Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Verwendung von gefriergetauten Embryonen für die hocheffiziente Produktion von gentechnisch veränderten Mäusen

doi: 10.3791/60808 Published: April 2, 2020
* These authors contributed equally

Summary

Hier stellen wir eine modifizierte Methode zur Kryokonservierung von Einzellembryonen sowie ein Protokoll vor, das die Verwendung von gefriergetauten Embryonen und Elektroporation für die effiziente Erzeugung genetisch veränderter Mäuse koppelt.

Abstract

Die Verwendung von gentechnisch veränderten (GV) Mäusen ist entscheidend für das Verständnis der Genfunktion und die Entschlüsselung der zugrunde liegenden Mechanismen menschlicher Krankheiten geworden. Das CRISPR/Cas9-System ermöglicht es Forschern, das Genom mit beispielloser Effizienz, Genauigkeit und Einfachheit zu modifizieren. Mit dieser Technologie suchen Forscher nach einem schnellen, effizienten und einfachen Protokoll zur Erzeugung von GV-Mäusen. Hier führen wir eine verbesserte Methode zur Kryokonservierung von Einzellembryonen ein, die zu einer höheren Entwicklungsrate der gefrierenden Embryonen führt. Durch die Kombination mit optimierten Elektroporationsbedingungen ermöglicht dieses Protokoll die Erzeugung von Knockout- und Knock-in-Mäusen mit hoher Effizienz und niedrigen Mosaikraten innerhalb kurzer Zeit. Darüber hinaus zeigen wir eine schritt weise Erklärung unseres optimierten Protokolls, das die CRISPR-Reagenzpräparation, In-vitro-Fertilisation, Kryokonservierung und das Auftauen von einzelligen Embryonen, die Elektroporation von CRISPR-Reagenzien, die Mausgenerierung und die Genotypisierung der Gründer umfasst. Mit diesem Protokoll sollten Forscher in der Lage sein, gentechnisch veränderte Mäuse mit beispielloser Leichtigkeit, Geschwindigkeit und Effizienz vorzubereiten.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Das gruppierte, regelmäßig interspaceierte kurzpalädime Wiederholungen (CRISPR)/CRISPR-assoziiertes Protein 9 (Cas9) System ist ein wissenschaftlicher Durchbruch, der eine beispiellose gezielte Modifikation im Genom1ermöglicht. Das CRISPR/Cas9-System besteht aus Cas9-Protein und Guide-RNA (gRNA) mit zwei molekularen Komponenten: einer zielspezifischen CRISPR-RNA (crRNA) und einer transaktivierenden CRISPR-RNA (tracrRNA)2 . Eine gRNA leitet das Cas9-Protein auf den spezifischen Ort im Genom, 20 Nukleotide, die crRNA ergänzen, und neben dem protospacer angrenzenden Motiv (PAM). Das Cas9-Protein bindet an die Zielsequenz und induziert Doppelstrangbrüche (DSBs), die entweder durch fehleranfällige nicht-homologe Endverbindung (NHEJ) oder High-Fidelity-Homologie-gesteuerte Reparatur (HDR)3,4,5repariert werden. Das NHEJ führt zu Einfügungen oder/und Deletionen (Indels) und damit zu einem Genverlust der Funktion, wenn eine Codierungssequenz angepeilt wird. Die HDR führt zu einer präzisen Genombearbeitung in Gegenwart einer Reparaturvorlage, die Homologiesequenzen3,4,5enthält. Die NHEJ und HDR wurden genutzt, um Knockout- bzw. Knock-in-Mäuse zu erzeugen.

Während das CRISPR/Cas9-System die Erzeugung von GV-Mäusen mit herausragender Wirksamkeit und Genauigkeit deutlich beschleunigt hat, stehen Wissenschaftler, die diese Methoden anwenden, oft vor technischen Herausforderungen. Erstens erfordern herkömmliche Protokolle eine Mikroinjektion für die Einführung der CRISPR-Bearbeitungswerkzeuge in den Vorkern befruchteter Eier6,7. Diese Technik ist zeitaufwändig und erfordert in der Regel eine umfangreiche Schulung. So ersetzten mehrere Gruppen die Mikroinjektion durch Elektroporation8,9,10,11,12,13. In den frühen Elektroporationsprotokollen wurden jedoch frische Embryonen für die Elektroporation verwendet. Dies verursachte ein weiteres Problem, denn die Vorbereitung frischer Embryonen vor jedem Experiment ist schwierig14.

Kürzlich haben wir und andere die Verwendung von gefriergetauten Embryonen und Elektroporation für die Genombearbeitung kombiniert, was die Erzeugung von GV-Mäusen15,16erleichtert. Dieses Protokoll ermöglicht es Forschern ohne fortgeschrittene Embryo-Manipulationsfähigkeiten, schnell Tiermodelle menschlicher Krankheiten mit hoher Effizienz zu generieren. Das Protokoll reduziert auch die praktischen Herausforderungen bei der Erzeugung von GV-Mäusen, wie z. B. genetische Heterogenität in den Gründern16. Um den Mosaikismus zu überwinden, führen wir die Elektroporation von CRISPR-Reagenzien innerhalb von 1 h nach dem Auftauen des Embryos durch, um sicherzustellen, dass die Bearbeitung vor der ersten Replikation des Genoms erfolgt. Eine weitere Verbesserung beinhaltet die Verwendung von Cas9-Protein anstelle von Cas9 mRNA, um unerwünschten Mosaikismus zu reduzieren17. Darüber hinaus haben wir eine optimale Methode für die Einzell-Embryo-Kryokonservierung entwickelt, die die Entwicklungsrate auf das Zweizellstadium16erhöht: Die Verwendung von fetalem Rinderserum (FBS) verbessert das Überleben gefriergetauter Eizellen nach der Befruchtung dramatisch, vielleicht durch denselben Mechanismus, der gefriertaute unbefruchtete Eizellen widerstandsfähiger macht18.

Hier stellen wir ein umfassendes Protokoll zur Erzeugung von gentechnisch veränderten Mäusen mit gefriergetgetgetatten Embryonen vor, einschließlich der modifizierten Methode zur Kryokonservierung von einzelligen C57BL/6J-Embryonen. Es umfasst 1) gRNA-Design, CRISPR-Reagenzvorbereitung und -montage; 2) IVF, Kryokonservierung und Auftauen von Einzell-Embryonen; 3) Elektroporation von CRISPR-Reagenzien in gefriergettaute Embryonen; 4) Embryotransfer in das Eileiter von pseudoschwangeren weiblichen Mäusen; und 5) Genotypisierung und Sequenzanalyse der F0-Gründertiere.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Alle in dieser Studie durchgeführten Tierpflege und -verfahren wurden gemäß den Regeln und Vorschriften des Leitfadens für die Pflege und Verwendung von Labortieren durchgeführt. Das experimentelle Protokoll wurde vom Animal Care Committee of Laboratory Animals der University of Toyama, der University of Tokyo, der Jichi University und dem Max-Planck-Florida-Institut für Neurowissenschaften genehmigt. Informationen über alle Reagenzien finden Sie in der Materialtabelle.

1. CRISPR Reagenzien-Design

  1. crRNA-Design
    1. Besuchen Sie CRISPR direct19 (https://crispr.dbcls.jp/), um spezifische crRNAs mit reduzierten Off-Target-Sites zu entwerfen.
      HINWEIS: Es gibt viele andere nützliche Werkzeuge, um die crRNA20 (https://bioinfogp.cnb.csic.es/tools/wereview/crisprtools/) zu entwerfen.
    2. Fügen Sie die Zielnukleotidsequenz ein und nehmen Sie die folgenden Änderungen vor:
      PAM-Sequenzanforderung = NGG
      Spezifitätsprüfung = Mausgenom (Mus musculus), GRCm38/mm10 (Dez, 2011)
      HINWEIS: Zum Beispiel zur Erzeugung von Tyrosinase (Tyr) Knockout-Mäusen wurde Exon 2 (Nukleotidsequenz von 9476–9692) ins Visier genommen.
    3. Klicken Sie auf Design, und markieren Sie für hochspezifische Treffer nur "Hochspezifisches Zielanzeigen ".
    4. Um potenzielle Off-Target-Effekte zu reduzieren, wählen Sie die Zielsequenz mit dem niedrigsten Wert in den Spalten "12 mer+PAM" und "8 mer+PAM" aus.
      HINWEIS: In diesen Spalten("1") wird angegeben, dass die Sequenz nur eine perfekte Übereinstimmung mit der beabsichtigten Zielsite hat und Zahlen größer als eine das Vorhandensein potenzieller Off-Target-Sites angeben.
    5. Bestellen Sie die resultierenden Oligonukleotide von crRNA-Syntheseunternehmen (Supplimentary Table 1).
      HINWEIS: Für das Exon-2-Tyr-Gen wurde die folgende Zielsequenz verwendet: GGACCACTATTACGTAATCC, mit +TGG als PAM-Sequenz (Abbildung 2A).
  2. Einstrang-Oligodeoxynukleotid (ssODN) Design für HDR-vermittelte Schnittexperimente (d. h. Einschlagsmäuseerzeugung).
    1. Entwerfen Sie die ssODN-Länge auf etwa 80–180 bp einschließlich 30–60 Nukleotid (nt) Homologiearme auf beiden Seiten.
      HINWEIS: Ein ssODN von 75–85 nt Länge, einschließlich eines 30-35 nt Homologiearms und komplementär zur gRNA, zeigte eine hohe Knock-in-Editing-Effizienz21.
    2. Fügen Sie die beabsichtigte Modifikation und stille Mutation in der PAM-Sequenz oder, wenn nicht möglich, an der 5-Zoll-Nachbarbasis von PAM ein, um den Nachschnitt nach der Genombearbeitung zu blockieren.
      HINWEIS: Die in dieser Studie verwendeten crRNA und ssODN sind in der ergänzenden Tabelle 1aufgeführt.

2. In-vitro-Fertilisation, Embryo-Kryokonservierung und Gefriertauen

  1. In-vitro-Fertilisation
    1. Superovulate C57BL/6J weibliche Mäuse (4 oder 8 Wochen alt) durch IP-Injektion mit schwangerer Stute Serum gonadotropin (PMSG) gefolgt von Injektion mit 7,5 IE humanem Choriongonadotropin (hCG) nach 48 h.
      HINWEIS: Die Anzahl der ovulierten Eizellen kann mit Ultra-Superovulation22um etwa das 3x erhöht werden.
    2. Entfernen Sie die Cauda Epididymide von geschlechtsreifen männlichen C57BL/6J-Mäusen (3–5 Monate alt).
      HINWEIS: Es ist möglich, Spermatozoen zu sammeln, ohne die männlichen Mäuse zu opfern.
    3. Extrahieren Sie Spermatozoen mit einer Seznadel und inkubieren Sie sie in einem 200-L-Tropfen menschlicher Tubalflüssigkeit (HTF) imCO2-Inkubator für 1,5 h zur Kapatitation.
    4. Sammeln Sie Cumulus-Oocyt-Komplexe (COCs) aus den Eileitern 16–18 h nach der hCG-Injektion und inkubieren Sie sie in einem frischen 200-L-Tropfen HTF-Medium, das mit Paraffinflüssigkeit bedeckt ist, in einemCO2-Inkubator (5%CO2, 37 °C) für nicht mehr als 2 h.
      HINWEIS: Es ist vorzuziehen, die Mäuse durch zervikale Dislokation unter Narkose zu opfern, da Die Euthanasie durchCO2-Inhalation IVF und embryonale Entwicklung beeinflusst23.
    5. Fügen Sie 1–5 L der Spermiensuspension von der Grenze des Inkubationsmediums zum 200-L-Tropfen2 htF-Medium, das COCs enthält, und inkubieren Sie sie in einem CO2-Inkubator für 3 h.
    6. Waschen Sie die Eizellen mit kaliumergänztem Simplex-Optimierungsmedium (KSOM) 3x, um verbleibende Spermien und Cumuluszellen zu entfernen.
    7. Überprüfen Sie die pronukleare Bildung und den Grad der einzelligen Embryonen mit einem invertierten Mikroskop.
  2. Kryokonservierung von Einzellembryonen
    1. Inkubieren Sie einzellige Embryonen in einem 200-L-Tropfen HTF, der 20 % FBS (nicht mit2 Paraffinflüssigkeit bedeckt) für 10 min in einem CO2-Inkubator enthält.
    2. 20–100 Embryonen auf 50 l 1 M Dimethylsulfoxid (DMSO) Lösung24übertragen.
    3. Eine Lösung mit 100 Embryonen in den Boden eines Kryotube sende und mit einem Kühler oder auf Eis 5 min bei 0 °C abkühlen lassen.
    4. 45 L DAP213 (2 M Dimethylsulfoxid, 1 M Acetamid und 3 M Propylenglykol) langsam entlang der Rohrwand hinzufügen, die Rohre verschließen und 5 min in einem Kühler oder auf Eis bei 0 °C aufbewahren.
      HINWEIS: Befestigen Sie die Kappen nicht zu fest, um sie beim Auftauen der Probe leicht zu entfernen.
    5. Rohre schnell in flüssigem Stickstoff lagern.
  3. Embryo auftauen
    1. Öffnen Sie den Deckel des Kryotube, entsorgen Sie den verbleibenden flüssigen Stickstoff und fügen Sie 900 l 0,25 M Saccharoselösung vorgewärmt auf 37 °C hinzu.
      HINWEIS: Die 0,25 M Saccharoselösung muss im Voraus auf 37 °C erwärmt werden, da die Verwendung einer kalten Lösung die Lebensfähigkeit des Embryos nach dem Auftauen verringert.
    2. Rohrleitung schnell für 10x und übertragen Sie den Inhalt der Kryotube in eine Kunststoffschale.
      HINWEIS: Die Pipetten sollten sorgfältig durchgeführt werden, damit keine Blasen erzeugt werden und die Embryonen beschädigt werden.
    3. Waschen Sie die morphologisch normal befruchteten Eizellen 2x in KSOM-Medium mit2 Paraffinflüssigkeit bedeckt und halten Sie sie in einem CO2-Inkubator bis zur Elektroporation.

3. Montage und Elektroporation von CRISPR-Reagenzien

HINWEIS: Für die Elektroporation verwendeten wir eine Platinplattenelektrode (Höhe: 0,5 mm, Länge: 10 mm, Breite: 3 mm, Spalt: 1 mm) und einen einstufigen Elektroporator, der zuvor8 (Materialtabelle)beschrieben wurde. Ein zweistufiger Elektroporator kann auch verwendet werden (Tabelle der Materialien).

  1. Herstellung und Montage von CRISPR-Reagenzien
    1. Bestellen Sie CRISPR-Reagenzien (d. h. crRNA, tracrRNA und Cas9-Protein) und ssODN, wenn HDR-vermittelte Bearbeitungsexperimente durchgeführt werden (Tabelle der Materialien und Ergänzende Tabelle 1).
    2. Bereiten Sie die Glühlösung wie folgt vor.
      1. Bereiten Sie in der Lösung "Reduced-Serum Minimal Essential Medium"(Materialtabelle)1 c-g/l crRNA und 1 g/L tracrRNA vor, und fügen Sie 6 l jeder Lösung zu 42 l des nukleasefreien Puffers hinzu.
      2. Inkubieren Sie die Mischung in der Trockenheizung bei 95 °C für 3 min und kühlen Sie bei RT für 5 min.
      3. Bereiten Sie das in Opti-MEM I verdünnte HiFi Cas9-Protein mit 1 g/l Zubereiten und der vorherigen Mischung 6 l für ein Gesamtvolumen von 60 l hinzufügen.
      4. Bei der Durchführung von HDR-vermittelten Bearbeitungsexperimenten fügen Sie 6 l von 1 g/l ssODN hinzu. Da das Endvolumen 60 l betragen sollte, verwenden Sie in Schritt 3.1.2.1 36 l nukleasefreies Wasser.
        HINWEIS: Die endletzte Konzentration von crRNA, tracrRNA, Cas9 Protein und ssODN beträgt 100 ng/l.
      5. Übertragen Sie bis zu 100 Embryonen bis zu 25 l des Endgemischs (RNP-Komplex) in ein Ein-Loch-Gleitglas und inkubieren Sie sie bei 37 °C für 10 min.
  2. Electroporation
    1. Füllen Sie den Elektrodenspalt mit 6 l der neuen Mischung von CRISPR-Reagenzien und fügen Sie 20–25 Embryonen in das Gemisch ein.
      HINWEIS: Es ist wichtig, jeglichen Kontakt zwischen den Embryonen und der Elektroporationselektrode zu vermeiden, die Embryonen während elektrischer Impulse schädigen kann.
    2. Führen Sie die Elektroporation unter folgenden Bedingungen für einen einstufigen Elektroporator durch:
      Spannung: 25 V, Pulsrichtung (Pd) +
      EIN: 3 ms, AUS: 97 ms
      Wiederholungen: 5x
      HINWEIS: Die Elektroporation sollte nicht mehr als 1 h nach dem Auftauen durchgeführt werden, um sicherzustellen, dass die Genombearbeitung vor der ersten DNA-Replikation erfolgt, um Mosaikismus zu verhindern.
    3. Stellen Sie für einen zweistufigen Elektroporator die Bedingungen wie folgt ein:
      Poring Pulse = 40V, Pd +
      ON = 1 oder 2,5 ms; Pulsintervall = 50 ms
      Wiederholungen: 4x, Decay 10%

      Transferpuls = 5 oder 7V; Pd +/-.
      EIN: 50 ms; Pulsintervall = 50 ms.
      Wiederholungen = 5x; Zerfall = 40%.
      HINWEIS: Es ist wichtig, das Volumen anzupassen, um die Impedanz innerhalb des vom Hersteller angegebenen Bereichs beizubehalten.
    4. Waschen Sie die Embryonen 3x mit modifiziertem Krebs-Ringer Bicarbonat Puffer 2 (M2) Medium gefolgt von zwei Wäschen mit einem Tropfen KSOM Medium mit Paraffinflüssigkeit bedeckt.
    5. Inkubieren Sie die gewaschenen Embryonen (in KSOM-Medium) über Nacht in einemCO2-Inkubator zur weiteren Transplantation.

4. Embryotransfer

  1. Bereiten Sie pseudoschwangere weibliche Mäuse vor. Mate ICR weibliche Mäuse (3-6 Monate) mit vasectomisierten männlichen Mäusen 1 Tag vor dem Embryotransfer (ET).
    HINWEIS: Mäuse sollten am nächsten Morgen auf einen kopulatorischen Stecker überprüft werden. Die Mäuse mit einem Stecker gelten als pseudopregnant und können für ET verwendet werden.
  2. Saugluft und KSOM (ohne Paraffinflüssigkeit) in abwechselnden Abständen von 2–3 mm in eine Glaskapillare als Marker für eine erfolgreiche Implantation.
  3. Führen Sie 20–24 Embryonen in einen 200-L-Tropfen KSOM (ohne Paraffinflüssigkeit) ein und ziehen Sie 10–12 Embryonen in die Glaskapillare zur Implantation in jedem Eileiter.
  4. Anästhetisieren Sie die weiblichen Mäuse durch Isofluran (Inhalation) oder eine IP-Injektion einer Lösung, die Medetomidin/Midazolam/Butorphanol kombiniert (0,3 mg/kg, 4,0 mg/kg bzw. 5,0 mg/kg). Positionieren Sie die anästhesierte Maus auf ihrer ventralen Seite auf einem Heizkissen. Schützen Sie die Augen der anästhesierten Maus mit einem feuchtigkeitsbefeuchtenden Gel.
  5. Rasieren Sie entlang des unteren Teils der dorsalen Mittellinie und desinfizieren Sie den Bereich mit Povidon Jod gefolgt von 70% Ethanol.
  6. Machen Sie einen langen Schnitt von 1 cm parallel zur dorsalen Mittellinie.
  7. Nehmen Sie das Eileiterund heraus und legen Sie es auf einen sterilen Kunststoffvorhang. Halten Sie es feucht mit warmer steriler Saline.
  8. Legen Sie das Eileiterunter das stereoskopische Mikroskop.
  9. Machen Sie ein Loch in die Wand des Eileiters zwischen dem Infundibulum und Ampulla ein paar Millimeter vor der Ampulla durch Mikrofederschere.
  10. Setzen Sie die Spitze der Glaskapillare, die die Embryonen enthält, in das Loch ein und blasen Sie sanft in das Mundstück des Kapillarhalters, um die Embryonen zu vertreiben, bis eine Luftblase in der Ampulla sichtbar ist.
    HINWEIS: Transfer zwischen 10–12 Embryonen pro Eileiter.
  11. Ziehen Sie die Glaskapillare aus der Eileiterwand und schieben Sie das Fortpflanzungsorgan sanft zurück in die Körperhöhle.
  12. Wiederholen Sie den vorherigen Vorgang, um die Embryonen in das andere Eileiterzuführen einzuführen.
  13. Nach Abschluss des ET-Verfahrens das Peritoneum mit einem einfachen unterbrochenen Nahtmuster (50, resorbierbar, geflochtene synthetische Nähte) und dann die Haut mit einem einfachen unterbrochenen Muster oder einem vergrabenen subcuticularen unterbrochenen Stichmuster (60 nicht resorbierbaren, monosynthetischen Nähten).
  14. Halten Sie die Maus auf einer 37 °C Wärmeplatte warm, bis sie sich von der Anästhesie erholt.
  15. Überwachen Sie die Gesundheit des Tieres täglich für 7 Tage nach der Operation.

5. Genotypisierung und Sequenzanalyse

  1. Genomische DNA-Extraktion
    HINWEIS: Wir verwendeten NucleoSpin-Gewebe-DNA-Extraktionskits, um die genomische DNA aus dem Ohrgewebe von Mäusen zu extrahieren, die den Empfehlungen des Herstellers folgten.
    1. Fügen Sie der Probe 180 l Puffer-T1 und 25 l Proteinase-K-Lösung hinzu und mischen Sie sie durch Wirbeln für 10 s.
    2. Bei 56 °C für 2 h oder bis eine vollständige Lyse inkubieren. Wirbel für 10 s alle 30 min der Inkubation.
    3. Fügen Sie 200 l Puffer B3 hinzu, wirbeln Sie 30 s kräftig aus, und brüten Sie bei 70 °C für 10 min.
    4. Fügen Sie der Probe 210 l 100% Ethanol hinzu und wirbeln Sie kräftig.
    5. Legen Sie für jede Probe eine Gewebesäule in ein Sammelrohr und wenden Sie die Probe auf die Spalte an.
    6. Zentrifugieren Sie 1 min bei 11.000 x g, verwerfen Sie den Durchfluss und legen Sie die Spalte wieder in das Sammelrohr.
    7. Fügen Sie 500 l Puffer BW hinzu, um die Probe (1. Wäsche), Zentrifuge für 1 min bei 11.000 x gzu waschen, den Durchfluss zu verwerfen und die Säule wieder in das Sammelrohr zu legen.
    8. Fügen Sie der Säule 600 l Puffer B5 (2. Wäsche), Zentrifuge für 1 min bei 11.000 x g,den Durchfluss hinzu, und legen Sie die Spalte wieder in das Sammelrohr.
    9. Zentrifugieren Sie die Säule für 1 min bei 11.000 x g, um die Kieselsäuremembran zu trocknen und die NucleoSpin-Gewebesäule in ein 1,5 ml Mikrozentrifugenrohr zu legen.
    10. Fügen Sie 100 l Puffer BE hinzu, inkubieren bei Raumtemperatur für 1 min, dann Zentrifuge 1 min bei 11.000 x g.
  2. PCR-Verstärkung und -Reinigung
    1. Entwerfen Sie die Primer mit der Primer3 plus Website (https://primer3plus.com/), um eine 400–500 bp-Sequenz um den Zielort zu verstärken.
    2. Entwerfen Sie ein neues PCR-Protokoll und testen Sie es empirisch.
    3. Reinigen Sie das PCR-Produkt, um unerwünschte Enzyme, Nukleotide, Primer und Pufferkomponenten zu entfernen. Eine Standardreinigungsmethode kann wie folgt verwendet werden.
      1. Fügen Sie 50 l Phenol auf 50 l der PCR-Produkte hinzu und mischen Sie sie durch Wirbeln.
      2. Zentrifuge für 1 min bei 11.000 x g und übertragen Sie die obere transparente Schicht in ein neues Rohr.
      3. Fügen Sie 120 l 99,5 % Ethanol und 20 l 5 M Ammoniumacetat und Wirbel für 30 s hinzu.
      4. Halten Sie bei RT für 10 min und Zentrifuge bei 11.000 x g für 10 min.
      5. Entsorgen Sie den Überstand und waschen Sie das DNA-Pellet mit 1 ml 70% Ethanol.
      6. Das Pellet bei RT 10 min trocknen und in 10 l RNase-freiem Wasser auflösen.
        HINWEIS: PCR-Säulen-basierte Reinigungskits werden rekommentiert, weil Phenol für den Menschen giftig ist.
  3. Sanger-Sequenzierung
    1. Führen Sie eine DNA-Quantifizierungsanalyse (siehe Materialtabelle) durch, um das gereinigte PCR-Amplikon zu quantifizieren.
    2. Senden Sie PCR-Produkte und Sequenzierungsprimer an einen Sequenzierungsdienstanbieter.
    3. Analysieren Sie die Reihenfolge anhand der verfügbaren Online-Websites.
      HINWEIS: In dieser Studie wurde CRISP-ID25 (http:/crispid.gbiomed.kuleuven.be/) für die Sequenzanalyse verwendet.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Unsere modifizierte Methode zur Kryokonservierung von Einzellembryonen, einschließlich der Inkubation in HTF mit 20% FBS für 10 min gefolgt von Kryokonservierung in 1 M DMSO und DAP213 Lösung, verbesserte die Entwicklungsrate der gefriertauten Embryonen in das Zweizellstadium(Abbildung 1, p = 0,009, Student es t-Test). Die gefriertauten Embryonen wurden zur Herstellung von gentechnisch veränderten Mäusen verwendet und elektroporationsbedingungen optimiert: fünf Wiederholungen von 25 V mit 3 ms Impulsen und 97 ms Intervallen mit einem Elektroporator, wie im Protokollabschnitt beschrieben. Die Anwendbarkeit des Protokolls wurde durch die Generierung von Albino-Tyrosinase-Gen (Tyr) Knockout-Mäusen(Abbildung 2) überprüft. Dazu wurde gRNA targeting exon 2 entwickelt (Abbildung 2A) und CRISPR-Reagenzien wurden wie im Abschnitt Protokoll beschrieben hergestellt. Die Bearbeitungswerkzeuge wurden innerhalb von 1 h embryonalen Auftauens elektropoiert, um sicherzustellen, dass die Genombearbeitung vor der ersten Replikation des Genoms stattfand und somit Den Mosaikismus in den Gründern verhinderte (Abbildung 2B). Alle erzeugten Mäuse waren Albino, und nur eine Maus war Mosaik, mit einem Mantel mit weißen und schwarzen Flecken (Abbildung 2C). Alle Albino-Mäuse mit zwei verschiedenen mutierten Allelen (heterozygote Mutation) mit Ausnahme einer Maus, die nur ein Allel beherbergt (homozygote Mutation), sind in Abbildung 2Edargestellt. Daraus lässt sich schließen, dass unsere Methode eine Bearbeitungseffizienz von fast 100 % bei einer niedrigen Mosaikrate bieten kann, wie durch Sequenzierungsanalysen sowie Die Farbe der Beschichtung bestätigt wird (Abbildung 2CE).

Als nächstes wurde die Reproduzierbarkeit des Protokolls durch die Erzeugung mehrerer Zeilen von Knockout- und Knock-in-Mäusen überprüft. Wie in Tabelle 1dargestellt, kann das Protokoll Knockout- und Knock-in-Mäuse mit hoher Effizienz und niedrigen Mosaikraten erzeugen. Die meisten der erzeugten F0-Mäuse wurden mit wilden Typ C57BL/6J-Mäusen gepaart, um die Keimbahnübertragung von mutierten Allelen auf die F1-Generationen zu bestätigen. Wie erwartet waren alle F1-Nachkommen der homozygoten F0-Mäuse heterozygot und enthielten ein mutiertes Allel und ein Wild-Typ-Allel. Zwischen der Genotypisierung der Gründer und ihren Generationen wurden keine unterschiedlichen Mutationen beobachtet. Das beschriebene Protokoll erzeugte innerhalb kurzer Zeit (d. h. 4 Wochen) gentechnisch veränderte Mäuse, wie im Workflow des Protokolls in Abbildung 3dargestellt.

Figure 1
Abbildung 1: Fetales Rinderserum (FBS) verbesserte die Entwicklungsrate der gefrierenden Embryonen im Zwei-Zell-Stadium. Die Anzahl der FBS+ Embryonen betrug 286 (das Experiment wurde 3x wiederholt), und die Anzahl der FBS-Embryonen betrug 272 (das Experiment wurde 3x wiederholt). Die Daten werden als Mittelwert dargestellt. Diese Figur ist mit Genehmigung von Darwish M et al.16 reproduziert. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 2
Abbildung 2: Erzeugung von Tyr Knockout-Mäusen mit hoher Effizienz und niedriger Mosaikrate. Diese Figur wurde von Darwish M et al.16 mit Genehmigung modifiziert. (A) Schematische Abbildung, die das Design von gRNA zeigt. Die PAM-Sequenz wird rot dargestellt. (B) Abbildung, die den Zeitpunkt der Elektroporation für die gefriertauten Embryonen zeigt, stellt das gelbe Symbol die Elektroporationszeit dar. (C) Repräsentative Bilder der erzeugten Tyr-Knockout-Mäuse. (D) Sequenzanalyse verschiedener Allele der Tyr-Knockout-Mäuse. Die Zielsequenz ist rot beschriftet und Bindestriche weisen auf das Löschen von Nukleotiden in den mutierten Allelen hin. WT = Wildtyp M = mutiertes Allel. (E) Ein repräsentativer Teil des Chromatogramms der Albinomaus, das das M1-Allel enthält, ist in D dargestellt. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 3
Abbildung 3: Workflow des Protokolls zur Erzeugung von GV-Mäusen. Der erste Schritt war die Herstellung von kryokonservierten Embryonen. Weibliche C57BL/6J-Mäuse wurden zuerst durch PMSG-Injektion, dann 48 h später durch hCG-Injektion superoviert. COCs wurden 16 h später gesammelt und iVF mit Spermatozoen von männlichen C57BL/6J-Mäusen unterzogen. Befruchtete Eizellen wurden kryokonserviert und bis zum Bedarf in flüssigem Stickstoff gelagert. Der zweite Schritt umfasste das Auftauen der Embryonen und die Elektroporation. Kryopreservede Embryonen wurden aufgetaut und CRISPR-Reagenzien (d.h. tracrRNA, crRNA und Cas9-Protein) wurden nach dem Auftauen der Embryonen innerhalb von 1 h zusammengesetzt und elektroporating. Der dritte Schritt umfasste den Embryotransfer und die Geburt von Mäusen. Am Tag nach der Elektroporation wurden zweizellige Embryonen in das Eileitervon pseudoschwangerer weiblicher Mäuse übertragen, um genetisch veränderte Mäuse zu erzeugen, die später mit Sanger-Sequenzierung genotypisiert wurden, um die Bearbeitungseffizienz zu bestätigen. Der Zeit- und Aufwand, der für die Vorbereitung befruchteter Eizellen vor jedem Experiment (Schritt 1) erforderlich ist, kann verkürzt werden, wenn eine große Anzahl von kryokonservierten Embryonen im Voraus vorbereitet wird. Diese Abbildung ist von Darwish M et al.16angepasst. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Mutante Mäuse Elektroporated Embryonen 2-Zell-Embryonen Übertragene Embryonen Welpen (%) Mutante Mäuse(%) Keine Mosaikmäuse
Tyr KO 124 84 48 12 (25) 100 1
Glrb KO 151 94 40 6 (15) 100 0
Slc39a6 KO 48 25 25 5 (20) 100 0
Tasche3 KI 233 84 20 3 (15) 50 1
Camk2a KI 124 70 70 14 (20) 64.3 0

Tabelle 1: Herstellung mehrerer Linien von gvGV-Mäusen mit gefriergetauten Embryonen mit C57BL/6J-Hintergrund.

Ergänzende Tabelle 1. Bitte klicken Sie hier, um diese Tabelle herunterzuladen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Das beschriebene Protokoll ermöglicht die Erzeugung von GV-Mäusen mit hoher Effizienz und niedrigen Mosaikraten (Tabelle 1). Es ermöglicht Forschern ohne fortgeschrittene Embryo-Manipulationsfähigkeiten, mutierte Mäuse leicht zu erstellen, da sie die neuesten und nützlichsten Fortschritte sowohl in der Reproduktionstechnik als auch in den Genom-Editing-Technologien nutzen: CRISPR/Cas9 Ribonucleoprotein (RNP) und Elektroporation in gefriergettaute Embryonen. Diese Fortschritte erleichterten und beschleunigten die Erzeugung der GV-Mäuse. Wie in Abbildung 3beschrieben, dauert es 4 Wochen, um die genetisch veränderten Mäuse zu erzeugen. Im Vergleich zu anderen Protokollen, die ähnliche Ansätze verwenden26, ist unsere Methode in Bezug auf Effizienz, Geburtenrate und Mosaikismus überlegen.

Die Inkubation von Einzell-Embryonen in FBS vor der Kryokonservierung ist entscheidend für die Verbesserung der Entwicklungsrate der Embryonen. Die im Protokoll beschriebenen Elektroporationsbedingungen der kryokonservierten Embryonen ermöglichen einen Kompromiss zwischen der Bearbeitungseffizienz von CRISPR-Reagenzien und dem Überleben der Embryonen. In der Tat können härtere oder mildere Bedingungen die Entwicklungsrate der Embryonen und die Bearbeitungseffizienz beeinflussen, bzw.16. Der Zeitpunkt der Elektroporation (Abbildung 2B) ist entscheidend, um den Mosaikismus bei Gründern zu überwinden und sicherzustellen, dass die Genommodifikation in Gegenwart von nur zwei Allelen auftritt. Dies steht im Einklang mit früheren Berichten, die zeigen, dass die Elektroporation im Frühstadium nicht-mosaik-mutant produzieren könnte17. Darüber hinaus verringert die Verwendung von RNP anstelle von gRNA/mRNA die Mosaikrate und verbessert die Bearbeitungseffizienz17.

Das beschriebene Protokoll weist mehrere Vorteile auf. Zunächst erzeugt es die mutierten Mäuse innerhalb kurzer Zeit (ca. 4 Wochen). Zweitens handelt es sich um ein hocheffizientes und robustes Protokoll; Mehrere Knockout-Mäuse (KO) und Knock-in -Mäuse (KI) wurden mit hohen Mutationsraten erzeugt (KO = 100%, KI = 50 bis 64,3%). Drittens ist es bequem und kostengünstig. Die Verwendung von vollständigem synthetischem crRNA-, tracrRNA-, ssODN- und Cas9-Protein macht eine mühsame Herstellung der Cas9-Vektoren und eine In-vitro-Transkription überflüssig. Stattdessen können Forscher einfach kommerzielle Reagenzien und Standardausrüstung verwenden. Viertens verwendet es keine Mikroinjektion, was hohe technische Fähigkeiten erfordert. Fünftens reduziert es den Mosaikismus bei Gründern und führt so zu einer effizienteren Keimbahnübertragung der bearbeiteten Allele, wodurch die komplizierte genotypische Analyse der Mosaikmäuse überwindet wird. Schließlich ist dieses Protokoll effizient mit dem C57BL/6J Inbred-Stamm, der den Einsatz von F1-Hybriden vermeidet, und damit die Notwendigkeit, zahlreiche Backcrosses durchzuführen, um die genetische Komplexität loszuwerden. Die Genotypisierung von F1-Generationen bestätigte eine genaue Keimbahnübertragung. Es wird jedoch nicht empfohlen, die Phänotypen der F0-Mäuse aufgrund der Allauchkomplexität und der irreführenden Vorhersage der Genotypisierung der nachfolgenden Generation zu untersuchen, extrapoliert von der Genotypisierung der F0-Gründer14,27.

Es ist von größter Bedeutung, die Verwendung der gefrierenden Embryonen bei der Genombearbeitung von nichtmenschlichen Primaten und großen Tieren wie Schweinen und Schafen zu nutzen, die nicht immer leicht verfügbar sind. Die Methoden des Einfrierens von Embryonen unterscheiden sich stark je nach Tierart. Daher denken wir, dass unser Kryokonservierungsprotokoll möglicherweise nur für Mäuse gilt. Andererseits ist unser Protokoll potenziell für die Verwendung anderer technischer Nukleasen als Cas9 für die Erzeugung von GV-Mäusen anwendbar, da bisher berichtet wurde, dass die Elektroporation andere Nukleasen wie Cas12a effizient in den Embryo einführt28,29.

Eine Einschränkung des Protokolls ist die präzise Integration eines langen Transgens in das Genom, was in elektroporationsbasierten Protokollen als schwierig gilt. Es wurde jedoch eine mögliche Lösung gemeldet: Die Integration von Transgenen bis 4,9 Kb in das Mausgenom wurde erfolgreich durch die Kombination von Elektroporation mit einem ADENo-assoziierten Virus (AAV)-vermittelten HDR-Spender-Bereitstellungssystem30durchgeführt, was eine frühere Publikationbestätigte 31. Auch das mögliche Auftreten von Nebenwirkungen außerhalb des Ziels ist ein großes Problem mit dem Einsatz von CRISPR/Cas9-Technologie. Wir haben keine Vollgenomsequenzierung der bearbeiteten Mäuse durchgeführt, um den potenziellen Off-Target-Effekt auszuschließen. Wir haben jedoch CRISPR-Tools verwendet, die gemeldet wurden, um den Off-Target-Effekt zu reduzieren, wie RNP32. Darüber hinaus haben wir eine High-Fidelity-Cas9-Variante verwendet, die die Off-Target-Bearbeitung deutlich reduziert, ohne die On-Target-Leistung zu opfern33. Außerdem haben wir gRNAs mit CRISPRdirect Software (https://crispr.dbcls.jp) entwickelt, die zu Zielsequenzen mit minimierten Off-Target-Sites führen soll19. Um die Kausalität des Genotyp-Phänotyps zu bestätigen und die Bedenken über Off-Target-Effekte zu lindern, sollten Forscher mehrere bearbeitete Mäuse desselben Genotyps mit verschiedenen gRNAs erzeugen oder die Rückkreuzung der erzeugten Mäuse für mehrere Generationen durchführen.

Die Knockout-Mäuse, die mit dem NHEJ-Mechanismus und Frameshift-Mutationen erzeugt wurden, sind weit verbreitet und zeigen relevante Phänotypen. Allerdings kann es ein abgeschnittenes Restprotein geben, das entweder auf die Translationsrückeinleitung oder das Überspringen des bearbeitetenExons 34,35zurückzuführen ist. Um die Phänotypen genau zu interpretieren, ist daher eine Charakterisierung der Restproteinfunktion oder -expression erforderlich. Die Erzeugung von vollständigen Gen-Knockout-Mäusen mit mehr als einer gRNA wäre eine gute Alternative. Besondere Aufmerksamkeit sollte jedoch beachtet werden, um zu bestätigen, dass das Gen keine intronischen Regionen enthält, die auf nicht kodierierte RNAs transkribiert sind, die regulatorische Funktionen haben und somit die phänotypische Analyse erschweren könnten.

In dieser Studie zeigen wir ein einfaches Protokoll, mit dem viele Forscher genetisch veränderte Mäuse in 4 Wochen oder weniger erzeugen können. Durch die Kombination von gefriergetgetgetatten Embryonen und Elektroporation machen wir die Vorbereitung von Mausmodellen menschlicher Krankheiten einfach, schnell und effizient.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben keine relevanten finanziellen Angaben.

Acknowledgments

Wir danken Hitomi Sawada und Elizabeth Garcia für die Tierpflege. Diese Arbeit wurde von KAKENHI (15K20134, 17K11222, 16H06276 und 16K01946) und Hokugin Research Grant (an H.N.) und Jichi Medical University Young Investigator Award (nach H.U.) unterstützt. Die Otsuka Toshimi Scholarship Foundation unterstützte M.D.

Materials

Name Company Catalog Number Comments
0.25 M Sucrose ARK Resource Co., Ltd. (Kumamoto, Japan) SUCROSE
1 M DMSO ARK Resource Co., Ltd. (Kumamoto, Japan) 1M DMSO
Butorphanol Meiji Seika Pharma Co., Ltd. (Tokyo, Japan) Vetorphale 5mg
Cas9 protein: Alt-R® S.p. HiFi Cas9 Nuclease 3NLS Integrated DNA Technologies, Inc. (Coralville, IA) 1081060
C57BL/6J mice Japan SLC (Hamamatsu, Japan) N/A
DAP213 ARK Resource Co., Ltd. (Kumamoto, Japan) DAP213
FBS Sigma-Aldrich, Inc. (St. Louis, MO) ES-009-C
hCG MOCHIDA PHARMACEUTICAL CO., LTD (Tokyo, Japan) HCG Mochida 3000
HTF ARK Resource Co., Ltd. (Kumamoto, Japan) HTF
ICR mice Japan SLC (Hamamatsu, Japan) N/A
Isoflurane Petterson Vet Supply, Inc. (Greeley, CO) 07-893-1389
KSOM ARK Resource Co., Ltd. (Kumamoto, Japan) KSOM
LN2 Tank Chart Industries (Ball Ground, GA) XC 34/18
M2 ARK Resource Co., Ltd. (Kumamoto, Japan) M2
Medetomidine Nippon Zenyaku Kogyo Co.,Ltd. (Koriyama, Japan) 1124401A1060
Microscope Nikon Co. (Tokyo, Japan) SMZ745T
Midazolam Sandoz K.K. (Tokyo, Japan) 1124401A1060
Nuclease free buffer Integrated DNA Technologies, Inc. (Coralville, IA) 1072570
Nucleospin DNA extraction kit Takara Bio Inc (Kusatsu, Japan) 740952 .5
One-hole slide glass Matsunami Glass Ind., Ltd. (Kishiwada, Japan) S339929
One-step type Electroporator BEX Co., Ltd. (Tokyo, Japan) CUY21EDIT II
Paraffin Liquid NACALAI TESQUE Inc. (Kyoto, Japan) SP 26137-85
Platinum plate electrode BEX Co., Ltd. (Tokyo, Japan) LF501PT1-10, GE-101
PMSG ASKA Animal Health Co., Ltd (Tokyo, Japan) SEROTROPIN 1000
Povidone iodide Professional Disposables International, Inc. (Orangeburg, NY) C12400
Reduced-Serum Minimal Essential Medium: OptiMEM I Sigma-Aldrich, Inc. (St. Louis, MO) 22600134
Two-step type Electroporator Nepa Gene Co., Ltd. (Ichikawa, Japan) NEPA21

DOWNLOAD MATERIALS LIST

References

  1. Wang, H., et al. One-step generation of mice carrying mutations in multiple genes by CRISPR/cas-mediated genome engineering. Cell. 153, (4), 910-918 (2013).
  2. Jinek, M., et al. A programmable dual-RNA - guided DNA endonuclease in adaptive bacterial immunity. Science. 337, (6096), 816-822 (2012).
  3. Mali, P., et al. RNA-guided human genome engineering via Cas9. Science. 339, (6121), 823-826 (2013).
  4. Cong, L., et al. Multiplex genome engineering using CRISPR/VCas systems. Science. 339, (6121), 819-823 (2013).
  5. Doudna, J. A., Charpentier, E. The new frontier of genome engineering with CRISPR-Cas9. Science. 346, (6213), 1258096 (2014).
  6. Mashiko, D., et al. Generation of mutant mice by pronuclear injection of circular plasmid expressing Cas9 and single guided RNA. Scientific Reports. 3, 3355 (2013).
  7. Yen, S. T., et al. Somatic mosaicism and allele complexity induced by CRISPR/Cas9 RNA injections in mouse zygotes. Developmental Biology. 393, (1), 3-9 (2014).
  8. Kaneko, T., Mashimo, T. Simple genome editing of rodent intact embryos by electroporation. PLoS ONE. 10, (11), 1-7 (2015).
  9. Qin, W., et al. Efficient CRISPR/cas9-mediated genome editing in mice by zygote electroporation of nuclease. Genetics. 200, (2), 423-430 (2015).
  10. Kaneko, T., Sakuma, T., Yamamoto, T., Mashimo, T. Simple knockout by electroporation of engineered endonucleases into intact rat embryos. Scientific Reports. 4, 6382 (2014).
  11. Hashimoto, M., Takemoto, T. Electroporation enables the efficient mRNA delivery into the mouse zygotes and facilitates CRISPR/Cas9-based genome editing. Scientific Reports. 5, 11315 (2015).
  12. Chen, S., Lee, B., Lee, A. Y. F., Modzelewski, A. J., He, L. Highly efficient mouse genome editing by CRISPR ribonucleoprotein electroporation of zygotes. Journal of Biological Chemistry. 291, (28), 14457-14467 (2016).
  13. Modzelewski, A. J., et al. Efficient mouse genome engineering by CRISPR-EZ technology. Nature Protocols. 13, (6), 1253-1274 (2018).
  14. Teixeira, M., et al. Electroporation of mice zygotes with dual guide RNA/Cas9 complexes for simple and efficient cloning-free genome editing. Scientific Reports. 8, 474 (2018).
  15. Nakagawa, Y., et al. Production of knockout mice by DNA microinjection of various CRISPR/Cas9 vectors into freeze-thawed fertilized oocytes. BMC Biotechnology. 15, (1), 1-10 (2015).
  16. Darwish, M., et al. Rapid and high-efficient generation of mutant mice using freeze-thawed embryos of the C57BL/6J strain. Journal of Neuroscience Methods. 317, 149-156 (2019).
  17. Hashimoto, M., Yamashita, Y., Takemoto, T. Electroporation of Cas9 protein/sgRNA into early pronuclear zygotes generates non-mosaic mutants in the mouse. Developmental Biology. 418, (1), 1-9 (2016).
  18. Sakamoto, W., Kaneko, T., Nakagata, N. Use of frozen-thawed oocytes for efficient production of normal offspring from cryopreserved mouse spermatozoa showing low fertility. Comparative Medicine. 55, (2), 136-139 (2005).
  19. Naito, Y., Hino, K., Bono, H., Ui-Tei, K. CRISPRdirect: Software for designing CRISPR/Cas guide RNA with reduced off-target sites. Bioinformatics. 31, (7), 1120-1123 (2015).
  20. Torres-Perez, R., Garcia-Martin, J. A., Montoliu, L., Oliveros, J. C., Pazos, F. WeReview: CRISPR Tools-Live Repository of Computational Tools for Assisting CRISPR/Cas Experiments. Bioengineering. 6, (3), 63 (2019).
  21. Okamoto, S., Amaishi, Y., Maki, I., Enoki, T., Mineno, J. Highly efficient genome editing for single-base substitutions using optimized ssODNs with Cas9-RNPs. Scientific Reports. 9, 4811 (2019).
  22. Takeo, T., Nakagata, N. Superovulation using the combined administration of inhibin antiserum and equine chorionic gonadotropin increases the number of ovulated oocytes in C57BL/6 female mice. PLoS ONE. 10, (5), 1-11 (2015).
  23. Wuri, L., Agca, C., Agca, Y. Euthanasia via CO2 inhalation causes premature cortical granule exocytosis in mouse oocytes and influences in vitro fertilization and embryo development. Molecular Reproduction and Development. 86, (7), 825-834 (2019).
  24. Nakagata, N. High survival rate of unfertilized mouse oocytes after vitrification. Journal of Reproduction and Fertility. 87, (2), 479-483 (1989).
  25. Dehairs, J., Talebi, A., Cherifi, Y., Swinnen, J. V. CRISP-ID: Decoding CRISPR mediated indels by Sanger sequencing. Scientific Reports. 6, 28973 (2016).
  26. Nakagawa, Y., Sakuma, T., Takeo, T., Nakagata, N., Yamamoto, T. Electroporation-mediated genome editing in vitrified/warmed mouse zygotes created by ivf via ultra-superovulation. Experimental Animals. 67, (4), 535-543 (2018).
  27. Nakajima, K., Nakajima, T., Takase, M., Yaoita, Y. Generation of albino Xenopus tropicalis using zinc-finger nucleases. Development Growth and Differentiation. 54, (9), 777-784 (2012).
  28. Hur, J. K., et al. Targeted mutagenesis in mice by electroporation of Cpf1 ribonucleoproteins. Nature Biotechnology. 34, 807-808 (2016).
  29. Dumeau, C. E., et al. Introducing gene deletions by mouse zygote electroporation of Cas12a/Cpf1. Transgenic Research. 28, (5-6), 525-535 (2019).
  30. Chen, S., et al. CRISPR-READI: Efficient Generation of Knockin Mice by CRISPR RNP Electroporation and AAV Donor Infection. Cell Reports. 27, (13), 3780-3789 (2019).
  31. Mizuno, N., et al. Intra-embryo Gene Cassette Knockin by CRISPR/Cas9-Mediated Genome Editing with Adeno-Associated Viral Vector. iScience. 9, 286-297 (2018).
  32. Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. Highly Efficient RNA-guide genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Research. 24, (6), 1012-1019 (2014).
  33. Vakulskas, C. A., et al. A high-fidelity Cas9 mutant delivered as a ribonucleoprotein complex enables efficient gene editing in human hematopoietic stem and progenitor cells. Nature Medicine. 24, (8), 1216-1224 (2018).
  34. Rodriguez-Rodriguez, J. A., et al. Distinct Roles of RZZ and Bub1-KNL1 in Mitotic Checkpoint Signaling and Kinetochore Expansion. Current Biology. 28, (21), 3422-3429 (2018).
  35. Smits, A. H., et al. Biological Plasticity Rescues Target Activity in CRISPR Knockouts. Nature Methods. 16, 1087-1093 (2019).
Verwendung von gefriergetauten Embryonen für die hocheffiziente Produktion von gentechnisch veränderten Mäusen
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Nishizono, H., Darwish, M., Uosaki, H., Masuyama, N., Seki, M., Abe, H., Yachie, N., Yasuda, R. Use of Freeze-thawed Embryos for High-efficiency Production of Genetically Modified Mice. J. Vis. Exp. (158), e60808, doi:10.3791/60808 (2020).More

Nishizono, H., Darwish, M., Uosaki, H., Masuyama, N., Seki, M., Abe, H., Yachie, N., Yasuda, R. Use of Freeze-thawed Embryos for High-efficiency Production of Genetically Modified Mice. J. Vis. Exp. (158), e60808, doi:10.3791/60808 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter