Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Genetiği Değiştirilmiş Farelerin Yüksek Verimli Üretimi için Dondurulmuş Çözülmüş Embriyoların Kullanımı

doi: 10.3791/60808 Published: April 2, 2020
* These authors contributed equally

Summary

Burada, tek hücreli embriyoların kriyopreservation için değiştirilmiş bir yöntem yanı sıra genetik olarak değiştirilmiş farelerin verimli nesil için dondurulmuş çözülmüş embriyolar ve elektroporasyon kullanarak çiftler bir protokol sıyoruz.

Abstract

Genetiği değiştirilmiş (GM) farelerin kullanımı gen fonksiyonunu anlamak ve insan hastalıklarının altında yatan mekanizmaları çözmek için çok önemli hale gelmiştir. CRISPR/Cas9 sistemi, araştırmacıların genomu eşi görülmemiş verimlilik, sadakat ve basitlikle değiştirmelerine olanak tanır. Bu teknolojiden yararlanarak, araştırmacılar GM fareler üretmek için hızlı, verimli ve kolay bir protokol arıyorlar. Burada, dondurulan çözülmüş embriyoların daha yüksek gelişimsel oranına yol açan tek hücreli embriyoların kriyopreservation için geliştirilmiş bir yöntem sıyoruz. Optimize elektroporasyon koşulları ile birleştirerek, bu protokol kısa bir süre içinde yüksek verimlilik ve düşük mozaik oranları ile nakavt ve knock-in farelerin üretimi için izin verir. Ayrıca, CRISPR reaktif hazırlama, in vitro fertilizasyon, kriyopreservation ve tek hücreli embriyoların çözülmesi, CRISPR reaktiflerinin elektroporasyonu, fare üretimi ve kurucuların genotiplemesini kapsayan optimize edilmiş protokolümüzün adım adım açıklamasını gösteriyoruz. Bu protokolü kullanarak, araştırmacılar benzersiz bir kolaylık, hız ve verimlilik ile GM fareler hazırlamak gerekir.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Kümelenmiş düzenli olarak uzaydan kısa palindromik tekrarlar (CRISPR)/CRISPR ilişkili protein 9 (Cas9) sistemi genom1'debenzeri görülmemiş hedefli modifikasyon sağlayan bilimsel bir atılımdır. CRISPR/Cas9 sistemi Cas9 proteinve kılavuz RNA (gRNA) iki moleküler bileşenden oluşur: hedefe özel CRISPR RNA (crRNA) ve trans-aktive CRISPR RNA (tracrRNA)2. Bir gRNA, Cas9 proteinini genomdaki spesifik lokusa, crRNA'ya bitişik 20 nükleotite ve protospacer bitişik motifine (PAM) yönlendirir. Cas9 proteini hedef sıraya bağlanır ve hatayatkın olmayan homolog uç birleştirme (NHEJ) veya yüksek sadakat homoloji yönelimli onarım (HDR)3,4,5tarafından onarılır çift iplikçikli sonları (DSBs) indükler. NHEJ eklemelere veya/ve silmelere (indels) ve dolayısıyla bir kodlama dizisi hedeflendiğinde gen kaybına yol açar. HDR homoloji dizileri içeren bir onarım şablonu varlığında hassas genom düzenleme yol açar3,4,5. NHEJ ve HDR sırasıyla nakavt ve nakavt fareler üretmek için harnessed edilmiştir.

CRISPR/Cas9 sistemi olağanüstü etkinlik ve sadakatle GM farelerinin neslini belirgin bir şekilde hızlandırmış olsa da, bu yöntemleri uygulayan bilim adamları genellikle teknik zorluklarla karşılaşır. İlk olarak, konvansiyonel protokoller döllenmişyumurta6,7pronükleus içine CRISPR düzenleme araçları tanıtmak için mikroenjeksiyon gerektirir. Bu teknik zaman alıcıdır ve genellikle kapsamlı bir eğitim gerektirir. Böylece, çeşitli gruplar elektroporasyon8ilemikroenjeksiyon yerine 8 ,9,10,11,12,13. Ancak, erken elektroporasyon protokollerinde elektroporasyon için taze embriyolar kullanılmıştır. Her deney den önce taze embriyo hazırlama zor olduğu için bu, başka bir soruna nedenoldu 14.

Son zamanlarda biz ve diğerleri gmfarelerinüretimini kolaylaştıran genom düzenleme için dondurulmuş çözülmüş embriyolar ve elektroporasyon kullanımı kombine ettik15 ,16. Bu protokol, gelişmiş embriyo manipülasyon becerileri olmadan araştırmacıların hızla yüksek verimlilik ile insan hastalıklarının hayvan modelleri oluşturmak için olanak sağlar. Protokol aynı zamanda önemli ölçüde kurucuları16genetik heterojenlik gibi GM fareler, üreten pratik zorlukları azaltır. Mozaiğiaşmak için, embriyo erimesinden sonra 1 saat içinde CRISPR reaktiflerinin elektroporasyonunu gerçekleştiriyoruz ve düzenlemenin genomun ilk replikasyonundan önce gerçekleşmesini sağlıyoruz. Başka bir gelişme istenmeyen mozaikazaltmak için Cas9 mRNA yerine Cas9 protein kullanımı içerir17. Ayrıca, tek hücreli embriyo kriyopreservation için optimal bir yöntem geliştirdik bu iki hücreli evre için gelişim hızını artırır16: fetal sığır serumu kullanımı (FBS) önemli ölçüde döllenme sonrası donma çözülmüş oositlerin hayatta kalma artırır, belki de donma çözülmüş unfertilized oositler daha esnek kılan aynı mekanizma ile18.

Burada tek hücreli C57BL/6J embriyoların kriyopreservation için modifiye yöntemi de dahil olmak üzere, dondurulmuş çözülmüş embriyolar kullanarak GM farelerin üretimi için kapsamlı bir protokol sıyoruz. Bu içerir 1) gRNA tasarım, CRISPR reaktif hazırlama ve montaj; 2) TEK hücreli embriyoların ivf, kriyoprezervasyon ve erime; 3) CRISPR reaktiflerinin dondurulmuş embriyolara elektroporasyonu; 4) Embriyo transferi sözde hamile dişi farelerin oviduct içine; ve 5) F0'nin kurucu hayvanlarının genotipleme ve dizi analizi.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Bu çalışmada yapılan tüm hayvan bakımı ve işlemleri Laboratuvar Hayvanlarının Bakımı ve Kullanımı Rehberi'nin kural ve yönetmeliklerine göre gerçekleştirilmiştir. Deneysel protokol Toyama Üniversitesi, Tokyo Üniversitesi, Jichi Üniversitesi ve Max Planck Florida Nörobilim Enstitüsü Laboratuvar Hayvanları Hayvan Bakım Komitesi tarafından onaylandı. Tüm reaktifler hakkında bilgiler Malzeme Tablosu'ndagösterilmiştir.

1. CRISPR reaktif tasarımı

  1. crRNA tasarımı
    1. Azaltılmış hedef dışı sitelere sahip belirli crRNA'lar tasarlamak için CRISPR direct19 (https://crispr.dbcls.jp/) adresini ziyaret edin.
      NOT: CrRNA20 (https://bioinfogp.cnb.csic.es/tools/wereview/crisprtools/) tasarlamak için diğer birçok yararlı araç vardır.
    2. Hedef nükleotid dizisini ekleyin ve aşağıdaki değişiklikleri yapın:
      PAM sıra gereksinimi = NGG
      Özgüllük kontrolü = Fare (Muş musculus) genomu, GRCm38/mm10 (Aralık, 2011)
      NOT: Örnek olarak, Tyrosinase (Tyr) nakavt fareler oluşturmak için, exon 2 (9476-9692 nükleotit dizisi) hedeflenmiştir.
    3. Tasarım'ıtıklatın ve son derece özel isabetler için Yalnızca Yüksek Özel Hedef Göster'i işaretleyin.
    4. Hedef dışı etkileri azaltmak için , "12 mer+PAM" ve "8 mer+PAM" sütunlarında en düşük değere sahip hedef sırasını seçin.
      NOT: Bu sütunlarda, ("1") dizinin hedeflenen hedef siteyle tek bir mükemmel eşleşmesi olduğunu ve birden büyük sayıların potansiyel hedef dışı sitelerin varlığını gösterdiğini gösterir.
    5. CrRNA sentez şirketlerinden elde edilen oligonükleotidleri sipariş edin (Supplimentary Tablo 1).
      NOT: Ekson 2 Tyr geni için aşağıdaki hedef dizi kullanılmıştır: GGACCACTATTACGTAATCC, PAM dizisi olarak +TGG ile(Şekil 2A).
  2. HDR aracılı düzenleme deneyleri için tek iplikçikli oligodeoksinükleotid (ssODN) tasarımı (yani, knock-in fare üretimi).
    1. SSODN uzunluğunu, her iki tarafta 30-60 nükleotit (nt) homoloji kolları da dahil olmak üzere 80-180 bp civarında tasarla.
      NOT: 30-35 nt homoloji kolu ve gRNA tamamlayıcısı dahil olmak üzere 75-85 nt uzunluğunda bir ssODN, yüksek knock-in düzenleme verimliliğigösterdi 21.
    2. Pam dizisine veya mümkün değilse, pam'in 5' komşu tabanında genom düzenlemesinden sonra yeniden kesmeyi engellemek için istenilen modifikasyonve sessiz mutasyonu yerleştirin.
      NOT: Bu çalışmada kullanılan crRNA ve ssODN Ek Tablo 1'delistelenmiştir.

2. In vitro fertilizasyon, embriyo kriyopreservation ve donma-eritme

  1. İn vitro fertilizasyon
    1. Superovulate C57BL/6J dişi fareler (4 veya 8 haftalık) ip enjeksiyonu ile gebe mare serum gonadotropin (PMSG) enjeksiyonu ile takip 7.5 IU insan koryonik gonadotropin (hCG) sonra 48 saat.
      NOT: Yumurtalıkoosit sayısı ultra-superovulation22kullanılarak yaklaşık 3x artırılabilir.
    2. Cinsel olgun C57BL/6J erkek fareler (3-5 aylık) kauda epididimids kaldırın.
      NOT: Erkek farelerden ödün vermeden spermatozoa toplamak mümkündür.
    3. Bir diseksiyon iğnesi ile spermatozoa pıhtıları ayıklayın ve kapacitation için 1,5 saat boyunca CO2 kuluçka insan tubal sıvı (HTF) bir 200 μL damla onları kuluçka.
    4. HCG enjeksiyonundan sonra oviducts 16-18 h kümülüs kompleksleri (COCs) toplamak ve bir CO2 kuvöz parafin sıvı ile kaplı HTF orta taze bir 200 μL damla onları kuluçka 2 saat (5% CO2, 37 °C).
      NOT: CO2 inhalasyonu yoluyla ötanazi IVF ve embriyo gelişimini etkilediği için anestezi altında servikal çıkış ile farelerin kurban edilmesi tercih edilir23.
    5. Kuluçka ortamının sınırından COC içeren 200 μL'lik HTF ortamına 1-5 μL sperm süspansiyonu ekleyin ve 3 saat boyunca CO2 kuluçka makinesinde kuluçkaya yatırın.
    6. Kalan sperm ve kümülüs hücrelerini temizlemek için yumurtaları potasyum takviyesi simpleks optimizasyon ortamı (KSOM) ile yıkayın.
    7. Ters mikroskop kullanarak pronükleer oluşumunu ve tek hücreli embriyoların derecesini kontrol edin.
  2. Tek hücreli embriyoların kriyopreservation
    1. Tek hücreli embriyoları % 20 FBS içeren 200 μL'lik htf damlasında (parafin sıvısı ile kapsanmıyor) 10 dakika boyunca CO2 kuluçka makinesinde kuluçkaya yatırın.
    2. 20-100 embriyonun 50 μL'lik 1 Meditil sülfoksit (DMSO) çözeltisine aktarılması24.
    3. 100 embriyo içeren bir çözeltinin 5 μL'ini bir kriyotube'un dibine aktarın ve 0 °C'de 5 dakika boyunca soğutucu veya buz üzerinde serinlayın.
    4. 45 μL DAP213 (2 M dimethyl sulfoxide, 1 M asetamid ve 3 M propilen glikol) çözeltisini tüp duvarı boyunca yavaşça ekleyin, tüpleri kaplayın ve 5 dakika boyunca bir soğutucuda veya 0 °C'de buz üzerinde tutun.
      NOT: Numune erimesi sırasında kapakları kolayca çıkaramayacak kadar sıkı bir şekilde sabitlemeyin.
    5. Tüpleri sıvı nitrojende hızla saklayın.
  3. Embriyo erime
    1. Kriyotube'un kapağını açın, kalan sıvı nitrojeni atın ve önceden 37 °C'ye önceden ısıtılmış 0,25 M sakaroz çözeltisi 900 μL ekleyin.
      NOT: Soğuk çözeltinin kullanımı eritildikten sonra embriyo canlılığını azalttığı için 0,25 M sakaroz çözeltisi 37 °C'ye önceden ısıtılmalıdır.
    2. Pipet hızlı bir şekilde 10x ve plastik bir çanak içine kriyotube içeriğini aktarın.
      NOT: Pipetleme dikkatle yapılmalıdır, böylece kabarcıklar oluşturulmamalı ve embriyolara zarar verilmelidir.
    3. Morfolojik olarak normal döllenmiş yumurtaları parafin sıvısı ile kaplı KSOM ortamda 2x yıkayın ve elektroporasyona kadar CO2 kuluçka makinesinde tutun.

3. CRISPR reaktiflerinin montajı ve elektroporasyonu

NOT: Elektroporasyon için platin plaka elektrodu (yükseklik: 0,5 mm, uzunluk: 10 mm, genişlik: 3 mm, boşluk: 1 mm) ve daha önce8 (Malzeme Tablosu)tanımlanmış tek adımlı tip elektroporatör kullandık. İki aşamalı tip elektroporatör de kullanılabilir (Malzeme Tablosu).

  1. CRISPR reaktiflerinin hazırlanması ve montajı
    1. HDR aracılı düzenleme deneyleri yapıyorsanız CRISPR reaktiflerini (crRNA, tracrRNA ve Cas9 proteini) ve ssODN'yi sipariş edin(Malzeme Tablosu ve Ek Tablo 1).
    2. Annealing çözümlerini aşağıdaki gibi hazırlayın.
      1. Azaltılmış Serum Minimal Esansiyel Orta çözeltisinde(Malzeme Tablosu)1 μg/μL crRNA ve 1 μg/μL tracrRNA hazırlayın ve her çözeltiden çekirdeksiz tamponun 42°L'ine 6 μL ekleyin.
      2. Karışımı 95 °C'de kuru ısıtıcıda 3 dk ve RT'de 5 dk soğutun.
      3. Opti-MEM I'de seyreltilmiş 1 μg/μL HiFi Cas9 proteini hazırlayın ve toplam 60 μL hacim için önceki karışıma 6 μL ekleyin.
      4. HDR aracılı düzenleme denemeleri yaparken 6 μL 1 μg/μL ssODN ekleyin. Son hacim 60 μL olması gerektiğinden, adım 3.1.2.1'de 36 μL nükleaz içermeyen su kullanın.
        NOT: CrRNA, tracrRNA, Cas9 protein ve ssODN'nin son konsantrasyonu 100 ng/μL olacaktır.
      5. 100 embriyoyu tek delikli bir slayt camında son karışımın 25°L'sine (RNP kompleksi) aktarın ve 10 dakika boyunca 37 °C'de kuluçkaya yatırın.
  2. Elektroporasyon
    1. Elektrot boşluğunu CRISPR reaktiflerinin yeni karışımının 6 μL'si ile doldurun ve karışıma 20-25 embriyo ekleyin.
      NOT: Bu embriyolar ve elektroporasyon elektrot arasında herhangi bir temas önlemek için önemlidir, hangi elektrik darbeleri sırasında embriyolara zarar verebilir.
    2. Tek adımlı tip elektroporatör için elektroporasyonu aşağıdaki koşullarda gerçekleştirin:
      Gerilim: 25 V, Darbe yönü (Pd) +
      ACI: 3 ms, KAPALI: 97 ms
      Tekrareder: 5x
      NOT: Elektroporasyon, mozaikliği önlemek için genom düzenlemesinin ilk DNA çoğaltılmasından önce gerçekleşmesini sağlamak için çözülmeden sonra en fazla 1 saat yapılmalıdır.
    3. İki aşamalı tip bir elektroporatör için koşulları aşağıdaki gibi ayarlayın:
      Poring Pulse = 40V, Pd +
      ON = 1 veya 2,5 ms; Darbe aralığı = 50 ms
      Tekrarlar: 4x, Çürüme 10%

      Transfer Darbesi = 5 veya 7V; Pd +/-.
      ACI: 50 ms; Nabız aralığı = 50 ms.
      Tekrarlar = 5x; Çürüme = %40.
      NOT: Empedansı üretici tarafından belirtilen belirli aralıkta korumak için ses düzeyini ayarlamak önemlidir.
    4. Modifiye Krebs-Ringer Bikarbonat Tampon 2 (M2) orta parafin sıvı ile kaplı KSOM orta bir damla ile iki yıkar sonra embriyolar 3x yıkayın.
    5. Yıkanmış embriyoları (KSOM ortamda) daha fazla transplantasyon için bir gecede CO2 kuvözde kuluçkaya yatırın.

4. Embriyo transferi

  1. Sözde hamile dişi fareler hazırlayın. Mate ICR dişi fareler (3-6 ay) vazektomi erkek fareler ile 1 gün önce embriyo transferi (ET).
    NOT: Fareler bir copulatory fiş için ertesi sabah kontrol edilmelidir. Fişi olan fareler sözde gebe olarak kabul edilir ve ET için kullanılabilir.
  2. Başarılı implantasyon için bir belirteç olarak cam kılcal içine 2-3 mm alternatif aralıklarla aspire hava ve KSOM (parafin sıvıolmadan).
  3. 20-24 embriyoyu 200 μL'lik bir KSOM damlasına (parafin sıvısı olmadan) getirin ve her oviduct'a implantasyon için 10-12 embriyoyu cam kılcal damara çekin.
  4. Dişi fareleri izofluran (inhalasyon) veya medetomidin/midazolam/butorphanol (sırasıyla 0.3 mg/kg, 4.0 mg/kg ve 5.0 mg/kg) birleştiren bir çözeltinin IP enjeksiyonu ile anestezi edin. Anestezili fareyi havalandırma tarafındaki bir ısıtma yastığına yerleştirin. Bir nemlendirici jel ile anestezili farenin gözlerini koruyun.
  5. Dorsal orta hattın alt kısmı boyunca tıraş ve povison iyot ile bölgeyi dezenfekte% 70 etanol ile takip.
  6. Dorsal orta hatta paralel uzun ~ 1 cm kesi yapın.
  7. Oviduct ve steril plastik bir perde üzerine yerleştirin. Sıcak steril salin kullanarak nemli tutun.
  8. Ovidük'u stereoskopik mikroskobun altına yerleştirin.
  9. Mikrobahar makas ile ampulla birkaç milimetre yukarı infundibulum ve ampulla arasında oviduct duvarına bir delik olun.
  10. Embriyoları içeren cam kılcal damarın ucunu deliğe yerleştirin ve ampulla bir hava kabarcığı görünene kadar embriyoları dışarı atmak için kılcal damar tutucunun ağızlık içine hafifçe üfler.
    NOT: Oviduct başına 10-12 embriyo transferi.
  11. Oviduct duvardan cam kılcal geri çekin ve yavaşça vücut boşluğuna geri üreme organı itin.
  12. Diğer oviduct içine embriyolar tanıtmak için önceki işlemi tekrarlayın.
  13. ET prosedürünü tamamladıktan sonra, peritonu basit bir kesit deseni (50, emilebilir, örgülü sentetik dikişler) ve sonra deriye basit bir kesme desen veya gömülü subcuticular kesmedikiş deseni ile dikme (60 absorbe edilemeyen, monosentetik dikişler).
  14. Fareyi anesteziden iyileşene kadar 37 °C'lik bir ısınma tabağı üzerinde sıcak tutun.
  15. Ameliyattan sonra 7 gün boyunca her gün hayvanın sağlığını takip edin.

5. Genotipleme ve dizi analizi

  1. Genomik DNA ekstraksiyonu
    NOT: Üreticinin önerileri doğrultusunda fare kulak dokusundan genomik DNA elde etmek için NucleoSpin doku DNA çıkarma kitleri kullandık.
    1. Numuneye 180 μL Tampon T1 ve 25°L Proteinaz K çözeltisi ekleyin ve 10 s girdap ile karıştırın.
    2. 56 °C'de 2 saat veya tam bir lisis elde edilene kadar kuluçkaya yatırın. Girdap kuluçka nın her 30 dakikasında 10 s.
    3. Tampon B3 200 μL ekleyin, 30 s için şiddetle girdap ve 10 dakika için 70 °C'de kuluçka.
    4. Numuneye ve girdaba güçlü bir şekilde 210 μL %100 etanol ekleyin.
    5. Her örnek için bir doku sütunu bir toplama tüpüne yerleştirin ve örneği kolona uygulayın.
    6. 1 11.000 x gde 1 dakika için santrifüj, akış atmak ve toplama tüpü içine sütun geri yerleştirin.
    7. Numuneyi yıkamak için 500 μL Tampon BW ekleyin (1. yıkama), 1 dk 11.000 x giçin santrifüj, akışı atın ve kolongeri toplama tüpüne yerleştirin.
    8. Sütuna 600 μL Arabellek B5 ekleyin (2. yıkama), 1 dakika için santrifüj 11.000 x g,akış atmak ve toplama tüpü içine sütun geri yerleştirin.
    9. Silika zarını kurutmak ve NucleoSpin doku kolonlarını 1,5 mL mikrosantrifüj tüpüne yerleştirmek için 1 dk 11.000 x g'de kolonsantrik olun.
    10. Tampon BE 100 μL ekleyin, 1 dakika oda sıcaklığında kuluçka, sonra 1 11.000 x gsantrifüj 1 dk .
  2. PCR amplifikasyon ve arıtma
    1. Hedeflenen çekirgeyi çevreleyen 400-500 bp'lik bir diziyi yükseltmek için primer3 plus web sitesini (https://primer3plus.com/) kullanarak astarları tasarla.
    2. Yeni bir PCR protokolü tasarla ve ampirik olarak test edin.
    3. İstenmeyen enzimleri, nükleotitleri, astarları ve tampon bileşenlerini çıkarmak için PCR ürünlerini arındırın. Standart bir arıtma yöntemi aşağıdaki gibi kullanılabilir.
      1. PCR ürünlerinin 50 000'ine 50°L fenol ekleyin ve girdap ile karıştırın.
      2. 1 11.000 x g'de 1 dk santrifüj ve üst saydam katmanı yeni bir tüpe aktarın.
      3. 30 s için % 99,5 etanol ve 5 M amonyum asetat ve girdap 20 μL 120 μL ekleyin.
      4. 10 dk için RT'de tutun ve 10 dk için 11.000 x g'da santrifüj.
      5. Supernatant atın ve% 70 etanol 1 mL ile DNA pelet yıkayın.
      6. Peleti RT'de 10 dakika kurulayın ve 10 μL RNase serbest suda çözün.
        NOT: PCR kolon bazlı arınma kitleri fenol insanlar için toksik olduğu için yeniden yorumlanır.
  3. Sanger sıralama
    1. Saflaştırılmış PCR amplicon'u ölçmek için DNA niceleme analizini (bkz. Malzemeler Tablosu)çalıştırın.
    2. PCR ürün(ler) ve sıralama astarı(lar)ı sıralama hizmeti sağlayıcısına gönderin.
    3. Kullanılabilir çevrimiçi web sitelerini kullanarak diziyi analiz edin.
      NOT: Bu çalışmada, CRISP-ID25 (http:/crispid.gbiomed.kuleuven.be/) dizi analizi için kullanılmıştır.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

10 dk için %20 FBS içeren HTF'de kuluçka dahil olmak üzere tek hücreli embriyoların kriyopreservation için modifiye yöntemimiz ve ardından 1 M DMSO ve DAP213 çözeltisinde kriyopreservation, dondurulan çözülmüş embriyoların gelişim hızını iki hücreli evreye iyileştirmiştir(Şekil 1, p = 0.009, Öğrencinin t-testi). Dondurulan çözülmüş embriyolar GM farelerin üretimi için kullanıldı ve elektroporasyon koşulları optimize edildi: Protokol bölümünde açıklandığı gibi elektroporatör kullanılarak 3 ms darbeli 25 V'lik beş tekrar ve 97 ms aralıklı. Protokolün uygulanabilirliği albino Tyrosinaz geni (Tyr) nakavt farelerin nesli tarafından kontrol edildi(Şekil 2). Bunun için gRNA hedefleme ekson 2(Şekil 2A)tasarlanmış ve CRISPR reaktifleri Protokol bölümünde açıklandığı şekilde hazırlanmıştır. Düzenleme araçları, genom düzenlemesinin genomun ilk replikasyonundan önce meydana geldiğini ve böylece kurucularda mozaizmi önlediğinden emin olmak için embriyo erimesinin 1 saat içinde elektroporated edildi(Şekil 2B). Üretilen tüm fareler albino idi ve sadece bir fare mozaik, beyaz ve siyah yamalar ile bir ceket(Şekil 2C)idi. İki farklı mutant alel (heterozigot mutasyon) barındıran tüm albino fareler, sadece bir alel (homozigot mutasyon) barındıran bir fare hariç Şekil 2E'degösterilmiştir. Yöntemimizin, kat renginin yanı sıra sıralama analizi ile de doğrulandığı gibi düşük mozaik oranı yla %100'e yakın bir düzenleme verimi sağlayabileceği sonucuna varılabilir(Şekil 2CE).

Daha sonra, protokolün tekrarlanabilirliği nakavt ve nakavt farelerin çeşitli satır nesil tarafından kontrol edildi. Tablo 1'degösterildiği gibi, protokol yüksek verimlilik ve düşük mozaik oranları ile nakavt ve knock-in fareler üretebilir. Üretilen F0 farelerinin çoğu, mutant alellerin F1 nesillerine germline iletimini doğrulamak için yabani tip C57BL/6J farelerle çiftleşti. Beklendiği gibi, homozigot F0 farelerin tüm F1 yavruları heterozigot, bir mutant alel ve bir yabani tip alel içeren. Kurucuların ve nesillerinin genotiplemeleri arasında farklı mutasyonlar gözlenmedi. Açıklanan protokol, Şekil 3'tekiprotokolün iş akışında gösterildiği gibi kısa bir süre içinde (yani ~4 hafta) GM fareler ilerler.

Figure 1
Şekil 1: Fetal sığır serumu (FBS) dondurulan embriyoların iki hücreli evre gelişim hızını artırdı. FBS+ embriyo sayısı 286 (deney 3x tekrarlandı) ve FBS-embriyo sayısı 272 idi (deney 3x tekrarlandı). Veriler ortalama ± SEM olarak sunulur. Bu rakam Darwish M ve ark.16'dan izinle çoğaltılır. Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.

Figure 2
Şekil 2: Yüksek verimlilik ve düşük mozaik oranı ile Tyr nakavt farelerin üretimi. Bu rakam Darwish M ve ark.16'dan izinle değiştirilmiştir. (A) GRNA'nın tasarımını gösteren şematik illüstrasyon. PAM dizisi kırmızı renkle gösterilir. (B) Dondurulmuş çözülmüş embriyolar için elektroporasyon zamanlamasını gösteren çizim, sarı sembol elektroporasyon süresini temsil eder. (C) Oluşturulan Tyr nakavt farelerin temsili görüntüleri. (D) Tyr nakavt farelerin farklı alellerinin dizi analizi. Hedef sıra kırmızı olarak etiketlenmiştir ve tireler mutant alellerinde nükleotitlerin silinmesini gösterir. WT = yabani tip M = mutant alel. (E) Albino farenin M1 alelesini içeren kromatogramının temsili bir bölümü D.'de gösterilmiştir.

Figure 3
Şekil 3: GM farelerinin üretimi için protokolün iş akışı. İlk adım kriyokorunmuş embriyoların hazırlanmasıydı. Dişi C57BL/6J fareler önce PMSG enjeksiyonu, daha sonra 48 saat hCG enjeksiyonu ile süperovulated edildi. COC'lar 16 saat sonra toplandı ve erkek C57BL/6J farelerden toplanan spermatozoa ile IVF'ye tabi tutuldu. Döllenmiş oositler kriyomlanmış ve ihtiyaç duyulana kadar sıvı nitrojende depolanır. İkinci adım da embriyoların çözülmesi ve elektroporasyon un yer aldığı bir adımdı. Kriyopayrılmış embriyolar çözüldü ve CRISPR reaktifleri (tracrRNA, crRNA ve Cas9 proteini) embriyoları çözdükten sonra 1 saat içinde bir araya getirildi ve elektroporated edildi. Üçüncü adım embriyo transferi ve farelerin doğum dahil. Elektroporasyondan bir gün sonra, iki hücreli embriyolar, daha sonra düzenleme verimliliğini doğrulamak için Sanger sekanslama kullanılarak genotiplenmiş genetik olarak değiştirilmiş fareler üretmek için sözde hamile dişi farelerin oviduct'ine nakledildi. Her deneyden önce döllenmiş yumurtaların hazırlanması için gereken süre ve çaba (adım 1) çok sayıda kriyokorunmuş embriyo önceden hazırlanırsa kısaltılabilir. Bu rakam Darwish M ve ark.16uyarlanmıştırBu rakamın daha büyük bir sürümünü görmek için lütfen buraya tıklayın.

Mutant fareler Elektroporated embriyolar 2 hücreli embriyolar Transfer edilen embriyolar Yavrular (%) Mutant fareler(%) Mozaik farelerin hayır
Tir KO 124 84 48 12 (25) 100 1
Glrb KO 151 94 40 6 (15) 100 0
Slc39a6 KO 48 25 25 5 (20) 100 0
Çanta3 KI 233 84 20 3 (15) 50 1
Camk2a KI 124 70 70 14 (20) 64.3 0

Tablo 1: C57BL/6J arka plan dondurulmuş çözülmüş embriyolar kullanarak GM farelerin çeşitli satır üretimi.

Ek Tablo 1. Bu tabloyu indirmek için lütfen buraya tıklayınız.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Açıklanan protokol, yüksek verimlilik ve düşük mozaik oranlarıile GM farelerin üretimine olanak sağlar(Tablo 1). Gelişmiş embriyo manipülasyon becerileri olmadan araştırmacıların mutant fareleri kolayca yaratmalarını sağlar, çünkü hem üreme mühendisliği hem de genom düzenleme teknolojilerinde en son ve en yararlı gelişmelerden yararlanır: CRISPR/Cas9 ribonükleoprotein (RNP) ve dondurulmuş çözülmüş embriyolara elektroporasyon. Bu gelişmeler GM farelerin neslini kolaylaştırmadı ve hızlandırdı. Şekil 3'teaçıklandığı gibi, GM farelerin üretimi ~4 hafta sürer. Benzer yaklaşımlar26kullanarak diğer protokoller ile karşılaştırıldığında, bizim yöntem verimlilik, doğum oranı ve mozaik açısından üstündür.

Kriyopreservation önce FBS tek hücreli embriyoların kuluçka embriyoların gelişim hızını artırmak için önemlidir. Protokol'de tanımlanan kriyopozasyon embriyolarının elektroporasyon koşulları CRISPR reaktiflerinin düzenleme verimliliği ile embriyoların hayatta kalması arasında bir uzlaşma sağlar. Nitekim, sert veya daha hafif koşullar embriyoların gelişim hızı ve düzenleme verimliliği, sırasıylaetkileyebilir 16. Elektroporasyonun zamanlaması(Şekil 2B),kurucularda mozaizmin üstesinden gelmek ve genom modifikasyonunun sadece iki alel in varlığında gerçekleşmesini sağlamak için çok önemlidir. Bu erken aşama elektroporasyon mozaik olmayan mutantlar üretebilir gösteren önceki raporlar iletutarlıdır 17. Buna ek olarak, gRNA/mRNA yerine RNP kullanımı mozaik oranını düşürür ve düzenleme verimliliğini artırır17.

Açıklanan protokol çeşitli avantajlara sahiptir. İlk olarak, kısa bir süre içinde mutant fareler üretir (~ 4 hafta). İkincisi, son derece verimli ve sağlam bir protokoldür; knockout (KO) ve knock-in (KI) farelerin çeşitli satırları yüksek mutasyon oranları (KO = % 100, KI = 50-64,3%) ile üretildi. Üçüncü olarak, uygun ve uygun maliyetlidir. Komple sentetik crRNA, tracrRNA, ssODN ve Cas9 proteininin kullanımı Cas9 vektörlerinin sıkıcı hazırlanması ve in vitro transkripsiyon ihtiyacını ortadan kaldırır. Bunun yerine, araştırmacılar sadece ticari reaktifler ve standart ekipman kullanmanıza olanak sağlar. Dördüncü olarak, yüksek teknik beceri gerektiren mikroenjeksiyon kullanmaz. Beşinci olarak, kurucularda mozaisizm azaltır ve böylece düzenlenmiş alellerin daha verimli germline iletimi yol açar, mozaik farelerin karmaşık genotypik analizi üstesinden. Son olarak, bu protokol F1 melezlerin kullanımını önler C57BL/6J inbred suşu ile verimli, ve böylece genetik karmaşıklığı kurtulmak için çok sayıda backcrosss gerçekleştirmek için ihtiyaç. F1 nesillerinin genotipleme doğru germline iletimdoğruladı. Ancak, alel karmaşıklığı ve Sonraki nesil genotipleme yanıltıcı tahmin nedeniyle F0 farelerin fenotipleri çalışma tavsiye edilmez F0 kurucuları14,27.

İnsan olmayan primatların ve domuz ve koyun gibi büyük hayvanların genom düzenlemesinde dondurulmuş çözülmüş embriyoların kullanımından yararlanmak büyük önem taşımaktadır. Embriyo dondurma yöntemleri hayvan türlerine bağlı olarak büyük ölçüde farklılık gösterir. Bu nedenle, kriyoprezervasyon protokolümüzün sadece fareler için geçerli olabileceğini düşünüyoruz. Öte yandan, protokolümüz potansiyel gm farelerin üretimi için Cas9 dışındaki mühendislik nükleazları kullanmak için geçerlidir, elektroporasyon daha önce verimli bir şekilde embriyo içine Cas12a gibi diğer nükleazlar tanıtmak bildirilmiştir çünkü28,29.

Protokolün bir sınırlaması, elektroporasyon tabanlı protokollerde zor kabul edilen uzun bir transgenin genoma hassas bir şekilde entegrasyonudur. Ancak, bir potansiyel çözüm bildirilmiştir: fare genomunda transgenlerin entegrasyonu başarıyla bir adeno ilişkili virüs ile elektroporasyon birleştirerek yapıldı (AAV)-aracılı HDR donör dağıtım sistemi30, daha önceki bir yayın teyit31. Ayrıca, off-hedef yan etkilerin potansiyel oluşumu CRISPR / Cas9 teknolojisinin kullanımı ile önemli bir endişe kaynağıdır. Potansiyel hedef dışı etkiyi dışlamak için düzenlenmiş farelerin tüm genom dizisini gerçekleştirmedik. Ancak, RNP32gibi hedef dışı etkiyi azaltmak için bildirilen CRISPR araçlarını kullandık. Ayrıca, hedefteki performanstan ödün vermeden hedef dışı düzenlemeyi önemli ölçüde azaltan yüksek kaliteli cas9 varyantı kullandık33. Ayrıca, crisprdirect yazılımı (https://crispr.dbcls.jp) kullanarak gRNA'lar tasarladık, bu da hedef dışı siteleri en aza indirgedi hedef dizileri ile sonuçlanmalıdır19. Genotip-fenotip nedenselliğini doğrulamak ve hedef dışı etkilerle ilgili endişeleri hafifletmek için araştırmacılar, farklı gRNA'lar kullanarak aynı genotipten birkaç düzenlenmiş fare üretmeli veya üretilen farelerin birkaç nesil boyunca arkadan geçişini gerçekleştirmelidir.

NHEJ mekanizması ve frameshift mutasyonları kullanılarak üretilen nakavt fareler yaygın olarak kullanılmış ve ilgili fenotipleri göstermektedir. Ancak, kesilen artık protein ya çeviri reinitiation veya düzenlenmiş ekson atlayarak nedeniyle var olabilir34,35. Bu nedenle, tam olarak fenotipleri yorumlamak için, artık protein fonksiyonu veya ifadesinin karakterizasyonu gereklidir. Birden fazla gRNA kullanarak tam gen nakavt farelerin nesil iyi bir alternatif olacaktır. Ancak, genin kodlamayan RNA'lara aktarılan intronik bölgeleri içermediğini doğrulamak için özellikle dikkat edilmelidir, bu da düzenleyici işlevlere sahip olabilir ve bu nedenle henotik analizi zorlaştırabilir.

Bu çalışmada, birçok araştırmacının 4 hafta veya daha kısa sürede genetiği değiştirilmiş fareler üretebildiği basit bir protokol gösteriyoruz. Dondurulmuş embriyoların kullanımını ve elektroporasyonunu birleştirerek, insan hastalıklarının fare modellerinin hazırlanmasını kolay, hızlı ve verimli hale getiriyoruz.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarların konuyla ilgili herhangi bir mali açıklamaları yoktur.

Acknowledgments

Hitomi Sawada ve Elizabeth Garcia'ya hayvan bakımı için teşekkür ederiz. Bu çalışma KAKENHI (15K20134, 17K11222, 16H06276 ve 16K01946) ve Hokugin Research Grant (H.N.'ye) ve Jichi Medical University Genç Araştırmacı Ödülü (H.U.'ya) tarafından desteklenmiştir. Otsuka Toshimi Burs Vakfı, Yüksek Angeles'ı destekledi.

Materials

Name Company Catalog Number Comments
0.25 M Sucrose ARK Resource Co., Ltd. (Kumamoto, Japan) SUCROSE
1 M DMSO ARK Resource Co., Ltd. (Kumamoto, Japan) 1M DMSO
Butorphanol Meiji Seika Pharma Co., Ltd. (Tokyo, Japan) Vetorphale 5mg
Cas9 protein: Alt-R® S.p. HiFi Cas9 Nuclease 3NLS Integrated DNA Technologies, Inc. (Coralville, IA) 1081060
C57BL/6J mice Japan SLC (Hamamatsu, Japan) N/A
DAP213 ARK Resource Co., Ltd. (Kumamoto, Japan) DAP213
FBS Sigma-Aldrich, Inc. (St. Louis, MO) ES-009-C
hCG MOCHIDA PHARMACEUTICAL CO., LTD (Tokyo, Japan) HCG Mochida 3000
HTF ARK Resource Co., Ltd. (Kumamoto, Japan) HTF
ICR mice Japan SLC (Hamamatsu, Japan) N/A
Isoflurane Petterson Vet Supply, Inc. (Greeley, CO) 07-893-1389
KSOM ARK Resource Co., Ltd. (Kumamoto, Japan) KSOM
LN2 Tank Chart Industries (Ball Ground, GA) XC 34/18
M2 ARK Resource Co., Ltd. (Kumamoto, Japan) M2
Medetomidine Nippon Zenyaku Kogyo Co.,Ltd. (Koriyama, Japan) 1124401A1060
Microscope Nikon Co. (Tokyo, Japan) SMZ745T
Midazolam Sandoz K.K. (Tokyo, Japan) 1124401A1060
Nuclease free buffer Integrated DNA Technologies, Inc. (Coralville, IA) 1072570
Nucleospin DNA extraction kit Takara Bio Inc (Kusatsu, Japan) 740952 .5
One-hole slide glass Matsunami Glass Ind., Ltd. (Kishiwada, Japan) S339929
One-step type Electroporator BEX Co., Ltd. (Tokyo, Japan) CUY21EDIT II
Paraffin Liquid NACALAI TESQUE Inc. (Kyoto, Japan) SP 26137-85
Platinum plate electrode BEX Co., Ltd. (Tokyo, Japan) LF501PT1-10, GE-101
PMSG ASKA Animal Health Co., Ltd (Tokyo, Japan) SEROTROPIN 1000
Povidone iodide Professional Disposables International, Inc. (Orangeburg, NY) C12400
Reduced-Serum Minimal Essential Medium: OptiMEM I Sigma-Aldrich, Inc. (St. Louis, MO) 22600134
Two-step type Electroporator Nepa Gene Co., Ltd. (Ichikawa, Japan) NEPA21

DOWNLOAD MATERIALS LIST

References

  1. Wang, H., et al. One-step generation of mice carrying mutations in multiple genes by CRISPR/cas-mediated genome engineering. Cell. 153, (4), 910-918 (2013).
  2. Jinek, M., et al. A programmable dual-RNA - guided DNA endonuclease in adaptive bacterial immunity. Science. 337, (6096), 816-822 (2012).
  3. Mali, P., et al. RNA-guided human genome engineering via Cas9. Science. 339, (6121), 823-826 (2013).
  4. Cong, L., et al. Multiplex genome engineering using CRISPR/VCas systems. Science. 339, (6121), 819-823 (2013).
  5. Doudna, J. A., Charpentier, E. The new frontier of genome engineering with CRISPR-Cas9. Science. 346, (6213), 1258096 (2014).
  6. Mashiko, D., et al. Generation of mutant mice by pronuclear injection of circular plasmid expressing Cas9 and single guided RNA. Scientific Reports. 3, 3355 (2013).
  7. Yen, S. T., et al. Somatic mosaicism and allele complexity induced by CRISPR/Cas9 RNA injections in mouse zygotes. Developmental Biology. 393, (1), 3-9 (2014).
  8. Kaneko, T., Mashimo, T. Simple genome editing of rodent intact embryos by electroporation. PLoS ONE. 10, (11), 1-7 (2015).
  9. Qin, W., et al. Efficient CRISPR/cas9-mediated genome editing in mice by zygote electroporation of nuclease. Genetics. 200, (2), 423-430 (2015).
  10. Kaneko, T., Sakuma, T., Yamamoto, T., Mashimo, T. Simple knockout by electroporation of engineered endonucleases into intact rat embryos. Scientific Reports. 4, 6382 (2014).
  11. Hashimoto, M., Takemoto, T. Electroporation enables the efficient mRNA delivery into the mouse zygotes and facilitates CRISPR/Cas9-based genome editing. Scientific Reports. 5, 11315 (2015).
  12. Chen, S., Lee, B., Lee, A. Y. F., Modzelewski, A. J., He, L. Highly efficient mouse genome editing by CRISPR ribonucleoprotein electroporation of zygotes. Journal of Biological Chemistry. 291, (28), 14457-14467 (2016).
  13. Modzelewski, A. J., et al. Efficient mouse genome engineering by CRISPR-EZ technology. Nature Protocols. 13, (6), 1253-1274 (2018).
  14. Teixeira, M., et al. Electroporation of mice zygotes with dual guide RNA/Cas9 complexes for simple and efficient cloning-free genome editing. Scientific Reports. 8, 474 (2018).
  15. Nakagawa, Y., et al. Production of knockout mice by DNA microinjection of various CRISPR/Cas9 vectors into freeze-thawed fertilized oocytes. BMC Biotechnology. 15, (1), 1-10 (2015).
  16. Darwish, M., et al. Rapid and high-efficient generation of mutant mice using freeze-thawed embryos of the C57BL/6J strain. Journal of Neuroscience Methods. 317, 149-156 (2019).
  17. Hashimoto, M., Yamashita, Y., Takemoto, T. Electroporation of Cas9 protein/sgRNA into early pronuclear zygotes generates non-mosaic mutants in the mouse. Developmental Biology. 418, (1), 1-9 (2016).
  18. Sakamoto, W., Kaneko, T., Nakagata, N. Use of frozen-thawed oocytes for efficient production of normal offspring from cryopreserved mouse spermatozoa showing low fertility. Comparative Medicine. 55, (2), 136-139 (2005).
  19. Naito, Y., Hino, K., Bono, H., Ui-Tei, K. CRISPRdirect: Software for designing CRISPR/Cas guide RNA with reduced off-target sites. Bioinformatics. 31, (7), 1120-1123 (2015).
  20. Torres-Perez, R., Garcia-Martin, J. A., Montoliu, L., Oliveros, J. C., Pazos, F. WeReview: CRISPR Tools-Live Repository of Computational Tools for Assisting CRISPR/Cas Experiments. Bioengineering. 6, (3), 63 (2019).
  21. Okamoto, S., Amaishi, Y., Maki, I., Enoki, T., Mineno, J. Highly efficient genome editing for single-base substitutions using optimized ssODNs with Cas9-RNPs. Scientific Reports. 9, 4811 (2019).
  22. Takeo, T., Nakagata, N. Superovulation using the combined administration of inhibin antiserum and equine chorionic gonadotropin increases the number of ovulated oocytes in C57BL/6 female mice. PLoS ONE. 10, (5), 1-11 (2015).
  23. Wuri, L., Agca, C., Agca, Y. Euthanasia via CO2 inhalation causes premature cortical granule exocytosis in mouse oocytes and influences in vitro fertilization and embryo development. Molecular Reproduction and Development. 86, (7), 825-834 (2019).
  24. Nakagata, N. High survival rate of unfertilized mouse oocytes after vitrification. Journal of Reproduction and Fertility. 87, (2), 479-483 (1989).
  25. Dehairs, J., Talebi, A., Cherifi, Y., Swinnen, J. V. CRISP-ID: Decoding CRISPR mediated indels by Sanger sequencing. Scientific Reports. 6, 28973 (2016).
  26. Nakagawa, Y., Sakuma, T., Takeo, T., Nakagata, N., Yamamoto, T. Electroporation-mediated genome editing in vitrified/warmed mouse zygotes created by ivf via ultra-superovulation. Experimental Animals. 67, (4), 535-543 (2018).
  27. Nakajima, K., Nakajima, T., Takase, M., Yaoita, Y. Generation of albino Xenopus tropicalis using zinc-finger nucleases. Development Growth and Differentiation. 54, (9), 777-784 (2012).
  28. Hur, J. K., et al. Targeted mutagenesis in mice by electroporation of Cpf1 ribonucleoproteins. Nature Biotechnology. 34, 807-808 (2016).
  29. Dumeau, C. E., et al. Introducing gene deletions by mouse zygote electroporation of Cas12a/Cpf1. Transgenic Research. 28, (5-6), 525-535 (2019).
  30. Chen, S., et al. CRISPR-READI: Efficient Generation of Knockin Mice by CRISPR RNP Electroporation and AAV Donor Infection. Cell Reports. 27, (13), 3780-3789 (2019).
  31. Mizuno, N., et al. Intra-embryo Gene Cassette Knockin by CRISPR/Cas9-Mediated Genome Editing with Adeno-Associated Viral Vector. iScience. 9, 286-297 (2018).
  32. Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. Highly Efficient RNA-guide genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Research. 24, (6), 1012-1019 (2014).
  33. Vakulskas, C. A., et al. A high-fidelity Cas9 mutant delivered as a ribonucleoprotein complex enables efficient gene editing in human hematopoietic stem and progenitor cells. Nature Medicine. 24, (8), 1216-1224 (2018).
  34. Rodriguez-Rodriguez, J. A., et al. Distinct Roles of RZZ and Bub1-KNL1 in Mitotic Checkpoint Signaling and Kinetochore Expansion. Current Biology. 28, (21), 3422-3429 (2018).
  35. Smits, A. H., et al. Biological Plasticity Rescues Target Activity in CRISPR Knockouts. Nature Methods. 16, 1087-1093 (2019).
Genetiği Değiştirilmiş Farelerin Yüksek Verimli Üretimi için Dondurulmuş Çözülmüş Embriyoların Kullanımı
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Nishizono, H., Darwish, M., Uosaki, H., Masuyama, N., Seki, M., Abe, H., Yachie, N., Yasuda, R. Use of Freeze-thawed Embryos for High-efficiency Production of Genetically Modified Mice. J. Vis. Exp. (158), e60808, doi:10.3791/60808 (2020).More

Nishizono, H., Darwish, M., Uosaki, H., Masuyama, N., Seki, M., Abe, H., Yachie, N., Yasuda, R. Use of Freeze-thawed Embryos for High-efficiency Production of Genetically Modified Mice. J. Vis. Exp. (158), e60808, doi:10.3791/60808 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter