Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Användning av frysta upptinade embryon för högeffektiv produktion av genetiskt modifierade möss

doi: 10.3791/60808 Published: April 2, 2020
* These authors contributed equally

Summary

Här presenterar vi en modifierad metod för kryokonservering av encelliga embryon samt ett protokoll som kopplar användningen av frysta-tinade embryon och elektroporation för effektiv generation av genetiskt modifierade möss.

Abstract

Användningen av genetiskt modifierade (GM) möss har blivit avgörande för att förstå genfunktionen och dechiffrera de underliggande mekanismerna för mänskliga sjukdomar. CRISPR/Cas9-systemet gör det möjligt för forskare att ändra genomet med oöverträffad effektivitet, trohet och enkelhet. Utnyttja denna teknik, forskare söker en snabb, effektiv och enkelt protokoll för att generera GM möss. Här introducerar vi en förbättrad metod för kryokonservering av encelliga embryon som leder till en högre utvecklingstakt av de frysta upptinade embryona. Genom att kombinera det med optimerade elektroporationsförhållanden möjliggör detta protokoll generering av knockout- och knock-in-möss med hög effektivitet och låga mosaikhastigheter inom en kort tid. Dessutom visar vi en steg-för-steg-förklaring av vårt optimerade protokoll, som omfattar CRISPR-reagensberedning, provspisbefruktning, kryokonservering och upptining av encelliga embryon, elektroporation av CRISPR-reagenser, musgenerering och genotypning av grundarna. Med hjälp av detta protokoll bör forskare kunna förbereda GM-möss med oöverträffad lätthet, hastighet och effektivitet.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Det klustrade regelbundet interspaced korta palindromic repetitioner (CRISPR)/CRISPR-associerade protein 9 (Cas9) systemet är ett vetenskapligt genombrott som ger oöverträffad riktad modifiering i genomet1. CRISPR/Cas9-systemet består av Cas9-protein och styr RNA (gRNA) med två molekylära komponenter: ett målspecifik CRISPR RNA (crRNA) och ett transaktiverande CRISPR RNA (tracrRNA)2 . Ett gRNA riktar Cas9-proteinet mot den specifika locus i genomet, 20 nukleotider som kompletterar crRNA och intill protospacer intilliggande motiv (PAM). Cas9-proteinet binder till målsekvensen och inducerar dubbelsträngsbrott (DSB) som repareras av antingen felbenägna nonhomologous end joining (NHEJ) eller high fidelity homology-directed repair (HDR)3,4,5. NHEJ leder till infogningar eller/och borttagningar (indels), och därmed till genförlust av funktion när en kodningssekvens är riktad. HDR leder till exakt genomredigering i närvaro av en reparationsmall som innehåller homologisekvenser3,,4,5. NHEJ och HDR har utnyttjats för att generera knockout och knock-in möss, respektive.

Crispr/Cas9-systemet har accelererat produktionen av GM-möss med enastående effekt och trohet, men forskare som tillämpar dessa metoder stöter ofta på tekniska utmaningar. För det första kräver konventionella protokoll mikroinjektion för att införa CRISPR-redigeringsverktygen i pronucleusen av befruktade ägg6,7. Denna teknik är tidskrävande och kräver vanligtvis omfattande utbildning. Således ersatte flera grupper mikroinjektion med elektroporation8,9,10,11,12,13. I de tidiga elektroporation protokollen färska embryon användes för elektroporation. Detta orsakade ett annat problem, eftersom förbereda färska embryon före varje experiment är svårt14.

Nyligen har vi och andra kombinerat användningen av frysta-tinade embryon och elektroporation för genomredigering, vilket underlättar uppkomsten av GM möss15,16. Detta protokoll gör det möjligt för forskare utan avancerad embryomanipulationsförmåga att snabbt generera djurmodeller av mänskliga sjukdomar med hög effektivitet. Protokollet minskar också avsevärt praktiska utmaningar i att generera GM möss, såsom genetisk heterogenitet i grundarna16. För att övervinna mosaicism utför vi elektroporation av CRISPR-reagenser inom 1 h efter embryoupptining för att säkerställa att redigering sker före den första replikeringen av genomet. En annan förbättring inkluderar användningen av Cas9 protein istället för Cas9 mRNA för att minska oönskad mosaicism17. Dessutom utvecklade vi en optimal metod för en-cell embryo cryopreservation som ökar utvecklingstakten till två-cell steg16:användning av fetala nötkreatur serum (FBS) dramatiskt förbättrar överlevnaden av fryst-tinade äggceller efter befruktning, kanske med samma mekanism som gör fryst-tinade ofertiliserade oocyter mer motståndskraftiga18.

Här presenterar vi ett omfattande protokoll för generering av GM-möss med frysta-tinade embryon, inklusive den modifierade metoden för cryopreservation av en-cell C57BL/6J embryon. Den innehåller 1) gRNA-design, CRISPR-reagensberedning och montering; 2) IVF, kryobevarande och upptining av encelliga embryon; 3) Elektroporering av CRISPR-reagenser till fryst tinade embryon. 4) Embryoöverföring till oviduct av pseudopregnant kvinnliga möss; och 5) Genotypning och sekvensanalys av F0-grundarnas djur.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

All djurvård och alla djurförsök som utförts i denna studie har utförts i enlighet med reglerna och föreskrifterna i Handledning för skötsel och användning av försöksdjur. Det experimentella protokollet godkändes av Animal Care Kommittén för laboratoriedjur vid University of Toyama, University of Tokyo, Jichi University, och Max Planck Florida Institute for Neuroscience. Information om alla reagenser visas i materialregistret.

1. CRISPR reagenser design

  1. crRNA design
    1. Besök CRISPR direct19 (https://crispr.dbcls.jp/) för att designa specifika crRNAs med reducerade off-target-webbplatser.
      Obs: Det finns många andra användbara verktyg för att utforma crRNA20 (https://bioinfogp.cnb.csic.es/tools/wereview/crisprtools/).
    2. Sätt i mål nukleotidsekvensen och gör följande ändringar:
      PAM-sekvenskrav = NGG
      Specificitetskontroll = Mus (muskulas) genom, GRCm38/mm10 (dec, 2011)
      OBS: För att generera Tyrosinase (Tyr) knockout-möss var exon 2 (nukleotidsekvens från 9476–9692) måltavla.
    3. Klicka på Designoch markera Visa högst specifikt målför mycket specifika träffar .
    4. Om du vill minska potentiella off-target-effekter väljer du målsekvensen med det lägsta värdet i kolumnerna "12 mer+PAM" och "8 mer+PAM".
      I dessa kolumner anger ("1") att sekvensen bara har en perfekt matchning med den avsedda målplatsen och tal som är större än en anger förekomsten av potentiella off-target-platser.
    5. Beställ de resulterande oligonukleotiderna från syntesföretag för crRNA (Supplimentary Table 1).
      OBS: För exon 2 Tyr genen användes följande målsekvens: GGACCACTATTACGTAATCC, med +TGG som PAM-sekvens (Figur 2A).
  2. Single strand oligodeoxynucleotide (ssODN) design för HDR-medierad redigering experiment (dvs. knock-in möss generation).
    1. Designa ssODN längd vara runt 80-180 bp inklusive 30-60 nukleotid (nt) homologi armar på båda sidor.
      OBS: En ssODN på 75-85 nt längd, inklusive en 30-35 nt homologi arm och komplement till GRNA, visade hög knock-in redigering effektivitet21.
    2. Sätt in den avsedda modifieringen och den tysta mutationen vid PAM-sekvensen eller, om det inte är möjligt, vid PAM:s 5"-angränsande bas för att blockera omskärningen efter genomredigering.
      OBS: Det crRNA och ssODN som används i denna studie anges i tilläggstabell 1.

2. In vitro-befruktning, embryot cryopreservation och frystupptining

  1. In vitro-befruktning
    1. Superovulate C57BL/6J honmöss (4 eller 8 veckor gamla) genom IP-injektion med gravid stoserumsadotropin (PMSG) följt av injektion med 7,5 IE humant korionens gonadotropin (hCG) efter 48 timmar.
      OBS: Antalet ägglossade äggceller kan ökas med ca 3x med ultra-superovulation22.
    2. Ta bort cauda epididymides från sexuellt mogna C57BL/6J hanmöss (3-5 månader gamla).
      OBS: Det är möjligt att samla spermatozoa utan att offra de manliga mössen.
    3. Extrahera blodproppar av spermatozoa med en dissekera nål och inkubera dem i en 200 μL2 droppe mänsklig tubalvätska (HTF) i CO 2-inkubator för 1,5 h för kapacitering.
    4. Samla cumulus-oocyter komplex (COCs) från oviducts 16-18 h efter hCG injektion och inkubera dem i en färsk 200 μL droppe HTF medium täckt med paraffin vätska i en CO2 inkubator (5% CO2, 37 °C) för högst 2 h.
      OBS: Det är att föredra att offra mössen genom cervikal störning under anestesi eftersom dödshjälp via CO2 inandning påverkar IVF och embryoutveckling23.
    5. Tillsätt 1–5 μl spermieupphängning från inkubationsmediets gräns till 200 μl droppe HTF-medium2 som innehåller COC och inkubera dem i en CO 2-inkubator i 3 timmar.
    6. Tvätta äggcellerna med kalium-kompletterade simplex optimeringsmedium (KSOM) 3x för att ta bort återstående spermier och cumulus celler.
    7. Kontrollera pronuclearbildningen och sorterna av encelliga embryon med hjälp av ett inverterat mikroskop.
  2. Kryokonservering av encelliga embryon
    1. Inkubera encelliga embryon i en 200 μl droppe HTF innehållande 20 % FBS (ej täckt2 med paraffinvätska) i 10 minuter i en CO 2-inkubator.
    2. Överför 20–100 embryon till 50 μl 1 M dimetylsulfoxidlösning (DMSO)24.
    3. Överför 5 μl lösning som innehåller 100 embryon till botten av en kryotube och svalna i 5 min vid 0 °C med en kylmaskin eller på is.
    4. Tillsätt 45 μl DAP213 (2 M dimetylsulfaoxid, 1 M acetamid och 3 M propylenglykol) lösning långsamt längs rörväggen, locket rören, och hålla i 5 min i en kylmaskin eller på is vid 0 °C.
      OBS: Fäst inte locken för hårt för att lätt ta bort dem under provupptiningen.
    5. Förvara rören snabbt i flytande kväve.
  3. Upptining av embryon
    1. Öppna locket på kryotuben, kassera det återstående flytande kvävet och tillsätt 900 μL 0,25 M sackaroslösning som är förvärmd till 37 °C.
      OBS: Sackaroslösningen på 0,25 M måste värmas upp till 37 °C i förväg eftersom användningen av kalllösning minskar embryots livskraft efter upptining.
    2. Pipet snabbt för 10x och överföra innehållet i cryotube i en plastskål.
      OBS: Pipetteringen bör utföras noggrant, så att inga bubblor genereras och skadar embryona.
    3. Tvätta morfologiskt normala befruktade äggceller 2x i KSOM medium täckt med2 paraffinvätska och förvara dem i en CO 2-inkubator tills elektroporationen.

3. Montering och elektroporering av CRISPR-reagenser

OBS: För elektroporation använde vi en platinaplatta elektrod (höjd: 0,5 mm, längd: 10 mm, bredd: 3 mm, mellanrum: 1 mm) och en ettstegstyp elektroporator som beskrevs tidigare8 (Tabell över material). En elektroporator av två steg kan också användas (Tabell över material).

  1. Beredning och montering av CRISPR-reagenser
    1. Beställ CRISPR-reagenser (t.ex. crRNA, tracrRNA och Cas9-protein) och ssODN om du utför HDR-medierade redigeringsexperiment(Tabell över material och tilläggstabell 1).
    2. Förbered glödgningslösningen enligt följande.
      1. Förbered 1 μg/μL crRNA och 1 μg/μL tracrRNA i reducerad serum minimal essential mediumlösning (tabell över material)och tillsätt 6 μL av varje lösning till 42 μL av den nukleafria bufferten.
      2. Inkubera blandningen i torrvärmaren vid 95 °C i 3 min och svalna vid RT i 5 min.
      3. Förbered 1 μg/μL HiFi Cas9 protein utspätt i Opti-MEM I och tillsätt 6 μL till föregående blandning för en total volym på 60 μL.
      4. Vid HDR-medierade redigeringsexperiment, tillsätt 6 μL av 1 μg/μL ssODN. Eftersom den slutliga volymen bör vara 60 μL, använd 36 μL nukleasfritt vatten i steg 3.1.2.1.
        OBS: Den slutliga koncentrationen av crRNA, tracrRNA, Cas9 protein och ssODN kommer att vara 100 ng/μL.
      5. Överför upp till 100 embryon till 25 μl av den slutliga blandningen (RNP-komplex) i ett ett hålglas och inkubera dem vid 37 °C i 10 min.
  2. Elektroporation
    1. Fyll elektrodgapet med 6 μL av den nya blandningen av CRISPR-reagenser och tillsätt 20–25 embryon till blandningen.
      OBS: Det är viktigt att undvika all kontakt mellan embryona och elektroporationselektroden, som kan skada embryon under elektriska pulser.
    2. Utför elektroporationen vid följande förhållanden för en elektroporator av en stegtyp:
      Spänning: 25 V, Pulsriktning (Pd) +
      PÅ: 3 ms, AV: 97 ms
      Upprepar: 5x
      OBS: Elektroporation bör utföras högst 1 h efter upptining för att säkerställa att genomredigering sker före den första DNA-replikationen för att förhindra mosaicism.
    3. För en elektroporator av två steg ställer du in villkoren enligt följande:
      Poring Pulse = 40V, Pd +
      ON = 1 eller 2,5 ms; Pulsintervall = 50 ms
      Upprepar: 4x, Decay 10%

      Överföringspuls = 5 eller 7V; Pd +/-.
      PÅ: 50 ms; Pulsintervall = 50 ms.
      Repetitioner = 5x; Förfall = 40%.
      Obs: Det är viktigt att justera volymen för att bibehålla impedansen inom det specifika intervall som anges av tillverkaren.
    4. Tvätta embryona 3x med modifierad Krebs-Ringer Bikarbonat Buffert 2 (M2) medium följt av två tvättar med en droppe KSOM medium täckt med paraffinvätska.
    5. Inkubera de tvättade embryona (i KSOM-medium) i en CO2-inkubator över natten för vidare transplantation.

4. Överföring av embryon

  1. Förbered pseudopregnant kvinnliga möss. Mate ICR honmöss (3–6 månader) med vasektomiserade hanmöss 1 dag före embryoöverföringen (ET).
    OBS: Möss bör kontrolleras nästa morgon för en copulatory kontakt. Mössen med en plugg anses vara pseudopregnant och kan användas för ET.
  2. Sug luft och KSOM (utan paraffinvätska) i alternativa intervall på 2–3 mm i en glaskapillär som markör för framgångsrik implantation.
  3. För in 20–24 embryon i en 200 μl droppe KSOM (utan paraffinvätska) och dra in 10–12 embryon i glaskahäxet för implantation i varje äggledarskap.
  4. Söva de kvinnliga mössen genom isofluran (inandning) eller en IP-injektion av en lösning som kombinerar medetomidin/midazolam/butorfanol (0,3 mg/kg, 4,0 mg/kg respektive 5,0 mg/kg). Placera den sövda musen på dess ventrala sida på en värmedyna. Skydda ögonen på den sövda musen med en återfuktande gel.
  5. Raka längs den nedre delen av dorsala mittlinjen och desinficera området med povidone jod följt av med 70% etanol.
  6. Gör en lång ~ 1 cm snitt parallellt med dorsala mittlinjen.
  7. Ta ut äggledaren och placera på en steril plast drapera. Håll den fuktig med hjälp av varm steril koksaltlösning.
  8. Placera äggledaren under det stereoskopiska mikroskopet.
  9. Gör ett hål i väggen av äggledaren mellan infundibulum och ampulla några millimeter uppströms ampulla genom microspring sax.
  10. För in spetsen på den kapillär som innehåller embryona i hålet och blås försiktigt in i kapillärhållarens munstycke för att driva ut embryona tills en luftbubbla syns i ampulla.
    OBS: Överför mellan 10–12 embryon per äggledare.
  11. Dra tillbaka glaskapillären från oviductväggen och tryck tillbaka reproduktionsorganet försiktigt in i kroppshålan.
  12. Upprepa den tidigare processen för att införa embryona i den andra äggledaren.
  13. Efter avslutad ET-ingrepp, sutur bukhinnan med en enkel avbruten sutur mönster (50, absorberbara, flätade syntetiska suturer) och sedan huden med ett enkelt avbrutet mönster eller en begravd subkuticular avbruten stygn mönster (60 icke-absorberbara, monosyntetiska suturer).
  14. Håll musen varm på en 37 °C värmeplatta tills den återhämtar sig från anestesi.
  15. Övervaka djurets hälsa dagligen i 7 dagar efter operationen.

5. Genotypning och sekvensanalys

  1. Genomisk DNA-extraktion
    OBS: Vi använde NucleoSpin vävnad DNA extraktion kit för att extrahera det genomiska DNA från möss öronvävnad efter tillverkarens rekommendationer.
    1. Tillsätt 180 μl buffert T1 och 25 μL proteinas K-lösning till provet och blanda genom att virvla i 10 s.
    2. Inkubera vid 56 °C i 2 timmar eller tills fullständig lys erhålls. Vortex för 10 s var 30:e minut av inkubationen.
    3. Tillsätt 200 μl buffert B3, virvel kraftigt i 30 s och inkubera vid 70 °C i 10 min.
    4. Tillsätt 210 μL 100% etanol till provet och virvel kraftigt.
    5. För varje prov placerar du en vävnadskolumn i ett uppsamlingsrör och applicera provet på kolonnen.
    6. Centrifugera i 1 min vid 11 000 x g,kasta genom flödet och placera tillbaka kolonnen i uppsamlingsröret.
    7. Tillsätt 500 μl buffert BW för att tvätta provet (1:a tvätten), centrifug i 1 min vid 11 000 x g,kasta genom flödet och placera tillbaka kolonnen i uppsamlingsröret.
    8. Tillsätt 600 μl buffert B5 till kolonnen (2:a tvätten), centrifugera i 1 min vid 11 000 x g,kasta flödet genomströmningen och placera tillbaka kolonnen i uppsamlingsröret.
    9. Centrifugera kolonnen i 1 min vid 11 000 x g för att torka kiseldioxidmembranet och placera nucleoSpinvävnadskolonnen i ett 1,5 ml mikrocentrifugrör.
    10. Tillsätt 100 μl buffert BE, inkubera i rumstemperatur i 1 min och centrifugera 1 min vid 11 000 x g.
  2. PCR förstärkning och rening
    1. Designa primers med primer3 plus webbplats (https://primer3plus.com/) för att förstärka en 400-500 bp sekvens som omger riktade locus.
    2. Designa ett nytt PCR-protokoll och testa det empiriskt.
    3. Rena PCR-produkten för att ta bort oönskade enzymer, nukleotider, grundfärger och buffertkomponenter. En standardreningsmetod kan användas enligt följande.
      1. Tillsätt 50 μl fenol till 50 μl av PCR-produkterna och blanda genom att virvla.
      2. Centrifugera i 1 min vid 11 000 x g och överför det övre genomskinliga skiktet till ett nytt rör.
      3. Tillsätt 120 μL 99,5 % etanol och 20 μl 5 M ammoniumacetat och virvel för 30 s.
      4. Förvaras på RT i 10 min och centrifug på 11 000 x g i 10 min.
      5. Kasta supernatanten och tvätta DNA-pelleten med 1 ml 70% etanol.
      6. Torka pelleten på RT i 10 min och lös på 10 μL RNase fritt vatten.
        OBS: PCR kolumn-baserade rening kit recommented eftersom fenol är giftigt för människor.
  3. Sanger sekvensering
    1. Kör DNA-kvantifieringsanalys (se Tabell över material) för att kvantifiera den renade PCR-ampliconen.
    2. Skicka PCR-produkter och sekvenseringsprimer till en sekvenseringstjänstleverantör.
    3. Analysera sekvensen med hjälp av tillgängliga online-webbplatser.
      OBS: I denna studie användes CRISP-ID25 (http:/crispid.gbiomed.kuleuven.be/) för sekvensanalys.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Vår modifierade metod för kryokonservering av encelliga embryon, inklusive inkubation i HTF som innehåller 20% FBS för 10 min följt av kryokonservering i 1 M DMSO och DAP213 lösning, förbättrade utvecklingshastigheten av fryst-tinade embryon i två-cellstadiet(Figur 1, p = 0,009, Students t-test). De frysta-tinade embryona användes för produktion av GM möss och elektroporation villkor optimerades: fem repetitioner av 25 V med 3 ms pulser och 97 ms intervall med hjälp av en elektroporator som beskrivs i protokollet avsnitt. Protokollets tillämplighet kontrollerades genom generering av albino tyrosinasegen (Tyr) knockout-möss (figur 2). För att göra detta utformades GRNA-inriktning exon 2 (figur 2A) och CRISPR-reagenser utarbetades enligt beskrivningen i protokollavsnittet. Redigeringsverktygen elektroporerades inom 1 h av embryoupptining för att säkerställa genomredigering inträffade före den första replikeringen av genomet och därmed förhindrade mosaicism i grundarna (Figur 2B). Alla genererade möss var albino, och endast en mus var mosaik, med en kappa med vita och svarta fläckar (Figur 2C). Alla albinomöss som hyser två olika mutanta alleler (heterozygous mutation) utom en mus som hyser endast en allel (homozygous mutation) visas i figur 2E. Man kan dra slutsatsen att vår metod kan ge en redigering effektivitet nära 100% med en låg mosaik hastighet som bekräftas av sekvensering analys samt päls färg (Figur 2C-E).

Därefter kontrollerades reproducerbarheten av protokollet av genereringen av flera rader av knockout och knock-in möss. Som visas i tabell 1kan protokollet generera knockout- och knock-in-möss med hög effektivitet och låga mosaikhastigheter. De flesta av de genererade F0 möss var parat med vilda typ C57BL/6J möss för att bekräfta sett överföring av mutanta alleler till F1 generationer. Som väntat var alla F1-avkommor till de homozygous F0-mössen heterozygous, som innehöll en mutant allel och en vild typ allel. Inga olika mutationer observerades mellan genotypning av grundarna och deras generationer. Det beskrivna protokollet genererade GM-möss inom en kort tid (dvs. ~ 4 veckor) som visas i arbetsflödet för protokollet i figur 3.

Figure 1
Figur 1: Fetala bovin serum (FBS) förbättrade två-cell steg utvecklingshastigheten för frysta tinade embryon. Antalet FBS+ embryon var 286 (experimentet upprepades 3x), och antalet FBS-embryon var 272 (experimentet upprepades 3x). Data presenteras som medelvärde ± SEM. Denna siffra återges från Darwish M et al.16 med tillstånd. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2: Generation av Tyr knockout möss med hög effektivitet och låg mosaik hastighet. Denna siffra ändras från Darwish M et al.16 med tillstånd. (A)Schematisk illustration som visar utformningen av gRNA. PAM-sekvensen visas i rött. (B)Illustration som visar tidpunkten för elektroporation för frysta-tinade embryon, den gula symbolen representerar elektroporationstid. (C)Representativa bilder av de genererade Tyr knockout möss. (D)Sekvensanalys av olika alleler av Tyr knockout möss. Målsekvensen är märkt i rött och streck indikerar borttagning av nukleotider i mutanta alleler. WT = vild typ M = mutant allel. (E)En representativ del av albinomusens kromatogram som innehåller M1-allelen visas i D. Klicka här för att se en större version av denna figur.

Figure 3
Figur 3: Arbetsflöde för protokollet för generering av genetiskt modifierade möss. Det första steget var beredningen av kryoreserverade embryon. Hona C57BL/6J möss superovulated, först genom PMSG injektion, sedan 48 h senare genom hCG injektion. COCs samlades 16 h senare och utsätts för IVF med spermatozoa samlas in från manliga C57BL/6J möss. Befruktade äggceller var cryopreserved och lagras i flytande kväve tills det behövs. Det andra steget inkluderade upptining av embryon och elektroporation. Cryopreserved embryon tinades och CRISPR reagenser (dvs. tracrRNA, crRNA och Cas9 protein) monterades och elektroporeras inom 1 h efter upptining embryon. Det tredje steget inkluderade embryoöverföring och födelse av möss. Dagen efter elektroporation, två-cell embryon överfördes till oviduct av pseudopregnant kvinnliga möss att generera genetiskt modifierade möss som senare genotyped med Sanger sekvensering för att bekräfta redigering effektivitet. Den tid och ansträngning som krävs för att förbereda befruktade äggceller före varje experiment (steg 1) kan förkortas om ett stort antal kryoreserverade embryon bereds i förväg. Denna siffra är anpassad från Darwish M et al.16Klicka här för att se en större version av denna siffra.

Muterade möss Elektroporerade embryon 2-cellsembryon Överförda embryon Valpar (%) Muterade möss(%) Ingen av mosaikmöss
Tyr KO 124 84 48 12 (25) 100 1
Glrb KO 151 94 40 6 (15) 100 0
Slc39a6 KO 48 25 25 5 (20) 100 0
Bag3 KI 233 84 20 3 (15) 50 1
Camk2a KI 124 70 70 14 (20) 64.3 0

Tabell 1: Produktion av flera rader genetiskt modifierade möss med frysta upptinade embryon med C57BL/6J-bakgrund.

Tilläggstabell 1. Klicka här för att ladda ner denna tabell.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Det beskrivna protokollet möjliggör generering av genetiskt modifierade möss med hög effektivitet och låga mosaikhastigheter (tabell 1). Det gör det möjligt för forskare utan avancerade embryo manipulation färdigheter för att skapa muterade möss lätt eftersom det drar nytta av de senaste och mest användbara framsteg inom både reproduktiv teknik och genomet redigeringsteknik: CRISPR/Cas9 ribonucleoprotein (RNP) och elektroporation i frysta-tinade embryon. Dessa framsteg underlättade och påskyndade utvecklingen av GM-mössen. Som beskrivs i figur 3, det tar ~ 4 veckor att generera GM möss. Jämfört med andra protokoll med liknande metoder26, vår metod är överlägsen när det gäller effektivitet, födelsetal och mosaicism.

Inkubationen av encelliga embryon i FBS före kryokonserveringen är avgörande för att förbättra embryonas utvecklingsfrekvens. Elektroporationsförhållandena för de kryoreserverade embryona, som beskrivs i protokollet, möjliggör en kompromiss mellan redigeringseffektiviteten hos CRISPR-reagenser och embryonas överlevnad. I själva verket kan hårdare eller mildare förhållanden påverka utvecklingen av embryon och redigering effektivitet,respektive 16. Tidpunkten för elektroporationen (figur 2B) är avgörande för att övervinna mosaicismen hos grundarna och se till att genomet modifiering sker i närvaro av endast två alleler. Detta är förenligt med tidigare rapporter som visar att tidig elektroporation kan producera icke-mosaik mutanter17. Dessutom minskar användningen av RNP istället för gRNA/mRNA mosaikhastighet och förbättrar redigeringseffektiviteten17.

Det beskrivna protokollet har flera fördelar. Först genererar det muterade möss inom en kort tid (~ 4 veckor). För det andra är det ett mycket effektivt och robust protokoll. flera rader av knockout (KO) och knock-in (KI) möss genererades med hög mutationsfrekvens (KO = 100%, KI = 50 till 64,3%). För det tredje är det bekvämt och kostnadseffektivt. Användningen av komplett syntetiskt crRNA, tracrRNA, ssODN och Cas9 protein eliminerar behovet av tråkiga beredning av Cas9 vektorer och in vitro transkription. Istället gör det möjligt för forskare att helt enkelt använda kommersiella reagenser och standardutrustning. För det fjärde använder den inte mikroinjektion, vilket kräver hög teknisk kompetens. För det femte minskar det mosaicism i grundare, och därmed leder till effektivare sett överföring av de redigerade allelerna, övervinna den komplicerade genotypiska analysen av mosaik möss. Slutligen är detta protokoll effektivt med C57BL/6J inavlade stam, som undviker användning av F1 hybrider, och därmed behovet av att utföra många backcrosses att bli av med genetisk komplexitet. Genotypning av F1 generationer bekräftade korrekt sett överföring. Det rekommenderas dock inte att studera fenotyper av F0 möss på grund av allel komplexitet och vilseledande förutsägelse av genotypning av efterföljande generation extrapoleras från genotypning av F0 grundare14,27.

Det är av största vikt att utnyttja användningen av fryst tinade embryon i genomredigering av icke-mänskliga primater och stora djur som grisar och får, som inte alltid är lätt tillgängliga. Metoderna för frysning av embryon skiljer sig mycket åt beroende på djurart. Därför tror vi att vårt kryokonserveringsprotokoll endast kan vara tillämpligt på möss. Å andra sidan är vårt protokoll potentiellt tillämpligt för att använda tekniska nukleaser än Cas9 för generering av GM möss, eftersom elektroporation har tidigare rapporterats att införa andra nukleaser såsom Cas12a i embryot effektivt28,29.

En begränsning av protokollet är den exakta integrationen av ett långt transgen i arvsmassan, vilket anses svårt i elektroporationsbaserade protokoll. En potentiell lösning rapporterades dock: integrationen av transgener upp 4,9 Kb i musgenomet utfördes framgångsrikt genom att kombinera elektroporation med en adeno-associerade virus (AAV)-medierad HDR givare leveranssystem30, bekräftar en tidigare publikation31. Dessutom är den potentiella förekomsten av biverkningar utanför målet ett stort problem med användningen av CRISPR/Cas9-teknik. Vi har inte utfört hela genomsekvensering av de redigerade mössen för att utesluta den potentiella off-target-effekten. Vi har dock använt CRISPR-verktyg som har rapporterats för att minska off-target-effekten, till exempel RNP32. Dessutom använde vi en hifi-Cas9-variant som avsevärt minskar off-target-redigering utan att offra prestanda på målet33. Dessutom har vi utformat gRNAs med CRISPRdirect programvara (https://crispr.dbcls.jp), vilket bör resultera i målsekvenser med minimerade off-target platser19. För att bekräfta genotyp-fenotyp kausalitet och lindra oron för off-target effekter, forskare bör generera flera redigerade möss av samma genotyp med hjälp av olika gRNAs eller utföra backcrossing av genererade möss i flera generationer.

Knockout möss som genereras med hjälp av NHEJ mekanism och frameshift mutationer har använts i stor utsträckning och visar relevanta fenotyper. Trunkerat restprotein kan dock förekomma på grund av antingen översättningsåteritiering eller hoppning av den redigeradeexonen 34,35. Därför, för att exakt tolka fenotyper, karakterisering av kvarvarande protein funktion eller uttryck är nödvändigt. Genereringen av kompletta gen knockout möss med mer än ett gRNA skulle vara ett bra alternativ. Särskild uppmärksamhet bör dock ägnas åt att bekräfta att genen inte innehåller introniska regioner som transkriberas till icke-kodande RNA, som kan ha reglerande funktioner och därmed komplicera den fenotypiska analysen.

I denna studie visar vi ett enkelt protokoll genom vilket många forskare kan generera genetiskt modifierade möss i 4 veckor eller mindre. Genom att kombinera användningen av frysta-tinade embryon och elektroporation, gör vi beredningen av musmodeller av mänskliga sjukdomar enkelt, snabbt och effektivt.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har inga relevanta finansiella upplysningar.

Acknowledgments

Vi vill tacka Hitomi Sawada och Elizabeth Garcia för djurvård. Detta arbete stöddes av KAKENHI (15K20134, 17K11222, 16H06276 och 16K01946) och Hokugin Research Grant (till H.N.), och Jichi Medical University Young Investigator Award (till H.U.). Otsuka Toshimi Scholarship Foundation stödde M.D.

Materials

Name Company Catalog Number Comments
0.25 M Sucrose ARK Resource Co., Ltd. (Kumamoto, Japan) SUCROSE
1 M DMSO ARK Resource Co., Ltd. (Kumamoto, Japan) 1M DMSO
Butorphanol Meiji Seika Pharma Co., Ltd. (Tokyo, Japan) Vetorphale 5mg
Cas9 protein: Alt-R® S.p. HiFi Cas9 Nuclease 3NLS Integrated DNA Technologies, Inc. (Coralville, IA) 1081060
C57BL/6J mice Japan SLC (Hamamatsu, Japan) N/A
DAP213 ARK Resource Co., Ltd. (Kumamoto, Japan) DAP213
FBS Sigma-Aldrich, Inc. (St. Louis, MO) ES-009-C
hCG MOCHIDA PHARMACEUTICAL CO., LTD (Tokyo, Japan) HCG Mochida 3000
HTF ARK Resource Co., Ltd. (Kumamoto, Japan) HTF
ICR mice Japan SLC (Hamamatsu, Japan) N/A
Isoflurane Petterson Vet Supply, Inc. (Greeley, CO) 07-893-1389
KSOM ARK Resource Co., Ltd. (Kumamoto, Japan) KSOM
LN2 Tank Chart Industries (Ball Ground, GA) XC 34/18
M2 ARK Resource Co., Ltd. (Kumamoto, Japan) M2
Medetomidine Nippon Zenyaku Kogyo Co.,Ltd. (Koriyama, Japan) 1124401A1060
Microscope Nikon Co. (Tokyo, Japan) SMZ745T
Midazolam Sandoz K.K. (Tokyo, Japan) 1124401A1060
Nuclease free buffer Integrated DNA Technologies, Inc. (Coralville, IA) 1072570
Nucleospin DNA extraction kit Takara Bio Inc (Kusatsu, Japan) 740952 .5
One-hole slide glass Matsunami Glass Ind., Ltd. (Kishiwada, Japan) S339929
One-step type Electroporator BEX Co., Ltd. (Tokyo, Japan) CUY21EDIT II
Paraffin Liquid NACALAI TESQUE Inc. (Kyoto, Japan) SP 26137-85
Platinum plate electrode BEX Co., Ltd. (Tokyo, Japan) LF501PT1-10, GE-101
PMSG ASKA Animal Health Co., Ltd (Tokyo, Japan) SEROTROPIN 1000
Povidone iodide Professional Disposables International, Inc. (Orangeburg, NY) C12400
Reduced-Serum Minimal Essential Medium: OptiMEM I Sigma-Aldrich, Inc. (St. Louis, MO) 22600134
Two-step type Electroporator Nepa Gene Co., Ltd. (Ichikawa, Japan) NEPA21

DOWNLOAD MATERIALS LIST

References

  1. Wang, H., et al. One-step generation of mice carrying mutations in multiple genes by CRISPR/cas-mediated genome engineering. Cell. 153, (4), 910-918 (2013).
  2. Jinek, M., et al. A programmable dual-RNA - guided DNA endonuclease in adaptive bacterial immunity. Science. 337, (6096), 816-822 (2012).
  3. Mali, P., et al. RNA-guided human genome engineering via Cas9. Science. 339, (6121), 823-826 (2013).
  4. Cong, L., et al. Multiplex genome engineering using CRISPR/VCas systems. Science. 339, (6121), 819-823 (2013).
  5. Doudna, J. A., Charpentier, E. The new frontier of genome engineering with CRISPR-Cas9. Science. 346, (6213), 1258096 (2014).
  6. Mashiko, D., et al. Generation of mutant mice by pronuclear injection of circular plasmid expressing Cas9 and single guided RNA. Scientific Reports. 3, 3355 (2013).
  7. Yen, S. T., et al. Somatic mosaicism and allele complexity induced by CRISPR/Cas9 RNA injections in mouse zygotes. Developmental Biology. 393, (1), 3-9 (2014).
  8. Kaneko, T., Mashimo, T. Simple genome editing of rodent intact embryos by electroporation. PLoS ONE. 10, (11), 1-7 (2015).
  9. Qin, W., et al. Efficient CRISPR/cas9-mediated genome editing in mice by zygote electroporation of nuclease. Genetics. 200, (2), 423-430 (2015).
  10. Kaneko, T., Sakuma, T., Yamamoto, T., Mashimo, T. Simple knockout by electroporation of engineered endonucleases into intact rat embryos. Scientific Reports. 4, 6382 (2014).
  11. Hashimoto, M., Takemoto, T. Electroporation enables the efficient mRNA delivery into the mouse zygotes and facilitates CRISPR/Cas9-based genome editing. Scientific Reports. 5, 11315 (2015).
  12. Chen, S., Lee, B., Lee, A. Y. F., Modzelewski, A. J., He, L. Highly efficient mouse genome editing by CRISPR ribonucleoprotein electroporation of zygotes. Journal of Biological Chemistry. 291, (28), 14457-14467 (2016).
  13. Modzelewski, A. J., et al. Efficient mouse genome engineering by CRISPR-EZ technology. Nature Protocols. 13, (6), 1253-1274 (2018).
  14. Teixeira, M., et al. Electroporation of mice zygotes with dual guide RNA/Cas9 complexes for simple and efficient cloning-free genome editing. Scientific Reports. 8, 474 (2018).
  15. Nakagawa, Y., et al. Production of knockout mice by DNA microinjection of various CRISPR/Cas9 vectors into freeze-thawed fertilized oocytes. BMC Biotechnology. 15, (1), 1-10 (2015).
  16. Darwish, M., et al. Rapid and high-efficient generation of mutant mice using freeze-thawed embryos of the C57BL/6J strain. Journal of Neuroscience Methods. 317, 149-156 (2019).
  17. Hashimoto, M., Yamashita, Y., Takemoto, T. Electroporation of Cas9 protein/sgRNA into early pronuclear zygotes generates non-mosaic mutants in the mouse. Developmental Biology. 418, (1), 1-9 (2016).
  18. Sakamoto, W., Kaneko, T., Nakagata, N. Use of frozen-thawed oocytes for efficient production of normal offspring from cryopreserved mouse spermatozoa showing low fertility. Comparative Medicine. 55, (2), 136-139 (2005).
  19. Naito, Y., Hino, K., Bono, H., Ui-Tei, K. CRISPRdirect: Software for designing CRISPR/Cas guide RNA with reduced off-target sites. Bioinformatics. 31, (7), 1120-1123 (2015).
  20. Torres-Perez, R., Garcia-Martin, J. A., Montoliu, L., Oliveros, J. C., Pazos, F. WeReview: CRISPR Tools-Live Repository of Computational Tools for Assisting CRISPR/Cas Experiments. Bioengineering. 6, (3), 63 (2019).
  21. Okamoto, S., Amaishi, Y., Maki, I., Enoki, T., Mineno, J. Highly efficient genome editing for single-base substitutions using optimized ssODNs with Cas9-RNPs. Scientific Reports. 9, 4811 (2019).
  22. Takeo, T., Nakagata, N. Superovulation using the combined administration of inhibin antiserum and equine chorionic gonadotropin increases the number of ovulated oocytes in C57BL/6 female mice. PLoS ONE. 10, (5), 1-11 (2015).
  23. Wuri, L., Agca, C., Agca, Y. Euthanasia via CO2 inhalation causes premature cortical granule exocytosis in mouse oocytes and influences in vitro fertilization and embryo development. Molecular Reproduction and Development. 86, (7), 825-834 (2019).
  24. Nakagata, N. High survival rate of unfertilized mouse oocytes after vitrification. Journal of Reproduction and Fertility. 87, (2), 479-483 (1989).
  25. Dehairs, J., Talebi, A., Cherifi, Y., Swinnen, J. V. CRISP-ID: Decoding CRISPR mediated indels by Sanger sequencing. Scientific Reports. 6, 28973 (2016).
  26. Nakagawa, Y., Sakuma, T., Takeo, T., Nakagata, N., Yamamoto, T. Electroporation-mediated genome editing in vitrified/warmed mouse zygotes created by ivf via ultra-superovulation. Experimental Animals. 67, (4), 535-543 (2018).
  27. Nakajima, K., Nakajima, T., Takase, M., Yaoita, Y. Generation of albino Xenopus tropicalis using zinc-finger nucleases. Development Growth and Differentiation. 54, (9), 777-784 (2012).
  28. Hur, J. K., et al. Targeted mutagenesis in mice by electroporation of Cpf1 ribonucleoproteins. Nature Biotechnology. 34, 807-808 (2016).
  29. Dumeau, C. E., et al. Introducing gene deletions by mouse zygote electroporation of Cas12a/Cpf1. Transgenic Research. 28, (5-6), 525-535 (2019).
  30. Chen, S., et al. CRISPR-READI: Efficient Generation of Knockin Mice by CRISPR RNP Electroporation and AAV Donor Infection. Cell Reports. 27, (13), 3780-3789 (2019).
  31. Mizuno, N., et al. Intra-embryo Gene Cassette Knockin by CRISPR/Cas9-Mediated Genome Editing with Adeno-Associated Viral Vector. iScience. 9, 286-297 (2018).
  32. Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. Highly Efficient RNA-guide genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Research. 24, (6), 1012-1019 (2014).
  33. Vakulskas, C. A., et al. A high-fidelity Cas9 mutant delivered as a ribonucleoprotein complex enables efficient gene editing in human hematopoietic stem and progenitor cells. Nature Medicine. 24, (8), 1216-1224 (2018).
  34. Rodriguez-Rodriguez, J. A., et al. Distinct Roles of RZZ and Bub1-KNL1 in Mitotic Checkpoint Signaling and Kinetochore Expansion. Current Biology. 28, (21), 3422-3429 (2018).
  35. Smits, A. H., et al. Biological Plasticity Rescues Target Activity in CRISPR Knockouts. Nature Methods. 16, 1087-1093 (2019).
Användning av frysta upptinade embryon för högeffektiv produktion av genetiskt modifierade möss
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Nishizono, H., Darwish, M., Uosaki, H., Masuyama, N., Seki, M., Abe, H., Yachie, N., Yasuda, R. Use of Freeze-thawed Embryos for High-efficiency Production of Genetically Modified Mice. J. Vis. Exp. (158), e60808, doi:10.3791/60808 (2020).More

Nishizono, H., Darwish, M., Uosaki, H., Masuyama, N., Seki, M., Abe, H., Yachie, N., Yasuda, R. Use of Freeze-thawed Embryos for High-efficiency Production of Genetically Modified Mice. J. Vis. Exp. (158), e60808, doi:10.3791/60808 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter