Slc39a6 KO 48 25 25 5 (20) 100 0
Sac3 KI 233 84 20 3 (15) 50 1
Camk2a KI 124 70 70 14 (20) 64.3 0

Tableau 1 : Production de plusieurs lignées de souris GM à l’aide d’embryons décongelés congelés de fond C57BL/6J.

Tableau supplémentaire 1. S’il vous plaît cliquez ici pour télécharger cette table.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Le protocole décrit permet la génération de souris GM avec une efficacité élevée et de faibles taux de mosaïque(tableau 1). Il permet aux chercheurs sans compétences avancées en manipulation d’embryons de créer facilement des souris mutantes parce qu’il tire parti des progrès les plus récents et les plus utiles dans les technologies d’ingénierie de la reproduction et d’édition du génome : CRISPR/Cas9 ribonucleorotein (RNP) et électroporation en embryons décongelés par le gel. Ces progrès ont facilité et accéléré la génération des souris GM. Comme décrit dans la figure 3, il faut 4 semaines pour générer les souris GM. Par rapport à d’autres protocoles utilisant des approches similaires26, notre méthode est supérieure en termes d’efficacité, de taux de natalité et de mosaïque.

L’incubation d’embryons à une cellule dans FBS avant la cryoconservation est essentielle pour améliorer le taux de développement des embryons. Les conditions d’électroporation des embryons cryoconservés, décrites dans le Protocole, permettent un compromis entre l’efficacité d’édition des réactifs CRISPR et la survie des embryons. En effet, des conditions plus dures ou plus douces peuvent affecter le taux de développement des embryons et l’efficacité de l’édition, respectivement16. Le moment de l’électroporation(figure 2B) est essentiel pour surmonter le mosaïsme des fondateurs et s’assurer que la modification du génome se produit en présence de seulement deux allèles. Ceci est compatible avec les rapports précédents montrant que l’électroporation à un stade précoce pourrait produire des mutants non-mosaïques17. En outre, l’utilisation de RNP au lieu de l’ARN/mRNA diminue le taux de mosaïque et améliore l’efficacité d’édition17.

Le protocole décrit comporte plusieurs avantages. Tout d’abord, il génère les souris mutantes dans un court laps de temps (4 semaines). Deuxièmement, il s’agit d’un protocole très efficace et robuste; plusieurs lignes de souris knock-in (KO) et knock-in (KI) ont été générées avec des taux de mutation élevés (KO - 100%, KI - 50 à 64,3%). Troisièmement, il est pratique et rentable. L’utilisation de crRNA synthétique complète, tracrRNA, ssODN, et Cas9 protéine élimine la nécessité d’une préparation fastidieuse des vecteurs Cas9 et la transcription in vitro. Au lieu de cela, il permet aux chercheurs d’utiliser simplement des réactifs commerciaux et de l’équipement standard. Quatrièmement, il n’utilise pas de microinjection, ce qui nécessite des compétences techniques élevées. Cinquièmement, il réduit le mosaïsme chez les fondateurs, et conduit ainsi à une transmission germinale plus efficace des allèles édités, surmontant l’analyse génito-génielle compliquée des souris mosaïques. Enfin, ce protocole est efficace avec la souche consanguine C57BL/6J, qui évite l’utilisation d’hybrides F1, et donc la nécessité d’effectuer de nombreux backcrosses pour se débarrasser de la complexité génétique. Le génotypage des générations F1 a confirmé une transmission germinale précise. Cependant, il n’est pas recommandé d’étudier les phénotypes des souris F0 en raison de la complexité de l’allèle et la prédiction trompeuse du génotypage de la génération suivante extrapolée à partir du génotypage des fondateurs de F014,27.

Il est d’une importance primordiale d’exploiter l’utilisation des embryons décongelés dans l’édition génomique de primates non humains et de grands animaux tels que les porcs et les moutons, qui ne sont pas toujours facilement disponibles. Les méthodes de congélation des embryons diffèrent considérablement selon les espèces animales. Par conséquent, nous pensons que notre protocole de cryoconservation pourrait ne s’appliquer qu’aux souris. D’autre part, notre protocole est potentiellement applicable à l’utilisation de nucléases d’ingénierie autres que Cas9 pour la génération de souris GM, parce que l’électroporation a été précédemment signalé pour introduire d’autres nucléases telles que Cas12a dans l’embryon efficacement28,29.

L’une des limites du protocole est l’intégration précise d’un long transgène dans le génome, qui est considéré comme difficile dans les protocoles basés sur l’électroporation. Cependant, une solution potentielle a été rapportée : l’intégration de transgènes jusqu’à 4,9 Kb dans le génome de la souris a été réalisée avec succès en combinant l’électroporation avec un virus adéno-associé (AAV)-négocié SYSTÈME de livraison de donneurs HDR30, confirmant une publication antérieure31. En outre, l’apparition potentielle d’effets secondaires hors cible est une préoccupation majeure avec l’utilisation de la technologie CRISPR/Cas9. Nous n’avons pas effectué le séquençage du génome entier des souris modifiées pour exclure l’effet hors cible potentiel. Cependant, nous avons utilisé des outils CRISPR qui ont été signalés pour réduire l’effet hors cible, comme RNP32. En outre, nous avons utilisé une variante Cas9 haute fidélité qui réduit considérablement l’édition hors cible sans sacrifier les performances sur la cible33. En outre, nous avons conçu des arnsgiques à l’aide du logiciel CRISPRdirect (https://crispr.dbcls.jp), qui devrait aboutir à des séquences cibles avec des sites hors cibleminimisés 19. Pour confirmer la causalité du phénotype-phénotype et atténuer les préoccupations au sujet des effets hors cible, les chercheurs devraient générer plusieurs souris modifiées du même génotype à l’aide de différents gARN ou effectuer le backcrossing des souris générées pendant plusieurs générations.

Les souris knock-out générées à l’aide du mécanisme NHEJ et des mutations de frameshift ont été largement utilisés et montrent des phénotypes pertinents. Cependant, la protéine résiduelle tronquée peut exister en raison de la réinitiation de traduction ou du saut de l’exon34,35. Par conséquent, pour interpréter avec précision les phénotypes, la caractérisation de la fonction ou de l’expression résiduelle des protéines est nécessaire. La génération de souris complètes de gène knockout utilisant plus d’un ARN de gRNA serait une bonne alternative. Cependant, une attention particulière devrait être accordée pour confirmer que le gène ne contient pas de régions introniques transcrites aux ARN non codants, qui pourraient avoir des fonctions réglementaires et compliquer ainsi l’analyse phénotypique.

Dans cette étude, nous montrons un protocole simple par lequel de nombreux chercheurs peuvent générer des souris génétiquement modifiées en 4 semaines ou moins. En combinant l’utilisation d’embryons décongelés et l’électroporation, nous rendons la préparation de modèles murins de maladies humaines facile, rapide et efficace.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n’ont pas de divulgation financière pertinente.

Acknowledgments

Nous tenons à remercier Hitomi Sawada et Elizabeth Garcia pour les soins aux animaux. Ce travail a été soutenu par KAKENHI (15K20134, 17K11222, 16H06276 et 16K01946) et Hokugin Research Grant (à H.N.), et Jichi Medical University Young Investigator Award (à H.U.). La Fondation de bourses Otsuka Toshimi a appuyé M.D.

Materials

Name Company Catalog Number Comments
0.25 M Sucrose ARK Resource Co., Ltd. (Kumamoto, Japan) SUCROSE
1 M DMSO ARK Resource Co., Ltd. (Kumamoto, Japan) 1M DMSO
Butorphanol Meiji Seika Pharma Co., Ltd. (Tokyo, Japan) Vetorphale 5mg
Cas9 protein: Alt-R® S.p. HiFi Cas9 Nuclease 3NLS Integrated DNA Technologies, Inc. (Coralville, IA) 1081060
C57BL/6J mice Japan SLC (Hamamatsu, Japan) N/A
DAP213 ARK Resource Co., Ltd. (Kumamoto, Japan) DAP213
FBS Sigma-Aldrich, Inc. (St. Louis, MO) ES-009-C
hCG MOCHIDA PHARMACEUTICAL CO., LTD (Tokyo, Japan) HCG Mochida 3000
HTF ARK Resource Co., Ltd. (Kumamoto, Japan) HTF
ICR mice Japan SLC (Hamamatsu, Japan) N/A
Isoflurane Petterson Vet Supply, Inc. (Greeley, CO) 07-893-1389
KSOM ARK Resource Co., Ltd. (Kumamoto, Japan) KSOM
LN2 Tank Chart Industries (Ball Ground, GA) XC 34/18
M2 ARK Resource Co., Ltd. (Kumamoto, Japan) M2
Medetomidine Nippon Zenyaku Kogyo Co.,Ltd. (Koriyama, Japan) 1124401A1060
Microscope Nikon Co. (Tokyo, Japan) SMZ745T
Midazolam Sandoz K.K. (Tokyo, Japan) 1124401A1060
Nuclease free buffer Integrated DNA Technologies, Inc. (Coralville, IA) 1072570
Nucleospin DNA extraction kit Takara Bio Inc (Kusatsu, Japan) 740952 .5
One-hole slide glass Matsunami Glass Ind., Ltd. (Kishiwada, Japan) S339929
One-step type Electroporator BEX Co., Ltd. (Tokyo, Japan) CUY21EDIT II
Paraffin Liquid NACALAI TESQUE Inc. (Kyoto, Japan) SP 26137-85
Platinum plate electrode BEX Co., Ltd. (Tokyo, Japan) LF501PT1-10, GE-101
PMSG ASKA Animal Health Co., Ltd (Tokyo, Japan) SEROTROPIN 1000
Povidone iodide Professional Disposables International, Inc. (Orangeburg, NY) C12400
Reduced-Serum Minimal Essential Medium: OptiMEM I Sigma-Aldrich, Inc. (St. Louis, MO) 22600134
Two-step type Electroporator Nepa Gene Co., Ltd. (Ichikawa, Japan) NEPA21

DOWNLOAD MATERIALS LIST

References

  1. Wang, H., et al. One-step generation of mice carrying mutations in multiple genes by CRISPR/cas-mediated genome engineering. Cell. 153, (4), 910-918 (2013).
  2. Jinek, M., et al. A programmable dual-RNA - guided DNA endonuclease in adaptive bacterial immunity. Science. 337, (6096), 816-822 (2012).
  3. Mali, P., et al. RNA-guided human genome engineering via Cas9. Science. 339, (6121), 823-826 (2013).
  4. Cong, L., et al. Multiplex genome engineering using CRISPR/VCas systems. Science. 339, (6121), 819-823 (2013).
  5. Doudna, J. A., Charpentier, E. The new frontier of genome engineering with CRISPR-Cas9. Science. 346, (6213), 1258096 (2014).
  6. Mashiko, D., et al. Generation of mutant mice by pronuclear injection of circular plasmid expressing Cas9 and single guided RNA. Scientific Reports. 3, 3355 (2013).
  7. Yen, S. T., et al. Somatic mosaicism and allele complexity induced by CRISPR/Cas9 RNA injections in mouse zygotes. Developmental Biology. 393, (1), 3-9 (2014).
  8. Kaneko, T., Mashimo, T. Simple genome editing of rodent intact embryos by electroporation. PLoS ONE. 10, (11), 1-7 (2015).
  9. Qin, W., et al. Efficient CRISPR/cas9-mediated genome editing in mice by zygote electroporation of nuclease. Genetics. 200, (2), 423-430 (2015).
  10. Kaneko, T., Sakuma, T., Yamamoto, T., Mashimo, T. Simple knockout by electroporation of engineered endonucleases into intact rat embryos. Scientific Reports. 4, 6382 (2014).
  11. Hashimoto, M., Takemoto, T. Electroporation enables the efficient mRNA delivery into the mouse zygotes and facilitates CRISPR/Cas9-based genome editing. Scientific Reports. 5, 11315 (2015).
  12. Chen, S., Lee, B., Lee, A. Y. F., Modzelewski, A. J., He, L. Highly efficient mouse genome editing by CRISPR ribonucleoprotein electroporation of zygotes. Journal of Biological Chemistry. 291, (28), 14457-14467 (2016).
  13. Modzelewski, A. J., et al. Efficient mouse genome engineering by CRISPR-EZ technology. Nature Protocols. 13, (6), 1253-1274 (2018).
  14. Teixeira, M., et al. Electroporation of mice zygotes with dual guide RNA/Cas9 complexes for simple and efficient cloning-free genome editing. Scientific Reports. 8, 474 (2018).
  15. Nakagawa, Y., et al. Production of knockout mice by DNA microinjection of various CRISPR/Cas9 vectors into freeze-thawed fertilized oocytes. BMC Biotechnology. 15, (1), 1-10 (2015).
  16. Darwish, M., et al. Rapid and high-efficient generation of mutant mice using freeze-thawed embryos of the C57BL/6J strain. Journal of Neuroscience Methods. 317, 149-156 (2019).
  17. Hashimoto, M., Yamashita, Y., Takemoto, T. Electroporation of Cas9 protein/sgRNA into early pronuclear zygotes generates non-mosaic mutants in the mouse. Developmental Biology. 418, (1), 1-9 (2016).
  18. Sakamoto, W., Kaneko, T., Nakagata, N. Use of frozen-thawed oocytes for efficient production of normal offspring from cryopreserved mouse spermatozoa showing low fertility. Comparative Medicine. 55, (2), 136-139 (2005).
  19. Naito, Y., Hino, K., Bono, H., Ui-Tei, K. CRISPRdirect: Software for designing CRISPR/Cas guide RNA with reduced off-target sites. Bioinformatics. 31, (7), 1120-1123 (2015).
  20. Torres-Perez, R., Garcia-Martin, J. A., Montoliu, L., Oliveros, J. C., Pazos, F. WeReview: CRISPR Tools-Live Repository of Computational Tools for Assisting CRISPR/Cas Experiments. Bioengineering. 6, (3), 63 (2019).
  21. Okamoto, S., Amaishi, Y., Maki, I., Enoki, T., Mineno, J. Highly efficient genome editing for single-base substitutions using optimized ssODNs with Cas9-RNPs. Scientific Reports. 9, 4811 (2019).
  22. Takeo, T., Nakagata, N. Superovulation using the combined administration of inhibin antiserum and equine chorionic gonadotropin increases the number of ovulated oocytes in C57BL/6 female mice. PLoS ONE. 10, (5), 1-11 (2015).
  23. Wuri, L., Agca, C., Agca, Y. Euthanasia via CO2 inhalation causes premature cortical granule exocytosis in mouse oocytes and influences in vitro fertilization and embryo development. Molecular Reproduction and Development. 86, (7), 825-834 (2019).
  24. Nakagata, N. High survival rate of unfertilized mouse oocytes after vitrification. Journal of Reproduction and Fertility. 87, (2), 479-483 (1989).
  25. Dehairs, J., Talebi, A., Cherifi, Y., Swinnen, J. V. CRISP-ID: Decoding CRISPR mediated indels by Sanger sequencing. Scientific Reports. 6, 28973 (2016).
  26. Nakagawa, Y., Sakuma, T., Takeo, T., Nakagata, N., Yamamoto, T. Electroporation-mediated genome editing in vitrified/warmed mouse zygotes created by ivf via ultra-superovulation. Experimental Animals. 67, (4), 535-543 (2018).
  27. Nakajima, K., Nakajima, T., Takase, M., Yaoita, Y. Generation of albino Xenopus tropicalis using zinc-finger nucleases. Development Growth and Differentiation. 54, (9), 777-784 (2012).
  28. Hur, J. K., et al. Targeted mutagenesis in mice by electroporation of Cpf1 ribonucleoproteins. Nature Biotechnology. 34, 807-808 (2016).
  29. Dumeau, C. E., et al. Introducing gene deletions by mouse zygote electroporation of Cas12a/Cpf1. Transgenic Research. 28, (5-6), 525-535 (2019).
  30. Chen, S., et al. CRISPR-READI: Efficient Generation of Knockin Mice by CRISPR RNP Electroporation and AAV Donor Infection. Cell Reports. 27, (13), 3780-3789 (2019).
  31. Mizuno, N., et al. Intra-embryo Gene Cassette Knockin by CRISPR/Cas9-Mediated Genome Editing with Adeno-Associated Viral Vector. iScience. 9, 286-297 (2018).
  32. Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. Highly Efficient RNA-guide genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Research. 24, (6), 1012-1019 (2014).
  33. Vakulskas, C. A., et al. A high-fidelity Cas9 mutant delivered as a ribonucleoprotein complex enables efficient gene editing in human hematopoietic stem and progenitor cells. Nature Medicine. 24, (8), 1216-1224 (2018).
  34. Rodriguez-Rodriguez, J. A., et al. Distinct Roles of RZZ and Bub1-KNL1 in Mitotic Checkpoint Signaling and Kinetochore Expansion. Current Biology. 28, (21), 3422-3429 (2018).
  35. Smits, A. H., et al. Biological Plasticity Rescues Target Activity in CRISPR Knockouts. Nature Methods. 16, 1087-1093 (2019).
Utilisation d’embryons décongelés par le gel pour la production à haut rendement de souris génétiquement modifiées
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Nishizono, H., Darwish, M., Uosaki, H., Masuyama, N., Seki, M., Abe, H., Yachie, N., Yasuda, R. Use of Freeze-thawed Embryos for High-efficiency Production of Genetically Modified Mice. J. Vis. Exp. (158), e60808, doi:10.3791/60808 (2020).More

Nishizono, H., Darwish, M., Uosaki, H., Masuyama, N., Seki, M., Abe, H., Yachie, N., Yasuda, R. Use of Freeze-thawed Embryos for High-efficiency Production of Genetically Modified Mice. J. Vis. Exp. (158), e60808, doi:10.3791/60808 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter