Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Использование замороженных оттаять эмбрионов для высокоэффективного производства генетически модифицированных мышей

doi: 10.3791/60808 Published: April 2, 2020
* These authors contributed equally

Summary

Здесь мы представляем модифицированный метод криоконсервации одноклеточных эмбрионов, а также протокол, который соединяет использование замороженных оттаяющих эмбрионов и электропорации для эффективного поколения генетически модифицированных мышей.

Abstract

Использование генетически модифицированных (ГМ) мышей стало решающим фактором для понимания функции генов и расшифровки основных механизмов заболеваний человека. Система CRISPR/Cas9 позволяет исследователям изменять геном с беспрецедентной эффективностью, точностью и простотой. Используя эту технологию, исследователи ищут быстрый, эффективный и простой протокол для генерации ГМ мышей. Здесь мы внедряем усовершенствованный метод криоконсервации одноклеточных эмбрионов, что приводит к более высокой скорости развития замороженных оттаять эмбрионов. Комбинируя его с оптимизированными условиями электропорации, этот протокол позволяет в течение короткого времени выдвигать выбывающих и стук-в мышей с высокой эффективностью и низкими мозаичными ставками. Кроме того, мы показываем пошаговый разъяснение нашего оптимизированного протокола, охватывающего подготовку реагента CRISPR, экстракорпоральное оплодотворение, криоконсервацию и оттаивание одноклеточных эмбрионов, электропорацию реагентов CRISPR, генерацию мышей и генотипирование основателей. Используя этот протокол, исследователи должны быть в состоянии подготовить ГМ мышей с беспрецедентной легкостью, скоростью и эффективностью.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Кластерные регулярно межпространственные короткие палиндромные повторы (CRISPR)/CRISPR-ассоциированный белок 9 (Cas9) система является научным прорывом, который обеспечивает беспрецедентную целевую модификацию вгеноме 1. Система CRISPR/Cas9 состоит из белка Cas9 и направляющей РНК (gRNA) с двумя молекулярными компонентами: целевой РНК CRISPR (crRNA) и трансактивировавской РНК CRISPR (tracrRNA)2 . GRNA направляет белок Cas9 к специфическому локусу в геноме, 20 нуклеотидам, дополняют crRNA и примыкают к смежным мотивам протосказера (PAM). Cas9 белка связывается с целевой последовательности и вызывает двойные проломы (DSBs), которые восстанавливаются либо ошибка подверженных nonhomologous конец присоединения (NHEJ) или высокой точности гомологии направлены ремонт (HDR)3,4,5. NHEJ приводит к вставкам или/и удалениям (индельям) и, следовательно, к потере функции гена при целевой последовательности кодирования. HDR приводит к точному редактированию генома в присутствии шаблона ремонта, содержащего амологические последовательности3,,4,,5. NHEJ и HDR были использованы для создания нокаута и стук в мышей, соответственно.

В то время как система CRISPR/Cas9 заметно ускорила генерацию ГМ-мышей с выдающейся эффективностью и точностью, ученые, применяющие эти методы, часто сталкиваются с техническими проблемами. Во-первых, обычные протоколы требуют микроинъекции для внедрения инструментов редактирования CRISPR в пронуклеус оплодотворенных яйцеклеток6,,7. Этот метод занимает много времени и обычно требует обширной подготовки. Таким образом, несколько групп заменили микроинъекцию электропорацией88,9,,10,,11,,12,,13. Однако в ранних протоколах электропорации для электропорации использовались свежие эмбрионы. Это вызвало еще одну проблему, потому что подготовка свежих эмбрионов перед каждым экспериментом трудно14.

Недавно мы и другие объединили использование замораживающих оттепели эмбрионов и электропорации для редактирования генома, что облегчает генерацию ГМ мышей15,16. Этот протокол позволяет исследователям без предварительных искусств манипуляции зародыша быстро произвести животные модели людских заболеваний с высокой эффективностью. Протокол также значительно снижает практические проблемы в генерации ГМ мышей, такие как генетическая неоднородность у основателей16. Чтобы преодолеть мозаичность, мы выполняем электропорацию реагентов CRISPR в течение 1 ч после оттаивания эмбриона, чтобы обеспечить редактирование до первой репликации генома. Другое улучшение включает в себя использование белка Cas9 вместо Cas9 мРНК для уменьшения нежелательных мозаики17. Кроме того, мы разработали оптимальный метод криоконсервации одноклеточных эмбрионов, который увеличивает скорость развития до двухклеточной стадии16: использование сыворотки крупного рогатого скота плода (FBS) значительно улучшает выживаемость замороженных оттаять яоцитов после оплодотворения, возможно, тем же механизмом, который делает замораживание оттаяли неоплодное ооциты болееустойчивыми.

Здесь мы представляем всеобъемлющий протокол для генерации ГМ-мышей с использованием замороженных оттаять эмбрионов, в том числе модифицированный метод криоконсервации одноклеточных эмбрионов C57BL/6J. Она включает в себя 1) дизайн gRNA, подготовку реагента CRISPR и сборку; 2) ЭКО, криоконсервация и оттаивание одноклеточных эмбрионов; 3) Электропорация реагентов CRISPR в замораживание оттаяли эмбрионов; 4) Перенос эмбриона в яйцеклетку псевдобеременных самок мышей; и 5) Генотипирование и анализ последовательности животных-основателей F0.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Все процедуры по уходу за животными и процедуры, проведенные в данном исследовании, были проведены в соответствии с правилами и положениями Руководства по уходу и использованию лабораторных животных. Экспериментальный протокол был одобрен Комитетом по уходу за животными лабораторных животных Университета Тояма, Токийского университета, Университета Джичи и Института неврологии Макса Планка Флориды. Информация обо всех реагентах представлена в таблице материалов.

1. Конструкция реагентов CRISPR

  1. CrRNA дизайн
    1. Посетите CRISPR direct19 (https://crispr.dbcls.jp/) для разработки конкретных CRRNс с уменьшенными внецелевых участков.
      ПРИМЕЧАНИЕ: Есть много других полезных инструментов для разработки crRNA20 (https://bioinfogp.cnb.csic.es/tools/wereview/crisprtools/).
    2. Вставьте целевую нуклеотидную последовательность и внедивай следующие изменения:
      Требование последовательности PAM - NGG
      Проверка специфичности - Геном мыши (Mus musculus), GRCm38/mm10 (декабрь 2011)
      ПРИМЕЧАНИЕ: В качестве примера, для создания тирозиназы (Тир) нокаут мышей, экзон 2 (нуклеотидная последовательность от 9476-9692) был мишенью.
    3. Нажмите Дизайн, и для весьма конкретных хитов, знак Показать Высокоспецифическая цель только.
    4. Чтобы уменьшить потенциальные внецелевые эффекты, выберите целевую последовательность с наименьшим значением в столбцах «12 mer'PAM» и «8 mer'PAM».
      ПРИМЕЧАНИЕ: В этих столбцах("1") указывается, что последовательность имеет только один идеальный матч с намеченным целевым сайтом и числа, превышающее один, указывают на наличие потенциальных внецелевых участков.
    5. Закажите полученные олигонуклеотиды у компаний по синтезу CRRNA(Supplimentary Table 1).
      ПРИМЕЧАНИЕ: Для гена exon 2 Tyr была использована следующая целевая последовательность: GGACCACTACTTACGTAATCC, с «TGG как последовательность PAM » (Рисунок 2A).
  2. Одиночный нить олигодеоксинуклеотида (ssODN) дизайн для HDR-опосредованных экспериментов редактирования (т.е. стук-в мышей поколения).
    1. Дизайн ssODN длина, чтобы быть около 80-180 bp в том числе 30-60 нуклеотидов (nt) гомологических оружия с обеих сторон.
      ПРИМЕЧАНИЕ: ssODN 75-85 nt длина, в том числе 30-35 nt гомологической руки и дополняют gRNA, показали высокую эффективность стук-в редактировании21.
    2. Вставьте предполагаемую модификацию и молчаливую мутацию в последовательности PAM или, если не возможно, на 5 "соседней базе PAM, чтобы заблокировать перерезку после редактирования генома.
      ПРИМЕЧАНИЕ: CRRNA и ssODN, используемые в данном исследовании, перечислены в дополнительной таблице 1.

2. Экстракорпоральное оплодотворение, криоконсервация эмбрионов и замораживание оттаивания

  1. Экстракорпоральное оплодотворение
    1. Superovulate C57BL/6J самок мышей (4 или 8-недельных) путем инъекции IP с беременной кобылы сыворотки гонадотропин (PMSG) следуют инъекции с 7,5 МЕ человека хорионический гонадотропин (HCG) после 48 ч.
      ПРИМЕЧАНИЕ: Количество овуляции яйцеклетки могут быть увеличены примерно в 3 раз с помощью ультра-суперовуляции22.
    2. Удалите кауда эпидидимиды из сексуально зрелых мышей C57BL/6J (3-5-месячный).
      ПРИМЕЧАНИЕ: Можно собирать сперматозоиды, не жертвуя мышами-самцами.
    3. Извлеките сгустки сперматозоидов с рассекающей иглой и инкубировать их в 200 л капли человеческой трубной жидкости (HTF) в ИНкубаторе CO2 для 1,5 ч для емки.
    4. Соберите кучевые ооцитные комплексы (COCs) из овидуков 16-18 ч после инъекции ХГЧ и инкубировать их в свежем 200 л капли HTF среды покрыты парафина жидкости в CO2 инкубатора (5% CO2, 37 кС) не более 2 ч.
      ПРИМЕЧАНИЕ: Предпочтительно пожертвовать мышей шейки матки дислокации под наркозом, потому что эвтаназия через CO2 ингаляции влияет на ЭКО и эмбриона развития23.
    5. Добавьте 1-5 л суспензии спермы от границы инкубационного среднего к 200-м л капли htF среды, содержащей КОК, и инкубировать их в ИНкубатор CO2 в течение 3 ч.
    6. Вымойте яйцеклетки с калием дополненпростой простаков оптимизации среды (KSOM) 3x, чтобы удалить оставшиеся спермы и кучевые клетки.
    7. Проверьте проядерное образование и сорт одноклеточных эмбрионов с помощью перевернутого микроскопа.
  2. Криоконсервация одноклеточных эмбрионов
    1. Инкубировать одноклеточные эмбрионы в 200 л капли HTF, содержащей 20% FBS (не покрытые парафина жидкости) в течение 10 минут в CO2 инкубатора.
    2. Передача 20-100 эмбрионов на 50 л раствора диметилсульксида (ДМСО)24.
    3. Передача 5 qL раствора, содержащего 100 эмбрионов в нижней части криотубежа и охладить в течение 5 минут при 0 градусов по Цельсию с помощью охладителя или на льду.
    4. Добавить 45 кл DAP213 (2 М диметил сульфоксид, 1 М ацетамида, и 3 М пропилен гликоль) раствор медленно вдоль стенки трубки, крышка труб, и держать в течение 5 минут в охладитель или на льду при 0 градусов по Цельсию.
      ПРИМЕЧАНИЕ: Не закрепите крышки слишком плотно, чтобы удалить их легко во время оттаивания образца.
    5. Хранить трубки быстро в жидком азоте.
  3. Оттаивание эмбрионов
    1. Откройте крышку криотубеста, отбросьте оставшийся жидкий азот и добавьте 900 л сахарозного раствора 0,25 М, разогретого до 37 градусов по Цельсию.
      ПРИМЕЧАНИЕ: Раствор сахарозы 0,25 М должен быть подогрет до 37 градусов по Цельсию заранее, потому что использование холодного раствора снижает жизнеспособность эмбриона после оттаивания.
    2. Pipet быстро в течение 10x и передать содержимое криотубеста в пластиковую тарелку.
      ПРИМЕЧАНИЕ: Пипетка должна быть выполнена тщательно, так что никаких пузырьков генерируются и повреждения эмбрионов.
    3. Вымойте морфологически нормальные оплодотворенные яйцеклетки 2x в среде KSOM, покрытой парафинами и держите их в инкубаторе CO2 до электропорации.

3. Сборка и электропорация реагентов CRISPR

ПРИМЕЧАНИЕ: Для электропорации мы использовали электрод платиновой пластины (высота: 0,5 мм, длина: 10 мм, ширина: 3 мм, зазор: 1 мм) и электропоратор одноступенчатого типа, которые были описаны ранее8 (Таблица материалов). Двухступенчатый тип электропорator может быть использован слишком(Таблица материалов).

  1. Подготовка и сборка реагентов CRISPR
    1. Заказать реагенты CRISPR (т.е. crRNA, tracrRNA, и cas9 белка) и ssODN при выполнении HDR-опосредованные эксперименты редактирования(Таблица материалов и дополнительная таблица 1).
    2. Подготовьте решение для аннулирования следующим образом.
      1. Подготовьте 1 мкг/КЛ CRRNA и 1 мкг/"L tracrRNA в смеченном минимальном основном среднем растворе (Таблица материалов),и добавьте 6 кЛ каждого раствора к 42 злу буфера без нукле.
      2. Инкубировать смесь в сухом обогревателе при температуре 95 градусов по Цельсию в течение 3 мин и охладить на RT в течение 5 мин.
      3. Приготовьте 1 мкг/Л белка HiFi Cas9, разбавленного в Opti-MEM I, и добавьте 6 л к предыдущей смеси при общем объеме 60 л.
      4. При выполнении hDR-опосредованного редактирования экспериментов, добавить 6 зл 1 мкг / Л ssODN. Поскольку окончательный объем должен сойти 60 л, используйте 36 л безнужной воды в шаге 3.1.2.1.
        ПРИМЕЧАНИЕ: Окончательная концентрация CRRNA, tracrRNA, белка Cas9 и ssODN составит 100 нг/Л.
      5. Перенесите до 100 эмбрионов до 25 qL конечной смеси (RNP-комплекс) в одно луночное стрижки стекла и инкубировать их при 37 градусах По Цельсию в течение 10 минут.
  2. Электропорация
    1. Заполните электродный зазор 6 зл новой смеси реагентов CRISPR и добавьте в смесь 20-25 эмбрионов.
      ПРИМЕЧАНИЕ: Важно избегать любого контакта между эмбрионами и электродом электропорации, который может повредить эмбрионы во время электрических импульсов.
    2. Выполните электропорацию при следующих условиях для электропоратора одного шага:
      Напряжение: 25 V, Пульсовое направление (Pd)
      ON: 3 мс, OFF: 97 мс
      Повторяется: 5x
      ПРИМЕЧАНИЕ: Электропорация должна быть выполнена не более 1 ч после оттаивания, чтобы обеспечить редактирование генома происходит до первой репликации ДНК для предотвращения мозаики.
    3. Для электропорера двухступенчатого типа установите следующие условия:
      Поморский пульс No 40V, Pd
      НА 1 или 2,5 мс; Импульсный интервал 50 мс
      Повторяется: 4x, Распад 10%

      Перенос пульса 5 или 7V; Pd --.
      ON: 50 мс; Импульсный интервал 50 мс.
      Повторяет 5x; Распад 40%.
      ПРИМЕЧАНИЕ: Важно настроить объем для поддержания импеданса в пределах определенного диапазона, указанного производителем.
    4. Вымойте эмбрионы 3x с модифицированным Krebs-Ringer Бикарбонат Буфер 2 (M2) среды следуют два моет с каплей KSOM среды покрыты парафиновой жидкости.
    5. Инкубировать вымытые эмбрионы (в среде KSOM) в инкубаторе CO2 на ночь для дальнейшей трансплантации.

4. Перенос эмбрионов

  1. Подготовка псевдобеременных самок мышей. Мате ICR самок мышей (3-6 месяцев) с вазэктомизированных мышей мужского пола 1 день до переноса эмбриона (ET).
    ПРИМЕЧАНИЕ: Мыши должны быть проверены на следующее утро для совокупляемого плагина. Мышей с вилкой считаются псевдобеременными и могут быть использованы для ET.
  2. Аспирный воздух и KSOM (без парафина жидкости) в альтернативных интервалах 2-3 мм в стеклянный капилляр в качестве маркера для успешной имплантации.
  3. Введите 20-24 эмбриона в 200 л капли KSOM (без парафина жидкости) и привлечь 10-12 эмбрионов в стеклянный капилляр для имплантации в каждом яйцеклетке.
  4. Анестезия самок мышей с помощью изофлюран (ингаляция) или IP инъекции раствора, сочетающего медетомидин/мидазолам/буторфанол (0,3 мг/кг, 4,0 мг/кг и 5,0 мг/кг соответственно). Расположите обезопаживающую мышь на ее брюшной стороне на грелке. Защитите глаза обезопатой мыши увлажняющим гелем.
  5. Бритье вдоль нижней части нижней линии и дезинфицировать области с повидон йод следуют с 70% этанола.
  6. Сделайте длинный разрез на 1 см параллельно со сонной средней линией.
  7. Выняйте яйцдук и поместите на стерильную пластиковую драпировку. Держите его влажным с помощью теплого стерильного сольения.
  8. Поместите яйцек под стереоскопический микроскоп.
  9. Сделайте отверстие в стене яйцека между инфундибулум омичем и ампулой на несколько миллиметров вверх по течению ампулы ножницами микропружини.
  10. Вставьте кончик стеклянного капилляра, содержащего эмбрионы в отверстие и удар осторожно в мундштук капиллярного держателя, чтобы изгнать эмбрионы, пока пузырь воздуха не виден в ампуле.
    ПРИМЕЧАНИЕ: Передача между 10-12 эмбрионов на яйц.
  11. Снимите стеклянный капилляр со стенки яйцепровода и осторожно нажмите репродуктивный орган обратно в полость тела.
  12. Повторите предыдущий процесс, чтобы ввести эмбрионы в другой яйц.
  13. После завершения процедуры ET, шов перитонеума с простой прерванный шов шаблон (50, абсорбируемые, плетеные синтетические швы), а затем кожа с простым прерванным рисунком или похоронен подкутные прерванный шаблон стежка (60 неабсорбируемые моносинтетические швы).
  14. Держите мышь теплой на 37 градусов по Цельсию нагревая пластины, пока он не оправится от анестезии.
  15. Мониторинг здоровья животного ежедневно в течение 7 дней после операции.

5. Генотипирование и анализ последовательности

  1. Экстракция геномной ДНК
    ПРИМЕЧАНИЕ: Мы использовали комплекты для извлечения ДНК ткани NucleoSpin для извлечения геномной ДНК из ушной ткани мышей в соответствии с рекомендациями производителя.
    1. Добавьте в образец 180 л буфера T1 и 25 л раствора Proteinase K и смешайте путем вихря в течение 10 с.
    2. Инкубировать при 56 градусах По цельсии в течение 2 ч или до полного лисиса. Вихрь в течение 10 с каждые 30 минут инкубации.
    3. Добавьте 200 кл. буфера B3, вихрь энергично в течение 30 с, и инкубировать при 70 градусов по Цельсию в течение 10 минут.
    4. Добавить 210 л 100% этанола в образец и вихрь энергично.
    5. Для каждого образца поместите одну колонку ткани в трубку для сбора и нанесите образец на столбец.
    6. Центрифуга в течение 1 мин при 11000 х г,отбросить проточное, и поместите колонку обратно в трубку сбора.
    7. Добавьте 500 кл. буфера BW для мытья образца (1-я стирка), центрифугу в течение 1 мин при 11000 х г,отбросьте пролет и поместите столбец обратно в трубку сбора.
    8. Добавьте 600 кл.л. буфера B5 в колонку (2-я стирка), центрифугу на 1 мин при 11 000 х г,отбросьте протекаемый, и поместите столбец обратно в трубку сбора.
    9. Centrifuge колонку в течение 1 мин на 11000 х г, чтобы высушить мембрану кремнезема и поместить колонку ткани NucleoSpin в 1,5 мл микроцентрифуговой трубки.
    10. Добавьте 100 л буфера BE, инкубировать при комнатной температуре в течение 1 мин, затем центрифугу 1 мин при 11000 х г.
  2. Усиление и очистка ПЦР
    1. Дизайн праймеров с помощью веб-сайта primer3 плюс (https://primer3plus.com/), с тем чтобы усилить 400-500 bp последовательности окружающих целевых локус.
    2. Разработать новый протокол ПЦР и проверить его эмпирически.
    3. Очистите продукт ПЦР для удаления нежелательных ферментов, нуклеотидов, грунтовок и буферных компонентов. Стандартный метод очистки может быть использован следующим образом.
      1. Добавьте 50 кл фенола к 50 л продуктов ПЦР и смешайте путем вихря.
      2. Центрифуге в течение 1 мин при 11 000 х г и перенесите верхний прозрачный слой на новую трубку.
      3. Добавьте 120 л из 99,5% этанола и 20 л из 5 М ацетата аммония и вихря на 30 с.
      4. Хранить на RT в течение 10 мин и центрифуги на 11000 х г в течение 10 мин.
      5. Откажитесь от супернатанта и промойте гранулы ДНК 1 мл 70% этанола.
      6. Высушите гранулы на RT в течение 10 мин и растворите в 10 кЛ свободной воды RNase.
        ПРИМЕЧАНИЕ: ПЦР колонки на основе очистки комплекты recommented потому, что фенол является токсичным для человека.
  3. Секвенирование Сэнгера
    1. Выполнить анализ количественной оценки ДНК (см. Таблицу материалов)для количественной оценки очищенного амобъектива ПЦР.
    2. Отправка пЦР-продукта (ы) и секвенирования грунтовки (ы) поставщику услуг по секвенированию.
    3. Проанализируйте последовательность с помощью доступных веб-сайтов в Интернете.
      ПРИМЕЧАНИЕ: В этом исследовании, CRISP-ID25 (http:/crispid.gbiomed.kuleuven.be/) был использован для анализа последовательности.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Наш модифицированный метод криоконсервации одноклеточных эмбрионов, включая инкубацию в HTF, содержащую 20% FBS в течение 10 мин, а затем криоконсервацию в 1 M DMSO и DAP213 решение, улучшение скорости развития замораживания оттаяли эмбрионов в двухклеточной стадии(Рисунок 1, стр. 0,009, Студент t-тест). Для производства ГМ-мышей были использованы замороженные эмбрионы и оптимизированы условия электропорации: пять повторов 25 V с импульсами 3 мс и 97 мс интервалами с использованием электропорятора, как описано в разделе Протокола. Применимость протокола была проверена генерацией гена альбинотировазы (Tyr) нокаутмы(рисунок 2). Для этого была разработана группа gRNA, направленная на экзон 2(рисунок 2А),а реагенты CRISPR были подготовлены, как описано в разделе Протокола. Инструменты редактирования были электропоранжированы в пределах 1 ч оттаивания эмбриона, чтобы обеспечить редактирование генома произошло до первой репликации генома и, таким образом, предотвратить мозаичность у основателей(рисунок 2B). Все сгенерированные мыши были альбиносами, и только одна мышь была мозаика, с пальто с белыми и черными пятнами(рисунок 2C). Все мыши-альбиносы, укрывающие два разных аллеля мутанта (гетерозиготная мутация), за исключением одной мыши, укрывающей только один аллель (гомозиготная мутация), показаны на рисунке 2E. Можно сделать вывод, что наш метод может обеспечить эффективность редактирования около 100% с низкой скоростью мозаики, как это подтверждается анализом секвенирования, а также цвет омыка(рисунок 2C-E).

Далее, воспроизводимость протокола была проверена поколением нескольких линий нокаута и стука в мышах. Как показано в таблице 1, протокол может генерировать нокаут и стук в мышей с высокой эффективностью и низкими мозаичными ставками. Большинство сгенерированных мышей F0 были спарены с дикими мышами типа C57BL/6J, чтобы подтвердить передачу зародышевой линии аллелей мутантов поколениям F1. Как и ожидалось, все потомки F1 гомозиготных мышей F0 были гетерозиготными, содержащими один мутант аллель и один дикий тип аллеля. Между генотипированием основателей и их поколений не наблюдалось разрозненных мутаций. Описанный протокол генерировал ГМ-мышей в течение короткого времени (т.е. 4 недели), как показано в рабочем процессе протокола на рисунке 3.

Figure 1
Рисунок 1: Сыворотка крупного рогатого скота плода (FBS) улучшила двухклеточный этап развития замороженных эмбрионов. Количество эмбрионов FBS составило 286 (эксперимент был повторен в 3 x), а количество эмбрионов FBS - 272 (эксперимент был повторен в 3x). Данные представлены в виде средних - SEM. Эта цифра воспроизводится с разрешения Darwish M et al.16. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Figure 2
Рисунок 2: Поколение мышей-нокаутов Тир с высокой эффективностью и низкой мозаикой. Эта цифра изменена с разрешения Darwish M et al.16. (A) Схематическая иллюстрация, показывающая дизайн gRNA. Последовательность PAM отображается красным цветом. (B) Иллюстрация, показывающая время электропорации для замораживающих оттепельных эмбрионов, желтый символ представляет время электропорации. (C) Представитель изображения генерируемых Тир нокаут мышей. (D) Последовательность анализа различных аллелей Тир нокаут мышей. Последовательность целей помечена красным цветом, а тире указывают на удаление нуклеотидов в аллелях мутантов. WT - дикий тип М и мутантный аллель. (E) Представительная часть хроматограммы мыши альбиносов, содержащей аллель M1, показана в D. Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой фигуры.

Figure 3
Рисунок 3: Рабочий процесс протокола для генерации ГМ мышей. Первым шагом стала подготовка криоконсервированных эмбрионов. Самки C57BL/6J мышей были суперовулированы, сначала инъекцией PMSG, затем 48 ч позже инъекцией ХГЧ. COCs были собраны 16 h более поздно и подвергли к IVF с сперматозоидами собранным от мышей C57BL/6J. Оплодотворенные яйцеклетки были криоконсервированы и хранились в жидком азоте до необходимости. Второй шаг включал в себя оттаивание эмбрионов и электропорацию. Криоконсервированные эмбрионы были оттаяли, а реагенты CRISPR (т.е. тракрРНКа, crRNA и белок Cas9) были собраны и электропоративированы в течение 1 ч после оттаивания эмбрионов. Третий шаг включал перенос эмбрионов и рождение мышей. На следующий день после электропорации, двухклеточные эмбрионы были переданы в яйцеклетку псевдобеременных самок мышей для генерации генетически модифицированных мышей, которые позже были генотипизированы с помощью секвенирования Sanger для подтверждения эффективности редактирования. Время и усилия, необходимые для подготовки оплодотворенных яйцеклеток перед каждым экспериментом (шаг 1), могут быть сокращены, если заранее подготовлено большое количество криоконсервированных эмбрионов. Эта цифра адаптирована из Darwish M и др.16Пожалуйста, нажмите здесь, чтобы просмотреть большую версию этой цифры.

Мыши-мутанты Электропорированные эмбрионы 2-клеточные эмбрионы Перенесенные эмбрионы Щенки (%) Мыши-мутанты (%) Нет мозаичных мышей
Тир KO 124 84 48 12 (25) 100 1
Глрб КО 151 94 40 6 (15) 100 0
Slc39a6 KO 48 25 25 5 (20) 100 0
Bag3 KI 233 84 20 3 (15) 50 1
Camk2a KI 124 70 70 14 (20) 64.3 0

Таблица 1: Производство нескольких линий ГМ-мышей с использованием замороженных оттаять эмбрионов C57BL/6J фона.

Дополнительная таблица 1. Пожалуйста, нажмите здесь, чтобы загрузить эту таблицу.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Описанный протокол позволяет для поколения ГМ мышей с высокой эффективностью и низкими мозаичными ставками(таблица 1). Это позволяет исследователям без передовых навыков манипуляции эмбрионов для создания мутантных мышей легко, потому что он использует новейшие и наиболее полезные достижения в области репродуктивной инженерии и технологии редактирования генома: CRISPR/Cas9 рибонуклеопротеин (RNP) и электропорации в замораживание оттепель эмбрионов. Эти достижения способствовали и ускорили генерацию ГМ мышей. Как описано на рисунке 3, это занимает 4 недели, чтобы генерировать ГМ мышей. По сравнению с другими протоколами, использующими аналогичные подходы26,наш метод превосходит по эффективности, рождаемости и мозаичности.

Инкубация одноклеточных эмбрионов в FBS до криоконсервации имеет решающее значение для улучшения скорости развития эмбрионов. Условия электропорации криоконсервированных эмбрионов, описанные в Протоколе, позволяют достичь компромисса между эффективностью редактирования реагентов CRISPR и выживанием эмбрионов. Действительно, более жесткие или мягкие условия могут повлиять на скорость развития эмбрионов и эффективность редактирования, соответственно16. Сроки электропорации(рисунок 2B) имеет решающее значение для преодоления мозаикизма у основателей и обеспечения того, чтобы изменение генома происходит в присутствии только двух аллелей. Это согласуется с предыдущими сообщениями, показывающими, что на ранних стадиях электропорации может производить немозамозамозационные мутанты17. Кроме того, использование РНП вместо gRNA/mRNA снижает скорость мозаики и повышает эффективность редактирования17.

Описанный протокол имеет ряд преимуществ. Во-первых, он генерирует мышей-мутантов в течение короткого времени (4 недели). Во-вторых, это высокоэффективный и надежный протокол; несколько линий нокаута (KO) и стук-в (KI) мышей были созданы с высоким уровнем мутации (KO 100%, KI и 50 до 64,3%). В-третьих, это удобно и рентабельно. Использование полной синтетической crRNA, tracrRNA, ssODN и Cas9 белка устраняет необходимость утомительной подготовки векторов Cas9 и транскрипции in vitro. Вместо этого, это позволяет исследователям просто использовать коммерческие реагенты и стандартное оборудование. В-четвертых, он не использует микроинъекцию, которая требует высоких технических навыков. В-пятых, это уменьшает мозаичность у основателей, и, таким образом, приводит к более эффективной зародышевой передаче отредактированных аллелей, преодолевая сложный генотипический анализ мозаичных мышей. Наконец, этот протокол эффективен с штаммом C57BL/6J, который позволяет избежать использования гибридов F1, и, таким образом, необходимость выполнять многочисленные бэккроссы, чтобы избавиться от генетической сложности. Генотипирование поколений F1 подтвердило точную передачу зародышевой линии. Тем не менее, не рекомендуется изучать фенотипы мышей F0 из-за сложности аллеля и вводящее в заблуждение предсказание генотипирования последующего поколения экстраполированных из генотипирования F0 основателей14,27.

Чрезвычайно важно использовать замороженные оттаявшие эмбрионы при редактировании генома нечеловеческих приматов и крупных животных, таких как свиньи и овцы, которые не всегда доступны. Методы замораживания эмбрионов сильно различаются в зависимости от вида животных. Поэтому мы считаем, что наш протокол криоконсервации может быть применим только к мышам. С другой стороны, наш протокол потенциально применим к использованию инженерных нуклеаз, кроме Cas9 для поколения ГМ мышей, потому что электропорация ранее сообщалось ввести другие нуклеазы, такие как Cas12a в эмбрион эффективно28,29.

Одним из ограничений протокола является точная интеграция длинного трансгена в геном, который считается сложным в протоколах, основанных на электропорации. Тем не менее, одно потенциальное решение было сообщено: интеграция трансгенов до 4,9 КБ в геноме мыши была успешно выполнена путем объединения электропорации с адено-ассоциированных вирусов (AAV) опосредованно HDR донорской системы доставки30, подтверждающие ранее публикацию31. Кроме того, потенциальное появление побочных эффектов вне цели является серьезной проблемой с использованием технологии CRISPR/Cas9. Мы не проводили секвенирование всего генома отредактированных мышей, чтобы исключить потенциальный эффект вне цели. Тем не менее, мы использовали инструменты CRISPR, которые, как сообщается, уменьшают эффект вне цели, такие как RNP32. Кроме того, мы использовали вариант высокой точности Cas9, который значительно снижает внецелевое редактирование без ущерба для производительности33. Кроме того, мы разработали gRNA с использованием программного обеспечения CRISPRdirect (https://crispr.dbcls.jp), что должно привести к целевым последовательности с минимизированными внецелевых сайтов19. Чтобы подтвердить причинно-следственную связь генотипа-фенотипа и облегчить опасения по поводу внецелевых эффектов, исследователи должны генерировать несколько отредактированных мышей одного и того же генотипа с использованием различных гРНК или выполнять обратный скрещивания генерируемых мышей в течение нескольких поколений.

Выбывание мышей, генерируемых с помощью механизма NHEJ и frameshift мутации были широко использованы и показывают соответствующие фенотипы. Тем не менее, усеченный остаточный белок может существовать из-за либо перевод реинициации или пропуска отредактированного экзона34,35. Поэтому для точного толкования фенотипов необходима характеристика функции или экспрессии остаточного белка. Поколение полных мышей нокаутгена гена используя больше чем одно gRNA было бы хорошей алтернативой. Тем не менее, особое внимание следует уделить, чтобы подтвердить, что ген не содержит интронических регионов транскрибируется некодирования РНК, которые могут иметь регулятивные функции и, следовательно, усложнять фенотипический анализ.

В этом исследовании мы показываем простой протокол, по которому многие исследователи могут генерировать генетически модифицированных мышей в течение 4 недель или меньше. Объединив использование замораживающих оттепели эмбрионов и электропорации, мы делаем подготовку мыши модели человеческих заболеваний легко, быстро и эффективно.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы не имеют соответствующей финансовой информации.

Acknowledgments

Мы хотели бы поблагодарить Хитоми Саваду и Элизабет Гарсия за заботу о животных. Эта работа была поддержана KAKENHI (15K20134, 17K11222, 16H06276 и 16K01946) и Хокугин исследований Грант (для H.N.), и Джичи Медицинский университет Молодой следователь премии (в H.U.). Стипендиальный фонд Отсуки Тошими поддержал докторов наук

Materials

Name Company Catalog Number Comments
0.25 M Sucrose ARK Resource Co., Ltd. (Kumamoto, Japan) SUCROSE
1 M DMSO ARK Resource Co., Ltd. (Kumamoto, Japan) 1M DMSO
Butorphanol Meiji Seika Pharma Co., Ltd. (Tokyo, Japan) Vetorphale 5mg
Cas9 protein: Alt-R® S.p. HiFi Cas9 Nuclease 3NLS Integrated DNA Technologies, Inc. (Coralville, IA) 1081060
C57BL/6J mice Japan SLC (Hamamatsu, Japan) N/A
DAP213 ARK Resource Co., Ltd. (Kumamoto, Japan) DAP213
FBS Sigma-Aldrich, Inc. (St. Louis, MO) ES-009-C
hCG MOCHIDA PHARMACEUTICAL CO., LTD (Tokyo, Japan) HCG Mochida 3000
HTF ARK Resource Co., Ltd. (Kumamoto, Japan) HTF
ICR mice Japan SLC (Hamamatsu, Japan) N/A
Isoflurane Petterson Vet Supply, Inc. (Greeley, CO) 07-893-1389
KSOM ARK Resource Co., Ltd. (Kumamoto, Japan) KSOM
LN2 Tank Chart Industries (Ball Ground, GA) XC 34/18
M2 ARK Resource Co., Ltd. (Kumamoto, Japan) M2
Medetomidine Nippon Zenyaku Kogyo Co.,Ltd. (Koriyama, Japan) 1124401A1060
Microscope Nikon Co. (Tokyo, Japan) SMZ745T
Midazolam Sandoz K.K. (Tokyo, Japan) 1124401A1060
Nuclease free buffer Integrated DNA Technologies, Inc. (Coralville, IA) 1072570
Nucleospin DNA extraction kit Takara Bio Inc (Kusatsu, Japan) 740952 .5
One-hole slide glass Matsunami Glass Ind., Ltd. (Kishiwada, Japan) S339929
One-step type Electroporator BEX Co., Ltd. (Tokyo, Japan) CUY21EDIT II
Paraffin Liquid NACALAI TESQUE Inc. (Kyoto, Japan) SP 26137-85
Platinum plate electrode BEX Co., Ltd. (Tokyo, Japan) LF501PT1-10, GE-101
PMSG ASKA Animal Health Co., Ltd (Tokyo, Japan) SEROTROPIN 1000
Povidone iodide Professional Disposables International, Inc. (Orangeburg, NY) C12400
Reduced-Serum Minimal Essential Medium: OptiMEM I Sigma-Aldrich, Inc. (St. Louis, MO) 22600134
Two-step type Electroporator Nepa Gene Co., Ltd. (Ichikawa, Japan) NEPA21

DOWNLOAD MATERIALS LIST

References

  1. Wang, H., et al. One-step generation of mice carrying mutations in multiple genes by CRISPR/cas-mediated genome engineering. Cell. 153, (4), 910-918 (2013).
  2. Jinek, M., et al. A programmable dual-RNA - guided DNA endonuclease in adaptive bacterial immunity. Science. 337, (6096), 816-822 (2012).
  3. Mali, P., et al. RNA-guided human genome engineering via Cas9. Science. 339, (6121), 823-826 (2013).
  4. Cong, L., et al. Multiplex genome engineering using CRISPR/VCas systems. Science. 339, (6121), 819-823 (2013).
  5. Doudna, J. A., Charpentier, E. The new frontier of genome engineering with CRISPR-Cas9. Science. 346, (6213), 1258096 (2014).
  6. Mashiko, D., et al. Generation of mutant mice by pronuclear injection of circular plasmid expressing Cas9 and single guided RNA. Scientific Reports. 3, 3355 (2013).
  7. Yen, S. T., et al. Somatic mosaicism and allele complexity induced by CRISPR/Cas9 RNA injections in mouse zygotes. Developmental Biology. 393, (1), 3-9 (2014).
  8. Kaneko, T., Mashimo, T. Simple genome editing of rodent intact embryos by electroporation. PLoS ONE. 10, (11), 1-7 (2015).
  9. Qin, W., et al. Efficient CRISPR/cas9-mediated genome editing in mice by zygote electroporation of nuclease. Genetics. 200, (2), 423-430 (2015).
  10. Kaneko, T., Sakuma, T., Yamamoto, T., Mashimo, T. Simple knockout by electroporation of engineered endonucleases into intact rat embryos. Scientific Reports. 4, 6382 (2014).
  11. Hashimoto, M., Takemoto, T. Electroporation enables the efficient mRNA delivery into the mouse zygotes and facilitates CRISPR/Cas9-based genome editing. Scientific Reports. 5, 11315 (2015).
  12. Chen, S., Lee, B., Lee, A. Y. F., Modzelewski, A. J., He, L. Highly efficient mouse genome editing by CRISPR ribonucleoprotein electroporation of zygotes. Journal of Biological Chemistry. 291, (28), 14457-14467 (2016).
  13. Modzelewski, A. J., et al. Efficient mouse genome engineering by CRISPR-EZ technology. Nature Protocols. 13, (6), 1253-1274 (2018).
  14. Teixeira, M., et al. Electroporation of mice zygotes with dual guide RNA/Cas9 complexes for simple and efficient cloning-free genome editing. Scientific Reports. 8, 474 (2018).
  15. Nakagawa, Y., et al. Production of knockout mice by DNA microinjection of various CRISPR/Cas9 vectors into freeze-thawed fertilized oocytes. BMC Biotechnology. 15, (1), 1-10 (2015).
  16. Darwish, M., et al. Rapid and high-efficient generation of mutant mice using freeze-thawed embryos of the C57BL/6J strain. Journal of Neuroscience Methods. 317, 149-156 (2019).
  17. Hashimoto, M., Yamashita, Y., Takemoto, T. Electroporation of Cas9 protein/sgRNA into early pronuclear zygotes generates non-mosaic mutants in the mouse. Developmental Biology. 418, (1), 1-9 (2016).
  18. Sakamoto, W., Kaneko, T., Nakagata, N. Use of frozen-thawed oocytes for efficient production of normal offspring from cryopreserved mouse spermatozoa showing low fertility. Comparative Medicine. 55, (2), 136-139 (2005).
  19. Naito, Y., Hino, K., Bono, H., Ui-Tei, K. CRISPRdirect: Software for designing CRISPR/Cas guide RNA with reduced off-target sites. Bioinformatics. 31, (7), 1120-1123 (2015).
  20. Torres-Perez, R., Garcia-Martin, J. A., Montoliu, L., Oliveros, J. C., Pazos, F. WeReview: CRISPR Tools-Live Repository of Computational Tools for Assisting CRISPR/Cas Experiments. Bioengineering. 6, (3), 63 (2019).
  21. Okamoto, S., Amaishi, Y., Maki, I., Enoki, T., Mineno, J. Highly efficient genome editing for single-base substitutions using optimized ssODNs with Cas9-RNPs. Scientific Reports. 9, 4811 (2019).
  22. Takeo, T., Nakagata, N. Superovulation using the combined administration of inhibin antiserum and equine chorionic gonadotropin increases the number of ovulated oocytes in C57BL/6 female mice. PLoS ONE. 10, (5), 1-11 (2015).
  23. Wuri, L., Agca, C., Agca, Y. Euthanasia via CO2 inhalation causes premature cortical granule exocytosis in mouse oocytes and influences in vitro fertilization and embryo development. Molecular Reproduction and Development. 86, (7), 825-834 (2019).
  24. Nakagata, N. High survival rate of unfertilized mouse oocytes after vitrification. Journal of Reproduction and Fertility. 87, (2), 479-483 (1989).
  25. Dehairs, J., Talebi, A., Cherifi, Y., Swinnen, J. V. CRISP-ID: Decoding CRISPR mediated indels by Sanger sequencing. Scientific Reports. 6, 28973 (2016).
  26. Nakagawa, Y., Sakuma, T., Takeo, T., Nakagata, N., Yamamoto, T. Electroporation-mediated genome editing in vitrified/warmed mouse zygotes created by ivf via ultra-superovulation. Experimental Animals. 67, (4), 535-543 (2018).
  27. Nakajima, K., Nakajima, T., Takase, M., Yaoita, Y. Generation of albino Xenopus tropicalis using zinc-finger nucleases. Development Growth and Differentiation. 54, (9), 777-784 (2012).
  28. Hur, J. K., et al. Targeted mutagenesis in mice by electroporation of Cpf1 ribonucleoproteins. Nature Biotechnology. 34, 807-808 (2016).
  29. Dumeau, C. E., et al. Introducing gene deletions by mouse zygote electroporation of Cas12a/Cpf1. Transgenic Research. 28, (5-6), 525-535 (2019).
  30. Chen, S., et al. CRISPR-READI: Efficient Generation of Knockin Mice by CRISPR RNP Electroporation and AAV Donor Infection. Cell Reports. 27, (13), 3780-3789 (2019).
  31. Mizuno, N., et al. Intra-embryo Gene Cassette Knockin by CRISPR/Cas9-Mediated Genome Editing with Adeno-Associated Viral Vector. iScience. 9, 286-297 (2018).
  32. Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. Highly Efficient RNA-guide genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Research. 24, (6), 1012-1019 (2014).
  33. Vakulskas, C. A., et al. A high-fidelity Cas9 mutant delivered as a ribonucleoprotein complex enables efficient gene editing in human hematopoietic stem and progenitor cells. Nature Medicine. 24, (8), 1216-1224 (2018).
  34. Rodriguez-Rodriguez, J. A., et al. Distinct Roles of RZZ and Bub1-KNL1 in Mitotic Checkpoint Signaling and Kinetochore Expansion. Current Biology. 28, (21), 3422-3429 (2018).
  35. Smits, A. H., et al. Biological Plasticity Rescues Target Activity in CRISPR Knockouts. Nature Methods. 16, 1087-1093 (2019).
Использование замороженных оттаять эмбрионов для высокоэффективного производства генетически модифицированных мышей
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Nishizono, H., Darwish, M., Uosaki, H., Masuyama, N., Seki, M., Abe, H., Yachie, N., Yasuda, R. Use of Freeze-thawed Embryos for High-efficiency Production of Genetically Modified Mice. J. Vis. Exp. (158), e60808, doi:10.3791/60808 (2020).More

Nishizono, H., Darwish, M., Uosaki, H., Masuyama, N., Seki, M., Abe, H., Yachie, N., Yasuda, R. Use of Freeze-thawed Embryos for High-efficiency Production of Genetically Modified Mice. J. Vis. Exp. (158), e60808, doi:10.3791/60808 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter