Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Uso di embrioni congelati per la produzione ad alta efficienza di topi geneticamente modificati

doi: 10.3791/60808 Published: April 2, 2020
* These authors contributed equally

Summary

Qui presentiamo un metodo modificato per la crioconservazione di embrioni unicellulari, nonché un protocollo che afcoppia l'uso di embrioni congelato ed elettroporazione per la generazione efficiente di topi geneticamente modificati.

Abstract

L'uso di topi geneticamente modificati (GM) è diventato cruciale per comprendere la funzione genica e decifrare i meccanismi alla base delle malattie umane. Il sistema CRISPR/Cas9 consente ai ricercatori di modificare il genoma con efficienza, fedeltà e semplicità senza precedenti. Sfruttando questa tecnologia, i ricercatori sono alla ricerca di un protocollo rapido, efficiente e facile per la generazione di topi GM. Qui introduciamo un metodo migliorato per la crioconservazione degli embrioni unicellulari che porta ad un più alto tasso di sviluppo degli embrioni congelato. Combinandolo con condizioni di elettroporazione ottimizzate, questo protocollo consente la generazione di topi knockout e knock-in con alta efficienza e bassi tassi di mosaico in breve tempo. Inoltre, mostriamo una spiegazione passo-passo del nostro protocollo ottimizzato, che copre la preparazione del reagente CRISPR, la fecondazione in vitro, la crioconservazione e lo scongelamento degli embrioni unicellulari, l'elettroporazione dei reagenti CRISPR, la generazione di topi e la genotipizzazione dei fondatori. Utilizzando questo protocollo, i ricercatori dovrebbero essere in grado di preparare i topi GM con facilità, velocità ed efficienza senza pari.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Il sistema di proteina palindromica corta (CRISPR)/proteina 9 (Cas9) associata a cluster regolarmente interspazioe è una svolta scientifica che fornisce una modifica mirata senza precedenti nel genoma1. Il sistema CRISPR/Cas9 è composto da proteine Cas9 e guidaRNA (gRNA) con due componenti molecolari: un RNA CRISPR (crRNA) specifico del bersaglio e un RNA CRISPR (tracrRNA)2 che attiva la transattivazione. Un gRNA indirizza la proteina Cas9 al locus specifico nel genoma, 20 nucleotidi complementari al crRNA e adiacenti al motivo adiacente al protospaziale adiacente (PAM). La proteina Cas9 si lega alla sequenza bersaglio e induce interruzioni a doppio filamento (DSB) che vengono riparate da un'estremità non omologa soggetta a errori (NHEJ) o da riparazioni ad alta fedeltà (HDR)3,4,5. Il NHEJ porta a inserimenti o /e delezioni (indels), e quindi alla perdita genica di funzione quando una sequenza di codifica è mirata. L'HDR porta ad una precisa modifica del genoma in presenza di un modello di riparazione contenente sequenze homologia3,4,5. La NHEJ e l'HDR sono stati sfruttati per generare topi knockout e knock-in, rispettivamente.

Mentre il sistema CRISPR/Cas9 ha notevolmente accelerato la generazione di topi GM con eccezionale efficacia e fedeltà, gli scienziati che applicano questi metodi spesso incontrano sfide tecniche. In primo luogo, i protocolli convenzionali richiedono la microiniezione per introdurre gli strumenti di editing CRISPR nel pronucle delle uova fecondate6,7. Questa tecnica richiede molto tempo e di solito richiede un'ampia formazione. Così, diversi gruppi hanno sostituito la microiniezione con elettroporazione8,9,10,11,12,13. Tuttavia, nei primi protocolli di elettroporazione sono stati utilizzati embrioni freschi per l'elettroporazione. Ciò ha causato un altro problema, perché la preparazione di embrioni freschi prima di ogni esperimento è difficile14.

Recentemente noi e altri abbiamo combinato l'uso di embrioni congelati ed elettroporazione per l'editing del genoma, che facilita la generazione di topi GM15,16. Questo protocollo consente ai ricercatori che non hanno competenze avanzate di manipolazione degli embrioni di generare rapidamente modelli animali di malattie umane con alta efficienza. Il protocollo riduce anche significativamente le sfide pratiche nella generazione di topi genetici, come l'eterogeneità genetica nei fondatori16. Per superare il mosaicismo, eseguiamo l'elettroporrazione dei reagenti CRISPR entro 1 h dopo lo scongelamento dell'embrione per garantire che l'editing avvenga prima della prima replicazione del genoma. Un altro miglioramento include l'uso della proteina Cas9 al posto dell'mRNA Cas9 per ridurre il mosaicismo indesiderabile17. Inoltre, abbiamo sviluppato un metodo ottimale per la crioconservazione degli embrioni a una cellula che aumenta il tasso di sviluppo allo stadio a due cellule16: l'uso del siero bovino fetale (FBS) migliora notevolmente la sopravvivenza degli ovociti congelati dopo la fecondazione, forse con lo stesso meccanismo che rende gli ovociti congelati non fecondati più resilienti18.

Qui presentiamo un protocollo completo per la generazione di topi geneticamente modificati utilizzando embrioni con congelamento scongelato, tra cui il metodo modificato per la crioconservazione degli embrioni C57BL/6J a una cellula. Esso comprende 1) progettazione gRNA, preparazione e assemblaggio del reagente CRISPR; 2) fecondazione in vitro, crioconservazione e scongelamento di embrioni unicellulari; 3) Elettroporazione dei reagenti CRISPR in embrioni con congelamento; 4) Trasferimento dell'embrione nell'ovidotto di topi femmine pseudopregnanti; e 5) Genotipizzazione e analisi di sequenza degli animali fondatori F0.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Tutte le cure e le procedure adottate in questo studio sono state effettuate secondo le regole e i regolamenti della Guida per la cura e l'uso degli animali da laboratorio. Il protocollo sperimentale è stato approvato dal Comitato per la cura degli animali di laboratorio degli animali dell'Università di Toyama, dell'Università di Tokyo, della Jichi University e del Max Planck Florida Institute for Neuroscience. Le informazioni su tutti i reagenti sono riportate nella Tabella dei Materiali.

1. Progettazione di reagenti CRISPR

  1. progettazione crRNA
    1. Visita CRISPR direct19 (https://crispr.dbcls.jp/) per progettare crRNA specifici con siti off-target ridotti.
      NOTA: Ci sono molti altri strumenti utili per progettare il crRNA20 (https://bioinfogp.cnb.csic.es/tools/wereview/crisprtools/).
    2. Inserire la sequenza di nucleotidi di destinazione e apportare le seguenti modifiche:
      Requisito di sequenza PAM - NGG
      Controllo di specificità - Mouse (Mus musculus) genoma, GRCm38/mm10 (dicembre 2011)
      NOTA: Ad esempio, per generare topi knockout di tirosinasi (Tyr), è stato preso di mira l'esonione 2 (sequenza di nucleotidi dal 9476 al 9692).
    3. Fare clic su Progettazionee, per hit altamente specifici, contrassegnare Mostra solo obiettivo altamente specifico.
    4. Per ridurre i potenziali effetti fuori target, scegliere la sequenza di destinazione con il valore più basso nelle colonne di "12 mer -PAM" e "8 mer -PAM".
      NOTA: in queste colonne, ("1") indica che la sequenza ha una sola corrispondenza perfetta con il sito di destinazione previsto e numeri maggiori di uno indicano la presenza di potenziali siti fuori target.
    5. Ordinare gli oligonucleotidi risultanti dalle società di sintesi crRNA (Tabella (Sommario 1).
      NOTA: per il gene exon 2 Tyr, è stata utilizzata la seguente sequenza di destinazione: GGACCACTATTACGTAATCC, con la sequenza PAM (Figura 2A).
  2. Progettazione di oligodeoxynucleotide (ssODN) a singolo filamento per esperimenti di editing mediati da HDR (ad esempio, generazione di topi knock-in).
    1. Progettare la lunghezza ssODN intorno 80-180 bp tra cui 30-60 braccia homology nucleotide (nt) su entrambi i lati.
      NOTA: Un ssODN di lunghezza 75-85 nt, tra cui un braccio di omologia 30-35 nt e complementare al gRNA, ha mostrato un'elevata efficienza di editing knock-in21.
    2. Inserire la modifica desiderata e la mutazione silenziosa nella sequenza PAM o, se non è possibile, alla base vicina 5' di PAM per bloccare la risostituzione dopo l'editing del genoma.
      NOTA: il crRNA e lo ssODN utilizzati in questo studio sono elencati nella Tabella supplementari 1.

2. Fecondazione in vitro, crioconservazione degli embrioni e scongelamento

  1. Fecondazione in vitro
    1. Superovulate C57BL/6J topi femminili (4 o 8 settimane) per iniezione ip con cavalla incinta gonadotropina (PMSG) seguita da iniezione con 7.5 IU gonadotropina colionica umana (hCG) dopo 48 h.
      NOTA: Il numero di ovociti ovulati può essere aumentato di circa 3 volte utilizzando ultra-superovulazione22.
    2. Rimuovere gli epididymidi cauda dai topi maschi C57BL/6J sessualmente maturi (3-5 mesi).
      NOTA: È possibile raccogliere spermatozoi senza sacrificare i topi maschi.
    3. Estrarre coaguli di spermatozoi con un ago dissettivo e incubarli in una goccia di 200 l di liquido toracico umano (HTF) in incubatrice di CO2 per 1,5 h per la covo.
    4. Raccogliere i complessi cumulo-ovociti (COC) dagli ovidotti 16-18 h dopo l'iniezione hCG e incubarli in una fresca goccia di 200 gradi di HTF media ricoperta di liquido di paraffina in un'incubatrice di CO2 (5% CO2, 37 gradi centigradi) per non più di 2 h.
      NOTA: È preferibile sacrificare i topi con lussazione cervicale in anestesia perché l'eutanasia tramite inalazione di CO2 colpisce lo sviluppo della fecondazione in vitro e dell'embrione23.
    5. Aggiungere 1-5 l di sospensione dello sperma dal contorno del mezzo di incubazione alla caduta di 200 gradi del mezzo HTF contenente COC e incubarli in un'incubatrice di CO2 per 3 h.
    6. Lavare gli ovociti con un supporto di ottimizzazione simplex integrato in potassio (KSOM) 3x per rimuovere le cellule rimanenti dello sperma e del cumulo.
    7. Controllare la formazione pronucleare e il grado di embrioni a una cellula utilizzando un microscopio invertito.
  2. Crioconservazione di embrioni unicellulari
    1. Incubare embrioni unicellulari in una goccia di 200 gradi di HTF contenente il 20% di FBS (non coperta da liquido di paraffina) per 10 min in un'incubatrice di CO2.
    2. Trasferire 20-100 embrioni a 50 -L di 1 M di solfuro dimetilo (DMSO) soluzione24.
    3. Trasferire 5 l-l di una soluzione contenente 100 embrioni nel fondo di un criotubo e raffreddarla per 5 min a 0 gradi centigradi utilizzando un refrigeratore o sul ghiaccio.
    4. Aggiungete lentamente 45 -L di DAP213 (2 M di solforo dimetilo, 1 M di acetamide e glicole propilene 3 M) lentamente lungo la parete del tubo, fate il tappo dei tubi e conservate per 5 min in un refrigeratore o sul ghiaccio a 0 gradi centigradi.
      NOTA: Non fissare i tappi troppo saldamente per rimuoverli facilmente durante lo scongelamento del campione.
    5. Conservare rapidamente i tubi in azoto liquido.
  3. Scongelamento dell'embrione
    1. Aprire il coperchio del criotubo, scartare l'azoto liquido rimanente e aggiungere 900 .
      NOTA: La soluzione di saccarosio da 0,25 M deve essere riscaldata a 37 gradi centigradi in anticipo perché l'uso della soluzione a freddo diminuisce la vitalità embrionale dopo lo scongelamento.
    2. Pipet rapidamente per 10x e trasferire il contenuto del criotubo in un piatto di plastica.
      NOTA: La pipettatura deve essere eseguita con attenzione, in modo che non vengano generate bolle e danni agli embrioni.
    3. Lavare gli ovociti concemi morfologicamente normali 2x nel mezzo KSOM coperti con liquido di paraffina e tenerli in un'incubatrice di CO2 fino all'elettroporazione.

3. Assemblaggio ed elettroporazione dei reagenti CRISPR

NOTA: Per l'elettroporazione, abbiamo usato un elettrodo a piastra platino (altezza: 0,5 mm, lunghezza: 10 mm, larghezza: 3 mm, gap: 1 mm) e un elettroporatore a un passo che sono stati descritti in precedenza8 (Tabella dei materiali). È possibile utilizzare anche un elettroporatore in due fasi (Tabella dei materiali).

  1. Preparazione e assemblaggio dei reagenti CRISPR
    1. Ordinare reagenti CRISPR (ad esempio, crRNA, tracrRNA e proteina Cas9) e ssODN se eseguono esperimenti di editing mediati da HDR (Tabella dei materiali e tabella supplementare 1).
    2. Preparare la soluzione di annessione come segue.
      1. Preparate 1 crRNA g/l e 1 g/tracrRNA nella soluzione Reduced-Serum Minimal Essential Medium (Tabella dei materiali) e aggiungete 6 l di ciascuna soluzione a 42 ll del buffer privo di nucleani.
      2. Incubare il composto nel riscaldatore asciutto a 95 gradi centigradi per 3 min e raffreddare a RT per 5 min.
      3. Preparate 1 proteina HiFi Cas9 diluita in Opti-MEM I e aggiungete 6 l alla miscela precedente per un volume totale di 60 .L.
      4. Nell'esecuzione di esperimenti di editing mediati dall'HDR, aggiungere 6 -L l di 1 ssODN. Poiché il volume finale dovrebbe essere di 60 gradi L, utilizzare 36 l'acqua senza nuclesino al punto 3.1.2.1.
        NOTA: La concentrazione finale di crRNA, tracrRNA, proteina Cas9 e ssODN sarà 100 ng/L.
      5. Trasferire fino a 100 embrioni a 25 gradi della miscela finale (complesso RNP) in un bicchiere da scivolo a un foro e incubarli a 37 gradi centigradi per 10 min.
  2. Elettroporazione
    1. Riempire il divario dell'elettrodo con 6 l'l della nuova miscela di reagenti CRISPR e aggiungere 20-25 embrioni alla miscela.
      NOTA: È importante evitare qualsiasi contatto tra gli embrioni e l'elettrodo di elettroporazione, che può danneggiare gli embrioni durante gli impulsi elettrici.
    2. Eseguire l'elettroporazione alle seguenti condizioni per un elettroporatore monofase:
      Tensione: 25 V, direzione dell'impulso (Pd)
      ON: 3 ms, OFF: 97 ms
      Ripetizioni: 5x
      NOTA: L'elettroporazione deve essere eseguita non più di 1 h dopo lo scongelamento per garantire che l'editing del genoma avvenga prima della prima replicazione del DNA per prevenire il mosaicismo.
    3. Per un elettroporatore di tipo in due fasi, impostare le condizioni come segue:
      Impulso di Poring 40V, Pd
      ON : 1 o 2,5 ms; Intervallo di impulsi: 50 ms
      Ripetizioni: 4x, Decadimento 10%

      Impulso di trasferimento - 5 o 7V; P.A. N. /-.
      ON: 50 ms; Intervallo di impulsi: 50 ms.
      Ripetizioni : 5x; Decadimento - 40%.
      NOTA: È importante regolare il volume per mantenere l'impedito all'interno dell'intervallo specifico specificato dal produttore.
    4. Lavare gli embrioni 3x con krebs-Ringer Bicarbonate Buffer 2 (M2) misura modificata seguita da due lavaggi con una goccia di mezzo KSOM coperto con liquido di paraffina.
    5. Incubare gli embrioni lavati (nel mezzo KSOM) in un'incubatrice di CO2 durante la notte per ulteriori trapianti.

4. Trasferimento dell'embrione

  1. Preparare topi femminili pseudopregnanti. Mate i topi femmina ICR (3-6 mesi) con topi maschi vasectomizzati 1 giorno prima del trasferimento dell'embrione (ET).
    NOTA: I mouse devono essere controllati la mattina successiva per una spina copulatoria. I topi con una spina sono considerati pseudopregnanti e possono essere utilizzati per ET.
  2. Aria aspirata e KSOM (senza liquido di paraffina) a intervalli alternati di 2-3 mm in un capillare di vetro come marcatore per il successo dell'impianto.
  3. Introdurre 20-24 embrioni in una goccia di KSOM (senza liquido di paraffina) e disegnare 10-12 embrioni nel capillare del vetro per l'impianto in ogni ovidotto.
  4. Anestesizzare i topi femminili mediante isoflurane (inalazione) o un'iniezione IP di una soluzione che combina medetomidine/midazolam/butorphanol (0,3 mg/kg, 4,0 mg/kg rispettivamente). Posizionare il topo anetizzato sul suo lato ventrale su una piastra di riscaldamento. Proteggere gli occhi del topo anetizzato con un gel idratante.
  5. Rasare lungo la parte inferiore della linea mediana dorsale e disinfettare l'area con iodio povidone seguita da con 70% di etanolo.
  6. Fai una lunga incisione di 1 cm parallela alla linea mediana dorsale.
  7. Estrarre l'olitdotto e posizionare su un drappo di plastica sterile. Mantenere umido utilizzando calda sterile salina.
  8. Posizionare l'ovidotto sotto il microscopio stereoscopico.
  9. Fare un buco nella parete dell'ovulo tra l'infundibulum e ampulla pochi millimetri a monte dell'ampulla da forbici a micromolla.
  10. Inserire la punta del vetro capillare contenente gli embrioni nel foro e soffiare delicatamente nel boccaglio del portavoce capillare per espellere gli embrioni fino a quando una bolla d'aria è visibile nell'ampulla.
    NOTA: Trasferimento tra 10-12 embrioni per ovidotto.
  11. Ritirare il vetro capillare dalla parete dell'ovidotto e spingere delicatamente l'organo riproduttivo nella cavità del corpo.
  12. Ripetere il processo precedente per introdurre gli embrioni nell'altro ovidotto.
  13. Dopo aver completato la procedura ET, suturare il peritoneo con un semplice motivo di sutura interrotta (50, suture sintetiche intrecciate e assorbenti) e poi la pelle con un semplice motivo interrotto o un modello di punto subcuticolare sepolto (60 suture monosintetiche non assorbibili).
  14. Tenere il topo caldo su una piastra di riscaldamento di 37 gradi centigradi fino a quando non si riprende dall'anestesia.
  15. Monitorare la salute dell'animale ogni giorno per 7 giorni dopo l'intervento chirurgico.

5. Genotipizzazione e analisi delle sequenze

  1. Estrazione genomica del DNA
    NOTA: Abbiamo usato kit di estrazione del DNA del tessuto NucleoSpin per estrarre il DNA genomico dal tessuto dell'orecchio dei topi seguendo le raccomandazioni del produttore.
    1. Aggiungete al campione 180 l l di Buffer T1 e 25 ll di soluzione Proteinase K e mescolate vortice vortice per 10 s.
    2. Incubare a 56 gradi centigradi per 2 h o fino a ottenere una lisi completa. Vortice per 10 s ogni 30 min dell'incubazione.
    3. Aggiungere 200 l di Buffer B3, vortice vigorosamente per 30 s, e incubare a 70 gradi C per 10 min.
    4. Aggiungere 110 L di 100% etanolo al campione e vortice vigorosamente.
    5. Per ogni campione, inserire una colonna di tessuto in un tubo di raccolta e applicare il campione alla colonna.
    6. Centrifuga per 1 min a 11.000 x g, scartare il flusso attraverso e posizionare nuovamente la colonna nel tubo di raccolta.
    7. Aggiungete 500 l of Buffer BW per lavare il campione (primo lavaggio), centrifugare per 1 min a 11.000 x g, scartare il flusso e riposizionare la colonna nel tubo di raccolta.
    8. Aggiungete 600 l di Buffer B5 alla colonna (secondo lavaggio), centrifugate per 1 min a 11.000 x g,scartate il flusso e collocate nuovamente la colonna nel tubo di raccolta.
    9. Centrifugare la colonna per 1 min a 11.000 x g per asciugare la membrana di silice e posizionare la colonna di tessuto NucleoSpin in un tubo di microcentrifuga da 1,5 mL.
    10. Aggiungere 100 l di Buffer BE, incubare a temperatura ambiente per 1 min, quindi centrifugare 1 min a 11.000 x g.
  2. Amplificazione e purificazione PCR
    1. Progettare i primer utilizzando il sito web primer3 plus (https://primer3plus.com/) al fine di amplificare una sequenza di 400-500 bp che circonda il locus mirato.
    2. Progettare un nuovo protocollo PCR e testarlo empiricamente.
    3. Purificare il prodotto PCR per rimuovere gli enzimi indesiderati, i nucleotidi, i primer e i componenti tamponati. Un metodo di purificazione standard può essere utilizzato come segue.
      1. Aggiungere da 50 a 50 l di prodotti PCR e mescolare vortice.
      2. Centrifuga per 1 min a 11.000 x g e trasferire lo strato trasparente superiore in un nuovo tubo.
      3. Aggiungere 120 -L di 99,5% di etanolo e 20 di 5 M di acetato di ammonio e vortice per 30 s.
      4. Conservare a RT per 10 min e centrifugare a 11.000 x g per 10 min.
      5. Scartare il supernatante e lavare il pellet di DNA con 1 mL del 70% di etanolo.
      6. Asciugare il pellet a RT per 10 min e sciogliere in 10 litri di acqua libera da RNase.
        NOTA: i kit di purificazione basati su colonne PCR vengono ricommentati perché il fenolo è tossico per gli esseri umani.
  3. Sequenziamento di Sanger
    1. Eseguire l'analisi della quantificazione del DNA (cfr. tabella dei materiali)per quantificare l'amplificatore PCR purificato.
    2. Inviare prodotti PCR e primer di sequenziamento a un provider di servizi di sequenziamento.
    3. Analizzare la sequenza utilizzando i siti Web online disponibili.
      NOTA: In questo studio, CRISP-ID25 (http:/crispid.gbiomed.kuleuven.be/) è stato utilizzato per l'analisi della sequenza.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Il nostro metodo modificato per la crioconservazione degli embrioni a una cellula, compresa l'incubazione in HTF contenente il 20% di FBS per 10 min seguita dalla crioconservazione in 1 M Soluzione DMSO e DAP213, ha migliorato il tasso di sviluppo degli embrioni con gelo nello stadio a due cellule (Figura 1, p , 0,009, test t di Student). Gli embrioni con congelamento sono stati utilizzati per la produzione di topi GM e le condizioni di elettroporazione sono state ottimizzate: cinque ripetizioni di 25 V con impulsi a 3 ms e intervalli di 97 ms utilizzando un elettroporatore come descritto nella sezione Protocollo. L'applicabilità del protocollo è stata verificata mediante generazione di topi albino tirosinasi (Tyr) (Figura 2). A tale scopo, è stato progettato il targeting gRNA esone 2 (Figura 2A) e sono stati preparati reagenti CRISPR come descritto nella sezione Protocollo. Gli strumenti di editing sono stati elettropotizzati entro 1 h dallo scongelamento dell'embrione per garantire che l'editing del genoma si verificasse prima della prima replicazione del genoma e quindi impedisse il mosaicismo nei fondatori (Figura 2B). Tutti i topi generati erano albini, e solo un mouse era mosaico, con un cappotto con macchie bianche e nere (Figura 2C). Tutti i topi albini che ospitano due diversi alleli mutanti (mutazione eterozigoa) tranne un topo che ospita un solo allele (mutazione omozice) sono mostrati nella Figura 2E. Si può concludere che il nostro metodo può fornire un'efficienza di editing di vicino al 100% con un basso tasso di mosaico come confermato dall'analisi di sequenziamento così come il colore del cappotto (Figura 2CE).

Successivamente, la riproducibilità del protocollo è stata verificata dalla generazione di diverse linee di topi knockout e knock-in. Come mostrato nella Tabella 1, il protocollo può generare topi knockout e knock-in con alta efficienza e bassi tassi di mosaico. La maggior parte dei topi F0 generati sono stati accoppiati con topi di tipo selvaggio C57BL/6J per confermare la trasmissione germinale di alleli mutanti alle generazioni di F1. Come previsto, tutti i figli di F1 dei topi omozici F0 erano eterozigosi, contenenti un allele mutante e un allele di tipo selvaggio. Non sono state osservate mutazioni disparate tra la genotipizzazione dei fondatori e le loro generazioni. Il protocollo descritto ha generato mouse GM in breve tempo (ad es. 4 settimane) come illustrato nel flusso di lavoro del protocollo in Figura 3.

Figure 1
Figura 1: Il siero bovino fetale (FBS) ha migliorato il tasso di sviluppo dello stadio a due cellule degli embrioni congelato. Il numero di embrioni di FBS è stato di 286 (l'esperimento è stato ripetuto 3x), e il numero di embrioni FBS era 272 (l'esperimento è stato ripetuto 3x). I dati sono presentati come media : SEM. Questa cifra è riprodotta da Darwish M et al.16 con il permesso. Fare clic qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2: Generazione di topi knockout Tyr con elevata efficienza e basso tasso di mosaico. Questa cifra è stata modificata da Darwish M etal. 16 con il permesso. (A) Illustrazione schematica che mostra il design del gRNA. La sequenza PAM viene visualizzata in rosso. (B) Illustrazione che mostra i tempi di elettroporazione per gli embrioni concongelamento, il simbolo giallo rappresenta il tempo di elettroporazione. (C) Immagini rappresentative dei topi knockout Tyr generati. (D) Analisi della sequenza dei diversi alleli dei topi knockout Tyr. La sequenza bersaglio è etichettata in rosso e i trattini indicano la delezione dei nucleotidi negli alleli mutanti. WT - tipo selvaggio M - allele mutante. (E) Una parte rappresentativa del cromatogramma del topo albino contenente l'allele M1 è mostrata in D. Si prega di fare clic qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3: Flusso di lavoro del protocollo per la generazione di mouse GM. Il primo passo è stata la preparazione di embrioni crioconservati. Le femmine di topi C57BL/6J sono state superovulate, prima per iniezione di PMSG, poi 48 h più tardi per iniezione di hCG. I COC sono stati raccolti 16 h più tardi e sottoposti a fecondazione in vitro con spermatozoi raccolti da topi maschi C57BL/6J. Gli ovociti fecondati sono stati crioconservati e conservati in azoto liquido fino a quando necessario. Il secondo passo includeva lo scongelamento degli embrioni e l'elettroporazione. Gli embrioni crioconservati sono stati sconlorosi e i reagenti CRISPR (ad esempio, tracrRNA, crRNA e proteina Cas9) sono stati assemblati ed elettropotati entro 1 h dopo lo scongelamento degli embrioni. Il terzo passo comprendeva il trasferimento di embrioni e la nascita di topi. Il giorno dopo l'elettroporazione, gli embrioni a due cellule sono stati trasferiti all'ovidotto di topi femminili pseudopregnanti per generare topi geneticamente modificati che sono stati successivamente genotati utilizzando Sanger sequenziamento per confermare l'efficienza di editing. Il tempo e lo sforzo necessari per preparare gli ovociti fecondati prima di ogni esperimento (passaggio 1) possono essere ridotti se un gran numero di embrioni crioconservati viene preparato in anticipo. Questa cifra è adattata da Darwish M et al.16Clicca qui per vedere una versione più grande di questa figura.

Topi mutanti Embrioni elettropotati Embrioni a 2 celle Embrioni trasferiti Pup (%) Topi mutanti(%) No di topi a mosaico
Tyr KO 124 84 48 12 (25) 100 1
Glrb KO 151 94 40 6 (15) 100 0
Slc39a6 KO 48 25 25 5 (20) 100 0
Borsa3 KI 233 84 20 3 (15) 50 1
Camk2a KI 124 70 70 14 (20) 64.3 0

Tabella 1: Produzione di diverse linee di topi GM che utilizzano embrioni con gelate di fondo C57BL/6J.

Tabella supplementare 1. Fare clic qui per scaricare questa tabella.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Il protocollo descritto consente la generazione di topi GM ad alta efficienza e bassi tassi di mosaico (Tabella 1). Consente ai ricercatori privi di avanzate capacità di manipolazione degli embrioni di creare facilmente topi mutanti perché sfruttano i progressi più recenti e più utili nelle tecnologie di ingegneria riproduttiva e di editing del genoma: ribonucleoproteina CRISPR/Cas9 (RNP) ed elettroporazione in embrioni concongelamento. Questi progressi hanno facilitato e accelerato la generazione dei topi GM. Come descritto nella Figura 3, sono necessarie 4 settimane per generare i mouse GM. Rispetto ad altri protocolli che utilizzano approcci simili26, il nostro metodo è superiore in termini di efficienza, tasso di natalità e mosaicismo.

L'incubazione di embrioni unicellulari in FBS prima della crioconservazione è fondamentale per migliorare il tasso di sviluppo degli embrioni. Le condizioni di elettroporazione degli embrioni crioconservati, descritte nel Protocollo, consentono un compromesso tra l'efficienza di editing dei reagenti CRISPR e la sopravvivenza degli embrioni. In effetti, condizioni più dure o più lievi possono influenzare il tasso di sviluppo degli embrioni e l'efficienza di modifica, rispettivamente16. La tempistica dell'elettroporazione (Figura 2B) è fondamentale per superare il mosaicismo nei fondatori e garantire che la modificazione del genoma avvenga in presenza di soli due alleli. Questo è coerente con i rapporti precedenti che mostrano che l'elettroporazione in fase iniziale potrebbe produrre mutanti non mosaici17. Inoltre, l'uso di RNP al posto di gRNA/mRNA diminuisce la velocità del mosaico e migliora l'efficienza di editing17.

Il protocollo descritto presenta diversi vantaggi. In primo luogo, genera i topi mutanti in breve tempo (4 settimane). In secondo luogo, si tratta di un protocollo altamente efficiente e robusto; sono state generate diverse linee di topi knockout (KO) e knock-in (KI) con alti tassi di mutazione (KO - 100%, KI - 50-64,3%). In terzo luogo, è conveniente e conveniente. L'uso di crRNA sintetico completo, tracrRNA, ssODN e proteina Cas9 elimina la necessità di una noiosa preparazione dei vettori Cas9 e nella trascrizione vitro. Al contrario, consente ai ricercatori di utilizzare semplicemente reagenti commerciali e attrezzature standard. In quarto luogo, non utilizza la microiniezione, che richiede elevate competenze tecniche. In quinto luogo, riduce il mosaicismo nei fondatori, e porta così a una trasmissione germinale più efficiente degli alleli modificati, superando la complicata analisi genotipica dei topi a mosaico. Infine, questo protocollo è efficiente con il ceppo inbred C57BL/6J, che evita l'uso di ibridi F1, e quindi la necessità di eseguire numerosi backcross per sbarazzarsi della complessità genetica. La genotipizzazione delle generazioni di F1 ha confermato l'accurata trasmissione germinale. Tuttavia, non è consigliabile studiare i fenotipi dei topi F0 a causa della complessità allele e la previsione fuorviante della genotipizzazione della generazione successiva estrapolata dalla genotipizzazione dei fondatori F014,27.

È di primaria importanza sfruttare l'uso degli embrioni con congelamento nella modifica del genoma di primati non umani e di animali di grandi dimensioni come suini e pecore, che non sempre sono prontamente disponibili. I metodi di congelamento degli embrioni variano notevolmente a seconda delle specie animali. Pertanto, riteniamo che il nostro protocollo di crioconservazione possa essere applicabile solo ai topi. D'altra parte, il nostro protocollo è potenzialmente applicabile per utilizzare nucleasi di ingegneria diversi da Cas9 per la generazione di topi GM, perché l'elettroporazione è stata precedentemente segnalata per introdurre altre nucleasi come Cas12a nell'embrione in modo efficiente28,29.

Una limitazione del protocollo è la precisa integrazione di un lungo transgene nel genoma, che è considerato difficile nei protocolli basati sull'elettroporazione. Tuttavia, è stata riportata una potenziale soluzione: l'integrazione di transgeni fino a 4,9 Kb nel genoma del topo è stata eseguita con successo combinando l'elettroporazione con un sistema di erogazione di donatori HDR mediato da virus adeno (AAV)30, confermando una precedente pubblicazione31. Inoltre, il potenziale verificarsi di effetti collaterali fuori bersaglio è una delle principali preoccupazioni con l'uso della tecnologia CRISPR/Cas9. Non abbiamo eseguito il sequenziamento dell'intero genoma dei topi modificati per escludere il potenziale effetto fuori bersaglio. Tuttavia, abbiamo utilizzato strumenti CRISPR che sono stati segnalati per ridurre l'effetto off-target, come RNP32. Inoltre, abbiamo utilizzato una variante Cas9 ad alta fedeltà che riduce significativamente l'editing off-target senza sacrificare le prestazioni sul target33. Inoltre, abbiamo progettato gRNA utilizzando il software CRISPRdirect (https://crispr.dbcls.jp), che dovrebbe risultare in sequenze di destinazione con siti off-target ridotti al minimo19. Per confermare la causalità genotipo-fenotipo e alleviare le preoccupazioni sugli effetti fuori bersaglio, i ricercatori dovrebbero generare diversi topi modificati dello stesso genotipo utilizzando gRNA diversi o eseguire il backcrossing dei topi generati per diverse generazioni.

I topi knockout generati utilizzando il meccanismo NHEJ e le mutazioni frameshift sono stati ampiamente utilizzati e mostrano fenotipi pertinenti. Tuttavia, la proteina residua troncata può esistere a causa della reinitizione di traduzione o del salto dell'esone modificato34,35. Pertanto, per interpretare con precisione i fenotipi, è necessaria la caratterizzazione della funzione o dell'espressione della proteina residua. La generazione di topi knockout genici completi che utilizzano più di un gRNA sarebbe una buona alternativa. Tuttavia, occorre prestare particolare attenzione per confermare che il gene non contiene regioni introiche trascritte agli RNA non codificanti, che potrebbero avere funzioni regolatorie e quindi complicare l'analisi fenotipica.

In questo studio, mostriamo un semplice protocollo con il quale molti ricercatori possono generare topi geneticamente modificati in 4 settimane o meno. Combinando l'uso di embrioni congelato ed elettroporazione, renderemo la preparazione di modelli murini di malattie umane facile, veloce ed efficiente.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno informazioni finanziarie rilevanti.

Acknowledgments

Ringraziamo Hitomi Sawada ed Elizabeth Garcia per la cura degli animali. Questo lavoro è stato supportato da KAKENHI (15K20134, 17K11222, 16H06276 e 16K01946) e Hokugin Research Grant (a H.N.), e dal Jichi Medical University Young Investigator Award (per H.U.). La Otsuka Toshimi Scholarship Foundation ha sostenuto M.D.

Materials

Name Company Catalog Number Comments
0.25 M Sucrose ARK Resource Co., Ltd. (Kumamoto, Japan) SUCROSE
1 M DMSO ARK Resource Co., Ltd. (Kumamoto, Japan) 1M DMSO
Butorphanol Meiji Seika Pharma Co., Ltd. (Tokyo, Japan) Vetorphale 5mg
Cas9 protein: Alt-R® S.p. HiFi Cas9 Nuclease 3NLS Integrated DNA Technologies, Inc. (Coralville, IA) 1081060
C57BL/6J mice Japan SLC (Hamamatsu, Japan) N/A
DAP213 ARK Resource Co., Ltd. (Kumamoto, Japan) DAP213
FBS Sigma-Aldrich, Inc. (St. Louis, MO) ES-009-C
hCG MOCHIDA PHARMACEUTICAL CO., LTD (Tokyo, Japan) HCG Mochida 3000
HTF ARK Resource Co., Ltd. (Kumamoto, Japan) HTF
ICR mice Japan SLC (Hamamatsu, Japan) N/A
Isoflurane Petterson Vet Supply, Inc. (Greeley, CO) 07-893-1389
KSOM ARK Resource Co., Ltd. (Kumamoto, Japan) KSOM
LN2 Tank Chart Industries (Ball Ground, GA) XC 34/18
M2 ARK Resource Co., Ltd. (Kumamoto, Japan) M2
Medetomidine Nippon Zenyaku Kogyo Co.,Ltd. (Koriyama, Japan) 1124401A1060
Microscope Nikon Co. (Tokyo, Japan) SMZ745T
Midazolam Sandoz K.K. (Tokyo, Japan) 1124401A1060
Nuclease free buffer Integrated DNA Technologies, Inc. (Coralville, IA) 1072570
Nucleospin DNA extraction kit Takara Bio Inc (Kusatsu, Japan) 740952 .5
One-hole slide glass Matsunami Glass Ind., Ltd. (Kishiwada, Japan) S339929
One-step type Electroporator BEX Co., Ltd. (Tokyo, Japan) CUY21EDIT II
Paraffin Liquid NACALAI TESQUE Inc. (Kyoto, Japan) SP 26137-85
Platinum plate electrode BEX Co., Ltd. (Tokyo, Japan) LF501PT1-10, GE-101
PMSG ASKA Animal Health Co., Ltd (Tokyo, Japan) SEROTROPIN 1000
Povidone iodide Professional Disposables International, Inc. (Orangeburg, NY) C12400
Reduced-Serum Minimal Essential Medium: OptiMEM I Sigma-Aldrich, Inc. (St. Louis, MO) 22600134
Two-step type Electroporator Nepa Gene Co., Ltd. (Ichikawa, Japan) NEPA21

DOWNLOAD MATERIALS LIST

References

  1. Wang, H., et al. One-step generation of mice carrying mutations in multiple genes by CRISPR/cas-mediated genome engineering. Cell. 153, (4), 910-918 (2013).
  2. Jinek, M., et al. A programmable dual-RNA - guided DNA endonuclease in adaptive bacterial immunity. Science. 337, (6096), 816-822 (2012).
  3. Mali, P., et al. RNA-guided human genome engineering via Cas9. Science. 339, (6121), 823-826 (2013).
  4. Cong, L., et al. Multiplex genome engineering using CRISPR/VCas systems. Science. 339, (6121), 819-823 (2013).
  5. Doudna, J. A., Charpentier, E. The new frontier of genome engineering with CRISPR-Cas9. Science. 346, (6213), 1258096 (2014).
  6. Mashiko, D., et al. Generation of mutant mice by pronuclear injection of circular plasmid expressing Cas9 and single guided RNA. Scientific Reports. 3, 3355 (2013).
  7. Yen, S. T., et al. Somatic mosaicism and allele complexity induced by CRISPR/Cas9 RNA injections in mouse zygotes. Developmental Biology. 393, (1), 3-9 (2014).
  8. Kaneko, T., Mashimo, T. Simple genome editing of rodent intact embryos by electroporation. PLoS ONE. 10, (11), 1-7 (2015).
  9. Qin, W., et al. Efficient CRISPR/cas9-mediated genome editing in mice by zygote electroporation of nuclease. Genetics. 200, (2), 423-430 (2015).
  10. Kaneko, T., Sakuma, T., Yamamoto, T., Mashimo, T. Simple knockout by electroporation of engineered endonucleases into intact rat embryos. Scientific Reports. 4, 6382 (2014).
  11. Hashimoto, M., Takemoto, T. Electroporation enables the efficient mRNA delivery into the mouse zygotes and facilitates CRISPR/Cas9-based genome editing. Scientific Reports. 5, 11315 (2015).
  12. Chen, S., Lee, B., Lee, A. Y. F., Modzelewski, A. J., He, L. Highly efficient mouse genome editing by CRISPR ribonucleoprotein electroporation of zygotes. Journal of Biological Chemistry. 291, (28), 14457-14467 (2016).
  13. Modzelewski, A. J., et al. Efficient mouse genome engineering by CRISPR-EZ technology. Nature Protocols. 13, (6), 1253-1274 (2018).
  14. Teixeira, M., et al. Electroporation of mice zygotes with dual guide RNA/Cas9 complexes for simple and efficient cloning-free genome editing. Scientific Reports. 8, 474 (2018).
  15. Nakagawa, Y., et al. Production of knockout mice by DNA microinjection of various CRISPR/Cas9 vectors into freeze-thawed fertilized oocytes. BMC Biotechnology. 15, (1), 1-10 (2015).
  16. Darwish, M., et al. Rapid and high-efficient generation of mutant mice using freeze-thawed embryos of the C57BL/6J strain. Journal of Neuroscience Methods. 317, 149-156 (2019).
  17. Hashimoto, M., Yamashita, Y., Takemoto, T. Electroporation of Cas9 protein/sgRNA into early pronuclear zygotes generates non-mosaic mutants in the mouse. Developmental Biology. 418, (1), 1-9 (2016).
  18. Sakamoto, W., Kaneko, T., Nakagata, N. Use of frozen-thawed oocytes for efficient production of normal offspring from cryopreserved mouse spermatozoa showing low fertility. Comparative Medicine. 55, (2), 136-139 (2005).
  19. Naito, Y., Hino, K., Bono, H., Ui-Tei, K. CRISPRdirect: Software for designing CRISPR/Cas guide RNA with reduced off-target sites. Bioinformatics. 31, (7), 1120-1123 (2015).
  20. Torres-Perez, R., Garcia-Martin, J. A., Montoliu, L., Oliveros, J. C., Pazos, F. WeReview: CRISPR Tools-Live Repository of Computational Tools for Assisting CRISPR/Cas Experiments. Bioengineering. 6, (3), 63 (2019).
  21. Okamoto, S., Amaishi, Y., Maki, I., Enoki, T., Mineno, J. Highly efficient genome editing for single-base substitutions using optimized ssODNs with Cas9-RNPs. Scientific Reports. 9, 4811 (2019).
  22. Takeo, T., Nakagata, N. Superovulation using the combined administration of inhibin antiserum and equine chorionic gonadotropin increases the number of ovulated oocytes in C57BL/6 female mice. PLoS ONE. 10, (5), 1-11 (2015).
  23. Wuri, L., Agca, C., Agca, Y. Euthanasia via CO2 inhalation causes premature cortical granule exocytosis in mouse oocytes and influences in vitro fertilization and embryo development. Molecular Reproduction and Development. 86, (7), 825-834 (2019).
  24. Nakagata, N. High survival rate of unfertilized mouse oocytes after vitrification. Journal of Reproduction and Fertility. 87, (2), 479-483 (1989).
  25. Dehairs, J., Talebi, A., Cherifi, Y., Swinnen, J. V. CRISP-ID: Decoding CRISPR mediated indels by Sanger sequencing. Scientific Reports. 6, 28973 (2016).
  26. Nakagawa, Y., Sakuma, T., Takeo, T., Nakagata, N., Yamamoto, T. Electroporation-mediated genome editing in vitrified/warmed mouse zygotes created by ivf via ultra-superovulation. Experimental Animals. 67, (4), 535-543 (2018).
  27. Nakajima, K., Nakajima, T., Takase, M., Yaoita, Y. Generation of albino Xenopus tropicalis using zinc-finger nucleases. Development Growth and Differentiation. 54, (9), 777-784 (2012).
  28. Hur, J. K., et al. Targeted mutagenesis in mice by electroporation of Cpf1 ribonucleoproteins. Nature Biotechnology. 34, 807-808 (2016).
  29. Dumeau, C. E., et al. Introducing gene deletions by mouse zygote electroporation of Cas12a/Cpf1. Transgenic Research. 28, (5-6), 525-535 (2019).
  30. Chen, S., et al. CRISPR-READI: Efficient Generation of Knockin Mice by CRISPR RNP Electroporation and AAV Donor Infection. Cell Reports. 27, (13), 3780-3789 (2019).
  31. Mizuno, N., et al. Intra-embryo Gene Cassette Knockin by CRISPR/Cas9-Mediated Genome Editing with Adeno-Associated Viral Vector. iScience. 9, 286-297 (2018).
  32. Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. Highly Efficient RNA-guide genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Research. 24, (6), 1012-1019 (2014).
  33. Vakulskas, C. A., et al. A high-fidelity Cas9 mutant delivered as a ribonucleoprotein complex enables efficient gene editing in human hematopoietic stem and progenitor cells. Nature Medicine. 24, (8), 1216-1224 (2018).
  34. Rodriguez-Rodriguez, J. A., et al. Distinct Roles of RZZ and Bub1-KNL1 in Mitotic Checkpoint Signaling and Kinetochore Expansion. Current Biology. 28, (21), 3422-3429 (2018).
  35. Smits, A. H., et al. Biological Plasticity Rescues Target Activity in CRISPR Knockouts. Nature Methods. 16, 1087-1093 (2019).
Uso di embrioni congelati per la produzione ad alta efficienza di topi geneticamente modificati
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Nishizono, H., Darwish, M., Uosaki, H., Masuyama, N., Seki, M., Abe, H., Yachie, N., Yasuda, R. Use of Freeze-thawed Embryos for High-efficiency Production of Genetically Modified Mice. J. Vis. Exp. (158), e60808, doi:10.3791/60808 (2020).More

Nishizono, H., Darwish, M., Uosaki, H., Masuyama, N., Seki, M., Abe, H., Yachie, N., Yasuda, R. Use of Freeze-thawed Embryos for High-efficiency Production of Genetically Modified Mice. J. Vis. Exp. (158), e60808, doi:10.3791/60808 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter