Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Uso de embriones congelados descongelados para la producción de alta eficiencia de ratones modificados genéticamente

doi: 10.3791/60808 Published: April 2, 2020
* These authors contributed equally

Summary

Aquí, presentamos un método modificado para la criopreservación de embriones unicelulares, así como un protocolo que combina el uso de embriones de congelación descongelado y electroporación para la generación eficiente de ratones modificados genéticamente.

Abstract

El uso de ratones modificados genéticamente (GM) se ha vuelto crucial para comprender la función génica y descifrar los mecanismos subyacentes de las enfermedades humanas. El sistema CRISPR/Cas9 permite a los investigadores modificar el genoma con una eficiencia, fidelidad y simplicidad sin precedentes. Aprovechando esta tecnología, los investigadores buscan un protocolo rápido, eficiente y fácil para generar ratones modificados genéticamente. Aquí introducimos un método mejorado para la criopreservación de embriones unicelulares que conduce a una mayor tasa de desarrollo de los embriones liofilconantes. Al combinarlo con condiciones de electroporación optimizadas, este protocolo permite la generación de ratones knockout y knock-in con alta eficiencia y bajas tasas de mosaico en poco tiempo. Además, mostramos una explicación paso a paso de nuestro protocolo optimizado, que cubre la preparación de reactivos CRISPR, la fertilización in vitro, la criopreservación y descongelación de embriones de una célula, la electroporación de reactivos CRISPR, la generación de ratones y el genotipado de los fundadores. Con este protocolo, los investigadores deben ser capaces de preparar ratones modificados genéticamente con una facilidad, velocidad y eficiencia sin igual.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

El sistema de repeticiones palindrómicas cortas interespaciadas (CRISPR)/CRISPR-associated protein 9 (Cas9) agrupados regularmente es un avance científico que proporciona una modificación específica sin precedentes en el genoma1. El sistema CRISPR/Cas9 está compuesto por proteínaCas Cas9 y ARN guía (gRNA) con dos componentes moleculares: un ARN CRISPR (CRRNA) específico de destino y un ARN CRISPR transactivador (tracrRNA)2 . Un gRNA dirige la proteína Cas9 al locus específico en el genoma, 20 nucleótidos complementarios al crRNA, y adyacentes al motivo adyacente protoespacial (PAM). La proteína Cas9 se une a la secuencia diana e induce roturas de doble cadena (DSB) que se reparan mediante unión final no homóloga no homóloga propensa a errores (NHEJ) o por reparación dirigida por homología de alta fidelidad (HDR)3,,4,5. El NHEJ conduce a inserciones o/y deleciones (indels), y por lo tanto a la pérdida de función genética cuando se dirige una secuencia de codificación. El HDR conduce a una edición precisa del genoma en presencia de una plantilla de reparación que contiene secuencias de homología3,4,5. El NHEJ y el HDR han sido aprovechados para generar ratones knockout y knock-in, respectivamente.

Si bien el sistema CRISPR/Cas9 ha acelerado notablemente la generación de ratones modificados genéticamente con una eficacia y fidelidad excepcionales, los científicos que aplican estos métodos a menudo se encuentran con desafíos técnicos. En primer lugar, los protocolos convencionales requieren microinyección para introducir las herramientas de edición CRISPR en el pronúcleo de los óvulos fertilizados6,7. Esta técnica consume mucho tiempo y por lo general requiere una amplia formación. Así, varios grupos sustituyeron la microinyección por electroporación8,,9,,10,,11,12,13. Sin embargo, en los primeros protocolos de electroporación se utilizaron embriones frescos para la electroporación. Esto causó otro problema, porque preparar embriones frescos antes de cada experimento es difícil14.

Recientemente nosotros y otros hemos combinado el uso de embriones de congelación y electroporación para la edición del genoma, lo que facilita la generación de ratones modificados genéticamente15,,16. Este protocolo permite a los investigadores sin habilidades avanzadas de manipulación de embriones generar rápidamente modelos animales de enfermedades humanas con alta eficiencia. El protocolo también reduce significativamente los desafíos prácticos en la generación de ratones modificados genéticamente, como la heterogeneidad genética en los fundadores16. Para superar el mosaico, realizamos la electroporación de reactivos CRISPR dentro de 1 h después de la descongelación del embrión para asegurar que la edición se produce antes de la primera replicación del genoma. Otra mejora incluye el uso de proteína Cas9 en lugar de ARNm Cas9 para reducir el mosaico indeseable17. Además, desarrollamos un método óptimo para la criopreservación de embriones de una célula que aumenta la tasa de desarrollo a la etapa de dos células16:el uso de suero bovino fetal (FBS) mejora dramáticamente la supervivencia de los ovocitos liofilizados después de la fertilización, tal vez por el mismo mecanismo que hace que los ovocitos no fecundos liofilizados sean más resistentes18.

Aquí presentamos un protocolo integral para la generación de ratones modificados genéticamente utilizando embriones liofilizados, incluyendo el método modificado para la criopreservación de embriones C57BL/6J de una célula. Incluye 1) diseño de gRNA, preparación y montaje de reactivos CRISPR; 2) FIV, criopreservación y descongelación de embriones unicelulares; 3) Electroporación de reactivos CRISPR en embriones liofilconantes descongelados; 4) Transferencia de embriones al oviducto de ratones hembra pseudoembarazada; y 5) Genotipado y análisis de secuencia de los animales fundadores de F0.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Todos los cuidados y procedimientos de animales realizados en este estudio se llevaron a cabo de acuerdo con las reglas y reglamentos de la Guía para el Cuidado y Uso de Animales de Laboratorio. El protocolo experimental fue aprobado por el Comité de Cuidado Animal de Animales de Laboratorio de la Universidad de Toyama, la Universidad de Tokio, la Universidad De Jichi y el Instituto Max Planck Florida para Neurociencia. La información sobre todos los reactivos se muestra en la Tabla de Materiales.

1. Diseño de reactivos CRISPR

  1. diseño crRNA
    1. Visite CRISPR directa19 (https://crispr.dbcls.jp/) para diseñar crRNA específicos con sitios fuera de destino reducidos.
      NOTA: Hay muchas otras herramientas útiles para diseñar el crRNA20 (https://bioinfogp.cnb.csic.es/tools/wereview/crisprtools/).
    2. Inserte la secuencia de nucleótidos de destino y realice los siguientes cambios:
      Requisito de secuencia de PAM : NGG
      Comprobación de la especificidad: ratón (Mus musculus) genoma, GRCm38/mm10 (dic, 2011)
      NOTA: Como ejemplo, para generar ratones noqueadores de tiro tiro (Tyr), se apuntó al exón 2 (secuencia de nucleótidos de 9476-9692).
    3. Haga clic en Diseñoy, para visitas muy específicas, marque Mostrar solo destino muy específico.
    4. Para reducir los posibles efectos fuera del objetivo, elija la secuencia de destino con el valor más bajo en las columnas de "12 mer+PAM" y "8 mer+PAM".
      NOTA: En estas columnas, ("1") indica que la secuencia solo tiene una coincidencia perfecta con el sitio de destino previsto y los números mayores que uno indican la presencia de sitios posibles fuera de destino.
    5. Ordenar los oligonucleótidos resultantes de las empresas de síntesis de CRRNA (Tabla suplicaria 1).
      NOTA: Para el gen Tyr exon 2, se utilizó la siguiente secuencia diana: GGACCACTATTACGTAATCC, con +TGG como secuencia PAM(Figura 2A).
  2. Diseño de oligodesoxinucleótido de una sola hebra (ssODN) para experimentos de edición mediados por HDR (es decir, generación de ratones knock-in).
    1. Diseñe la longitud del ssODN para que sea de alrededor de 80–180 bp, incluyendo 30–60 brazos de homología de nucleótidos (nt) en ambos lados.
      NOTA: Un ssODN de 75-85 nt de longitud, incluyendo un brazo homólogo de 30-35 nt y complementario al GRNA, mostró una alta eficiencia de edición de knock-in21.
    2. Inserte la modificación prevista y la mutación silenciosa en la secuencia PAM o, si no es posible, en la base vecina de 5o de PAM para bloquear el recorte después de la edición del genoma.
      NOTA: El crRNA y el ssODN utilizados en este estudio se enumeran en la Tabla Suplementaria 1.

2. Fertilización in vitro, criopreservación embrionaria y congelación

  1. Fertilización in vitro
    1. Superovulato C57BL/6J ratones hembra (4 u 8 semanas de edad) por inyección IP con gonnadotropina sérica de yegua embarazada (PMSG) seguido de inyección con 7,5 UI de gonadotropina coriónica humana (hCG) después de 48 h.
      NOTA: El número de ovocitos ovulados se puede aumentar en aproximadamente 3 veces utilizando ultra-superovulación22.
    2. Retire las epididimides cauda de ratones machos c57BL/6J sexualmente maduros (3-5 meses de edad).
      NOTA: Es posible recoger espermatozoides sin sacrificar los ratones machos.
    3. Extrae los coágulos de espermatozoides con una aguja dissección y incubarlos en una gota de 200 l de líquido trompa humano (HTF) en la incubadora de CO2 durante 1,5 h para la capacitación.
    4. Recoger los complejos cumulus-ovocitos (COC) de los oviductos 16-18 h después de la inyección de hCG e incubarlos en una nueva gota de 200 ol de medio HTF cubierto con líquido de parafina en una incubadora de CO2 (5% CO2, 37 oC) durante no más de 2 h.
      NOTA: Es preferible sacrificar a los ratones por luxación cervical bajo anestesia porque la eutanasia a través de la inhalación de CO2 afecta la FIV y el desarrollo embrionario23.
    5. Añadir de 1 a 5 ml de suspensión de espermatozoides desde el límite del medio de incubación hasta la gota de 200 l de medio HTF que contenga COC y cómo incubarlos en una incubadora deCO2 durante 3 h.
    6. Lave los ovocitos con medio de optimización simplex (KSOM) 3x complementado por potasio para eliminar los espermatozoides restantes y las células cúmulos.
    7. Compruebe la formación pronuclear y el grado de embriones unicelulares utilizando un microscopio invertido.
  2. Criopreservación de embriones unicelulares
    1. Incubar embriones de una célula en una gota de 200 ol de HTF que contenga 20% FBS (no cubierto con líquido de parafina) durante 10 minutos en una incubadora deCO2.
    2. Transferir entre 20 y 100 embriones a 50 ml de solución de 1 M de dimetilsulfóxido (DMSO)24.
    3. Transfiera 5 ml de una solución que contenga 100 embriones en la parte inferior de un criotubo y enfríe durante 5 minutos a 0 oC utilizando un enfriador o sobre hielo.
    4. Añadir 45 l de daP213 (2 M de dimetil sulfóxido, 1 M de acetamida y 3 M de propilenglicol) lentamente a lo largo de la pared del tubo, tapar los tubos, y mantener durante 5 minutos en un enfriador o en hielo a 0 oC.
      NOTA: No sujete las tapas demasiado firmemente para retirarlas fácilmente durante la descongelación de la muestra.
    5. Almacene los tubos rápidamente en nitrógeno líquido.
  3. Descongelación de embriones
    1. Abra la tapa del criotubo, deseche el nitrógeno líquido restante y añada 900 ml de solución de sacarosa de 0,25 M precalentada a 37 oC.
      NOTA: La solución de sacarosa de 0,25 M debe calentarse con 37 oC de antelación, ya que el uso de solución fría disminuye la viabilidad de los embriones después de la descongelación.
    2. Pipet rápidamente durante 10x y transferir el contenido del criotubo en un plato de plástico.
      NOTA: El pipeteo debe realizarse con cuidado, de modo que no se generen burbujas y dañen los embriones.
    3. Lavar los ovocitos fertilizados morfológicamente normales 2veces en medio KSOM cubierto con líquido de parafina y mantenerlos en una incubadora deCO2 hasta la electroporación.

3. Montaje y electroporación de reactivos CRISPR

NOTA: Para la electroporación, utilizamos un electrodo de placa de platino (altura: 0,5 mm, longitud: 10 mm, anchura: 3 mm, hueco: 1 mm) y un electroporator de tipo de un paso que se describió anteriormente8 (Tabla de materiales). También se puede utilizar un electroporator de dos pasos(Tabla de materiales).

  1. Preparación y montaje de reactivos CRISPR
    1. Ordene reactivos CRISPR (es decir, crRNA, tracrRNA y proteína Cas9) y ssODN si realiza experimentos de edición mediados por HDR(Tabla de materiales y Tabla suplementaria 1).
    2. Prepare la solución de recocido de la siguiente manera.
      1. Preparar 1 g/l de crRNA y 1 tracrRNA de g/L en la solución de medio esencial mínimo de suero reducido(Tabla de materiales)y añadir 6 ml de cada solución a 42 ml del tampón libre de nucleasas.
      2. Incubar la mezcla en el calentador seco a 95 oC durante 3 min y enfriar a RT durante 5 min.
      3. Preparar 1 proteína HiFi Cas9 diluida en Opti-MEM I y añadir 6 l a la mezcla anterior para un volumen total de 60 l.
      4. En la realización de experimentos de edición mediados por HDR, agregue 6 ssODN de 1 g/L. Debido a que el volumen final debe ser de 60 l, utilice 36 ml de agua libre de nucleasas en el paso 3.1.2.1.
        NOTA: La concentración final de crRNA, tracrRNA, proteína Cas9 y ssODN será de 100 ng/L.
      5. Transfiera hasta 100 embriones a 25 l de la mezcla final (complejo RNP) en un vidrio deslizante de un orificio e incubarlos a 37 oC durante 10 minutos.
  2. Electroporación
    1. Llenar el hueco de los electrodos con 6 l de la nueva mezcla de reactivos CRISPR y añadir 20–25 embriones a la mezcla.
      NOTA: Es importante evitar cualquier contacto entre los embriones y el electrodo de electroporación, que puede dañar los embriones durante los pulsos eléctricos.
    2. Realice la electroporación en las siguientes condiciones para un electroporator de tipo de un solo paso:
      Voltaje: 25 V, Dirección del pulso (Pd) +
      ON: 3 ms, OFF: 97 ms
      Repeticiones: 5x
      NOTA: La electroporación no debe realizarse más de 1 h después de la descongelación para garantizar que la edición del genoma se produzca antes de la primera replicación del ADN para evitar el mosaico.
    3. Para un electroporator de tipo de dos pasos, establezca las condiciones de la siguiente manera:
      Pulso de Poring 40V, Pd +
      ENCENDIDO 1 o 2,5 ms; Intervalo de pulsos a 50 ms
      Repeticiones: 4x, Decaimiento 10%

      Pulso de transferencia a 5 o 7V; Pd +/-.
      ON: 50 ms; Intervalo de pulsos a 50 ms.
      Repeticiones de 5x; Decaimiento 40%.
      NOTA: Es importante ajustar el volumen para mantener la impedancia dentro del rango específico especificado por el fabricante.
    4. Lavar los embriones 3veces con medio modificado Krebs-Ringer Bicarbonate Buffer 2 (M2) seguido de dos lavados con una gota de medio KSOM cubierto con líquido parafina.
    5. Incubar los embriones lavados (en medio KSOM) en una incubadora de CO2 durante la noche para un trasplante posterior.

4. Transferencia de embriones

  1. Prepare ratones hembra pseudoembarazadas. Ratones hembra Mate ICR (3-6 meses) con ratones macho vasectomizados 1 día antes de la transferencia embrionaria (ET).
    NOTA: Los ratones deben ser revisados a la mañana siguiente para un enchufe copulator. Los ratones con un tapón se consideran pseudoembarazada y se pueden utilizar para ET.
  2. Aspirar aire y KSOM (sin líquido de parafina) en intervalos alternativos de 2-3 mm en un capilar de vidrio como marcador para una implantación exitosa.
  3. Introducir entre 20 y 24 embriones en una gota de 200 ol de KSOM (sin líquido de parafina) y extraer de 10 a 12 embriones en el capilar de vidrio para su implantación en cada oviducto.
  4. Anestetizar a los ratones hembra por isoflurano (inhalación) o una inyección IP de una solución que combine medetomidina/midazolam/butorphanol (0,3 mg/kg, 4,0 mg/kg y 5,0 mg/kg respectivamente). Coloque el ratón anestesiado en su lado ventral en una almohadilla de calentamiento. Protege los ojos del ratón anestesiado con un gel hidratante.
  5. Afeitar a lo largo de la parte inferior de la línea media dorsal y desinfectar el área con yodo de povidona seguido de 70% de etanol.
  6. Haga una incisión larga de 1 cm paralela a la línea media dorsal.
  7. Saque el oviducto y colóquelo en una cortina de plástico estéril. Manténgalo húmedo usando solución salina estéril caliente.
  8. Coloque el oviducto bajo el microscopio estereoscópico.
  9. Haga un agujero en la pared del oviducto entre el infundibulum y la ampolla unos pocos milímetros aguas arriba de la ampolla por tijeras de microprimavera.
  10. Inserte la punta del capilar de vidrio que contiene los embriones en el orificio y sople suavemente en la boquilla del soporte capilar para expulsar los embriones hasta que una burbuja de aire sea visible en la ampolla.
    NOTA: Transferencia entre 10-12 embriones por oviducto.
  11. Retirar el capilar de vidrio de la pared del oviducto y empujar el órgano reproductivo suavemente hacia la cavidad corporal.
  12. Repita el proceso anterior para introducir los embriones en el otro oviducto.
  13. Al completar el procedimiento ET, sutura el peritoneo con un sencillo patrón de sutura interrumpida (50 suturas sintéticas absorbibles y trenzadas) y luego la piel con un patrón interrumpido simple o un patrón de puntada interrumpida subcuticular enterrado (60 suturas monosintéticas no absorbibles).
  14. Mantenga el ratón caliente en una placa de calentamiento de 37 oC hasta que se recupere de la anestesia.
  15. Controlar la salud del animal diariamente durante 7 días después de la cirugía.

5. Genotipado y análisis de secuencias

  1. Extracción de ADN genómico
    NOTA: Utilizamos kits de extracción de ADN de tejido NucleoSpin para extraer el ADN genómico del tejido auditivo de ratones siguiendo las recomendaciones del fabricante.
    1. Añadir 180 s de T1 t1 t1 y 25 l de solución de proteinasa K a la muestra y mezclar por vórtice durante 10 s.
    2. Incubar a 56oC durante 2 h o hasta obtener la lisis completa. Vórtice para 10 s cada 30 min de la incubación.
    3. Añadir 200 s de Tampón B3, vórtice vigorosamente durante 30 s, e incubar a 70 oC durante 10 min.
    4. Añadir 210 l de etanol al 100% a la muestra y al vórtice vigorosamente.
    5. Para cada muestra, coloque una columna de tejido en un tubo de recolección y aplique la muestra a la columna.
    6. Centrifugar durante 1 min a 11.000 x g,deseche el flujo y vuelva a colocar la columna en el tubo de recogida.
    7. Añadir 500 l de Tampón BW para lavar la muestra (1er lavado), centrífuga durante 1 min a 11.000 x g,deseche el flujo y vuelva a colocar la columna en el tubo de recogida.
    8. Añadir 600 l de tampón B5 a la columna (2o lavado), centrífuga durante 1 min a 11.000 x g,desechar el flujo a través y volver a colocar la columna en el tubo de recogida.
    9. Centrifugar la columna durante 1 min a 11.000 x g para secar la membrana de sílice y colocar la columna de tejido NucleoSpin en un tubo de microcentrífuga de 1,5 ml.
    10. Añadir 100 l de Tampón BE, incubar a temperatura ambiente durante 1 min, luego centrifugar 1 min a 11.000 x g.
  2. Amplificación y purificación de PCR
    1. Diseñe las imprimaciones utilizando el sitio web de primer3 plus (https://primer3plus.com/) para amplificar una secuencia de 400-500 bp que rodea el locus objetivo.
    2. Diseñe un nuevo protocolo PCR y pruébelo empíricamente.
    3. Purificar el producto PCR para eliminar las enzimas no deseadas, nucleótidos, imprimaciones y componentes tampón. Un método de purificación estándar se puede utilizar de la siguiente manera.
      1. Añadir 50 l de fenol a 50 l de los productos de PCR y mezclar por vórtice.
      2. Centrifugar durante 1 min a 11.000 x g y transferir la capa transparente superior a un tubo nuevo.
      3. Añadir 120 ml de etanol al 99,5 % y 20 ml de acetato de amonio y vórtice de 5 M durante 30 s.
      4. Mantener en RT durante 10 minutos y centrifugar a 11.000 x g durante 10 min.
      5. Deseche el sobrenadante y lave el pellet de ADN con 1 ml de etanol al 70%.
      6. Secar el pellet a RT durante 10 min y disolver en 10 ml de agua libre de RNase.
        NOTA: Los kits de purificación basados en columnas de PCR se vuelven a comentar porque el fenol es tóxico para los seres humanos.
  3. Secuenciación de Sanger
    1. Ejecute el análisis de cuantificación de ADN (ver Tabla de Materiales)para cuantificar el amplicon de PCR purificado.
    2. Envíe productos de PCR e imprimaciones de secuenciación a un proveedor de servicios de secuenciación.
    3. Analice la secuencia utilizando los sitios web en línea disponibles.
      NOTA: En este estudio, se utilizó CRISP-ID25 (http:/crispid.gbiomed.kuleuven.be/) para el análisis de secuencias.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Nuestro método modificado para la criopreservación de embriones unicelulares, incluida la incubación en HTF que contiene 20% de FBS durante 10 minutos seguido de criopreservación en 1 M DMSO y DAP213 solución, mejoró la tasa de desarrollo de los embriones de congelación descongelado en la etapa de dos células(Figura 1, p - 0.009, Prueba t del estudiante). Los embriones liofiluñas congeladas se utilizaron para la producción de ratones modificados genéticamente y se optimizaron las condiciones de electroporación: cinco repeticiones de 25 V con pulsos de 3 ms y intervalos de 97 ms utilizando un electroporator como se describe en la sección Protocolo. La aplicabilidad del protocolo se comprobó mediante la generación de ratones noqueadores del gen de la tirosinasa albino (Tyr)(Figura 2). Para ello, se diseñó el exón 2 de la orientación del ARG(figura 2A)y se prepararon reactivos CRISPR como se describe en la sección Protocolo. Las herramientas de edición se electroportaron dentro de 1 h de descongelación de embriones para garantizar que la edición del genoma se produjera antes de la primera replicación del genoma y así evitaron el mosaico en los fundadores(Figura 2B). Todos los ratones generados eran albinos, y sólo un ratón era mosaico, con una capa con parches blancos y negros(Figura 2C). Todos los ratones albinos que albergan dos alelos mutantes diferentes (mutación heterocigota), excepto un ratón que alberga solo un alelo (mutación homocigota) se muestran en la Figura 2E. Se puede concluir que nuestro método puede proporcionar una eficiencia de edición de cerca del 100% con una baja tasa de mosaico como se confirma por el análisis de secuenciación, así como el color de la capa(Figura 2CE).

A continuación, la reproducibilidad del protocolo fue comprobada por la generación de varias líneas de knockout y knock-in ratones. Como se muestra en la Tabla 1,el protocolo puede generar ratones knockout y knock-in con alta eficiencia y bajas tasas de mosaico. La mayoría de los ratones F0 generados se aparcían con ratones de tipo salvaje C57BL/6J para confirmar la transmisión germinal de alelos mutantes a las generaciones de F1. Como se preveía, todas las crías de F1 de los ratones homocigotos F0 eran heterocigotos, conteniendo un alelo mutante y un alelo de tipo salvaje. No se observaron mutaciones dispares entre el genotipado de los fundadores y sus generaciones. El protocolo descrito generó ratones GM en poco tiempo (es decir, 4 semanas) como se muestra en el flujo de trabajo del protocolo en la Figura 3.

Figure 1
Figura 1: Suero bovino fetal (FBS) mejoró la tasa de desarrollo en estadio bicelular de los embriones liofilconantes. El número de embriones FBS+ fue de 286 (el experimento se repitió 3 veces), y el número de embriones FBS fue de 272 (el experimento se repitió 3 veces). Los datos se presentan como medias - SEM. Esta figura se reproduce de Darwish M et al.16 con permiso. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2: Generación de ratones Tyr knockout con alta eficiencia y baja tasa de mosaico. Esta figura se modifica de Darwish M et al.16 con permiso. (A) Ilustración esquemática que muestra el diseño de gRNA. La secuencia PAM se muestra en rojo. (B) Ilustración que muestra el momento de la electroporación para los embriones congelados, el símbolo amarillo representa el tiempo de electroporación. (C) Imágenes representativas de los ratones Knockout De Tyr generados. (D) Análisis de secuencia de diferentes alelos de los ratones knockout Tyr. La secuencia de destino se etiqueta en rojo y los guiones indican la eliminación de nucleótidos en los alelos mutantes. WT - Tipo salvaje M - alelo mutante. (E) Una parte representativa del cromatograma del ratón albino que contiene el alelo M1 se muestra en D. Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3: Flujo de trabajo del protocolo para la generación de ratones GM. El primer paso fue la preparación de embriones crioconservados. Los ratones hembra C57BL/6J fueron superovulados, primero por inyección de PMSG, luego 48 h más tarde por inyección de hCG. Los COC se recogieron 16 h más tarde y se sometieron a FIV con espermatozoides recogidos de ratones machos C57BL/6J. Los ovocitos fertilizados fueron crioconservados y almacenados en nitrógeno líquido hasta que fuera necesario. El segundo paso incluyó la descongelación de los embriones y la electroporación. Los embriones crioconservados fueron desconsañidos y los reactivos CRISPR (es decir, tracrRNA, crRNA y proteína Cas9) fueron ensamblados y electroporados dentro de 1 h después de descongelar los embriones. El tercer paso incluyó la transferencia de embriones y el nacimiento de ratones. Al día siguiente de la electroporación, los embriones de dos células fueron transferidos al oviducto de ratones hembra pseudoembarazadas para generar ratones modificados genéticamente que más tarde fueron genotipados usando la secuenciación de Sanger para confirmar la eficiencia de edición. El tiempo y el esfuerzo necesarios para preparar ovocitos fertilizados antes de cada experimento (paso 1) pueden acortarse si se prepara un gran número de embriones crioconservados con antelación. Esta figura está adaptada de Darwish M et al.16Por favor, haga clic aquí para ver una versión más grande de esta figura.

Ratones mutantes Embriones electroportados Embriones de 2 células Embriones transferidos Cachorros (%) Ratones mutantes(%) No de ratones de mosaico
Tyr KO 124 84 48 12 (25) 100 1
Glrb KO 151 94 40 6 (15) 100 0
Slc39a6 KO 48 25 25 5 (20) 100 0
Bag3 KI 233 84 20 3 (15) 50 1
Camk2a KI 124 70 70 14 (20) 64.3 0

Tabla 1: Producción de varias líneas de ratones modificados genéticamente utilizando embriones liofilconantes de fondo C57BL/6J.

Cuadro Suplementario 1. Haga clic aquí para descargar esta tabla.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

El protocolo descrito permite la generación de ratones modificados genéticamente con alta eficiencia y bajas tasas de mosaico(Tabla 1). Permite a los investigadores sin habilidades avanzadas de manipulación de embriones crear ratones mutantes fácilmente porque aprovecha los últimos y más útiles avances en ingeniería reproductiva y tecnologías de edición del genoma: ribonucleoprotein (RNP) CRISPR/Cas9 y electroporación en embriones de congelación descongelación. Estos avances facilitaron y agilizaron la generación de ratones modificados genéticamente. Como se describe en la Figura 3,se tarda 4 semanas en generar los ratones GM. En comparación con otros protocolos que utilizan enfoques similares26,nuestro método es superior en términos de eficiencia, tasa de natalidad y mosaico.

La incubación de embriones unicelulares en FBS antes de la criopreservación es fundamental para mejorar la tasa de desarrollo de los embriones. Las condiciones de electroporación de los embriones crioconservados, descritas en el Protocolo, permiten un compromiso entre la eficiencia de edición de los reactivos CRISPR y la supervivencia de los embriones. De hecho, las condiciones más duras o más leves pueden afectar la tasa de desarrollo de los embriones y la eficiencia de edición, respectivamente16. El momento de la electroporación(Figura 2B)es fundamental para superar el mosaico en los fundadores y asegurarse de que la modificación del genoma se produce en presencia de sólo dos alelos. Esto es consistente con informes anteriores que muestran que la electroporación en etapa temprana podría producir mutantes no mosaicos17. Además, el uso de RNP en lugar de gRNA/mRNA disminuye la tasa de mosaico y mejora la eficiencia de edición17.

El protocolo descrito ofrece varias ventajas. En primer lugar, genera los ratones mutantes en poco tiempo (4 semanas). En segundo lugar, es un protocolo altamente eficiente y robusto; se generaron varias líneas de nocaut (KO) y ratones knock-in (KI) con altas tasas de mutación (KO 100%, KI -50 a 64,3%). En tercer lugar, es conveniente y rentable. El uso de crRNA sintético completo, tracrRNA, ssODN y proteína Cas9 elimina la necesidad de preparación tediosa de los vectores Cas9 y transcripción in vitro. En su lugar, permite a los investigadores simplemente utilizar reactivos comerciales y equipos estándar. En cuarto lugar, no utiliza microinyección, que requiere altas habilidades técnicas. En quinto lugar, reduce el mosaico en los fundadores, y por lo tanto conduce a una transmisión germinal más eficiente de los alelos editados, superando el complicado análisis genotípico de los ratones de mosaico. Por último, este protocolo es eficiente con la cepa endogámica C57BL/6J, que evita el uso de híbridos F1, y por lo tanto la necesidad de realizar numerosos backcrosses para deshacerse de la complejidad genética. El genotipado de las generaciones de F1 confirmó una transmisión precisa de la línea germinal. Sin embargo, no se recomienda estudiar los fenotipos de los ratones F0 debido a la complejidad del alelo y la predicción engañosa del genotipado de la generación posterior extrapolada del genotipado de los fundadores de F014,,27.

Es de suma importancia aprovechar el uso de los embriones congelados descongelados en la edición del genoma de primates no humanos y animales grandes como cerdos y ovejas, que no siempre están disponibles. Los métodos de congelación de embriones difieren mucho dependiendo de la especie animal. Por lo tanto, creemos que nuestro protocolo de criopreservación podría ser sólo aplicable a ratones. Por otro lado, nuestro protocolo es potencialmente aplicable para el uso de nucleasas de ingeniería distintas de Cas9 para la generación de ratones modificados genéticamente, porque la electroporación se ha informado previamente para introducir otras nucleasas como Cas12a en el embrión eficientemente28,,29.

Una limitación del protocolo es la integración precisa de un transgén largo en el genoma, que se considera difícil en los protocolos basados en electroporación. Sin embargo, se informó de una posible solución: la integración de transgenes hasta 4,9 Kb en el genoma del ratón se realizó con éxito combinando electroporación con un sistema de entrega de donantes HDR mediado por un virus asociado a adeno (AAV)30,confirmando una publicación anterior31. Además, la posible aparición de efectos secundarios fuera del objetivo es una preocupación importante con el uso de la tecnología CRISPR/Cas9. No hemos realizado la secuenciación del genoma completo de los ratones editados para excluir el posible efecto fuera del objetivo. Sin embargo, hemos utilizado herramientas CRISPR que se han notificado para reducir el efecto fuera del objetivo, como RNP32. Además, utilizamos una variante Cas9 de alta fidelidad que reduce significativamente la edición fuera del objetivo sin sacrificar el rendimiento en el objetivo33. Además, diseñamos gRNAs utilizando software CRISPRdirect (https://crispr.dbcls.jp), lo que debería dar lugar a secuencias de destino con sitios de destino no objetivo minimizados19. Para confirmar la causalidad genotipo-fenotipo y aliviar las preocupaciones sobre los efectos fuera del objetivo, los investigadores deben generar varios ratones editados del mismo genotipo utilizando diferentes gRNAs o realizar el cruce posterior de los ratones generados durante varias generaciones.

Los ratones noqueadores generados utilizando el mecanismo NHEJ y las mutaciones de frameshift han sido ampliamente utilizados y muestran fenotipos relevantes. Sin embargo, la proteína residual truncada puede existir debido a la reiniciación de la traducción o a la omisión del exóneditado 34,35. Por lo tanto, para interpretar con precisión los fenotipos, es necesaria la caracterización de la función o expresión de proteína residual. La generación de ratones noqueadores genéticos completos que utilicen más de un ARNm sería una buena alternativa. Sin embargo, debe prestarse especial atención para confirmar que el gen no contiene regiones intrónicas transcritas a ARN no codificantes, que podrían tener funciones reglamentarias y, por lo tanto, complicar el análisis fenotípico.

En este estudio, mostramos un protocolo simple por el cual muchos investigadores pueden generar ratones genéticamente modificados en 4 semanas o menos. Al combinar el uso de embriones congelados y electroporación, hacemos que la preparación de modelos de ratón de enfermedades humanas sea fácil, rápida y eficiente.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen revelaciones financieras relevantes.

Acknowledgments

Queremos agradecer a Hitomi Sawada y Elizabeth García por el cuidado de los animales. Este trabajo fue apoyado por KAKENHI (15K20134, 17K11222, 16H06276 y 16K01946) y Hokugin Research Grant (a H.N.), y Jichi Medical University Young Investigator Award (a H.U.). La Fundación de Becas Otsuka Toshimi apoyó a M.D.

Materials

Name Company Catalog Number Comments
0.25 M Sucrose ARK Resource Co., Ltd. (Kumamoto, Japan) SUCROSE
1 M DMSO ARK Resource Co., Ltd. (Kumamoto, Japan) 1M DMSO
Butorphanol Meiji Seika Pharma Co., Ltd. (Tokyo, Japan) Vetorphale 5mg
Cas9 protein: Alt-R® S.p. HiFi Cas9 Nuclease 3NLS Integrated DNA Technologies, Inc. (Coralville, IA) 1081060
C57BL/6J mice Japan SLC (Hamamatsu, Japan) N/A
DAP213 ARK Resource Co., Ltd. (Kumamoto, Japan) DAP213
FBS Sigma-Aldrich, Inc. (St. Louis, MO) ES-009-C
hCG MOCHIDA PHARMACEUTICAL CO., LTD (Tokyo, Japan) HCG Mochida 3000
HTF ARK Resource Co., Ltd. (Kumamoto, Japan) HTF
ICR mice Japan SLC (Hamamatsu, Japan) N/A
Isoflurane Petterson Vet Supply, Inc. (Greeley, CO) 07-893-1389
KSOM ARK Resource Co., Ltd. (Kumamoto, Japan) KSOM
LN2 Tank Chart Industries (Ball Ground, GA) XC 34/18
M2 ARK Resource Co., Ltd. (Kumamoto, Japan) M2
Medetomidine Nippon Zenyaku Kogyo Co.,Ltd. (Koriyama, Japan) 1124401A1060
Microscope Nikon Co. (Tokyo, Japan) SMZ745T
Midazolam Sandoz K.K. (Tokyo, Japan) 1124401A1060
Nuclease free buffer Integrated DNA Technologies, Inc. (Coralville, IA) 1072570
Nucleospin DNA extraction kit Takara Bio Inc (Kusatsu, Japan) 740952 .5
One-hole slide glass Matsunami Glass Ind., Ltd. (Kishiwada, Japan) S339929
One-step type Electroporator BEX Co., Ltd. (Tokyo, Japan) CUY21EDIT II
Paraffin Liquid NACALAI TESQUE Inc. (Kyoto, Japan) SP 26137-85
Platinum plate electrode BEX Co., Ltd. (Tokyo, Japan) LF501PT1-10, GE-101
PMSG ASKA Animal Health Co., Ltd (Tokyo, Japan) SEROTROPIN 1000
Povidone iodide Professional Disposables International, Inc. (Orangeburg, NY) C12400
Reduced-Serum Minimal Essential Medium: OptiMEM I Sigma-Aldrich, Inc. (St. Louis, MO) 22600134
Two-step type Electroporator Nepa Gene Co., Ltd. (Ichikawa, Japan) NEPA21

DOWNLOAD MATERIALS LIST

References

  1. Wang, H., et al. One-step generation of mice carrying mutations in multiple genes by CRISPR/cas-mediated genome engineering. Cell. 153, (4), 910-918 (2013).
  2. Jinek, M., et al. A programmable dual-RNA - guided DNA endonuclease in adaptive bacterial immunity. Science. 337, (6096), 816-822 (2012).
  3. Mali, P., et al. RNA-guided human genome engineering via Cas9. Science. 339, (6121), 823-826 (2013).
  4. Cong, L., et al. Multiplex genome engineering using CRISPR/VCas systems. Science. 339, (6121), 819-823 (2013).
  5. Doudna, J. A., Charpentier, E. The new frontier of genome engineering with CRISPR-Cas9. Science. 346, (6213), 1258096 (2014).
  6. Mashiko, D., et al. Generation of mutant mice by pronuclear injection of circular plasmid expressing Cas9 and single guided RNA. Scientific Reports. 3, 3355 (2013).
  7. Yen, S. T., et al. Somatic mosaicism and allele complexity induced by CRISPR/Cas9 RNA injections in mouse zygotes. Developmental Biology. 393, (1), 3-9 (2014).
  8. Kaneko, T., Mashimo, T. Simple genome editing of rodent intact embryos by electroporation. PLoS ONE. 10, (11), 1-7 (2015).
  9. Qin, W., et al. Efficient CRISPR/cas9-mediated genome editing in mice by zygote electroporation of nuclease. Genetics. 200, (2), 423-430 (2015).
  10. Kaneko, T., Sakuma, T., Yamamoto, T., Mashimo, T. Simple knockout by electroporation of engineered endonucleases into intact rat embryos. Scientific Reports. 4, 6382 (2014).
  11. Hashimoto, M., Takemoto, T. Electroporation enables the efficient mRNA delivery into the mouse zygotes and facilitates CRISPR/Cas9-based genome editing. Scientific Reports. 5, 11315 (2015).
  12. Chen, S., Lee, B., Lee, A. Y. F., Modzelewski, A. J., He, L. Highly efficient mouse genome editing by CRISPR ribonucleoprotein electroporation of zygotes. Journal of Biological Chemistry. 291, (28), 14457-14467 (2016).
  13. Modzelewski, A. J., et al. Efficient mouse genome engineering by CRISPR-EZ technology. Nature Protocols. 13, (6), 1253-1274 (2018).
  14. Teixeira, M., et al. Electroporation of mice zygotes with dual guide RNA/Cas9 complexes for simple and efficient cloning-free genome editing. Scientific Reports. 8, 474 (2018).
  15. Nakagawa, Y., et al. Production of knockout mice by DNA microinjection of various CRISPR/Cas9 vectors into freeze-thawed fertilized oocytes. BMC Biotechnology. 15, (1), 1-10 (2015).
  16. Darwish, M., et al. Rapid and high-efficient generation of mutant mice using freeze-thawed embryos of the C57BL/6J strain. Journal of Neuroscience Methods. 317, 149-156 (2019).
  17. Hashimoto, M., Yamashita, Y., Takemoto, T. Electroporation of Cas9 protein/sgRNA into early pronuclear zygotes generates non-mosaic mutants in the mouse. Developmental Biology. 418, (1), 1-9 (2016).
  18. Sakamoto, W., Kaneko, T., Nakagata, N. Use of frozen-thawed oocytes for efficient production of normal offspring from cryopreserved mouse spermatozoa showing low fertility. Comparative Medicine. 55, (2), 136-139 (2005).
  19. Naito, Y., Hino, K., Bono, H., Ui-Tei, K. CRISPRdirect: Software for designing CRISPR/Cas guide RNA with reduced off-target sites. Bioinformatics. 31, (7), 1120-1123 (2015).
  20. Torres-Perez, R., Garcia-Martin, J. A., Montoliu, L., Oliveros, J. C., Pazos, F. WeReview: CRISPR Tools-Live Repository of Computational Tools for Assisting CRISPR/Cas Experiments. Bioengineering. 6, (3), 63 (2019).
  21. Okamoto, S., Amaishi, Y., Maki, I., Enoki, T., Mineno, J. Highly efficient genome editing for single-base substitutions using optimized ssODNs with Cas9-RNPs. Scientific Reports. 9, 4811 (2019).
  22. Takeo, T., Nakagata, N. Superovulation using the combined administration of inhibin antiserum and equine chorionic gonadotropin increases the number of ovulated oocytes in C57BL/6 female mice. PLoS ONE. 10, (5), 1-11 (2015).
  23. Wuri, L., Agca, C., Agca, Y. Euthanasia via CO2 inhalation causes premature cortical granule exocytosis in mouse oocytes and influences in vitro fertilization and embryo development. Molecular Reproduction and Development. 86, (7), 825-834 (2019).
  24. Nakagata, N. High survival rate of unfertilized mouse oocytes after vitrification. Journal of Reproduction and Fertility. 87, (2), 479-483 (1989).
  25. Dehairs, J., Talebi, A., Cherifi, Y., Swinnen, J. V. CRISP-ID: Decoding CRISPR mediated indels by Sanger sequencing. Scientific Reports. 6, 28973 (2016).
  26. Nakagawa, Y., Sakuma, T., Takeo, T., Nakagata, N., Yamamoto, T. Electroporation-mediated genome editing in vitrified/warmed mouse zygotes created by ivf via ultra-superovulation. Experimental Animals. 67, (4), 535-543 (2018).
  27. Nakajima, K., Nakajima, T., Takase, M., Yaoita, Y. Generation of albino Xenopus tropicalis using zinc-finger nucleases. Development Growth and Differentiation. 54, (9), 777-784 (2012).
  28. Hur, J. K., et al. Targeted mutagenesis in mice by electroporation of Cpf1 ribonucleoproteins. Nature Biotechnology. 34, 807-808 (2016).
  29. Dumeau, C. E., et al. Introducing gene deletions by mouse zygote electroporation of Cas12a/Cpf1. Transgenic Research. 28, (5-6), 525-535 (2019).
  30. Chen, S., et al. CRISPR-READI: Efficient Generation of Knockin Mice by CRISPR RNP Electroporation and AAV Donor Infection. Cell Reports. 27, (13), 3780-3789 (2019).
  31. Mizuno, N., et al. Intra-embryo Gene Cassette Knockin by CRISPR/Cas9-Mediated Genome Editing with Adeno-Associated Viral Vector. iScience. 9, 286-297 (2018).
  32. Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. Highly Efficient RNA-guide genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Research. 24, (6), 1012-1019 (2014).
  33. Vakulskas, C. A., et al. A high-fidelity Cas9 mutant delivered as a ribonucleoprotein complex enables efficient gene editing in human hematopoietic stem and progenitor cells. Nature Medicine. 24, (8), 1216-1224 (2018).
  34. Rodriguez-Rodriguez, J. A., et al. Distinct Roles of RZZ and Bub1-KNL1 in Mitotic Checkpoint Signaling and Kinetochore Expansion. Current Biology. 28, (21), 3422-3429 (2018).
  35. Smits, A. H., et al. Biological Plasticity Rescues Target Activity in CRISPR Knockouts. Nature Methods. 16, 1087-1093 (2019).
Uso de embriones congelados descongelados para la producción de alta eficiencia de ratones modificados genéticamente
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Nishizono, H., Darwish, M., Uosaki, H., Masuyama, N., Seki, M., Abe, H., Yachie, N., Yasuda, R. Use of Freeze-thawed Embryos for High-efficiency Production of Genetically Modified Mice. J. Vis. Exp. (158), e60808, doi:10.3791/60808 (2020).More

Nishizono, H., Darwish, M., Uosaki, H., Masuyama, N., Seki, M., Abe, H., Yachie, N., Yasuda, R. Use of Freeze-thawed Embryos for High-efficiency Production of Genetically Modified Mice. J. Vis. Exp. (158), e60808, doi:10.3791/60808 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter