Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

유전자 변형 마우스의 고효율 생산을 위한 동결 해동 배아 사용

doi: 10.3791/60808 Published: April 2, 2020
* These authors contributed equally

Summary

여기에서, 우리는 1 세포 배아의 동결 보존을 위한 수정된 방법 뿐만 아니라 유전자 변형 마우스의 효율적인 생성을 위한 동결 해동 된 배아 및 전기 천공의 사용을 결합하는 프로토콜을 제시한다.

Abstract

유전자 변형 (GM) 마우스의 사용은 유전자 기능을 이해하고 인간 질병의 기본 메커니즘을 해독하는 데 중요해졌습니다. CRISPR/Cas9 시스템을 통해 연구자들은 전례 없는 효율성, 충실도 및 단순성으로 게놈을 수정할 수 있습니다. 이 기술을 활용하여 연구원들은 GM 마우스를 생성하기 위한 신속하고 효율적이며 쉬운 프로토콜을 찾고 있습니다. 여기에서 우리는 동결 해동 된 배아의 더 높은 발달 속도로 이어지는 1 세포 배아의 냉동 보존을위한 개선 된 방법을 소개합니다. 최적화된 전기 천공 조건과 결합함으로써 이 프로토콜은 짧은 시간 내에 고효율 및 낮은 모자이크 비율로 녹아웃 및 노크인 마우스를 생성할 수 있게 합니다. 또한, 우리는 CRISPR 시약 준비, 체외 수정, 동결 보존 및 1 세포 배아의 동결 보존 및 해동, CRISPR 시약의 전기 천공, 마우스 생성 및 설립자의 게놈을 포함하는 최적화 된 프로토콜에 대한 단계별 설명을 보여줍니다. 이 프로토콜을 사용 하 여, 연구원은 비교할 수 없는 용이성 GM 마우스를 준비 수 있어야, 속도, 그리고 효율성.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

클러스터된 정기적으로 간격을 두는 짧은 palindromic 반복 (CRISPR)/CRISPR 관련 단백질 9 (Cas9) 시스템은 게놈1에있는 전례 없는 표적으로 한 수정을 제공하는 과학적인 돌파구입니다. CRISPR/Cas9 시스템은 Cas9 단백질과 가이드 RNA(gRNA)와 표적 특이적 CRISPR RNA(crRNA) 및 트랜스 활성화 CRISPR RNA(트라크RNA)2로 구성됩니다. gRNA는 Cas9 단백질을 게놈내의 특이적 궤적, 20개의 뉴클레오티드가 crRNA에 상보적이며, 프로토스페이서 인접 모티프(PAM)에 인접하여 지시한다. Cas9 단백질은 표적 서열에 결합하고 오류가 발생하기 쉬운 비동동성 단부 접합(NHEJ) 또는 고충실도 상동성 상동성 수리(HDR)3,,4,,5에의해 수리되는 이중 가닥 파손(DSB)을 유도합니다. NHEJ는 삽입 및 /및 삭제 (indels)로 이어지며, 따라서 코딩 서열이 표적화 될 때 기능의 유전자 손실로 이어집니다. HDR은 상동성 서열을 포함하는 복구 템플릿의 존재에 정확한 게놈 편집에 이르게3,,4,,5. NHEJ와 HDR은 각각 녹아웃 및 노크 인 마우스를 생성하기 위해 활용되었습니다.

CRISPR/Cas9 시스템은 뛰어난 효능과 충실도를 갖춘 GM 마우스의 생성을 현저히 가속화했지만, 이러한 방법을 적용하는 과학자들은 종종 기술적 인 과제를 겪습니다. 첫째, 종래의 프로토콜은 수정란6,,7의프로핵에 CRISPR 편집 도구를 도입하기 위한 미세 주입이 필요하다. 이 기술은 시간이 많이 걸리며 일반적으로 광범위한 교육이 필요합니다. 따라서 여러 그룹이 미세 주입을 전기 천공8,,9,10,,11,12,13으로대체했습니다. 그러나, 초기 전기 천공 프로토콜에서 신선한 배아는 전기 천공에 사용되었다. 이는 각 실험 전에 신선한 배아를 준비하는 것이 어렵기 때문에 또 다른 문제를 일으켰다14.

최근 우리및 다른 사람들은 동결해동배아의 사용을 결합하여 게놈 편집을 위한 전기포공화, 이는 GM마우스(15,,16)의생성을 용이하게 한다. 이 프로토콜은 고급 배아 조작 기술이없는 연구원이 고효율로 인간 질병의 동물 모델을 신속하게 생성 할 수 있게합니다. 이 프로토콜은 또한 설립자16에서유전적 이질성과 같은 GM 마우스 생성에 대한 실질적인 과제를 현저히 감소시킨다. 모자이크주의를 극복하기 위해, 우리는 게놈의 첫 번째 복제 전에 편집이 발생하는지 확인하기 위해 배아 해동 후 1 시간 이내에 CRISPR 시약의 전기 천공을 수행합니다. 또 다른 개선은 바람직하지 않은 모자이크주의를 감소시키기 위해 Cas9 mRNA 대신 Cas9 단백질의 사용을 포함한다17. 또한, 우리는 2 세포 단계16에발달 속도를 증가시키는 1 세포 배아 동결 보존을위한 최적의 방법을 개발 : 태아 소 혈청 (FBS)의 사용은 극적으로 수정 후 동결 해동 oocytes의 생존을 향상, 아마도 동결 해동 비 수정 oocytes더탄력18을만드는 동일한 메커니즘에 의해.

여기에서 우리는 1 세포 C57BL/6J 배아의 동결 보존을 위한 수정된 방법을 포함하여 동결 해동 된 배아를 사용하여 GM 마우스의 생성을 위한 포괄적인 프로토콜을 제시합니다. 여기에는 1) gRNA 설계, CRISPR 시약 제제 및 조립이 포함됩니다. 2) IVF, 동결 보존, 및 1 세포 배아의 해동; 3) CRISPR 시약의 전기 화동결 해동 배아; 4) 가성 임신 한 여성 마우스의 난관으로 배아 전달; 및 5) F0 설립자 동물의 게노티핑 및 서열 분석.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

이 연구에서 수행된 모든 동물 관리 및 절차는 실험실 동물의 관리 및 사용을 위한 가이드의 규칙 및 규정에 따라 수행되었습니다. 실험 프로토콜은 도야마 대학, 도쿄 대학, 지치 대학, 맥스 플랑크 플로리다 신경 과학 연구소의 실험실 동물의 동물 관리위원회에 의해 승인되었습니다. 모든 시약에 대한 정보는 재료 표에표시되어 있습니다.

1. CRISPR 시약 설계

  1. crRNA 디자인
    1. CRISPR 다이렉트19 19(https://crispr.dbcls.jp/)를 방문하여 오프타겟 사이트가 줄어든 특정 crRNA를 설계합니다.
      참고: crRNA 20(https://bioinfogp.cnb.csic.es/tools/wereview/crisprtools/)을20 디자인하는 다른 많은 유용한 도구가 있습니다.
    2. 표적 뉴클레오티드 서열을 삽입하고 다음과 같은 변경을 수행합니다.
      PAM 시퀀스 요구 사항 = NGG
      특이성 검사 = 마우스 (무스 근육) 게놈, GRCm38 / mm10 (2011 년 12 월)
      참고: 일례로, 티로시나제(Tyr) 녹아웃 마우스를 생성하기 위해, 엑소온 2(9476-9692로부터의 뉴클레오티드 서열)를 표적으로 하였다.
    3. 디자인을클릭하고 매우 구체적인 조회의 경우 매우 구체적인 대상만 표시합니다.
    4. 잠재적인 오프 타겟 효과를 줄이려면"12 mer+PAM""8 mer+PAM"의열에서 가장 낮은 값으로 대상 시퀀스를 선택합니다.
      참고: 이 열에서("1")은 시퀀스가 의도한 대상 사이트와 완벽하게 일치하는 지, 숫자보다 큰 숫자는 잠재적인 오프 타겟 사이트의 존재를 나타냅니다.1
    5. crRNA 합성 회사로부터 생성된 올리고뉴클레오티드를주문한다(상표 1).
      참고: 엑소판 2 Tyr 유전자의 경우, 다음과 같은 표적 서열이 사용되었다: GGACCACTTACTACGTAATCC, +TGG를 PAM 서열로서(도 2A).
  2. 단일 가닥 올리고데옥시뉴클레오티드(ssODN) HDR 매개 편집 실험(즉, 노크인 마우스 생성)을 위한 설계.
    1. ssODN 길이를 양쪽에 30-60 개의 뉴클레오티드 (nt) 상동성 무기를 포함하여 약 80-180 bp로 설계하십시오.
      참고: 30-35 nt 상동성 암 및 gRNA에 상보적인 것을 포함하는 75-85 nt 길이의 ssODN은, 높은 노크인 편집 효율21을보였다.
    2. PAM 서열에 의도된 수정 및 자동 돌연변이를 삽입하거나, 가능하지 않은 경우, 5′ PAM의 인접 베이스에서 게놈 편집 후 재절단을 차단한다.
      참고: 본 연구에 사용된 crRNA 및 ssODN은 보충 표 1에나열되어 있습니다.

2. 체외 수정, 배아 동결 보존 및 동결 해동

  1. 체외 수정
    1. 슈퍼로볼레이트 C57BL/6J 암컷 마우스(4 또는 8주령)에 임신한 암말 혈청 생식샘 자극호르몬(PMSG)을 가진 IP 주사에 의한 후 48시간 후에 7.5 IU 인간 융생식샘자극호르몬(hCG)을 주사하였다.
      참고: 배란 된 난모세포의 수는 초고배란22를사용하여 약 3 배 증가 될 수 있습니다.
    2. 성적으로 성숙한 C57BL/6J 수컷 마우스(3-5개월 생)에서 카우다 부고디마이드를 제거합니다.
      참고 : 남성 마우스를 희생하지 않고 정자를 수집 할 수 있습니다.
    3. 해부 바늘로 정자의 혈전을 추출하고CO2 인큐베이터에서 인간 관 액 (HTF)의 200 μL 드롭에서 1.5 시간 동안 capacitation.
    4. hCG 주입 후 16-18시간 후 oviducts로부터 적운-난자 복합체(COC)를 수집하고 2시간 이하의CO2 인큐베이터(5%CO2,37°C)에서 파라핀 액체로 덮인 HTF 배지의 신선한 200 μL 드롭으로 배양한다.
      참고:CO2 흡입을 통한 안락사로 인해 IVF 및 배아발달에영향을 미치기 때문에 마취하에 자궁경부 탈구에 의해 마우스를 희생하는 것이 바람직하다.
    5. 인큐베이션 배지의 경계로부터 COCs를 함유하는 HTF 배지의 200 μL 드롭까지 1-5 μL의 정자 현탁액을 추가하고 3시간 동안CO2 인큐베이터에서 인큐베이터에 인큐베이터화한다.
    6. 난모세포를 칼륨 보충 된 심플렉스 최적화 배지 (KSOM) 3 x로 씻어 남은 정자와 적운 세포를 제거하십시오.
    7. 반전된 현미경을 사용하여 핵 형성 및 1세포 배아의 등급을 확인합니다.
  2. 1 세포 배아의 동결 보존
    1. CO2 인큐베이터에서 10분 동안 20% FBS(파라핀 액체로 덮여 있지 않음)를 함유하는 HTF의2 200 μL 드롭에서 1세포 배아를 배양하였다.
    2. 20-100개의 배아를 1M 디메틸 설폭사이드(DMSO)24용액(DMSO)의 50 μL로 옮니다.
    3. 100개의 배아를 함유한 용액의 5 μL을 저온튜브 바닥으로 옮기고 냉각기 또는 얼음을 사용하여 0°C에서 5분간 식힙니다.
    4. 45 μL의 DAP213(2M 디메틸 설폭사이드, 1M 아세타미드, 3M 프로필렌 글리콜) 용액을 튜브 벽을 따라 천천히 추가하고 튜브를 캡으로 막고 냉각기 또는 얼음에 0°C에서 5분 동안 보관합니다.
      참고: 캡을 너무 단단히 고정하여 샘플 해동 중에 쉽게 제거하지 마십시오.
    5. 튜브를 액체 질소에 빠르게 저장합니다.
  3. 배아 해동
    1. 저온튜브의 뚜껑을 열고, 남은 액체 질소를 버리고, 37°C로 예열된 0.25M 수크로오스 용액 900 μL을 첨가한다.
      참고 : 0.25 M 수크로오스 용액은 차가운 용액의 사용이 해동 후 배아 생존력을 감소시키기 때문에 사전에 37 °C로 따뜻하게해야합니다.
    2. 10 배 신속하게 파이펫과 플라스틱 접시에 냉동 튜브의 내용을 전송합니다.
      참고 : 파이펫팅은 기포가 생성되지 않고 배아를 손상시키지 않도록 신중하게 수행해야합니다.
    3. 파라핀 액체로 덮인 KSOM 배지에서 형태학적으로 정상적인 수정 난모를 2x 세척하고 전기 가루가 될 때까지CO2 인큐베이터에 보관합니다.

3. CRISPR 시약의 조립 및 전기 화

참고 : 전기 를 위해, 우리는 백금 플레이트 전극 (높이 : 0.5mm, 길이 : 10mm, 폭 : 3mm, 갭 : 1mm)와 이전에 설명 한 1 단계 형 전기 포더(재료 표)를사용했다. 2 단계 형 전기 포더도 사용할 수 있습니다(재료 표).

  1. CRISPR 시약의 준비 및 조립
    1. HDR 매개 편집 실험을 수행하는 경우 CRISPR 시약(즉, crRNA, tracrRNA 및 Cas9 단백질)과 ssODN을 주문한다(재료보충표 1).
    2. 어닐링 용액을 다음과 같이 준비합니다.
      1. 감소 된 혈청 최소 필수 매체 용액(재료 표)에서1 μg / μL crRNA 및 1 μg / μL tracrRNA를 준비하고 각 용액의 6 μL을 뉴클레아제없는 완충액42 μL에 추가하십시오.
      2. 95°C에서 건조 히터에 혼합물을 3분 동안 배양하고 RT에서 5분간 식힙니다.
      3. Opti-MEM I에서 희석된 1 μg/μL HiFi Cas9 단백질을 준비하고 총 부피 60 μL에 대해 이전 혼합물에 6 μL을 첨가합니다.
      4. HDR 매개 편집 실험을 수행할 때 6 μL의 1 μg/μL ssODN을 추가합니다. 최종 부피는 60 μL이어야 하기 때문에 3.1.2.1단계에서 36 μL의 뉴클레아제 없는 물을 사용하십시오.
        참고: crRNA, tracrRNA, Cas9 단백질 및 ssODN의 최종 농도는 100 ng/μL입니다.
      5. 1개의 홀 슬라이드 유리에 최종 혼합물(RNP 복합체)의 최대 100μL까지 100μL까지 전달하고 10분 동안 37°C에서 배양한다.
  2. 전기 기공화
    1. CRISPR 시약의 새로운 혼합물의 6 μL로 전극 갭을 채우고 혼합물에 20-25 개의 배아를 추가합니다.
      참고: 전기 펄스 중에 배아를 손상시킬 수 있는 배아와 전기 천공 전극 사이의 접촉을 피하는 것이 중요합니다.
    2. 한 단계 형 전기 포더에 대한 다음과 같은 조건에서 전기 개더레이션을 수행 :
      전압: 25V, 펄스 방향(Pd) +
      ON : 3 ms, 끄기 : 97 ms
      반복: 5x
      참고: 전기 포출은 모자이크를 방지하기 위해 첫 번째 DNA 복제 전에 게놈 편집이 발생하도록 해동 후 1 시간 이상 수행해야합니다.
    3. 2단계 식 전기포더기의 경우 다음과 같이 조건을 설정합니다.
      포링 펄스 = 40V, Pd +
      ON = 1 또는 2.5 ms; 펄스 간격 = 50 ms
      반복: 4x, 감쇠 10%

      전송 펄스 = 5 또는 7V; PD +/-.
      ON: 50 ms; 펄스 간격 = 50 ms.
      반복 = 5x; 감쇠 = 40%.
      참고: 제조업체에서 지정한 특정 범위 내에서 임피던스를 유지하려면 볼륨을 조정하는 것이 중요합니다.
    4. 수정된 크렙스 링거 중탄산염 완충제 2(M2) 배지로 배아를 3x 세척한 다음, 파라핀 액체로 덮인 KSOM 배지 한 방울로 2개의 세척을 하였다.
    5. 세척된 배아(KSOM 배지)를CO2 인큐베이터에서 밤새 배양하여 추가 이식을 위해 배양한다.

4. 배아 이식

  1. 의사 임신 여성 마우스를 준비합니다. 메이트 ICR 암컷 마우스 (3-6 개월) vasectomized 남성 마우스와 함께 1 일 배아 전송 하기 전에 (ET).
    참고 : 마우스는 copulatory 플러그에 대한 다음 아침을 확인해야합니다. 플러그가있는 마우스는 의사 임신으로 간주되며 ET에 사용할 수 있습니다.
  2. 흡입 공기 및 KSOM (파라핀 액체 없이) 성공적인 이식을 위한 마커로서 유리 모세관에 2-3 mm의 교대 간격으로.
  3. 20-24개의 배아를 KSOM 200 μL 드롭(파라핀 액체 제외)에 넣고 각 난관에 이식하기 위해 10-12개의 배아를 유리 모세관에 그립니다.
  4. 이소플루란 (흡입) 또는 메데토비미딘/미다졸람/부토판놀(0.3 mg/kg, 4.0 mg/kg, 및 5.0 mg/kg)을 결합한 용액의 IP 주입으로 암컷 마우스를 마취시금으로 마취시금. 마취된 마우스를 가열 패드의 복부 쪽에 놓습니다. 보습 젤로 마취 된 마우스의 눈을 보호하십시오.
  5. 등쪽 중간선의 하부부분을 따라 면도하고 포비돈의 요오드로 주변을 소독하고 70% 에탄올로 소독합니다.
  6. 등지 중간선에 평행하게 긴 ~ 1cm 절개를합니다.
  7. 난관을 꺼내 멸균 플라스틱 커튼에 놓습니다. 따뜻한 멸균 식염수로 촉촉하게 유지하십시오.
  8. 입체 현미경 아래에 난관을 놓습니다.
  9. 마이크로스프링 가위로 암풀라상류에서 몇 밀리미터 상류에 있는 인펀디벌룸과 암풀라 사이의 난관 벽에 구멍을 뚫습니다.
  10. 배아를 포함하는 유리 모세관의 끝을 구멍에 넣고 모세관 홀더의 마우스피스에 부드럽게 불어 기포가 암풀라에서 보일 때까지 배아를 추방합니다.
    참고: 난관 당 10-12 배아 사이 를 전송합니다.
  11. 난관 벽에서 유리 모세관을 철회하고 생식 기관을 부드럽게 다시 신체 구멍으로 밀어 넣습니다.
  12. 배아를 다른 난관에 도입하기 위해 이전 과정을 반복합니다.
  13. ET 절차를 완료하면, 간단한 중단 봉합패턴 (50, 흡수성, 편조 합성 봉합사)으로 복막을 봉합한 다음 간단한 중단 패턴 또는 매장 된 피하 중단 스티치 패턴 (60)으로 피부를 봉합하십시오. 흡수성, 단합성 봉합사).
  14. 마취에서 회복 될 때까지 37 °C 온난화 판에 마우스를 따뜻하게 유지하십시오.
  15. 수술 후 7일 동안 매일 동물의 건강을 모니터링하십시오.

5. 지질 분석 및 서열 분석

  1. 게놈 DNA 추출
    참고: 우리는 NucleoSpin 조직 DNA 추출 키트를 사용하여 제조업체의 권고에 따라 마우스 귀 조직에서 게놈 DNA를 추출했습니다.
    1. 180 μL의 버퍼 T1과 25 μL의 프로틴라제 K 용액을 시료에 넣고 10초 동안 와르싱하여 혼합합니다.
    2. 56°C에서 2시간 동안 또는 완전한 용해가 얻어지실 때까지 배양합니다. 인큐베이션의 30분마다 10초동안 소용돌이.
    3. 완충B3 200 μL을 추가하고, 30초 동안 격렬하게 소용돌이를 넣고, 70°C에서 10분 동안 배양합니다.
    4. 시료와 와류에 100% 에탄올 210 μL을 힘차게 넣습니다.
    5. 각 샘플에 대해 하나의 조직 컬럼을 수집 튜브에 넣고 샘플을 컬럼에 적용합니다.
    6. 11,000 x g에서1 분 동안 원심 분리기를 버리고 흐름을 버리고 컬럼을 수집 튜브에 다시 놓습니다.
    7. 버퍼 BW 500 μL을 추가하여 샘플을 세척하고(1차 세척), 1분 동안 1분 동안 원심분리기를 11,000 x g에서제거하고 흐름을 버리고 컬럼을 다시 수집 튜브에 넣습니다.
    8. 버퍼 B5 의 600 μL을 컬럼 (2 차 세척)에 추가하고 1 1 분 동안 1 분 동안 원심 분리기를 11,000 x g에서넣고 흐름을 버리고 컬럼을 다시 수집 튜브에 넣습니다.
    9. 11,000 x g에서 1 분 동안 컬럼을 원심 분리하여 실리카 막을 건조시키고 NucleoSpin 조직 컬럼을 1.5 mL 미세 원심 분리지 튜브에 넣습니다.
    10. 버퍼 BE 100 μL을 넣고 실온에서 1 분 동안 배양 한 다음 11,000 x g에서1 분 원심 분리합니다.
  2. PCR 증폭 및 정제
    1. 표적 궤적을 둘러싼 400-500 bp 서열을 증폭시키기 위해 프라이머3 플러스 웹사이트(https://primer3plus.com/)를 사용하여 프라이머를 설계한다.
    2. 새로운 PCR 프로토콜을 설계하고 경험적으로 테스트합니다.
    3. 원치 않는 효소, 뉴클레오티드, 프라이머 및 완충 성분을 제거하기 위해 PCR 제품을 정제합니다. 표준 정제 방법은 다음과 같이 사용할 수 있습니다.
      1. PCR 제품의 50 μL에 페놀 50 μL을 넣고 소용돌이로 섞습니다.
      2. 11,000 x g에서 1 분 동안 원심 분리기를 하고 상부 투명 층을 새로운 튜브로 옮긴다.
      3. 99.5% 에탄올 120 μL, 30초 동안 5M 암모늄 아세테이트 및 와류 20 μL을 첨가합니다.
      4. RT에서 10분, 원심분리기를 11,000 x g에서 10분 동안 유지합니다.
      5. 상급제를 버리고 70 % 에탄올 1 mL로 DNA 펠릿을 씻으십시오.
      6. RT에서 펠릿을 10분 동안 건조시키고 10 μL의 RNase 자유물에 녹입니다.
        참고: 페놀은 인체에 독성이 있기 때문에 PCR 컬럼 기반 정제 키트는 다시 주석을 달수 있습니다.
  3. 생거 시퀀싱
    1. DNA 정량 분석(재료 표참조)을 실행하여 정제된 PCR 앰플리폰을 정량화합니다.
    2. PCR 제품 및 시퀀싱 프라이머를 시퀀싱 서비스 공급자에게 보냅니다.
    3. 사용 가능한 온라인 웹 사이트를 사용하여 순서를 분석합니다.
      참고: 이 연구에서는 CRISP-ID 25(http:/crispid.gbiomed.kuleuven.be/)를 서열 분석에 사용했습니다.25

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1M DMSO 및 DAP213 용액에서 동결 보존을 한 후 10 분 동안 20 % FBS를 함유하는 HTF에서의 배양을 포함한 1 세포 배아의 냉동 보존을위한 우리의 수정 된 방법은 동결 해동 된 배아의 발달 속도를 2 세포 단계로 향상시켰습니다(그림 1, p = 0.009, 학생 t-test). 동결 해동 배아는 GM 마우스의 생산을 위해 사용되었고 전기 포어화 조건은 최적화되었다: 프로토콜 섹션에 기재된 바와 같이 전기포더레이터를 사용하여 3 ms 펄스와 97 ms 간격으로 25 V의 5회 반복. 프로토콜의 적용성은 알비노 티로시나아제 유전자(Tyr) 녹아웃 마우스의 생성에 의해확인되었다(도 2). 이를 위해, gRNA 표적화 엑손2(도 2A)와CRISPR 시약을 프로토콜 섹션에 기재한 대로 제조하였다. 편집 도구는 게놈의 첫 번째 복제 전에 발생 게놈 편집을 보장하기 위해 배아 해동의 1 시간 이내에 전기화하고 따라서 설립자의 모자이크를 방지(그림 2B). 생성된 모든 마우스는 알비노였고, 오직 하나의 마우스만이 모자이크였고, 흰색과 검은색 패치가 있는 외투를하였다(도 2C). 하나의 대립유전자만을 항하는 마우스를 제외한 2개의 상이한 돌연변이 대립유전자(heterozygous mutation)를 항하는 모든 알비노 마우스는 도 2E에도시되어 있다. 우리의 방법은 시퀀싱 분석뿐만 아니라 코트 색상에 의해 확인 된 바와 같이 낮은 모자이크 속도와 거의 100 %의 편집 효율을 제공 할 수 있다고 결론을 내릴 수있다(그림 2CE).

다음으로, 프로토콜의 재현성은 녹아웃 및 노크인 마우스의 여러 라인의 생성에 의해 확인되었다. 표 1에도시된 바와 같이, 프로토콜은 높은 효율과 낮은 모자이크 비율로 녹아웃 및 노크인 마우스를 생성할 수 있다. 생성된 F0 마우스의 대부분은 F1 세대에 돌연변이 대문자의 생식선 전달을 확인하기 위해 야생형 C57BL/6J 마우스와 교배하였다. 예상대로, 동형 접합체 F0 마우스의 모든 F1 자손은 이형, 하나의 돌연변이 대립 유전자 및 하나의 야생 형 대립 유전자를 함유하였다. 창립자와 그들의 세대의 유전형질 사이에서 이질적인 돌연변이는 관찰되지 않았습니다. 기재된 프로토콜은 도 3에서프로토콜의 워크플로우에 도시된 바와 같이 짧은 시간(즉, ~4주) 내에 GM 마우스를 생성하였다.

Figure 1
도 1: 태아 소 혈청(FBS)은 동결 해동된 배아의 2세포 단계 발달 속도를 향상시켰습니다. FBS+ 배아의 수는 286개(실험은 3회 반복되었고, FBS-배아의 수는 272개였다(실험은 3배 반복되었다). 데이터는 평균 ± SEM으로 제시된다. 이 그림은 허가하에 Darwish M 등16에서 재현됩니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Figure 2
그림 2: 높은 효율과 낮은 모자이크 비율로 Tyr 녹아웃 마우스의 생성. 이 그림은 Darwish M 외16에서 허가를 받아 수정됩니다. (A)gRNA의 디자인을 보여주는 개략적 그림. PAM 시퀀스는 빨간색으로 표시됩니다. (B)동결해동배아에 대한 전기천공의 타이밍을 나타내는 그림으로, 노란색 심볼은 전기천공 시간을 나타낸다. (C)생성된 티르 녹아웃 마우스의 대표적인 이미지. (D)티르 녹아웃 마우스의 상이한 대금 전구의 서열 분석. 표적 서열은 적색으로 표지되고 대시는 돌연변이 대미에 뉴클레오티드의 결실을 나타낸다. WT = 야생형 M = 돌연변이 대문자. (E)M1 대립구를 포함하는 알비노 마우스의 크로마토그램의 대표적인 부분은 D. 이 그림의 더 큰 버전을 보려면 여기를 클릭하여 확인하십시오.

Figure 3
그림 3: GM 마우스의 생성을 위한 프로토콜의 워크플로우. 첫 번째 단계는 냉동 보존 된 배아의 준비였습니다. 암컷 C57BL/6J 마우스는 PMSG 주사에 의해 먼저, hCG 주사에 의해 48시간 후에 과다 화되었다. COCs는 16시간 후에 수집되었고, 수컷 C57BL/6J 마우스로부터 채취한 정자로 IVF를 행하였다. 수정된 난모세포는 저온 보존되었고 필요할 때까지 액체 질소에 저장되었습니다. 두 번째 단계는 배아와 전기 를 해동 포함. 냉동 보존된 배아를 해동하고 CRISPR 시약(즉, 트라크RNA, crRNA 및 Cas9 단백질)을 분해하고 배아를 해동한 후 1시간 이내에 전기화하였다. 세 번째 단계는 태아 이식 및 마우스의 출생을 포함했다. 전기천공 후, 2세포 배아는 의사 임신한 암컷 마우스의 난관으로 옮겨져 나중에 Sanger 시퀀싱을 사용하여 유전자변형 마우스를 생성하여 편집 효율을 확인하였다. 모든 실험(1단계)에 앞서 수정된 난모체를 제조하는 데 필요한 시간과 노력은 많은 수의 냉동 보존 배아가 미리 준비되는 경우 단축될 수 있다. 이 그림은 Darwish M 외16에서적응하여이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

돌연변이 마우스 전기 배아 2 세포 배아 이송된 배아 새끼 (%) 돌연변이 마우스(%) 모자이크 마우스 없음
티르 코 124 84 48 12 (25) 100 1
글라브 코 151 94 40 6 (15) 100 0
Slc39a6 KO 48 25 25 5 (20) 100 0
가방3 KI 233 84 20 3 (15) 50 1
캠크2a 기 124 70 70 14 (20) 64.3 0

표 1: C57BL/6J 배경의 동결 해동 배아를 사용하여 여러 줄의 GM 마우스를 생산한다.

보충 표 1. 이 표를 다운로드하려면 여기를 클릭하십시오.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

기재된 프로토콜은 높은 효율과 낮은 모자이크 레이트(표1)를가진 GM 마우스의 생성을 허용한다. CRISPR/Cas9 리보뉴클레오프로테인(RNP) 및 동결 해동 배아로의 전기 화: 생식 공학 및 게놈 편집 기술 모두에서 가장 유용한 최신의 진보를 활용하기 때문에 고급 배아 조작 기술이 없는 연구원은 돌연변이 마우스를 쉽게 만들 수 있습니다. 이러한 발전은 GM 마우스의 생성을 촉진하고 신속히 진행하였다. 도 3에기재된 바와 같이, GM 마우스를 생성하는 데 ~4주가 걸린다. 유사한 접근법26을사용하는 다른 프로토콜에 비해, 우리의 방법은 효율성, 출산율 및 모자이크의 측면에서 우수하다.

동결 보존 전에 FBS에서 1 세포 배아의 배양은 배아의 발달 속도를 개선하는 데 중요합니다. 프로토콜에 기술된 저온 보존 배아의 전기 천공 조건은 CRISPR 시약의 편집 효율과 배아의 생존 사이의 절충을 허용합니다. 실제로, 가혹하거나 온화한 조건은 각각16,배아의 발달 속도 및 편집 효율성에 영향을 미칠 수 있다. 전기 개화의 타이밍(그림 2B)은설립자의 모자이크를 극복하고 두 개의 대두가있는 경우에만 게놈 변형이 발생하도록하는 것이 중요합니다. 이는 초기 단계 전기 포공이 비 모자이크돌연변이(17)를생성할 수 있음을 보여주는 이전 보고서와 일치한다. 또한 gRNA/mRNA 대신 RNP를 사용하면 모자이크 속도가 감소하고 편집효율이 17로향상됩니다.

설명된 프로토콜에는 몇 가지 장점이 있습니다. 먼저, 짧은 시간(~4주) 내에 돌연변이 마우스를 생성한다. 둘째, 매우 효율적이고 강력한 프로토콜입니다. 녹아웃(KO) 및 노크인(KI) 마우스의 여러 줄은 높은 돌연변이율(KO=100%, KI=50~64.3%)으로 생성되었다. 셋째, 편리하고 비용 효율적입니다. 완전한 합성 crRNA, tracrRNA, ssODN 및 Cas9 단백질의 사용은 Cas9 벡터 및 시험관 내 전사의 지루한 준비에 대한 필요성을 제거합니다. 대신, 연구원은 단순히 상용 시약 및 표준 장비를 사용할 수 있습니다. 넷째, 그것은 높은 기술적 인 기술을 필요로하는 미세 주입을 사용하지 않습니다. 다섯째, 그것은 설립자의 모자이크주의를 감소시키고, 따라서 모자이크 마우스의 복잡한 genotypic 분석을 극복, 편집 된 골레알의 보다 효율적인 생식선 전달에 이르게. 마지막으로, 이 프로토콜은 F1 하이브리드의 사용을 피하는 C57BL/6J 근친 변형으로 효율적이며, 따라서 유전적 복잡성을 제거하기 위해 수많은 백크로스를 수행해야 합니다. F1 세대의 지질형 은 정확한 생식선 전달을 확인했습니다. 그러나, F0 창시자14,,27의유전형질로부터 추정된 후속 생성의 유전형질및 유전형의 오해의 소지가 있는 예측으로 인해 F0 마우스의 표현형을 연구하는 것은 권장되지 않는다.

항상 쉽게 구할 수 없는 비인간 영장류및 돼지와 양과 같은 큰 동물의 게놈 편집에서 동결 해동 된 배아의 사용을 활용하는 것이 가장 중요합니다. 배아 동결 방법은 동물 종에 따라 크게 다릅니다. 따라서, 우리는 우리의 동결 보존 프로토콜은 마우스에만 적용 할 수 있다고 생각합니다. 한편, 당사의 프로토콜은 GM 마우스의 생성을 위해 Cas9 이외의 엔지니어링 뉴클레아제사용에 잠재적으로 적용할 수 있으며, 전기천공은 이전에 Cas12a와 같은 다른 뉴클레아제등을 배아내로 효율적으로 도입하는 것으로 보고되었기 때문에28,,29.

프로토콜의 한 가지 제한은 긴 이식 유전자를 게놈에 정확하게 통합하는 것입니다. 그러나, 하나의 잠재적인 해결책은 마우스 게놈에서 4.9 Kb까지의 트랜스유전자의 통합이 아데노 관련 바이러스(AAV)와 전기천자를 결합하여 성공적으로수행되었다(30)이전 간행물31을확인하였다. 또한, 오프 대상 부작용의 잠재적인 발생은 CRISPR/Cas9 기술의 사용에 주요 관심사. 우리는 잠재적인 오프 타겟 효과를 배제하기 위해 편집된 마우스의 전체 게놈 시퀀싱을 수행하지 않았습니다. 그러나 RNP32와같은 오프 타겟 효과를 줄이기 위해 보고된 CRISPR 도구를 사용했습니다. 또한, 우리는 크게 대상 성능33을희생하지 않고 오프 대상 편집을 감소 고충실도 Cas9 변형을 사용했다. 또한 CRISPRdirect 소프트웨어(https://crispr.dbcls.jp)를 사용하여 gRNA를 설계하여 대상 사이트19를최소화하여 대상 시퀀스를 생성해야 합니다. 유전자형-표현형 인과관계를 확인하고 오프 타겟 효과에 대한 우려를 완화하기 위해, 연구원은 다른 gRNAs를 사용하여 동일한 유전자형의 여러 편집 된 마우스를 생성하거나 여러 세대에 대한 생성 된 마우스의 역횡단을 수행해야합니다.

NHEJ 메커니즘 및 프레임 시프트 돌연변이를 사용하여 생성된 녹아웃 마우스는 널리 사용되고 관련 표현형을 보여주었다. 그러나, 잘린 잔류 단백질은 편집된엑온(34,,35)의번역 재가동 또는 건너뛰기로 인해 존재할 수 있다. 따라서 표현형을 정확하게 해석하려면 잔류 단백질 기능 또는 발현의 특성화가 필요합니다. 하나 이상의 gRNA를 사용하는 완전한 유전자 녹아웃 마우스의 생성은 좋은 대안이 될 것이다. 그러나, 유전자가 비코딩 RNA에 전사된 인트로닉 영역을 포함하지 않는다는 것을 확인하기 위하여 특별한 주의를 기울여야 합니다, 이는 규정하는 기능이 있고 그러므로 phenotypic 분석을 복잡하게 할 수 있습니다.

이 연구에서는, 우리는 많은 연구원이 4 주 이하에 있는 유전으로 변형한 마우스를 생성할 수 있는 간단한 프로토콜을 보여줍니다. 동결 해동 배아와 전기 천공의 사용을 결합하여, 우리는 쉽고 빠르고 효율적인 인간의 질병의 마우스 모델의 준비를 렌더링합니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 관련 재무 공시가 없습니다.

Acknowledgments

사와다 히토미와 엘리자베스 가르시아에게 동물 보호에 감사드립니다. 이 작품은 KAKENHI (15K20134, 17K11222, 16H06276 및 16K01946)와 호쿠긴 연구 보조금 (H.N.에), 그리고 지치 의과 대학 젊은 조사상 (H.U.)에 의해 지원되었다. 오츠카 토시미 장학재단은 M.D.를 후원했습니다.

Materials

Name Company Catalog Number Comments
0.25 M Sucrose ARK Resource Co., Ltd. (Kumamoto, Japan) SUCROSE
1 M DMSO ARK Resource Co., Ltd. (Kumamoto, Japan) 1M DMSO
Butorphanol Meiji Seika Pharma Co., Ltd. (Tokyo, Japan) Vetorphale 5mg
Cas9 protein: Alt-R® S.p. HiFi Cas9 Nuclease 3NLS Integrated DNA Technologies, Inc. (Coralville, IA) 1081060
C57BL/6J mice Japan SLC (Hamamatsu, Japan) N/A
DAP213 ARK Resource Co., Ltd. (Kumamoto, Japan) DAP213
FBS Sigma-Aldrich, Inc. (St. Louis, MO) ES-009-C
hCG MOCHIDA PHARMACEUTICAL CO., LTD (Tokyo, Japan) HCG Mochida 3000
HTF ARK Resource Co., Ltd. (Kumamoto, Japan) HTF
ICR mice Japan SLC (Hamamatsu, Japan) N/A
Isoflurane Petterson Vet Supply, Inc. (Greeley, CO) 07-893-1389
KSOM ARK Resource Co., Ltd. (Kumamoto, Japan) KSOM
LN2 Tank Chart Industries (Ball Ground, GA) XC 34/18
M2 ARK Resource Co., Ltd. (Kumamoto, Japan) M2
Medetomidine Nippon Zenyaku Kogyo Co.,Ltd. (Koriyama, Japan) 1124401A1060
Microscope Nikon Co. (Tokyo, Japan) SMZ745T
Midazolam Sandoz K.K. (Tokyo, Japan) 1124401A1060
Nuclease free buffer Integrated DNA Technologies, Inc. (Coralville, IA) 1072570
Nucleospin DNA extraction kit Takara Bio Inc (Kusatsu, Japan) 740952 .5
One-hole slide glass Matsunami Glass Ind., Ltd. (Kishiwada, Japan) S339929
One-step type Electroporator BEX Co., Ltd. (Tokyo, Japan) CUY21EDIT II
Paraffin Liquid NACALAI TESQUE Inc. (Kyoto, Japan) SP 26137-85
Platinum plate electrode BEX Co., Ltd. (Tokyo, Japan) LF501PT1-10, GE-101
PMSG ASKA Animal Health Co., Ltd (Tokyo, Japan) SEROTROPIN 1000
Povidone iodide Professional Disposables International, Inc. (Orangeburg, NY) C12400
Reduced-Serum Minimal Essential Medium: OptiMEM I Sigma-Aldrich, Inc. (St. Louis, MO) 22600134
Two-step type Electroporator Nepa Gene Co., Ltd. (Ichikawa, Japan) NEPA21

DOWNLOAD MATERIALS LIST

References

  1. Wang, H., et al. One-step generation of mice carrying mutations in multiple genes by CRISPR/cas-mediated genome engineering. Cell. 153, (4), 910-918 (2013).
  2. Jinek, M., et al. A programmable dual-RNA - guided DNA endonuclease in adaptive bacterial immunity. Science. 337, (6096), 816-822 (2012).
  3. Mali, P., et al. RNA-guided human genome engineering via Cas9. Science. 339, (6121), 823-826 (2013).
  4. Cong, L., et al. Multiplex genome engineering using CRISPR/VCas systems. Science. 339, (6121), 819-823 (2013).
  5. Doudna, J. A., Charpentier, E. The new frontier of genome engineering with CRISPR-Cas9. Science. 346, (6213), 1258096 (2014).
  6. Mashiko, D., et al. Generation of mutant mice by pronuclear injection of circular plasmid expressing Cas9 and single guided RNA. Scientific Reports. 3, 3355 (2013).
  7. Yen, S. T., et al. Somatic mosaicism and allele complexity induced by CRISPR/Cas9 RNA injections in mouse zygotes. Developmental Biology. 393, (1), 3-9 (2014).
  8. Kaneko, T., Mashimo, T. Simple genome editing of rodent intact embryos by electroporation. PLoS ONE. 10, (11), 1-7 (2015).
  9. Qin, W., et al. Efficient CRISPR/cas9-mediated genome editing in mice by zygote electroporation of nuclease. Genetics. 200, (2), 423-430 (2015).
  10. Kaneko, T., Sakuma, T., Yamamoto, T., Mashimo, T. Simple knockout by electroporation of engineered endonucleases into intact rat embryos. Scientific Reports. 4, 6382 (2014).
  11. Hashimoto, M., Takemoto, T. Electroporation enables the efficient mRNA delivery into the mouse zygotes and facilitates CRISPR/Cas9-based genome editing. Scientific Reports. 5, 11315 (2015).
  12. Chen, S., Lee, B., Lee, A. Y. F., Modzelewski, A. J., He, L. Highly efficient mouse genome editing by CRISPR ribonucleoprotein electroporation of zygotes. Journal of Biological Chemistry. 291, (28), 14457-14467 (2016).
  13. Modzelewski, A. J., et al. Efficient mouse genome engineering by CRISPR-EZ technology. Nature Protocols. 13, (6), 1253-1274 (2018).
  14. Teixeira, M., et al. Electroporation of mice zygotes with dual guide RNA/Cas9 complexes for simple and efficient cloning-free genome editing. Scientific Reports. 8, 474 (2018).
  15. Nakagawa, Y., et al. Production of knockout mice by DNA microinjection of various CRISPR/Cas9 vectors into freeze-thawed fertilized oocytes. BMC Biotechnology. 15, (1), 1-10 (2015).
  16. Darwish, M., et al. Rapid and high-efficient generation of mutant mice using freeze-thawed embryos of the C57BL/6J strain. Journal of Neuroscience Methods. 317, 149-156 (2019).
  17. Hashimoto, M., Yamashita, Y., Takemoto, T. Electroporation of Cas9 protein/sgRNA into early pronuclear zygotes generates non-mosaic mutants in the mouse. Developmental Biology. 418, (1), 1-9 (2016).
  18. Sakamoto, W., Kaneko, T., Nakagata, N. Use of frozen-thawed oocytes for efficient production of normal offspring from cryopreserved mouse spermatozoa showing low fertility. Comparative Medicine. 55, (2), 136-139 (2005).
  19. Naito, Y., Hino, K., Bono, H., Ui-Tei, K. CRISPRdirect: Software for designing CRISPR/Cas guide RNA with reduced off-target sites. Bioinformatics. 31, (7), 1120-1123 (2015).
  20. Torres-Perez, R., Garcia-Martin, J. A., Montoliu, L., Oliveros, J. C., Pazos, F. WeReview: CRISPR Tools-Live Repository of Computational Tools for Assisting CRISPR/Cas Experiments. Bioengineering. 6, (3), 63 (2019).
  21. Okamoto, S., Amaishi, Y., Maki, I., Enoki, T., Mineno, J. Highly efficient genome editing for single-base substitutions using optimized ssODNs with Cas9-RNPs. Scientific Reports. 9, 4811 (2019).
  22. Takeo, T., Nakagata, N. Superovulation using the combined administration of inhibin antiserum and equine chorionic gonadotropin increases the number of ovulated oocytes in C57BL/6 female mice. PLoS ONE. 10, (5), 1-11 (2015).
  23. Wuri, L., Agca, C., Agca, Y. Euthanasia via CO2 inhalation causes premature cortical granule exocytosis in mouse oocytes and influences in vitro fertilization and embryo development. Molecular Reproduction and Development. 86, (7), 825-834 (2019).
  24. Nakagata, N. High survival rate of unfertilized mouse oocytes after vitrification. Journal of Reproduction and Fertility. 87, (2), 479-483 (1989).
  25. Dehairs, J., Talebi, A., Cherifi, Y., Swinnen, J. V. CRISP-ID: Decoding CRISPR mediated indels by Sanger sequencing. Scientific Reports. 6, 28973 (2016).
  26. Nakagawa, Y., Sakuma, T., Takeo, T., Nakagata, N., Yamamoto, T. Electroporation-mediated genome editing in vitrified/warmed mouse zygotes created by ivf via ultra-superovulation. Experimental Animals. 67, (4), 535-543 (2018).
  27. Nakajima, K., Nakajima, T., Takase, M., Yaoita, Y. Generation of albino Xenopus tropicalis using zinc-finger nucleases. Development Growth and Differentiation. 54, (9), 777-784 (2012).
  28. Hur, J. K., et al. Targeted mutagenesis in mice by electroporation of Cpf1 ribonucleoproteins. Nature Biotechnology. 34, 807-808 (2016).
  29. Dumeau, C. E., et al. Introducing gene deletions by mouse zygote electroporation of Cas12a/Cpf1. Transgenic Research. 28, (5-6), 525-535 (2019).
  30. Chen, S., et al. CRISPR-READI: Efficient Generation of Knockin Mice by CRISPR RNP Electroporation and AAV Donor Infection. Cell Reports. 27, (13), 3780-3789 (2019).
  31. Mizuno, N., et al. Intra-embryo Gene Cassette Knockin by CRISPR/Cas9-Mediated Genome Editing with Adeno-Associated Viral Vector. iScience. 9, 286-297 (2018).
  32. Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. Highly Efficient RNA-guide genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Research. 24, (6), 1012-1019 (2014).
  33. Vakulskas, C. A., et al. A high-fidelity Cas9 mutant delivered as a ribonucleoprotein complex enables efficient gene editing in human hematopoietic stem and progenitor cells. Nature Medicine. 24, (8), 1216-1224 (2018).
  34. Rodriguez-Rodriguez, J. A., et al. Distinct Roles of RZZ and Bub1-KNL1 in Mitotic Checkpoint Signaling and Kinetochore Expansion. Current Biology. 28, (21), 3422-3429 (2018).
  35. Smits, A. H., et al. Biological Plasticity Rescues Target Activity in CRISPR Knockouts. Nature Methods. 16, 1087-1093 (2019).
유전자 변형 마우스의 고효율 생산을 위한 동결 해동 배아 사용
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Nishizono, H., Darwish, M., Uosaki, H., Masuyama, N., Seki, M., Abe, H., Yachie, N., Yasuda, R. Use of Freeze-thawed Embryos for High-efficiency Production of Genetically Modified Mice. J. Vis. Exp. (158), e60808, doi:10.3791/60808 (2020).More

Nishizono, H., Darwish, M., Uosaki, H., Masuyama, N., Seki, M., Abe, H., Yachie, N., Yasuda, R. Use of Freeze-thawed Embryos for High-efficiency Production of Genetically Modified Mice. J. Vis. Exp. (158), e60808, doi:10.3791/60808 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter