Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Bruk av frysetinte embryoer for høyeffektivitetsproduksjon av genmodifiserte mus

doi: 10.3791/60808 Published: April 2, 2020
* These authors contributed equally

Summary

Her presenterer vi en modifisert metode for kryopreservation av encellede embryoer, samt en protokoll som parer bruken av frysetinte embryoer og elektroporasjon for effektiv generering av genmodifiserte mus.

Abstract

Bruken av genmodifiserte (GM) mus har blitt avgjørende for å forstå genfunksjon og dechiffrere de underliggende mekanismene for menneskelige sykdommer. CRISPR/Cas9-systemet gjør det mulig for forskere å modifisere genomet med enestående effektivitet, troskap og enkelhet. Ved å utnytte denne teknologien søker forskere en rask, effektiv og enkel protokoll for generering av GM-mus. Her introduserer vi en forbedret metode for kryopreservation av encellede embryoer som fører til en høyere utviklingshastighet av frysetinte embryoer. Ved å kombinere den med optimaliserte elektroporasjonsforhold, gir denne protokollen generering av knockout og knock-in mus med høy effektivitet og lave mosaikkhastigheter på kort tid. Videre viser vi en trinnvis forklaring av vår optimaliserte protokoll, som dekker CRISPR reagensforberedelse, in vitro befruktning, kryopreservation og tining av encellede embryoer, elektroporasjon av CRISPR-reagenser, musegenerering og genotyping av grunnleggerne. Ved hjelp av denne protokollen bør forskerne kunne forberede GM-mus med uovertruffen letthet, hastighet og effektivitet.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Det grupperte regelmessig ekle korte palindromic repeats (CRISPR) / CRISPR-assosiert protein 9 (Cas9) systemet er et vitenskapelig gjennombrudd som gir enestående målrettet endring i genomet1. CRISPR/Cas9-systemet består av Cas9-protein og guide RNA (gRNA) med to molekylære komponenter: en målspesifikk CRISPR RNA (crRNA) og en transaktiverende CRISPR RNA (tracrRNA)2 . En gRNA leder Cas9-proteinet til det spesifikke locus i genomet, 20 nukleotider komplementære til crRNA, og ved siden av protospacer tilstøtende motiv (PAM). Cas9-proteinet binder seg til målsekvensen og induserer dobbelttrådpauser (DSBs) som repareres av enten feilutsatt nonhomolog endesammenføyning (NHEJ) eller high fidelity homology-rettet reparasjon (HDR)3,,4,5. NHEJ fører til innsettinger eller/og slettinger (indels), og dermed til gentap av funksjon når en kodesekvens er målrettet. HDR fører til presis genomredigering i nærvær av en reparasjonsmal som inneholder homologisekvenser3,,4,,5. NHEJ og HDR har blitt utnyttet til å generere knockout og knock-in mus, henholdsvis.

Mens CRISPR/Cas9-systemet har akselerert genereringen av GM-mus med enestående effekt og troskap, møter forskere som bruker disse metodene ofte tekniske utfordringer. For det første krever konvensjonelle protokoller mikroinjeksjon for innføring av CRISPR-redigeringsverktøyene i pronucleus av befruktede egg6,,7. Denne teknikken er tidkrevende og krever vanligvis omfattende opplæring. Dermed erstattet flere grupper mikroinjeksjon med elektroporasjon8,9,10,11,12,13. I de tidlige elektroporasjonsprotokollene ble imidlertid friske embryoer brukt til elektroporasjon. Dette forårsaket et annet problem, fordi å forberede friske embryoer før hvert eksperiment er vanskelig14.

Nylig har vi og andre kombinert bruken av frysetinte embryoer og elektroporasjon for genomredigering, noe som letter genereringen av GM-mus15,16. Denne protokollen gjør det mulig for forskere uten avanserte embryomanipulasjonferdigheter å raskt generere dyremodeller av menneskelige sykdommer med høy effektivitet. Protokollen reduserer også praktiske utfordringer i å generere GM-mus, for eksempel genetisk heterogenitet hos grunnleggerne16. For å overvinne mosaikkisme utfører vi elektroporasjonen av CRISPR-reagenser innen 1 h etter embryotining for å sikre at redigering skjer før den første replikeringen av genomet. En annen forbedring inkluderer bruk av Cas9 protein i stedet for Cas9 mRNA for å redusere uønsket mosaikkisme17. Videre utviklet vi en optimal metode for encellede embryokryopreservation som øker utviklingshastigheten til to-celle stadium16: bruk av føtale storfe serum (FBS) dramatisk forbedrer overlevelsen av fryse-tint oocytes etter befruktning, kanskje av samme mekanisme som gjør fryse-tint ubefruktet oocytes mer motstandsdyktig18.

Her presenterer vi en omfattende protokoll for generering av GM-mus ved hjelp av frysetinte embryoer, inkludert den modifiserte metoden for kryopreservation av encellede C57BL/6J embryoer. Det inkluderer 1) gRNA design, CRISPR reagensforberedelse og montering; 2) IVF, kryopreservation, og tining av encellede embryoer; 3) Elektroporasjon av CRISPR reagenser i frysetinte embryoer; 4) Embryo overføring til oviduct av pseudopregnant kvinnelige mus; og 5) Genotyping og sekvens analyse av F0 grunnlegger dyr.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

All dyrepleie og prosedyrer utført i denne studien ble gjennomført i henhold til reglene og forskriftene til Guide for omsorg og bruk av laboratoriedyr. Den eksperimentelle protokollen ble godkjent av Animal Care Committee of Laboratory Animals of University of Toyama, University of Tokyo, Jichi University, og Max Planck Florida Institute for Neuroscience. Informasjon om alle reagenser vises i materialtabellen.

1. CRISPR reagenser design

  1. crRNA design
    1. Besøk CRISPR direct19 (https://crispr.dbcls.jp/) for å designe spesifikke crRNAer med reduserte off-target-nettsteder.
      MERK: Det finnes mange andre nyttige verktøy for å designe crRNA20 (https://bioinfogp.cnb.csic.es/tools/wereview/crisprtools/).
    2. Sett inn målnukleotidsekvensen og gjør følgende endringer:
      PAM sekvens krav = NGG
      Spesifisitetskontroll = Mus (Mus muskulatisk) genom, GRCm38/mm10 (desember 2011)
      MERK: Som et eksempel, for å generere Tyrosinase (Tyr) knockout mus, exon 2 (nukleotid sekvens fra 9476-9692) ble målrettet.
    3. Klikk Utforming, og merk Vis bare svært spesifikke målforhøy mål for svært spesifikke treff .
    4. For å redusere potensielle off-target effekter, velg målsekvensen med den laveste verdien i kolonnene "12 mer + PAM" og "8 mer + PAM".
      MERK: I disse kolonnene indikerer ("1") at sekvensen bare har én perfekt match med det tiltenkte målområdet, og tall som er større enn én, indikerer tilstedeværelsen av potensielle nettsteder utenfor mål.
    5. Bestill de resulterende oligonucleotides fra crRNA syntese selskaper (Supplimentary Tabell 1).
      MERK: For exon 2 Tyr-genet ble følgende målsekvens brukt: GGACCACTATTACGTAATCC, med +TGG som PAM-sekvens(figur 2A).
  2. Enkelt tråd oligodeoxynucleotide (ssODN) design for HDR-medierte redigeringseksperimenter (dvs. knock-in mus generasjon).
    1. Design ssODN-lengden til å være rundt 80–180 bp, inkludert 30–60 nukleotid (nt) homologiarmer på begge sider.
      MERK: En ssODN på 75–85 nt lengde, inkludert en 30–35 nt homologiarm og komplementære til gRNA, viste høy knock-in redigeringseffektivitet21.
    2. Sett inn den tiltenkte modifikasjonen og stille mutasjonen ved PAM-sekvensen eller, om ikke mulig, på 5' nabobase pam for å blokkere recutting etter genomredigering.
      MERK: CrRNA og ssODN som brukes i denne studien er oppført i tilleggstabell 1.

2. In vitro befruktning, embryo kryopreservation, og fryse-tining

  1. In vitro befruktning
    1. Superovulate C57BL/6J hunnmus (4 eller 8 uker gamle) ved IP-injeksjon med drektig mare serum gonadotropin (PMSG) etterfulgt av injeksjon med 7,5 IE humant choriongonadotropin (hCG) etter 48 timer.
      MERK: Antall ovulaterte oocytter kan økes med ca. 3x ved hjelp av ultra-superovulation22.
    2. Fjern cauda epididymides fra seksuelt modne C57BL/6J hannmus (3–5 måneder gammel).
      MERK: Det er mulig å samle spermatozoa uten å ofre de mannlige musene.
    3. Ekstra koatozoer med en dissekerende nål og inkuber dem i en 200 μL dråpe human tubal væske (HTF) i CO2 inkubator for 1,5 h for kapacitation.
    4. Samle cumulus-oocyte komplekser (COCs) fra oviducts 16-18 h etter hCG injeksjon og inkubere dem i en frisk 200 μL dråpe HTF medium dekket med parafin væske i en CO2 inkubator (5% CO2, 37 ° C) for ikke mer enn 2 h.
      MERK: Det er å foretrekke å ofre musene ved livmorhalsforvridning under anestesi fordi eutanasi via CO2 innånding påvirker IVF og embryoutvikling23.
    5. Tilsett 1–5 μL spermsuspensjon fra inkubasjonsmediets grense til 200 μL-dråpen av HTF-mediet som inneholder COCer og inkuber dem i en CO2 inkubator i 3 timer.
    6. Vask oocytes med kalium-supplert simplex optimalisering medium (KSOM) 3x for å fjerne gjenværende sperm og cumulus celler.
    7. Kontroller den pronukleære formasjonen og karakteren av encellede embryoer ved hjelp av et omvendt mikroskop.
  2. Kryopreservation av encellede embryoer
    1. Inkuber e-celle embryoer i en 200 μL dråpe HTF som inneholder 20% FBS (ikke dekket med parafinvæske) i 10 min i en CO2 inkubator.
    2. Overfør 20–100 embryoer til 50 μL av 1 M dimetylsulfoksid (DMSO)-oppløsning24.
    3. Overfør 5 μL av en løsning som inneholder 100 embryoer inn i bunnen av et kryorør og avkjøl i 5 min ved 0 °C ved hjelp av en kjøler eller på is.
    4. Tilsett oppløsning på 45 μL DAP213 (2 M dimetylsulfoksid, 1 M acetamid og 3 M propylenglykol) langsomt langs rørveggen, kaprørene og oppbevar esi i 5 min i en kjøler eller på is ved 0 °C.
      MERK: Ikke fest hettene for tett for å fjerne dem enkelt under prøvetining.
    5. Oppbevar rørene raskt i flytende nitrogen.
  3. Tining av embryo
    1. Åpne lokket på kryorøret, kast gjenværende flytende nitrogen, og tilsett 900 μL av 0,25 M sukroseoppløsning forvarmet til 37 °C.
      MERK: Den 0,25 M sukroseoppløsningen må varmes opp til 37 °C på forhånd fordi bruken av kald oppløsning reduserer embryolevedyktigheten etter tining.
    2. Rør raskt for 10x og overføre innholdet i kryorøret til en plastfat.
      MERK: Pipetteringen skal utføres nøye, slik at ingen bobler genereres og skader embryoene.
    3. Vask morfologisk normale befruktede oocytter 2x i KSOM medium dekket med parafinvæske og hold dem i en CO2 inkubator til elektroporasjon.

3. Montering og elektroporasjon av CRISPR reagenser

MERK: For elektroporasjon brukte vi en platinaplateelektrode (høyde: 0,5 mm, lengde: 10 mm, bredde: 3 mm, gap: 1 mm) og en ett-trinns type elektroporator som ble beskrevet tidligere8 (Materialbord). En to-trinns type elektroporator kan også brukes (Table of Materials).

  1. Tilberedning og montering av CRISPR-reagenser
    1. Bestill CRISPR-reagenser (dvs. crRNA, tracrRNA og Cas9 protein) og ssODN hvis du utfører HDR-medierte redigeringseksperimenter (Material- og tilleggstabell 1).
    2. Forbered glødeløsningen som følger.
      1. Forbered 1 μg/μL crRNA og 1 μg/μL tracrRNA i Redusert serum minimal terite medium oppløsning (Materialtabellen), og tilsett 6 μL av hver løsning til 42 μL av nukleoskefri buffer.
      2. Inkuber blandingen i den tørre varmeren ved 95 °C i 3 min og avkjøl ved RT i 5 min.
      3. Forbered 1 μg/μL HiFi Cas9-protein fortynnet i Opti-MEM I og tilsett 6 μL til forrige blanding for et totalt volum på 60 μL.
      4. Når du utfører HDR-medierte redigeringseksperimenter, legger du til 6 μL av 1 μg/μL ssODN. Fordi det endelige volumet skal være 60 μL, bruk 36 μL n kjernefritt vann i trinn 3,1,2,1.
        MERK: Den endelige konsentrasjonen av crRNA, tracrRNA, Cas9 protein og ssODN vil være 100 ng/μL.
      5. Overfør opptil 100 embryoer til 25 μL av den endelige blandingen (RNP-kompleks) i ett hulllysbildeglass og inkuber dem ved 37 °C i 10 min.
  2. Elektroporasjon
    1. Fyll elektrodegapet med 6 μL av den nye blandingen av CRISPR-reagenser og tilsett 20–25 embryoer til blandingen.
      MERK: Det er viktig å unngå kontakt mellom embryoene og elektroporasjonselektroden, som kan skade embryoer under elektriske pulser.
    2. Utfør elektroporasjonen under følgende forhold for en ett-trinns type elektroporator:
      Spenning: 25 V, Pulsretning (Pd) +
      PÅ: 3 ms, AV: 97 ms
      Repetisjoner: 5x
      MERK: Elektroporasjon bør utføres ikke mer enn 1 h etter tining for å sikre at genomredigering skjer før den første DNA-replikasjonen for å forhindre mosaikkisme.
    3. For en to-trinns type elektroporator, angi forholdene som følger:
      Poring Puls = 40V, Pd +
      PÅ = 1 eller 2,5 ms; Pulsintervall = 50 ms
      Gjentar: 4x, Forfall 10%

      Overføringspuls = 5 eller 7V; Pd +/-.
      PÅ: 50 ms; Pulsintervall = 50 ms.
      Repetisjoner = 5x; Forfall = 40%.
      MERK: Det er viktig å justere volumet for å opprettholde impedansen innenfor det spesifikke området som er angitt av produsenten.
    4. Vask embryoene 3x med modifisert Krebs-Ringer Bicarbonate Buffer 2 (M2) medium etterfulgt av to vasker med en dråpe KSOM medium dekket med parafinvæske.
    5. Inkuber de vasket embryoene (i KSOM medium) i en CO2 inkubator over natten for videre transplantasjon.

4. Embryooverføring

  1. Forbered pseudopregnant kvinnelige mus. Mate ICR hunnmus (3–6 måneder) med vasectomiserte hannmus 1 dag før embryooverføringen (ET).
    MERK: Mus bør kontrolleres neste morgen for en kopulerende plugg. Musene med en plugg anses pseudopregnant og kan brukes til ET.
  2. Aspirer luft og KSOM (uten parafinvæske) i alternative intervaller på 2–3 mm i et glasskapillær som markør for vellykket implantasjon.
  3. Introduser 20–24 embryoer i en 200 μL dråpe KSOM (uten parafinvæske) og trekk 10–12 embryoer inn i glasskapillæren for implantasjon i hver ovidukt.
  4. Bedøve de kvinnelige musene ved isofluran (inhalasjon) eller en IP-injeksjon av en oppløsning som kombinerer medetomidin/midazolam/butorphanol (henholdsvis 0,3 mg/kg, 4,0 mg/kg og 5,0 mg/kg). Plasser den bedøvede musen på ventralsiden på en varmepute. Beskytt øynene til den bedøvede musen med en fuktighetsgivende gel.
  5. Barber langs den nedre delen av rygglinjen og desinfiser området med povidonjod etterfulgt av med 70% etanol.
  6. Lag en lang ~ 1 cm snitt parallelt med dorsal midtlinjen.
  7. Ta ut ovidukten og legg på en steril plastdrapere. Hold den fuktig ved hjelp av varm steril saltvann.
  8. Plasser ovidudensen under stereoskopisk mikroskop.
  9. Lag et hull inn i veggen av ovidudensen mellom infundibulum og ampulla noen få millimeter oppstrøms av ampulla av mikrofjærsaks.
  10. Sett spissen av glasskapillæren som inneholder embryoene inn i hullet og blås forsiktig inn i munnstykket på kapillærholderen for å utvise embryoene til en luftboble er synlig i ampullaen.
    MERK: Overfør mellom 10–12 embryoer per ovidukt.
  11. Trekk glasskapillæren ut av oviduktveggen og skyv det reproduktive organet forsiktig tilbake i kroppshulen.
  12. Gjenta forrige prosess for å introdusere embryoene i den andre ovidukten.
  13. Ved endt behandling av ET, suturerperitoneumet med et enkelt avbrutt suturmønster (50, absorberbare, flettede syntetiske suturer) og deretter huden med et enkelt avbrutt mønster eller et begravet subkutant avbrutt stingmønster (60 ikke-absorberbare, monosyntetiske suturer).
  14. Hold musen varm på en 37 °C oppvarmingsplate til den gjenoppretter fra anestesi.
  15. Overvåk dyrets helse daglig i 7 dager etter operasjonen.

5. Genotyping og sekvensanalyse

  1. Genomisk DNA-ekstraksjon
    MERK: Vi brukte NucleoSpin-vevsDNA-ekstraksjonssett for å trekke ut det genomiske DNA fra musørevev etter produsentens anbefalinger.
    1. Tilsett 180 μL buffer T1 og 25 μL Proteinase K-oppløsning til prøven og bland ved å vortexing i 10 s.
    2. Inkuber ved 56 °C i 2 timer eller til fullstendig lysis er oppnådd. Vortex i 10 s hver 30 min av inkubasjonen.
    3. Tilsett 200 μL buffer B3, vortex kraftig i 30 s, og inkuber ved 70 °C i 10 min.
    4. Tilsett 210 μL 100% etanol til prøven og virvel kraftig.
    5. Plasser én vevskolonne i et samlingsrør for hver prøve, og bruk prøven på kolonnen.
    6. Sentrifuge i 1 min ved 11.000 x g, kast gjennomstrømningen, og plasser kolonnen tilbake i oppsamlingsrøret.
    7. Tilsett 500 μL buffer BW for å vaske prøven (første vask), sentrifuge i 1 min ved 11 000 x g,kast gjennomstrømningen og plasser kolonnen tilbake i oppsamlingsrøret.
    8. Tilsett 600 μL buffer B5 i kolonnen (2. vask), sentrifuge i 1 min ved 11 000 x g,kast gjennomstrømningen og plasser kolonnen tilbake i oppsamlingsrøret.
    9. Sentrifugerkolonnen i 1 min ved 11 000 x g for å tørke silikamembranen og plassere NucleoSpin-vevskolonnen i et 1,5 ml mikrosentrifugerør.
    10. Tilsett 100 μL buffer BE, inkuber ved romtemperatur i 1 min, deretter sentrifuge 1 min ved 11.000 x g.
  2. PCR forsterkning og rensing
    1. Design primere ved hjelp av primer3 plus nettstedet (https://primer3plus.com/) for å forsterke en 400-500 bp sekvens rundt den målrettede locus.
    2. Design en ny PCR-protokoll og test den empirisk.
    3. Rense PCR-produktet for å fjerne uønskede enzymer, nukleotider, primere og bufferkomponenter. En standard rensemetode kan brukes som følger.
      1. Tilsett 50 μL fenol til 50 μL av PCR-produktene og bland ved virvlende.
      2. Sentrifuge i 1 min på 11.000 x g og overføre det øvre gjennomsiktige laget til et nytt rør.
      3. Tilsett 120 μL av 99,5% etanol og 20 μL av 5 M ammoniumacetat og vortex i 30 s.
      4. Oppbevares ved RT i 10 min og sentrifuge på 11 000 x gr i 10 min.
      5. Kast supernatanten og vask DNA-pelleten med 1 ml 70% etanol.
      6. Tørk pelleten ved RT i 10 min og oppløs i 10 μL rnasefritt vann.
        MERK: PCR kolonnebaserte rensesett er rekommentert fordi fenol er giftig for mennesker.
  3. Sanger sekvensering
    1. Kjør DNA-kvantifiseringsanalyse (se materialtabell) for å kvantifisere den rensede PCR-ampliconen.
    2. Send PCR-produkt(er) og sekvensering primer(r) til en sekvenseringstjenesteleverandør.
    3. Analyser sekvensen ved hjelp av de tilgjengelige nettstedene på nettet.
      MERK: I denne studien ble CRISP-ID25 (http:/crispid.gbiomed.kuleuven.be/) brukt til sekvensanalyse.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Vår modifiserte metode for kryopreservation av encellede embryoer, inkludert inkubasjon i HTF som inneholder 20% FBS i 10 min etterfulgt av kryopreservation i 1 M DMSO og DAP213 løsning, forbedret utviklingshastigheten til fryse-tinte embryoer i to-celle stadium (Figur 1, p = 0.009, Student t-test). De frysetinte embryoene ble brukt til produksjon av GM-mus og elektroporasjonsforhold ble optimalisert: fem repetisjoner av 25 V med 3 ms pulser og 97 ms intervaller ved hjelp av en elektroporator som beskrevet i protokollseksjonen. Anvendelsen av protokollen ble kontrollert av generering av albino Tyrosinase genet (Tyr) knockout mus (Figur 2). For å gjøre dette ble gRNA-målretting exon 2 designet (figur 2A) og CRISPR-reagenser ble utarbeidet som beskrevet i protokollseksjonen. Redigeringsverktøyene ble elektroporated innen 1 tettering av embryo for å sikre genomredigering skjedde før den første replikeringen av genomet og dermed forhindret mosaikkisme i grunnleggerne (Figur 2B). Alle de genererte musene var albino, og bare en mus var mosaikk, med en frakk med hvite og svarte flekker (Figur 2C). Alle albinomusene som huser to forskjellige mutantalleler (heterozygous mutasjon) bortsett fra en mus som bare huser en allele (homozygot mutasjon) er vist i figur 2E. Det kan konkluderes med at vår metode kan gi en redigeringseffektivitet på nær 100% med lav mosaikkhastighet som bekreftet ved sekvenseringsanalyse samt pelsfarge (Figur 2C-E).

Deretter ble reproduserbarheten av protokollen kontrollert av generering av flere linjer med knockout og knock-in mus. Som vist i tabell 1,protokollen kan generere knockout og knock-in mus med høy effektivitet og lave mosaikk priser. De fleste av de genererte F0-musene ble parret med ville type C57BL/6J-mus for å bekrefte germlineoverføring av muterte alleler til F1-generasjonene. Som forventet var alle F1 avkom av homozygot F0 musene heterozygous, som inneholder en mutant allele og en vill type allele. Ingen ulike mutasjoner ble observert mellom genotyping av grunnleggerne og deres generasjoner. Den beskrevne protokollen genererte GM-mus i løpet av kort tid (dvs. ~4 uker) som vist i arbeidsflyten til protokollen i figur 3.

Figure 1
Figur 1: Føtal storfeserum (FBS) forbedret utviklingsfrekvensen for toceller stounder. Antall FBS + embryoer var 286 (eksperimentet ble gjentatt 3x), og antall FBS- embryoer var 272 (eksperimentet ble gjentatt 3x). Data presenteres som gjennomsnitt ± SEM. Dette tallet er gjengitt fra Darwish M et al.16 med tillatelse. Vennligst klikk her for å se en større versjon av denne figuren.

Figure 2
Figur 2: Generasjon av Tyr knockout mus med høy effektivitet og lav mosaikk hastighet. Dette tallet er endret fra Darwish M et al.16 med tillatelse. (A) Skjematisk illustrasjon som viser utformingen av gRNA. PAM-sekvensen vises i rødt. (B) Illustrasjon som viser tidspunktet for elektroporasjon for frysetinte embryoer, representerer det gule symbolet elektroporasjonstid. (C) Representative bilder av de genererte Tyr knockout mus. (D) Sekvensanalyse av forskjellige alleler av Tyr knockout mus. Målsekvensen er merket med rødt og bindestreker indikerer sletting av nukleotider i mutantallelene. WT = vill type M = mutant allele. (E) En representativ del av kromatogram av albino musen som inneholder M1 allele vises i D. Vennligst klikk her for å vise en større versjon av denne figuren.

Figure 3
Figur 3: Arbeidsflyt av protokollen for generering av GM-mus. Det første trinnet var utarbeidelsen av kryobevarte embryoer. Kvinnelige C57BL/6J-mus ble superovulated, først ved PMSG injeksjon, deretter 48 timer senere ved hCG injeksjon. COCer ble samlet inn 16 timer senere og utsatt for IVF med spermatozoa samlet inn fra mannlige C57BL/6J-mus. Befruktede oocytter ble kryobevart og lagret i flytende nitrogen til det var nødvendig. Det andre trinnet inkluderte tining av embryoer og elektroporasjon. Kryobevarte embryoer ble tint og CRISPR reagenser (dvs. tracrRNA, crRNA og Cas9 protein) ble montert og elektrokert innen 1 h etter tining av embryoene. Det tredje trinnet inkluderte embryooverføring og fødselen av mus. Dagen etter elektroporasjon ble tocellede embryoer overført til ovidukten av pseudogravide kvinnelige mus for å generere genmodifiserte mus som senere ble genoskrevet ved hjelp av Sanger sekvensering for å bekrefte redigeringseffektiviteten. Tiden og innsatsen som kreves for å forberede befruktede oocytter før hvert eksperiment (trinn 1) kan forkortes hvis et stort antall kryobevarte embryoer er forberedt på forhånd. Denne figuren er tilpasset fra Darwish M et al.16Vennligst klikk her for å se en større versjon av denne figuren.

Muterte mus Elektropoerte embryoer 2-celle embryoer Overførte embryoer Valper (%) Muterte mus (%) Nei av mosaikkmus
Tyr KO 124 84 48 12 (25) 100 1
Glrb KO 151 94 40 6 (15) 100 0
Slc39a6 KO 48 25 25 5 (20) 100 0
Bag3 KI 233 84 20 3 (15) 50 1
Camk2a KI 124 70 70 14 (20) 64.3 0

Tabell 1: Produksjon av flere linjer med GM-mus ved hjelp av frysetinte embryoer med C57BL/6J-bakgrunn.

Tilleggstabell 1. Vennligst klikk her for å laste ned denne tabellen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Den beskrevne protokollen gjør det mulig for generering av GM-mus med høy effektivitet og lave mosaikkhastigheter (Tabell 1). Det gjør det mulig for forskere uten avanserte embryomanipulasjonsferdigheter å lage muterte mus lett fordi det utnytter de nyeste og mest nyttige fremskrittene innen både reproduktiv ingeniør- og genomredigeringsteknologier: CRISPR/Cas9 ribonucleoprotein (RNP) og elektroporasjon til frysetinte embryoer. Disse fremskrittene tilrettelagt og fremskyndet generering av GM-musene. Som beskrevet i figur 3, tar det ~ 4 uker å generere GM-musene. Sammenlignet med andre protokoller ved hjelp av lignende tilnærminger26, er vår metode overlegen når det gjelder effektivitet, fødselsrate og mosaikkisme.

Inkubasjonen av encellede embryoer i FBS før kryopreservation er avgjørende for å forbedre utviklingshastigheten til embryoene. Elektroporasjonsforholdene til de kryobevarte embryoene, beskrevet i protokollen, tillater et kompromiss mellom redigeringseffektiviteten til CRISPR-reagenser og embryoenes overlevelse. Faktisk kan strengere eller mildere forhold påvirke utviklingshastigheten til embryoene og redigeringseffektiviteten, henholdsvis16. Tidspunktet for elektroporasjonen (Figur 2B) er avgjørende for å overvinne mosaikkismen hos grunnleggere og sikre at genommodifikasjon oppstår i nærvær av bare to alleler. Dette er i samsvar med tidligere rapporter som viser at tidlig stadium elektroporasjon kan produsere ikke-mosaikk mutanter17. I tillegg reduserer bruken av RNP i stedet for gRNA/mRNA mosaikkhastigheten og forbedrer redigeringseffektiviteten17.

Den beskrevne protokollen har flere fordeler. Først genererer det mutantmusene innen kort tid (~4 uker). For det andre er det en svært effektiv og robust protokoll; flere linjer med knockout (KO) og knock-in (KI) mus ble generert med høy mutasjonsrate (KO = 100%, KI = 50 til 64,3%). For det tredje er det praktisk og kostnadseffektivt. Bruken av komplett syntetisk crRNA, tracrRNA, ssODN og Cas9 protein eliminerer behovet for kjedelig fremstilling av Cas9 vektorer og in vitro transkripsjon. I stedet tillater det forskere å bare bruke kommersielle reagenser og standardutstyr. For det fjerde bruker den ikke mikroinjeksjon, noe som krever høye tekniske ferdigheter. For det femte reduserer det mosaikkismen hos grunnleggere, og fører dermed til mer effektiv germline overføring av de redigerte allelene, overvinne den kompliserte genotypiske analysen av mosaikkmusene. Til slutt er denne protokollen effektiv med C57BL/6J innavlet stamme, som unngår bruk av F1 hybrider, og dermed behovet for å utføre mange backcrosses for å kvitte seg med genetisk kompleksitet. Genotyping av F1 generasjoner bekreftet nøyaktig germline overføring. Det anbefales imidlertid ikke å studere fenotypene til F0-musene på grunn av allele kompleksitet og den misvisende prediksjonen av genotyping av etterfølgende generasjon ekstrapolert fra genotyping av F0 grunnleggere14,27.

Det er av hovedbetydning å utnytte bruken av frysetinte embryoer i genomredigering av ikke-menneskelige primater og store dyr som griser og sauer, som ikke alltid er lett tilgjengelige. Metodene for embryofrysing varierer sterkt avhengig av dyreartene. Derfor tror vi at vår kryopreservation protokoll bare gjelder for mus. På den annen side er vår protokoll potensielt anvendelig for å bruke andre tekniske kjerner enn Cas9 for generering av GM-mus, fordi elektroporasjon tidligere har blitt rapportert å introdusere andre kjerner som Cas12a i embryoet effektivt28,29.

En begrensning av protokollen er den nøyaktige integreringen av et langt transgene i genomet, som anses som vanskelig i elektroporasjonsbaserte protokoller. En potensiell løsning ble imidlertid rapportert: integreringen av transgenes opp 4,9 Kb i musegenomet ble vellykket utført ved å kombinere elektroporasjon med et adeno-assosiert virus (AAV)-mediert HDR-donorleveringssystem30, som bekrefter en tidligere publikasjon31. Den potensielle forekomsten av bivirkninger utenfor mål er også en stor bekymring for bruk av CRISPR/Cas9-teknologi. Vi har ikke utført hele genomsekvensering av de redigerte musene for å utelukke den potensielle off-target effekten. Vi har imidlertid brukt CRISPR-verktøy som er rapportert for å redusere off-target-effekten, for eksempel RNP32. Videre brukte vi en high-fidelity Cas9-variant som reduserer off-target redigering betydelig uten å ofre on-target ytelse33. Vi designet også gRNAer ved hjelp av CRISPRdirect-programvare (https://crispr.dbcls.jp), noe som bør resultere i målsekvenser med minimerte off-target nettsteder19. For å bekrefte genotype-fenotype årsakssammenheng og lindre bekymringene om off-target effekter, forskere bør generere flere redigerte mus av samme genotype ved hjelp av ulike gRNAs eller utføre tilbakekryssing av de genererte musene i flere generasjoner.

Knockoutmusene som genereres ved hjelp av NHEJ-mekanismen og frameshift mutasjoner har blitt mye brukt og viser relevante fenotyper. Avkortet gjenværende protein kan imidlertid eksistere på grunn av enten oversettelsereinitiering eller hoppe over den redigerte exon34,35. Derfor, for nøyaktig å tolke fenotypene, er karakterisering av gjenværende proteinfunksjon eller uttrykk nødvendig. Genereringen av komplette genknockoutmus som bruker mer enn én gRNA ville være et godt alternativ. Imidlertid bør det legges særlig vekt for å bekrefte at genet ikke inneholder intronic-regioner transkribert til ikke-kodede RNAer, som kan ha regulatoriske funksjoner og dermed komplisere fenotypisk analyse.

I denne studien viser vi en enkel protokoll der mange forskere kan generere genmodifiserte mus i 4 uker eller mindre. Ved å kombinere bruken av frysetinte embryoer og elektroporasjon, gjør vi utarbeidelsen av musemodeller av menneskelige sykdommer enkelt, raskt og effektivt.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ingen relevante finansielle avsløringer.

Acknowledgments

Vi ønsker å takke Hitomi Sawada og Elizabeth Garcia for dyrepleie. Dette arbeidet ble støttet av KAKENHI (15K20134, 17K11222, 16H06276 og 16K01946) og Hokugin Research Grant (til H.N.), og Jichi Medical University Young Investigator Award (til H.U.). Otsuka Toshimi Scholarship Foundation støttet MD.

Materials

Name Company Catalog Number Comments
0.25 M Sucrose ARK Resource Co., Ltd. (Kumamoto, Japan) SUCROSE
1 M DMSO ARK Resource Co., Ltd. (Kumamoto, Japan) 1M DMSO
Butorphanol Meiji Seika Pharma Co., Ltd. (Tokyo, Japan) Vetorphale 5mg
Cas9 protein: Alt-R® S.p. HiFi Cas9 Nuclease 3NLS Integrated DNA Technologies, Inc. (Coralville, IA) 1081060
C57BL/6J mice Japan SLC (Hamamatsu, Japan) N/A
DAP213 ARK Resource Co., Ltd. (Kumamoto, Japan) DAP213
FBS Sigma-Aldrich, Inc. (St. Louis, MO) ES-009-C
hCG MOCHIDA PHARMACEUTICAL CO., LTD (Tokyo, Japan) HCG Mochida 3000
HTF ARK Resource Co., Ltd. (Kumamoto, Japan) HTF
ICR mice Japan SLC (Hamamatsu, Japan) N/A
Isoflurane Petterson Vet Supply, Inc. (Greeley, CO) 07-893-1389
KSOM ARK Resource Co., Ltd. (Kumamoto, Japan) KSOM
LN2 Tank Chart Industries (Ball Ground, GA) XC 34/18
M2 ARK Resource Co., Ltd. (Kumamoto, Japan) M2
Medetomidine Nippon Zenyaku Kogyo Co.,Ltd. (Koriyama, Japan) 1124401A1060
Microscope Nikon Co. (Tokyo, Japan) SMZ745T
Midazolam Sandoz K.K. (Tokyo, Japan) 1124401A1060
Nuclease free buffer Integrated DNA Technologies, Inc. (Coralville, IA) 1072570
Nucleospin DNA extraction kit Takara Bio Inc (Kusatsu, Japan) 740952 .5
One-hole slide glass Matsunami Glass Ind., Ltd. (Kishiwada, Japan) S339929
One-step type Electroporator BEX Co., Ltd. (Tokyo, Japan) CUY21EDIT II
Paraffin Liquid NACALAI TESQUE Inc. (Kyoto, Japan) SP 26137-85
Platinum plate electrode BEX Co., Ltd. (Tokyo, Japan) LF501PT1-10, GE-101
PMSG ASKA Animal Health Co., Ltd (Tokyo, Japan) SEROTROPIN 1000
Povidone iodide Professional Disposables International, Inc. (Orangeburg, NY) C12400
Reduced-Serum Minimal Essential Medium: OptiMEM I Sigma-Aldrich, Inc. (St. Louis, MO) 22600134
Two-step type Electroporator Nepa Gene Co., Ltd. (Ichikawa, Japan) NEPA21

DOWNLOAD MATERIALS LIST

References

  1. Wang, H., et al. One-step generation of mice carrying mutations in multiple genes by CRISPR/cas-mediated genome engineering. Cell. 153, (4), 910-918 (2013).
  2. Jinek, M., et al. A programmable dual-RNA - guided DNA endonuclease in adaptive bacterial immunity. Science. 337, (6096), 816-822 (2012).
  3. Mali, P., et al. RNA-guided human genome engineering via Cas9. Science. 339, (6121), 823-826 (2013).
  4. Cong, L., et al. Multiplex genome engineering using CRISPR/VCas systems. Science. 339, (6121), 819-823 (2013).
  5. Doudna, J. A., Charpentier, E. The new frontier of genome engineering with CRISPR-Cas9. Science. 346, (6213), 1258096 (2014).
  6. Mashiko, D., et al. Generation of mutant mice by pronuclear injection of circular plasmid expressing Cas9 and single guided RNA. Scientific Reports. 3, 3355 (2013).
  7. Yen, S. T., et al. Somatic mosaicism and allele complexity induced by CRISPR/Cas9 RNA injections in mouse zygotes. Developmental Biology. 393, (1), 3-9 (2014).
  8. Kaneko, T., Mashimo, T. Simple genome editing of rodent intact embryos by electroporation. PLoS ONE. 10, (11), 1-7 (2015).
  9. Qin, W., et al. Efficient CRISPR/cas9-mediated genome editing in mice by zygote electroporation of nuclease. Genetics. 200, (2), 423-430 (2015).
  10. Kaneko, T., Sakuma, T., Yamamoto, T., Mashimo, T. Simple knockout by electroporation of engineered endonucleases into intact rat embryos. Scientific Reports. 4, 6382 (2014).
  11. Hashimoto, M., Takemoto, T. Electroporation enables the efficient mRNA delivery into the mouse zygotes and facilitates CRISPR/Cas9-based genome editing. Scientific Reports. 5, 11315 (2015).
  12. Chen, S., Lee, B., Lee, A. Y. F., Modzelewski, A. J., He, L. Highly efficient mouse genome editing by CRISPR ribonucleoprotein electroporation of zygotes. Journal of Biological Chemistry. 291, (28), 14457-14467 (2016).
  13. Modzelewski, A. J., et al. Efficient mouse genome engineering by CRISPR-EZ technology. Nature Protocols. 13, (6), 1253-1274 (2018).
  14. Teixeira, M., et al. Electroporation of mice zygotes with dual guide RNA/Cas9 complexes for simple and efficient cloning-free genome editing. Scientific Reports. 8, 474 (2018).
  15. Nakagawa, Y., et al. Production of knockout mice by DNA microinjection of various CRISPR/Cas9 vectors into freeze-thawed fertilized oocytes. BMC Biotechnology. 15, (1), 1-10 (2015).
  16. Darwish, M., et al. Rapid and high-efficient generation of mutant mice using freeze-thawed embryos of the C57BL/6J strain. Journal of Neuroscience Methods. 317, 149-156 (2019).
  17. Hashimoto, M., Yamashita, Y., Takemoto, T. Electroporation of Cas9 protein/sgRNA into early pronuclear zygotes generates non-mosaic mutants in the mouse. Developmental Biology. 418, (1), 1-9 (2016).
  18. Sakamoto, W., Kaneko, T., Nakagata, N. Use of frozen-thawed oocytes for efficient production of normal offspring from cryopreserved mouse spermatozoa showing low fertility. Comparative Medicine. 55, (2), 136-139 (2005).
  19. Naito, Y., Hino, K., Bono, H., Ui-Tei, K. CRISPRdirect: Software for designing CRISPR/Cas guide RNA with reduced off-target sites. Bioinformatics. 31, (7), 1120-1123 (2015).
  20. Torres-Perez, R., Garcia-Martin, J. A., Montoliu, L., Oliveros, J. C., Pazos, F. WeReview: CRISPR Tools-Live Repository of Computational Tools for Assisting CRISPR/Cas Experiments. Bioengineering. 6, (3), 63 (2019).
  21. Okamoto, S., Amaishi, Y., Maki, I., Enoki, T., Mineno, J. Highly efficient genome editing for single-base substitutions using optimized ssODNs with Cas9-RNPs. Scientific Reports. 9, 4811 (2019).
  22. Takeo, T., Nakagata, N. Superovulation using the combined administration of inhibin antiserum and equine chorionic gonadotropin increases the number of ovulated oocytes in C57BL/6 female mice. PLoS ONE. 10, (5), 1-11 (2015).
  23. Wuri, L., Agca, C., Agca, Y. Euthanasia via CO2 inhalation causes premature cortical granule exocytosis in mouse oocytes and influences in vitro fertilization and embryo development. Molecular Reproduction and Development. 86, (7), 825-834 (2019).
  24. Nakagata, N. High survival rate of unfertilized mouse oocytes after vitrification. Journal of Reproduction and Fertility. 87, (2), 479-483 (1989).
  25. Dehairs, J., Talebi, A., Cherifi, Y., Swinnen, J. V. CRISP-ID: Decoding CRISPR mediated indels by Sanger sequencing. Scientific Reports. 6, 28973 (2016).
  26. Nakagawa, Y., Sakuma, T., Takeo, T., Nakagata, N., Yamamoto, T. Electroporation-mediated genome editing in vitrified/warmed mouse zygotes created by ivf via ultra-superovulation. Experimental Animals. 67, (4), 535-543 (2018).
  27. Nakajima, K., Nakajima, T., Takase, M., Yaoita, Y. Generation of albino Xenopus tropicalis using zinc-finger nucleases. Development Growth and Differentiation. 54, (9), 777-784 (2012).
  28. Hur, J. K., et al. Targeted mutagenesis in mice by electroporation of Cpf1 ribonucleoproteins. Nature Biotechnology. 34, 807-808 (2016).
  29. Dumeau, C. E., et al. Introducing gene deletions by mouse zygote electroporation of Cas12a/Cpf1. Transgenic Research. 28, (5-6), 525-535 (2019).
  30. Chen, S., et al. CRISPR-READI: Efficient Generation of Knockin Mice by CRISPR RNP Electroporation and AAV Donor Infection. Cell Reports. 27, (13), 3780-3789 (2019).
  31. Mizuno, N., et al. Intra-embryo Gene Cassette Knockin by CRISPR/Cas9-Mediated Genome Editing with Adeno-Associated Viral Vector. iScience. 9, 286-297 (2018).
  32. Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. Highly Efficient RNA-guide genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Research. 24, (6), 1012-1019 (2014).
  33. Vakulskas, C. A., et al. A high-fidelity Cas9 mutant delivered as a ribonucleoprotein complex enables efficient gene editing in human hematopoietic stem and progenitor cells. Nature Medicine. 24, (8), 1216-1224 (2018).
  34. Rodriguez-Rodriguez, J. A., et al. Distinct Roles of RZZ and Bub1-KNL1 in Mitotic Checkpoint Signaling and Kinetochore Expansion. Current Biology. 28, (21), 3422-3429 (2018).
  35. Smits, A. H., et al. Biological Plasticity Rescues Target Activity in CRISPR Knockouts. Nature Methods. 16, 1087-1093 (2019).
Bruk av frysetinte embryoer for høyeffektivitetsproduksjon av genmodifiserte mus
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Nishizono, H., Darwish, M., Uosaki, H., Masuyama, N., Seki, M., Abe, H., Yachie, N., Yasuda, R. Use of Freeze-thawed Embryos for High-efficiency Production of Genetically Modified Mice. J. Vis. Exp. (158), e60808, doi:10.3791/60808 (2020).More

Nishizono, H., Darwish, M., Uosaki, H., Masuyama, N., Seki, M., Abe, H., Yachie, N., Yasuda, R. Use of Freeze-thawed Embryos for High-efficiency Production of Genetically Modified Mice. J. Vis. Exp. (158), e60808, doi:10.3791/60808 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter