Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Mediciones de las respuestas fisiológicas de estrés en C. Elegans

doi: 10.3791/61001 Published: May 21, 2020
* These authors contributed equally

Summary

Aquí, caracterizamos las respuestas de estrés proteotóxico celular en el nematodo C. elegans midiendo la activación de los reporteros transcripcionales fluorescentes y diciendo sensibilidad al estrés fisiológico.

Abstract

Los organismos a menudo están expuestos a ambientes fluctuantes y cambios en la homeostasis intracelular, que pueden tener efectos perjudiciales en su proteome y fisiología. Por lo tanto, los organismos han evolucionado respuestas de estrés específicas y específicas dedicadas a reparar el daño y mantener la homeostasis. Estos mecanismos incluyen la respuesta proteica desplegada del retículo endoplasmático (UPRER),la respuesta proteica desplegada de las mitocondrias (UPRMT),la respuesta de choque térmico (HSR) y la respuesta de estrés oxidativo (OxSR). Los protocolos aquí presentados describen métodos para detectar y caracterizar la activación de estas vías y sus consecuencias fisiológicas en el nematodo, C. elegans. En primer lugar, se describe el uso de reporteros transcripcionales fluorescentes específicos de la vía para la caracterización celular rápida, la detección de drogas o la detección genética a gran escala (por ejemplo, RNAi o bibliotecas mutantes). Además, se describen ensayos fisiológicos complementarios y robustos, que pueden utilizarse para evaluar directamente la sensibilidad de los animales a factores de estrés específicos, sirviendo como validación funcional de los reporteros transcripcionales. Juntos, estos métodos permiten una rápida caracterización de los efectos celulares y fisiológicos de las perturbaciones proteotóxicas internas y externas.

Introduction

La capacidad de un organismo para responder a los cambios en el entorno intra y extracelular es crucial para su supervivencia y adaptación. Esto se logra a nivel celular a través de numerosas vías protectoras que aseguran la integridad de la célula. Mientras que numerosos componentes celulares están sujetos a daño asociado al estrés, una participación importante de las respuestas de estrés celular es reparar y proteger la homeostasis del proteome celular. Sin embargo, la compartimentación de proteínas en estructuras especiales, llamadas orgánulos, plantea un desafío para la célula, ya que no puede confiar en una forma centralizada de control de calidad de proteínas para garantizar que todas las proteínas dentro de la célula estén correctamente plegadas y funcionales. Por lo tanto, para hacer frente a las perturbaciones a sus proteínas, los orgánulos han desarrollado mecanismos de control de calidad dedicados, que pueden detectar proteínas mal dobladas y activar una respuesta de tensión en un intento de aliviar el estrés dentro de ese compartimiento. Por ejemplo, el citosol se basa en la respuesta de choque térmico (HSR), mientras que el retículo endoplasmático (ER) y las mitocondrias dependen de sus respuestas proteicas desplegadas específicas del compartimiento (UPR). El OxSR sirve para aliviar los efectos tóxicos de las especies reactivas de oxígeno (ROS). Cada respuesta de estrés se activa en presencia de desafíos celulares e insultos ambientales e induce una respuesta transcripcional personalizada. Las características distintivas de estas respuestas incluyen la síntesis de moléculas que vuelven a plegar las proteínas mal dobladas (como los chaperones) dirigidas al orgánulo adecuado, o alternativamente, eliminan las proteínas dañadas por degradación de proteínas. Si no se activan estas respuestas de tensión, se acumulan proteínas dañadas, la disfunción celular se propaga a la insuficiencia sistémica de los tejidos y, finalmente, la muerte del organismo. La función y la regulación de las diferentes respuestas de tensión se revisan en otros lugares1.

Muchos conocimientos sobre la regulación y la actividad de las respuestas al estrés celular se han atribuido al nematodo, Caenorhabditis elegans, un organismo modelo multicelular en la investigación genética. Los nematodos no sólo permiten estudiar la activación de las respuestas de estrés a nivel celular, sino también a nivel de organismo; nematodos se han utilizado para estudiar los efectos de las perturbaciones genéticas o la exposición a fármacos y contaminantes en su crecimiento y supervivencia. Su tiempo de generación rápida, isogenia, transparencia, tractabilidad genética y facilidad de uso durante la experimentación los hacen ideales para tales estudios. Además, la respuesta fisiológica relativamente rápida al estrés (entre horas y unos días) y la conservación evolutiva de las vías celulares hacen de los nematodos una herramienta prominente en el estudio de la resistencia al estrés.

Hay dos cepas de E. coli comúnmente utilizadas como fuente de alimento para cultivar C. elegans: OP50 estándar, una cepa B en la que la mayoría de la experimentación se ha realizado históricamente2 y HT115, una cepa K-12 que se utiliza para casi todos los experimentos RNAi3,4. Es importante tener en cuenta que hay diferencias significativas entre las dietas bacterianas OP50 y HT115. Crecimiento en estas diferentes fuentes bacterianas se ha demostrado para causar grandes diferencias en el perfil metabólico, número de copia de ADN mitocondrial, y varios fenotipos principales, incluyendo la vida útil5. Algunas de estas diferencias se atribuyen a la deficiencia de vitamina B12 asociada con el crecimiento de bacterias OP50, que puede resultar en defectos en la homeostasis mitocondrial y mayor sensibilidad a patógenos y tensiones. Todos estos fenotipos han demostrado ser aliviados por el crecimiento de bacterias HT115, que tienen niveles más altos de vitamina B126. Por lo tanto, se recomienda que todos los experimentos sobre respuestas de estrés fisiológico se realicen en bacterias HT115, independientemente de la necesidad de condiciones de ARNi. Sin embargo, debido a la facilidad de mantener los animales en OP50, todo el crecimiento estándar (es decir, el mantenimiento y la amplificación de los animales) se puede realizar en OP50, ya que no se detectaron diferencias significativas en los paradigmas experimentales descritos aquí en los gusanos mantenidos en OP50 siempre y cuando se trasladaran a la sincronización posterior HT115 (es decir, desde el post-blanqueamiento de escotillas con o sin detención de L1) hasta la experimentación.

Aquí, se describe la caracterización de la actividad de las respuestas de estrés celular utilizando dos métodos funcionales. Cabe señalar que los protocolos presentados se centran principalmente en las respuestas de estrés celular y su impacto en la homeostasis proteica. En primer lugar, se utilizan reporteros transcripcionales fluorescentes, que están regulados por promotores de genes endógenos que se activan específicamente en respuesta a diferentes tensiones celulares. Estos reporteros transcripcionales fluorescentes se basan en la inducción transcripcional de genes específicos que son nativos parte de la respuesta al estrés. Por ejemplo, HSP-4, una proteína de choque térmico ortolista para el chaperone humano HSPA5/BiP, se activa al er-estrés y localiza a la sala de er para aliviar el estrés. En condiciones de estrés er (por ejemplo, la exposición a la tunicamicina), una proteína fluorescente verde (GFP), colocada bajo la regulación del promotor hsp-4, se sintetiza en niveles elevados, como puede evaluarse mediante microscopía fluorescente o medir cuantitativamente utilizando citometría de flujo de partículas grandes de nematodos7. Del mismo modo, el promotor de un chaperón mitocondrial, hsp-6 (ortologous a mamífero HSPA9), se utiliza para monitorear la activación de la UPRMT8,y el promotor de la chaperona citosólica hsp-16.2 (ortopéloga a los genes alfa de cristalino humana) se utiliza para evaluar la actividad del HSR9. Estos reporteros permiten una rápida caracterización de las vías activadas en respuesta a diversas perturbaciones.

A menudo, los reporteros presentados aquí son fotodos usando microscopía, que proporciona una salida cualitativa de la activación de las respuestas de estrés. Sin embargo, mientras que las técnicas de diagnóstico por imágenes proporcionan información sobre la intensidad y la ubicación de los tejidos de los reporteros descritos anteriormente, su cuantificación no siempre es precisa o robusta. Si bien es posible cuantificar la activación fluorescente utilizando herramientas de análisis de imágenes, estos métodos son relativamente bajos y el tamaño de la muestra es pequeño, debido al número relativamente bajo de animales en la imagen. La facilidad y la capacidad de obtener grandes cantidades de animales rápidamente hacen de C. elegans un sistema de modelo ideal para analizar la activación de los reporteros de estrés fluorescente a través del uso de un gran citómetro de flujo de partículas. Un citómetro de flujo de partículas grandes es capaz de registrar, analizar y clasificar en función del tamaño y la fluorescencia de muchos animales vivos. Usando este método, es posible obtener la intensidad fluorescente, el tamaño y también la información espacial (2D) para miles de gusanos. El sistema se controla mediante FlowPilot, que permite la adquisición y el análisis de datos en tiempo real de los parámetros medidos. Aquí, los métodos para la toma de imágenes microscópicas y el análisis cuantitativo utilizando un citómetro de flujo de partículas grandes se ofrecen como métodos para medir la activación de las respuestas de tensión.

Más allá del análisis del reportero, la sensibilidad o resistencia de los animales al estrés se puede medir mediante ensayos fisiológicos de estrés. Esto se logra mediante la exposición de los animales a ambientes estresantes que activan vías de estrés celular específicos. Aquí, se proporcionan varios métodos para medir la sensibilidad de animales enteros a tipos específicos de factores de estrés.

El estrés ER se aplica a C. elegans utilizando el agente químico, la tunicamicina, que bloquea la glicosilación ligada a N, causando la acumulación de proteínas mal plegadas en el ER10. En C. elegans, el crecimiento tras la exposición a la tunicamicina da lugar a perturbaciones importantes en la función de ER, y una vida útil significativamente disminuida11. Mediante la medición de la supervivencia de los animales en placas que contienen tunicamicina, se puede cuantificar la sensibilidad al estrés de los animales en ER. Por ejemplo, los animales con inducción ECtópica deURGENCIA supeditada y, por lo tanto, una mayor resistencia al estrés dedesdoblamiento de proteínas en el ER tienen una mayor supervivencia tras la exposición a la tunicamicina en comparación con los animales de tipo salvaje12.

El estrés oxidativo y mitocondrial se aplica a C. elegans al exponer animales al agente químico, paraquat. Paraquat es un herbicida de uso común, que causa la formación de superóxido específicamente en las mitocondrias13. Debido a la localización específica de las especies de oxígeno reactivo derivadas de las mitocondrias (ROS), los ensayos de paraquat se utilizan a menudo como un ensayo de estrés "mitocondrial". Sin embargo, el superóxido se convierte rápidamente en peróxido de hidrógeno por dismutas de superóxido mitocondrial (SOD)14. Posteriormente, el peróxido de hidrógeno puede salir de las mitocondrias y causar estrés oxidativo en otros compartimentos de la célula. Por lo tanto, describimos los ensayos de supervivencia de paraquat como la medición de la sensibilidad al estrés mitocondrial y oxidativo (otros ensayos de estrés oxidativo se pueden encontrar15).

Los ensayos de termotolerancia se realizan en C. elegans colocando animales a temperaturas elevadas. Las temperaturas ambiente de los nematodos son de 15-20 oC y se induce tensión térmica a temperaturas superiores a 25 oC16,17. Los ensayos de termotolerancia se realizan generalmente a temperaturas que oscilan entre 30-37 oC, ya que los animales presentan defectos celulares importantes a esta temperatura, y los ensayos de supervivencia se completan dentro de las 24 horas16,,18. Aquí, se proporcionan dos métodos alternativos para la realización de ensayos de termotolerancia: crecimiento a 34 oC y crecimiento a 37 oC. Juntos, los protocolos presentados aquí se pueden utilizar para realizar pantallas a gran escala cuando se combinan con el derribo de genes estándar utilizando interferencia de ARN o bibliotecas de fármacos químicos.

El protocolo se puede dividir en 4 procedimientos generales: crecimiento de C. elegans y preparación para la toma de imágenes (secciones 1 y 2), imágenes de reporteros transcripcionales mediante microscopía fluorescente (secciones 3-5), mediciones cuantitativas de reporteros utilizando un citómetro de flujo de partículas grandes (sección 6), y ensayos fisiológicos para medir la sensibilidad al estrés en C. elegans (sección 7).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Condiciones de crecimiento estándar de las temperaturas y OP50 vs HT115

  1. Crecimiento y expansión estándar
    1. Cultivar un cultivo de OP50 en LB (Tabla 1) o medios equivalentes de elección para 24-48 h a temperatura ambiente (22-25 oC). Crecer bacterias a temperatura ambiente ya que OP50 es un auxotrofi de uracilo y hay una mayor incidencia de revertientes (por ejemplo, mutantes supresores) cuando se cultiva a 37 oC. No se recomienda el almacenamiento a largo plazo de cultivos OP50 (máximo 1 semana a 4 oC).
    2. Semilla de un volumen de 100-200 ml de cultivo OP50 saturado en una placa NGM de 60 mm (Tabla 1) para el mantenimiento de gusanos y 1 ml de cultivo OP50 saturado en una placa de 100 mm para la expansión de animales para la experimentación.
    3. Deje que las placas se sequen durante la noche en un banco.
      NOTA: Las placas de 100 mm pueden necesitar más tiempo para secarse, especialmente si se utilizan placas no ventiladas. Almacene todas las placas C. elegans en recipientes herméticos almacenados a 4oC. No utilice placas de más de 6 meses de edad, ya que se producirá la desecación de las placas, lo que cambiará la fisiología animal en las placas debido a la diferente presión osmótica y rigidez de las placas.
    4. Para el mantenimiento estándar, mueva 10-15 animales jóvenes (huevos, etapas L1 o L2) en una placa de 60 mm, aunque se pueden mover más si se trata de mutantes o animales transgénicos con menor fecundidad. Para los animales con defectos de desarrollo o fecundidad, trozo un grupo de animales más variable para evitar la pérdida de la población. Si se mantiene a 15 oC, mover animales cada semana; para 20 oC, mover animales cada 3-4 días.
    5. Realizar un nuevo deshielo de los animales cada 25-30 pasajes (6 meses si los animales se mueven una vez a la semana y se mantienen a 15 oC).
    6. Para la expansión, descomare una placa completa de 60 mm sobre placas de 100 mm para su expansión. Como marco de referencia, los animales con fecundidad de tipo salvaje pueden tener una placa completa de 60 mm cortada en 4o-6o y ser fragmentados en una placa grande a 20 oC durante 2 días o 15 oC durante 3 días para crear una placa completa de 100 mm sin llegar a la inanición.

2. Ensayo/sincronización de gusanos mediante blanqueo

  1. Protocolo de blanqueamiento para sincronizar gusanos
    1. Lavar los gusanos gravídricos (adultos llenos de huevos) de las placas de agar utilizando M9 (Tabla 1). Comience desde una población no sincronizada de gusanos (es decir, gusanos fragmentados desde el paso 1.1.6) hasta la lejía para experimentos, ya que puede producirse una deriva genética significativa en rondas sucesivas de sincronización a través del blanqueo.
    2. Mover la mezcla de gusano/M9 en un tubo cónico de 15 ml utilizando una pipeta de vidrio; varias placas de gusanos se pueden recoger en un solo tubo cónico de 15 ml.
    3. Girar animales hacia abajo durante 30 s a 1.000 x g. Aspirar sobrenadante M9. No es necesario lavar las bacterias residuales a menos que haya una cantidad atroz de contaminación o grandes grupos de bacterias. Si este es el caso, realice varios lavados con M9.
    4. Preparar un stock fresco de solución de blanqueo (Tabla 1). La solución de blanqueo se puede mantener durante varios días a 4 oC, pero utilizar una solución de blanqueo recién hecha, ya que el blanqueo ineficiente puede resultar en un blanqueo desigual, que causará daños a los huevos antes de eliminar todas las canales de gusano.
    5. Añadir 2-10 ml de solución de blanqueo a los animales (1 ml de solución de lejía por cada 0,1 ml de pellet animal). Invertir la mezcla de lejía y gusano durante 5 minutos (no exceda los 10 min; tenga en cuenta que los tiempos de blanqueo pueden variar y deben valorarse específicamente para cada laboratorio). Agitar vigorosamente para ayudar a disolver las canales de gusano más rápido y para una preservación óptima de los huevos. Mire periódicamente bajo un microscopio de disección o ponga el tubo cónico a una luz para observar cuando las canales de gusano sofocadas adultas se hayan disuelto completamente y solo queden huevos en el tubo.
    6. Peletar los huevos girando a 1.000 x g durante 30 s y luego aspirar el sobrenadante. Los huevos se pueden centrifugar más rápido que los gusanos sin alterar su integridad, por lo que si no se está seguro de la velocidad de centrífuga, los huevos se pueden girar hasta 2.500 x g sin afectar su fisiología.
    7. Añadir M9 hasta 15 ml e invertir el tubo para limpiar la lejía de los huevos.
    8. Repita los pasos 2.1.6-2.1.7 (proceso de lavado/pellet) 2-3 veces más para eliminar la lejía.
    9. Huevo de pipeta/ M9 mezclar en placas y crecer a 15-20 oC para la experimentación. Para obtener una medida de cuántos gusanos utilizar, realice recuentos aproximados de huevos pipeteando 5 ml de mezcla de huevo en una placa de agar o deslice y dividiendo el recuento de óvulos por 5 para determinar el número de huevos por 1 l de volumen. El promedio de 3 recuentos independientes puede mejorar la precisión. Para evitar el hambre, una tabla de recuentos de huevos recomendados por plato está disponible en la Tabla 2.
    10. Si es necesario, L1 arresta animales para una sincronización temporal más estricta colocando la mezcla de huevo/M9 en un rotador a 20 oC durante un máximo de 24 h. En el alquiler de animales de tipo salvaje, no se detectaron defectos en la fisiología animal cuando se detienen L1 hasta 48 h. Sin embargo, a los mutantes que son sensibles a la inanición (por ejemplo, mutantes lisomas o de la autofagia) les va muy mal con la detención de L1, y por lo tanto no se recomienda realizar este método de sincronización para mutantes que se sabe que son sensibles a la inanición. Si se requiere una sincronización más estricta para los animales que no pueden ser arrestados en L1, utilice el método egg-lay descrito en la sección 2.2.
  2. Protocolo Egg-Lay para sincronizar gusanos
    NOTA: Como método alternativo al blanqueo, se puede realizar un ensayo de huevo. Egg-lay se utiliza cuando el blanqueo de animales no proporciona una sincronización lo suficientemente cercana, ya que los huevos dentro del saco de huevos de animales adultos pueden ser tan diferentes como 8-12 h de separación. Para los paradigmas experimentales en los que es fundamental que los animales sean lo más escenificados posible, pero donde no sea posible la detención de L1 (por ejemplo, en mutantes de hambre), se recomiendan ensayos de huevos. Sin embargo, cabe señalar que debido a la mano de obra involucrada en el protocolo egg-lay, es menos factible realizar experimentos a gran escala.
    1. Coloque 4-12 adultos gravid (ver Nota después del paso 2.2.2) en una placa NGM estándar OP50 o HT115 (ver Sección 1 anterior para obtener recomendaciones sobre cepas bacterianas). Dependiendo de la escala de los experimentos, se pueden utilizar varias placas. Asegúrese de documentar cuidadosamente cuántos animales hay en cada placa para el paso 2.2.
    2. Colocar los animales a la temperatura deseada para experimentos (15-20 oC) durante 4-8 h.
      NOTA: El número de horas que quedan los animales en el plato determinará la proximidad sincronizada del primer huevo puesto y el último huevo puesto, por lo que el tiempo se puede ajustar según sea necesario. Dado que los tiempos de incubación más cortos significarán que cada animal tiene menos tiempo para poner huevos, se deben colocar más animales en las placas para asegurarse de que se ponen suficientes huevos. Si bien la tasa real de puesta de huevos no está completamente normalizada debido a la tendencia de los animales a pasar por breves ráfagas de puesta de huevos en lugar de una tasa normalizada de huevos, la tasa media de huevos puestos por animal puede estimarse en 5 huevos/hora para los animales que presentan fecundidad de tipo salvaje19. Cuando trate de cultivar animales hasta la etapa adulta del día 1, cronometra que el huevo de pie tenga <100 huevos por plato para evitar el hambre (consulte la Tabla 2 para obtener más detalles sobre los animales recomendados por plato).
    3. Retire los animales adultos de las placas. Asegúrese de que todos los animales adultos se retiran de las placas, ya que los animales continuarán poniendo huevos y resultarán en una población no sincronizada y/o hambre de la placa.

3. Condiciones de crecimiento de los gusanos para la toma de imágenes de reporteros transcripcionales

  1. Crecimiento de gusanos
    1. Inocular el cultivo bacteriano de HT115 albergando plásmido RNAi (EV) pL4440 y/o llevando un casete RNAi contra los genes diana deseados en medios LB complementados con 100 g/ml de carbenicilina y 20 g/ml de tetraciclina.
    2. Cultivar el cultivo durante la noche (16 horas) hasta la saturación en una incubadora de 37 oC.
    3. Detectar placas RNAi NGM de 60 mm con 200 ml de cultivo bacteriano saturado y placas DE RNAi de 100 mm NGM con 1.000 ml de cultivo bacteriano saturado. Dejar secar a temperatura ambiente (22 oC) durante la noche en la oscuridad (cubierto libremente con papel de aluminio).
    4. Coloque la población sincronizada de gusanos transgénicos que transportan reporteros fluorescentes (ver Tabla 3 para una lista completa) en placas NGM RNAi sembradas con bacterias de elección.
    5. Crecer a 15-20 oC hasta las etapas requeridas para reporteros específicos como se describe a continuación.
  2. Consideraciones para la puesta en escena de gusanos para experimentos
    1. Realizar experimentos para reporteros transcripcionales en el día 1 de la edad adulta, con la excepción de los ensayos que requieren animales L4. Según WormAtlas, los animales L4 se obtienen aproximadamente 2,5 días (56 h) de crecimiento a 20oC desde la etapa del huevo (www.wormatlas.org).
    2. Para "el día 1 de los adultos", utilice animales a los aproximadamente 3-4 días (65-96 h) de crecimiento a 20 oC después de los huevos de chapado.
      NOTA: Esta amplia gama se explica de la siguiente manera: 65 h a 20 oC es cuando los animales alcanzan la "puesta de huevos", que es el verdadero estado de "edad adulta". 96 h es cuando los animales entran en lo que WormAtlas describe como "máximo de puesta de huevos", que es cuando el adulto es un adulto gravído y tiene un saco de huevo completo. Esto es cuando los animales se describirían como más antiguos que el día 1 y pueden comenzar a mostrar diferencias, y por lo tanto los protocolos descritos aquí se recomiendan comenzar en esta etapa del "día 1" a partir de 65 h y tan tarde como 96 h. Para los ensayos descritos aquí, no se observaron grandes diferencias cuando se utilizan animales en esta ventana de 65-96 h.
    3. Para las réplicas de un solo experimento, utilice un punto de tiempo similar para una reproducibilidad más robusta (por ejemplo, realice todos los experimentos a 65 h o 96 h después de los huevos de chapado).
      NOTA: Algunos animales transgénicos y mutantes muestran tasas de crecimiento más lentas. Para ello, existen dos recomendaciones. 1) Utilice la sincronización escalonada, donde los animales pueden ser blanqueados en diferentes momentos para que la experimentación se realice al mismo tiempo. Esto se recomienda cuando la variabilidad técnica en el ensayo puede ser mayor que las variabilidades técnicas que pueden surgir del ensayo de sincronización (por ejemplo, los ensayos de supervivencia, que se ejecutan durante largas duraciones pueden verse afectados si no se realizan simultáneamente). 2) Utilizar análisis escalonados, donde los animales pueden ser blanqueados al mismo tiempo, pero el ensayo en sí se realiza en diferentes momentos. Esto se recomienda para ensayos muy simples que no tienen variabilidad inherente (por ejemplo, inducción RNAi de respuestas de estrés).

4. Inducción de las respuestas al estrés

  1. Uso de hsp-4p::GFP como lectura para la activación delE+EE de la EPu
    1. Inducir el estrés de ER usando el ARNI
      1. Preparar placas manchadas con bacterias RNAi dirigidas al gen de interés en placas de ARNi NGM(Tabla 1)como en la sección 3. Utilice EV como control para los niveles basales deER de UPR y el derribo de RNAi de la etiqueta 335 (enzima para la glicosilación ligada a N de proteínas residentes de ER; El derribo de RNAi tiene efectos similares al tratamiento con tunicamicina) como un control positivo para la activación de laEPU ER bajo tensión ER.
      2. Sincronizar los animales reporteros hsp-4p::GFP utilizando los métodos descritos en la sección 2.
      3. Huevos de placa en placas RNAi utilizando los criterios recomendados en la Tabla 2.
      4. Incubar huevos a 20oC durante aproximadamente 3-4 días (65-96 h) para realizar experimentos en el día 1 de la edad adulta. Para los experimentos de UPRER, hay diferencias en la fluorescencia basal del reportero hsp-4::GFP cuando se cultiva a diferentes temperaturas. Por lo tanto, realice todos los experimentos a 20 oC.
    2. Inducir el estrés de Er utilizando un agente químico
      1. Sincronizar los animales reporteros hsp-4p::GFP utilizando los métodos descritos en la sección 2 y crecer a 20 oC hasta que los animales lleguen a la etapa L4. Transfiera animales a un tubo de M9. Permita que los gusanos se asienten (2-3 min por gravedad o un giro de 30 s a 1.000 x g)y, a continuación, retire M9.
      2. Diluir la tunicamicina a 25 ng/ml en M9 (dilución de 1:40 a partir de 1 mg/ml). Como control, diluir también un volumen equivalente de DMSO en M9.
      3. Añadir 25 ng/ml de tunicamicina/M9 o controlar la solución DMSO/M9 a los gusanos (utilice 400-500 ml para un tubo de 1,5 ml o 2 ml para un tubo cónico de 15 ml). Incubar a 20oC en plataforma giratoria durante 3-4 horas.
        NOTA: La tunicamicina también se puede diluir directamente en la mezcla de gusano/M9.
      4. Deje que los gusanos se asienten, retire la solución M9/TM y lave con 1 ml de M9.
      5. Transfiera los animales a placas NGM o placas DERN NGM y permita recuperarse durante la noche (o 15-20 h) y alcance el día 1 de la edad adulta a 20oC antes de realizar la microscopía fluorescente (sección 5). Se realiza una recuperación durante la noche para permitir la acumulación de un nivel detectable de GFP.
      6. Alternativamente, induzca hsp-4p::GFP moviendo los animales L4 a placas de agar que contengan 25 ng/L de tunicamicina durante 16-24 h. Esto tiene una inducción mucho más robusta de hsp-4p::GFP debido a la mayor duración de la tensión, y por lo tanto el rango dinámico es mucho menor que el ensayo descrito anteriormente.
  2. Uso de hsp-6p::GFP como lectura para la activación del UPRMT
    1. Inducir el estrés mitocondrial con EL ARNI
      1. Activar UPRMT siguiendo el mismo protocolo que la sección 4.1.1, excepto el uso de deknockdown RNAi de genes mitocondriales, como cox-5b/cco-1 (subunidad del citocromo c oxidasa 5B; el derribo inhibe la actividad de la cadena de transporte de electrones). Para la activación de UPRMT a través de perturbaciones en la función de la cadena de transporte de electrones, el derribo de RNAi debe realizarse durante el desarrollo temprano20. Por lo tanto, realice el ARNi desde la eclosión para estos experimentos.
    2. Inducir el estrés mitocondrial utilizando un agente químico
      1. Preparar placas manchadas con bacterias RNAi dirigidas al gen de interés como en la sección 3. Utilizar bacterias HT115 incluso en experimentos que no impliquen derribo de ARAi (ver Sección 1). Asegúrese de que las placas NGM RNAi (o NGM RNAi + DMSO0.2) y las placas NGM RNAi + antimicina A(Tabla 1)estén preparadas para el paso 4.2.2.5.
      2. Sincronizar hsp-6p::GFP o hsp-60p::GFP animales reportero utilizando los métodos descritos en la sección 2.
      3. Huevos de placa en placas de elección utilizando los criterios recomendados en la Tabla 2. Dado que la antimicina A se disuelve en DMSO, cultiva los animales en placas NGM RNAi + DMSO0.2 de la escotilla.
      4. Incubar huevos a 20oC durante 2 días (56 h) hasta la etapa L4. Alternativamente, cultivar animales a 15 oC durante 3 días (75 h) en su lugar.
      5. Mueva los gusanos de las placas NGM RNAi + DMSO0.2 a placas NGM RNAi + antimicina A o placas NGM RNAi + DMSO0.2 como control. Los gusanos se pueden mover manualmente con una selección para experimentos a pequeña escala, pero para experimentos a gran escala, recomendamos lavar animales con M9, establecerse con centrifugación, aspirar M9, y luego chapar a placas NGM RNAi + antimicina A.
      6. Incubar gusanos por 20 h adicionales e imagen en el día 1 adulto (sección 5).
  3. Uso de gst-4p::GFP como una lectura para la respuesta al estrés oxidativo.
    1. Inducir OxSR usando RNAi
      1. Alternativamente, induzca gst-4p::GFP usando RNAi-knockdown de wdr-23 (codifica un regulador negativo de skn-1; por lo tanto, su derribo induce OxSR) utilizando el protocolo descrito en la sección 4.1.1.
    2. Inducir el OxSR utilizando la exposición al oxidante químico Tert-butilo hidroperóxido (TBHP)
      1. Preparar placas manchadas con bacterias RNAi dirigidas al gen de interés como en la sección 3. Utilizar bacterias HT115 incluso en experimentos que no impliquen derribo de ARAi (ver Sección 1).
      2. Sincronizar gst-4p::GFP animales reportero utilizando los métodos descritos en la sección 2.
      3. Huevos de placa en placas de elección utilizando los criterios recomendados en la Tabla 2. Asegúrese de preparar más placas de las necesarias, ya que el protocolo de tratamiento de drogas resulta en la pérdida de >10-20% de los animales. Para obtener imágenes, comience con >100 animales y para ordenarlos, comience con >1.000 animales.
      4. Incubar huevos en 20oC durante 2 días (56 h) hasta la etapa L4. Alternativamente, cultivar animales a 15 oC durante 3 días (75 h) en su lugar.
      5. Lave los animales L4 de las placas y se divida en dos tubos cónicos de 15 ml por condición. Aspirar el volumen hasta por lo menos 1 mL y añadir un volumen igual de TBHP de 2 mM recién hecho. Utilice un volumen líquido total de al menos 2 ml, ya que los volúmenes más bajos pueden causar la muerte significativa de gusanos al girar. No lavar antes del tratamiento farmacológico, ya que las bacterias residuales de las placas ayudarán a garantizar que los gusanos no se mueran demasiado durante la incubación.
      6. Incubar gusanos en el rotador durante 4 h a 20oC.
      7. Lave los gusanos girando a 1.000 x g,aspirando la mezcla M9 + TBHP, y reemplazándolo con 15 ml de M9. Repita para un segundo lavado.
      8. Gusanos de placa en EV RNAi para recuperarse durante la noche (16-24 h) a 20 oC. Los gusanos se pueden recuperar en el ARNi correspondiente de elección, pero no se vieron diferencias significativas cuando se recuperaron en EL RNAi EV, por lo que esto se puede hacer para facilitar la configuración experimental. Tome imágenes de los adultos del día 1 después de la recuperación.
        NOTA: Se realiza una recuperación durante la noche para permitir la acumulación de un nivel detectable de GFP. Sin esta recuperación, no hay señal GFP detectable. Si se desea una recuperación a corto plazo, es posible utilizar el ensayo descrito en la sección 4.3.3.
    3. Inducir el OxSR mediante la exposición al paraquat oxidante químico (PQ)
      1. Repita todos los pasos de la sección 4.2.2 para obtener 2 lotes de L4 gst-4p::GFP animales en tubos cónicos de 15 ml por condición.
      2. Aspirar el volumen hasta por lo menos 1 ml y añadir un volumen igual de PQ recién hecho de 100 m. Similar a 4.3.2.5, se recomienda un volumen mínimo de 2 ml.
      3. Incubar gusanos en el rotador durante 2 h a 20oC.
      4. Lave los gusanos girando a 1.000 x g,aspirando la mezcla M9 + PQ, y reemplazándolo con 15 ml de M9. Repita para un segundo lavado.
      5. Gusanos de placa en EV RNAi para recuperar se recuperan durante 2 h a 20 oC, y luego tomar imágenes inmediatamente después de la recuperación.
        NOTA: 2 h de recuperación fue la recuperación mínima necesaria para visualizar la inducción de GFP.
  4. Usando hsp-16.2p::GFP y hsp-70p::GFP como lectura para la activación de HSR.
    1. Inducir HSR utilizando la exposición a temperaturas elevadas
      1. Preparar placas manchadas con bacterias RNAi dirigidas al gen de interés como en la sección 3. Utilice la bacteria HT115, incluso en experimentos que no impliquen derribo de ARAi (ver Introducción).
      2. Sincronizar hsp-16.2p::GFP o hsp-70p::GFP reportero animales utilizando los métodos descritos en la sección 2.
      3. Huevos de placa en placas de elección utilizando los criterios recomendados en la Tabla 2. Asegúrese de preparar 2 veces el número de placas necesarias, ya que la mitad de la muestra estará expuesta a temperaturas elevadas para la inducción de choque térmico, y la otra mitad servirá como un control no calentado.
      4. Incubar huevos a 20oC durante aproximadamente 3-4 días (65-96 h) para realizar experimentos en el día 1 de la edad adulta. No crezca gusanos a 15 oC para experimentos de choque térmico, ya que sólo hay pequeñas diferencias entre los animales que experimentan choque térmico de 15 oC frente a 20 oC.
      5. Mover grupos experimentales de animales a una incubadora de 34oC durante 2 h. Coloque las placas en la incubadora como una sola capa (es decir, sin apilamiento de placas) para asegurar la distribución más rápida e igualitaria del calor a través de las placas.
      6. Mueva los animales termomosorprendidos a una incubadora de 20 oC para recuperarlos durante 2 h y luego la imagen inmediatamente (ver Sección 5). Los animales se pueden recuperar más tiempo si es necesario para una mayor inducción de la FPG.
        NOTA: 2 h de recuperación fue la recuperación mínima necesaria para visualizar la inducción de GFP.

5. Imágenes mediante un microscopio estéreo o un microscopio de campo ancho/compuesto de bajo aumento

  1. Preparación de gusanos para microscopía fluorescente
    1. Pipeta de 5-10 ml de azida sódica de 100 mM encima de una placa NGM estándar (es decir, sin bacterias).
      NOTA: La concentración de azida sódica puede reducirse hasta 10 mM, aunque la inmovilización más robusta se observó a 100 mM de azida sódica sin efecto detectable sobre la señal fluorescente.
    2. Bajo un microscopio de disección, recoger 10-20 animales de placas experimentales, y transferir en el punto de azida sódica. Los animales deben dejar de moverse poco después de aterrizar en azida sódica, y la azida sódica se evaporará en cuestión de segundos.
    3. Una vez que el azida sódica se haya evaporado, alinee a los animales con la configuración de imágenes deseada. Mover los animales uno al lado del otro con los lados anterior y posterior en la misma orientación para todos los animales. Imagen de animales inmediatamente.
      NOTA: No se observaron cambios en la señal del reportero para ninguno de los reporteros transcripcionales en la Tabla 3 durante un máximo de 15 minutos después de paralizar en azida sódica.
  2. Adquisición de imágenes mediante un estereomicroscopio
    NOTA: Para este protocolo, se utilizó un microscopio Leica M205FA equipado con una cámara CCD monocromática Leica DFC3000G, un filtro Leica GFP estándar (ex 395-455, EM 480 LP) y un software LAS X. Los ajustes recomendados para los tiempos de exposición se pueden encontrar en la Tabla 4.
    1. Inicie el programa LAS X.
    2. Iniciar un nuevo proyecto: abra la pestaña de adquisición, haga clic en Abrir proyectos y haga clic en Carpeta para abrir un nuevo proyecto. Este proyecto se puede cambiar de nombre haciendo clic con el botón derecho en la carpeta y desplazándose hacia abajo hasta Cambiar nombre o haciendo clic en F2. En la pestaña de adquisición, también hay opciones para ajustar el tiempo de exposición y el zoom a los ajustes deseados.
    3. Coloque la muestra de gusano bajo el objetivo del microscopio y localice el punto focal correcto de los gusanos utilizando el ajuste de campo brillante para minimizar el blanqueo fluorescente. El centro de la muestra es donde la línea de huevos es claramente visible y no difusa. Establezca el tiempo de exposición, el zoom, el enfoque y los condensadores de campo brillante en los ajustes deseados.
    4. Adquiera una imagen con el botón Capturar imagen.
    5. Guarde la imagen en formato .lif (Leica Image File) mientras guarda todas las imágenes y metadatos sin procesar. Un TIFF también se puede exportar haciendo clic con el botón derecho en la imagen (o proyecto) y, en la opción Guardar como, haga clic en TIFF. Esto almacenará todos los canales (por ejemplo, campo brillante y GFP) con cualquier modificación (por ejemplo, si se ajustó el contraste, esto se guardará en el TIFF).
  3. Análisis cuantitativo de imágenes fluorescentes
    1. Si se realizará un análisis cuantitativo, tome imágenes tridimensionales. Esto se realiza haciendo clic en la opción de sección z etiquetada con "z" en la parte superior derecha. Las secciones Z estarán activas si este cuadro es rojo.
    2. Optimice las secciones z seleccionando el rango y el grosor del corte en la parte inferior izquierda de las opciones ajustables. Siempre que sea posible, utilice el botón System Optimized para obtener una configuración óptima.
    3. Capture la imagen y almacene la imagen como se describe anteriormente en la sección 5.2. Alinee los gusanos con espacios entre ellos para facilitar las mediciones.
    4. Importe imágenes TIFF en el software de imágenes de su elección (por ejemplo, ImageJ).
    5. En ImageJ, en el menú Analizar, elija Establecer medidas. Compruebe lo siguiente: área, valor medio de gris, densidad integrada, etiqueta de visualización.
    6. Con la herramienta ROI (región de interés), dibuje un ROI. Mida cada gusano individualmente. En el menú Analizar, elija Medir o pulse M. Dibuje un ROI en el fondo donde no haya gusanos y, a continuación, mida el fondo de la misma manera. Copie o guarde las medidas que aparecen en la ventana Resultados.
    7. Restar la densidad integrada de fondo de la densidad integrada de cada ROI medido. La intensidad de fondo de un ROI se define como el producto del valor gris medio de fondo y el área del ROI dibujado.
  4. Adquisición de imágenes mediante un microscopio compuesto/de campo ancho
    NOTA: Para obtener imágenes de reporteros transcripcionales utilizando un microscopio compuesto/de campo ancho, este protocolo utiliza un microscopio Revolve ECHO R4 equipado con una lente objetivo Olympus 4x Plan Fluorite NA 0.13, un filtro estándar Olympus FITC (ex 470/40; em 525/50; DM 560), y un iPad Pro para la cámara y para conducir el software ECHO. Los ajustes recomendados para los tiempos de exposición se pueden encontrar en la Tabla 4.
    1. Utilice el panel táctil para iniciar el programa de control. Cree un nuevo álbum y nombre de archivo.
    2. Placa de posición debajo de la lente objetivo. Ajuste el tiempo de exposición y la intensidad de la fluorescencia utilizando el valor basal (tratamiento EV/control) y el control positivo, de modo que la señal sea visible pero no saturada.
    3. Guarde una imagen de campo brillante y una imagen GFP/FITC.

6. Mediciones cuantitativas de los reporteros utilizando un citómetro de flujo de partículas grandes

NOTA: El crecimiento y la preparación de gusanos para el análisis de citómetros de flujo de partículas grandes pueden seguir los mismos paradigmas que las secciones 1-5 para la preparación de gusanos para imágenes fluorescentes, con la excepción de que se requiere un mayor número de animales. Utilizar >500 animales por condición, ya que algunos animales se pierden durante la manipulación, no todos los animales pasan los criterios de filtrado durante la cuantificación, y algunos animales no son leídos correctamente por el citómetro de flujo. Lave los animales listos para clasificar las placas en 5-10 ml de solución M9 en tubos cónicos de 15 ml para su posterior clasificación en el citómetro de flujo.

  1. Configuración de clasificación mediante un gran cytómetro de flujo de partículas
    1. Antes de encender el citometro de flujo
      1. Asegúrese de que la botella líquida de la vaina no esté vacía. Prepare el líquido de la vaina de la acción 250x al menos unas horas antes de usar el clasificador, ya que hay una pequeña cantidad de detergente en el líquido de la vaina, que puede causar burbujas que pueden causar artefactos durante la adquisición.
      2. Asegúrese de que todos los contenedores de residuos no estén llenos.
    2. Encendido del citometro de flujo
      1. Encienda el compresor de aire. Gire a Automático. Compruebe el manómetro - debe ser alrededor de 30 psi.
      2. Encienda el instrumento. Utilice el interruptor de alimentación que está junto al cable de alimentación a la izquierda del instrumento.
      3. Encienda los láseres. Una fuente de luz de 488 nm suele ser suficiente para la mayoría de los experimentos, aunque es necesario utilizar una fuente de luz de 561 nm si se requiere una excitación más alta para la fluorescencia roja.
      4. Abra el software FlowPilot; el instrumento debe hacer una serie de clics de conmutación en las diferentes válvulas.
      5. Encienda los láseres en la ventana del software haciendo clic en Iniciar. Inicie el láser en la ventana emergente de control láser Argon haciendo clic en Ejecutar. Esto debe hacer que el láser se encienda y alcance alrededor de 12 mW. El nivel de fuente de luz 488 subirá a alrededor de 12.
      6. Haga clic en Listo para cerrar la ventana.
    3. Comprueba el software antes de progresar
      1. Compruebe los manómetros -Mire los 4 valores de presión que se muestran en la parte inferior de la ventana. Los valores deben estar alrededor de la configuración original (Vaina 5.5-5.7; Muestra 5.7-6.0; Clasificador 3.1-3.3; Limpiar 8.5-8.7). Si tiene un aspecto similar, marque la casilla situada junto a Presión OK.
      2. Compruebe los fluidos -Para asegurarse de que no haya burbujas de aire y desechos bloqueando el flujo de vaina/muestra a través de la celda de flujo, haga clic en Limpiar varias veces.
      3. Compruebe el caudal de la vaina -Para ello, recoja la vaina para 60 s. Interruptor de clasificación,luego cambie On Sheath en los controles manuales para iniciar el flujo de vaina. Recoger en un tubo de 15 ml durante 60 s; el caudal debe ser de 9-10 ml/min.
    4. Limpieza antes del uso del cofómetro de flujo
      1. Ponga 3-5 ml de solución de lejía del 10% en la colección 'cup' y haga clic en Acquire. Deje correr durante 30 s, haga clic en Anulary elimine el exceso con vacío.
      2. Enjuagar la colección 'taza' con agua desionizada y retirar con vacío. Repita 2x.
      3. Ponga 3-5 ml de solución de limpieza COPAS en la colección 'cup' y haga clic en Acquire. Deje correr durante 30 s, haga clic en Anulary elimine el exceso de solución de limpieza con vacío.
      4. Enjuagar la colección 'taza' con agua desionizada y retirar con vacío. Repita 2x.
      5. Ponga 3-5 ml de solución M9 en la colección 'cup' y haga clic en Acquire. Deje correr durante 30 s, haga clic en Detenery elimine el exceso de solución M9 con vacío.
  2. Ejecución de muestras en el clasificador
    1. Ajuste la potencia del PMT láser y el tamaño de la gating en función de la condición que causa la activación más brillante del reportero transcriptor de interés. Los ajustes recomendados se pueden encontrar en la Tabla 4.
    2. Añadir gusanos preparados a 'cup'. Haga clic en Adquirir. Ver para asegurarse de que todo el líquido no se toma en la máquina; esto hará que el citómetro de flujo tome aire y cree burbujas en el detector.
    3. Haga clic en Abortar cuando la muestra sea baja y/o se hayan recogido suficientes animales.
    4. Haga clic en Configuración de la pantalla de la red de Almacenamiento de datos ? Sólo cerrado. Esto guardará los datos solo en función de las restricciones de tamaño. Haga clic en Almacenar bloqueado y guarde los datos bloqueados. Haga clic en Borrar para borrar datos.
    5. Enjuagar la colección 'taza' con agua desionizada y retirar con vacío. Repita 2x.
    6. Repita los pasos 6.2.1-6.2.5 con el resto de las muestras.
  3. Calibración/ Control de Calidad - si es necesario
    NOTA: Esto requiere un control de funcionamiento de partículas fluorescentes GYR de 42 m proporcionadas, para calibrar el láser 488.
    1. Presione el labio metálico en la parte superior de la taza de muestra para extraer el tubo de aire. Desenrosque la tapa y utilice una jeringa para extraer el líquido de la taza de muestra.
    2. Mezclar la botella de partículas de control mucho antes de su uso y añadir unos pocos mililitros en la taza de muestra. Cierre la tapa y vuelva a colocar el aire presionando hasta que encaje en su lugar.
    3. En el software, vaya a la opción Herramientas y haga clic en Ejecutar partículasde control .
    4. Para partículas de control, restablezca los valores de PMT a: VERDE - 325; AMARILLO - 365; ROJO - 575.
    5. Haga clic en Adquirir. La vaina debe encenderse seguida de una muestra. Una vez que las perlas comienzan a pasar a través de la celda de flujo, el caudal se verá en la parte inferior de la pantalla. De manera óptima, el caudal debe estar entre 5/s y 15/s. Si el caudal es demasiado bajo o cero, gire la válvula de muestra físicamente en el sentido de las agujas del reloj para aumentar el caudal. Si el caudal es demasiado alto, gire la válvula de muestra físicamente en sentido antihorario para disminuir el caudal.
      NOTA: Normalmente, en el modo de ahorro de cuentas, se leen 500 perlas antes de apagarlas. Los datos se pueden borrar y volver a leer los perlas.
    6. Una vez completada la lectura, compruebe si hay picos únicos limpios para los 5 parámetros, así como los valores CV. El Coeficiente de Variación (CV) debe ser <15%. Además, asegúrese de que los valores de CV para los tres canales fluorescentes diferentes estén cerca uno del otro.
    7. Haga un registro de la comprobación de control de calidad: en la pestaña Archivo, haga clic en Guardar como imagende pantalla .
  4. Limpieza y apagado
    1. Utilice una aspiradora para extraer la muestra de la taza de muestra y repetir la sección 4.1.4.
    2. Ponga 3-5 ml de agua desionizada en la colección 'cup' y haga clic en Acquire, let run for 30 s, y luego haga clic en Abort . Deje un poco de agua destilada en la taza de muestra.
    3. Vacíe la taza de recuperación de la muestra y la botella de residuos.
    4. Apague el software. En la pestaña Archivo, haga clic en Salir. En el menú emergente, haga clic en Desactivar sin purga .
    5. Apague el láser, apague el instrumento y, a continuación, apague el compresor de aire. Cierre la escotilla para cubrir el instrumento.

7. Ensayos fisiológicos para medir la sensibilidad al estrés en C. elegans

  1. Medición de la sensibilidad al estrés de ER mediante la exposición a la tunicamicina
    1. Preparar placas NGM RNAi DMSO manchadas con bacterias RNAi dirigidas al gen de interés como en la sección 3. Utilizar bacterias HT115 incluso en experimentos que no impliquen derribo de ARAi (ver Sección 1). Recuerde también sembrar las placas NGM RNAi TM (ver Tabla 1). Sembrar una cantidad suficiente de placas: planificar para los juegos de 5-7 de placas DMSO DE NGM RNAi y 2-3 juegos de placas NGM RNAi TM.
    2. Sincronizar animales de elección utilizando los métodos descritos en la sección 2.
    3. Huevos de placa en placas de sembrado NGM RNAi DMSO utilizando los criterios recomendados en la Tabla 2. Asegúrese de preparar 2 veces el número de placas necesarias, ya que la mitad de la muestra se transferirá a las placas NGM RNAi TM.
    4. Incubar huevos a 20oC durante aproximadamente 3-4 días (65-96 h) hasta el día 1 de la edad adulta.
    5. En el día 1, prepare la vida útil transfiriendo animales a placas separadas. Para conservar las placas (ya que los costos de TM son altos), utilice 8 placas de 15 animales por condición, para un total de 120 animales por condición. Esto permite un número manejable de animales por placa para la puntuación y permite una cantidad suficiente de animales para análisis estadísticos, incluso con cierta censura.
    6. Durante los primeros 5-7 días, aleje a los animales adultos de la progenie todos los días en una placa nueva hasta que la progenie ya no sea visible. Durante esta etapa, censurar a los animales que se embolsan, exhiben protuberancias/explosiones vulvales, o se arrastran por los lados de las placas, ya que no son muertes asociadas con la sensibilidad al estrés de Er. Tenga en cuenta que el tratamiento tm causa arresto en animales, y por lo tanto sólo 1-2 movimientos de estos animales cada 2-3 días es suficiente para minimizar los costos asociados con la producción de placas que contienen TM. Los animales de tipo salvaje tienen una supervivencia media de 15-17 días en DMSO y 12-14 días en tunicamcquina.
    7. Después de que los animales han dejado de producir progenie, puntúe la vida útil cada 1-2 días hasta que todos los animales sean marcados como muertos o censurados. Tm-tratamiento animales todos los días durante el día 6-14 de la edad adulta para una mayor resolución.
  2. Medición de la sensibilidad al estrés mitocondrial y oxidativo utilizando la exposición al paraquat
    1. Preparar placas manchadas con bacterias RNAi dirigidas al gen de interés como en la sección 3. Utilice la bacteria HT115 incluso en experimentos que no impliquen derribo de ARAi (ver Introducción).
    2. Sincronizar animales de elección utilizando los métodos descritos en la sección 2.
    3. Huevos de placa en placas de sembrado NGM RNAi de elección utilizando los criterios recomendados en la Tabla 1. El ensayo requiere 60-100 animales por condición, así que prepárate en consecuencia.
    4. Incubar huevos a 20oC durante aproximadamente 3-4 días (65-96 h) hasta el día 1 de la edad adulta.
    5. Preparar un vial fresco de 100 mM de paraquat en solución M9.
    6. Pipetear 50-75 l de M9+paraquat en tantos pozos de una placa de fondo plano de 96 pocillos como se desee. Por lo general, se recomienda tener pozos de 8 a 10 euros por condición que contengan 8-10 animales por pozo. Esto permite un número fácilmente visible de animales por pozo con 80 animales por cepa.
    7. Escoge de 8 a 10 animales por condición y transfiéralos a cada pocillo que contenga M9+paraquat. Utilice un pico para transferir animales a los pozos en lugar de pipetear para evitar diferencias de volumen y cambios no intencionales en las concentraciones de paraquat.
    8. Cada 2 h, puntuación para la muerte de animales en cada pozo. Toque suavemente las placas, lo que hará que los animales vivos golpeen o se doblen. Tenga en cuenta que es posible que los animales vivos a veces estén paralizados el tiempo suficiente para ser puntuados como muertos. Por lo tanto, si el número de animales vivos supera el número de animales vivos desde un punto de tiempo anterior, es probable que el animal estuviera vivo y deba ser desmarcado (por ejemplo, si a la hora 4, 2/10 animales son puntuados como muertos, y en la hora 6, sólo 1/10 animales están muertos, la hora 4 debe ser repuntuada como 1/10 animales muertos).
  3. Medición de la sensibilidad al calor mediante la exposición a temperaturas elevadas
    1. Preparar placas manchadas con bacterias RNAi dirigidas al gen de interés como en la sección 3. Utilizar bacterias HT115 incluso en experimentos que no impliquen derribo de ARAi (ver Sección 1).
    2. Sincronizar animales de elección utilizando los métodos descritos en la sección 2.
    3. Huevos de placa en placas de elección utilizando los criterios recomendados en la Tabla 1. Tener 60-100 animales por condición para ensayos de termotolerancia. Para los ensayos de termotolerancia, utilice ensayos de detención L1 o huevo para la mejor sincronización, ya que hay una gran variabilidad basada en la edad de los animales en el ensayo.
    4. Incubar animales a 20oC durante aproximadamente 3-4 días (65-96 h) para realizar experimentos en el día 1 de la edad adulta. No crezca gusanos a 15 oC para experimentos de choque térmico, ya que hay una diferencia menor entre los animales que experimentan choque térmico de 15 oC frente a 20 oC.
    5. En el día 1, prepare a los animales transfiriéndolos a placas separadas. Por lo general, se recomienda tener 10-15 animales por placa con 4-6 placas, para un total de 60 animales. Esto permite un número manejable de animales por placa para la puntuación y permite un tiempo mínimo para que los animales sean sacados de temperaturas elevadas.
    6. Colocar animales en una incubadora de 37 oC y puntuar cada 2 h. Empezar a puntuar para la termotolerancia a 37 oC a la hora 5, ya que poco o ninguna muerte ocurre antes de 5 horas. La mediana de la termotolerancia se logra a 9 horas, por lo que las horas 7, 9 y 11 son puntos de tiempo críticos, aunque debido a la variabilidad de incubadora y de laboratorio a laboratorio, esto puede necesitar ser valorado por laboratorio. Además, cualquier método para disminuir la variabilidad ayudará (por ejemplo, no apilar placas, colocar placas en la misma zona dentro de una sola incubadora, minimizando el tiempo que se abre o se cierra la incubadora, tomando tan pocas placas de la incubadora a la vez para minimizar el tiempo que los animales pasan fuera de 37 oC, etc. Para obtener una guía completa, consulte21).
    7. Como alternativa al paso 7.3.6, coloque los animales a 34 oC en lugar de 37 oC. La mediana de la termotolerancia a 34 oC está a poco más de 14 h, por lo que los puntos de tiempo 12, 14 y 16 son críticos para los ensayos de termotolerancia de 34 oC.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Uso de reporteros transcripcionales para medir la activación de las respuestas de estrés
Aquí, se utilizan reporteros transcripcionales fluorescentes, que sirven como herramientas robustas para medir la activación de la mayoría de las respuestas de estrés en C. elegans. La expresión gFP se impulsa bajo el promotor de objetivos canónicos de los reguladores transcripcionales maestros involucrados en la respuesta a las tensiones específicas del compartimiento. Una lista completa de reporteros transcripcionales de uso común está disponible en la Tabla 3.

La homeostasis de ER perturbadora a través de proteínas desplegadas o mal dobladas o el estrés bicapa lipídica hace que la activación de la respuesta proteica desplegada del ER (UPRER)restaure la calidad y la función de ER. El EPE de laUPR consta de 3 ramas distintas definidas por los sensores transmembranas: proteína 1 (IRE1), activación del factor de transcripción 6 (ATF6) y de quinasa ER (PERK), todas ellas conservadas en C. elegans7,22,23. La herramienta más común para monitorear la activación del EPUER en el nematodo, es la cepa de reportero transcripcional que expresa GFP bajo el control del promotor hsp-4 (hsp-4p::GFP)7. El gen hsp-4 codifica un ortologo de los mamíferos Hsp70, HSPA5 (o BiP/Grp78). En tiempos de estrés de ER cuando se activa el UPRER, la cepa de reportero hsp-4p::GFP expresa GFP. Este reportero tiene una expresión basal mínima en ausencia de estrés, pero exhibe una expresión GFP robusta cuando los animales están expuestos a la tunicamicina(Figura 1A). Estas diferencias también se pueden cuantificar utilizando un cytómetro de flujo de partículas grandes(Figura 1B). Por otra parte, la inducción de hsp-4p::GFP bajo tensión ER puede ser completamente suprimida por RNAi-knockdown de xbp-1, ya que la activación de este reportero transcriptorio depende del factor de transcripción, XBP-112.

Al igual queERel EPE, la mitocondria alberga su propio mecanismo de protección contra el estrés proteotóxico. Este mecanismo, llamado UPR mitocondrial (UPRMT)24, está regulado principalmente por el factor de transcripción, ATFS-1, que no entra en las mitocondrias bajo tensión debido a la disminución de la eficiencia de las importaciones, lo que resulta en la entrada de ATFS-1 en el núcleo25. Curiosamente, diferentes perturbaciones a los procesos mitocondriales pueden activar esta respuesta, incluyendo la agregación de proteínas, derribo de la cadena de transporte de electrones (ETC) complejos subunidades, estrés de replicación de ADN mitocondrial, y traducción de proteína mitocondrial8,26. La activación delTEM del EPU se ha supervisado mediante el uso de gusanos que expresan una construcción transgénica en la que la GFP se colocó bajo la regulación de los promotores de los genes de chaperona mitocondrial, hsp-6 y hsp-608. Similar a hsp-4p::GFP animales, hsp-6p::GFP animales exhiben una señal basal mínima en ausencia de estrés. El método más robusto para inducir el MT del EPUes a través de la reducción de LA RNA de las siguientes proteínas mitocondriales: cox-5B, la subunidad del citocromo c oxidasa Vb/COX4 (Complejo IV)20, nuo-4, la proteína NADH deshidrogenasa (Complejo I)27, o mrps-5, una proteína ribosomal mitocondrial28, activó el reportero hsp-6p::GFP. La expresión GFP a través de este reportero se activa de forma robusta y se puede visualizar y cuantificar fácilmente en estas condiciones(Figura 2A-B). El UPRMT también se puede activar a través de la inhibición química de la cadena de transporte de electrones (ETC), como con la antimicina A, que inhibe el citocromo c reductasa (complejo III). Al igual que el nARi-knockdown de los componentes etc, el tratamiento con antimicina A provoca una inducción robusta de hsp-6p::GFP (Figura 2C-D).

La capacidad de los organismos para detectar y responder al estrés oxidativo es un proceso conservado presente de bacterias a seres humanos29. En C. elegans,el homólogo NRF2, SKN-1, sirve como un importante factor de transcripción, que es sensible a los cambios de redox debido a las cisteínas reactivas en toda la proteína. SKN-1 sirve como uno de los activadores transcripcionales de la OxSR a través de la unión a la secuencia de consenso conservada altamente similar a los elementos de respuesta antioxidante enlazados por NRF230. En los seres humanos, NRF2 está regulada negativamente por KEAP1, que se cree que es sensible a los cambios de redox debido a las cisteínas reactivas a lo largo de la proteína31. Si bien no hay ortolog directo de KEAP1 en los gusanos, SKN-1 está regulado negativamente por la proteína WD-repeat, WDR-23, de una manera que es mecanicistamente distinta de la inhibición de KEAP1/NRF232. Sobre el estrés oxidativo, como el hidroperóxido de tert-butilo (TBHP), SKN-1 activa la desintoxicación y genes antioxidantes como gst-4,una glutatión S-Transferase. Para medir el estrés oxidativo, la expresión GFP se coloca bajo el promotor de gst-4,un glutatión S-transferasa33. A diferencia de los otros reguladores transcripcionales presentados aquí, gst-4p::GFP tiene alta expresión basal. Sin embargo, esta expresión todavía se puede activar de forma robusta en condiciones de estrés oxidativo, que se puede realizar tanto genética como químicamente. Para inducir genéticamente el estrés oxidativo, derribamos wdr-23, que codifica una proteína que desempeña un papel en la degradación proteasomal de SKN-134. wdr-23 knockdown resulta en la activación robusta de gst-4p::GFP. Además, el tratamiento de gusanos con el oxidante químico, TBHP, da como resultado una activación más leve, pero aún significativa, de gst-4p::GFP (Figura 3). La activación química y genética de gst-4p::GFP puede ser suprimida casi por completo por el derribo del ARNAi del skn-1,el gen que codifica el regulador transcripcional maestro del OxSR.

La mayoría de las proteínas celulares se traducen en el citoplasma y residen allí, aunque sólo sea temporalmente antes de ser dirigidas a otro lugar. Por lo tanto, el citoplasma alberga una amplia gama de chaperones que promueven el plegado y la función adecuada de proteínas, así como enzimas y proteínas responsables de degradar las proteínas dañadas, disfuncionales o en exceso. Para proteger este complejo paisaje proteico del citoplasma, la célula ha evolucionado varias vías de respuesta al estrés citoplasmático, incluyendo la respuesta de choque térmico (HSR)35,,36. El HSR es una vía dedicada a promover la homeostasis proteica en condiciones de estrés térmico y es modulada por el regulador transcripcional maestro, HSF-137. En condiciones de estado estacionario, HSF-1 está unido por chaperones citoplasma, HSP90 y HSP70/40, lo que lo mantiene bloqueado en un estado monomérico e inactivo. En condiciones de calor o estrés similar, un aumento de las proteínas mal plegadas da lugar a la valoración de los chaperones lejos de HSF-1, lo que le permite recortar y trasladar al núcleo para activar el HSR38,,39. Tal vez los objetivos posteriores más estudiados de HSF-1 bajo activación HSR son las proteínas de choque térmico (HSPSp), como HSP70, HSP90, DNAJ, y HSP6017,40. En C. elegans,los reporteros transcripcionales de HSR se han sintetizado impulsando la expresión de GFP bajo los promotores de HSPs canónicos, hsp-16.2 y hsp-709,41. Al igual que sus homólogos UPRMT y UPRER, hsp-16.2p::GFP y hsp-70p::GFP muestran una expresión basal mínima en ausencia de estrés. Sin embargo, ambos reporteros son fuertemente inducidos en condiciones de estrés térmico, que pueden visualizarse fácilmente mediante microscopía o cuantificarse utilizando un gran citómetro de flujo de partículas(Figura 4). Ambos reporteros tienen un gran rango dinámico, y la inducción depende completamente de hsf-1, ya que el nAi-knockdown de hsf-1 suprime completamente la inducción de hsp-16.2p::GFP y hsp-70p::GFP. Mientras que estos reporteros se pueden utilizar indistintamente para la mayoría de las situaciones, puede haber diferencias en los niveles de expresión y la expresión entre los tejidos.

Ensayos fisiológicos para medir la sensibilidad al estrés en C. elegans
Los c. elegans son un gran organismo modelo para medir la sensibilidad al estrés debido al bajo costo en mantenimiento y experimentación y la facilidad de edición del genoma o desmontaje genético utilizando RNAi, que proporciona la capacidad de realizar experimentos a gran escala en todo un organismo. Para probar la tolerancia al estrés al estrés de ER, exponemos C. elegans al agente químico, la tunicamicina, que provoca la acumulación de proteínas dañadas en el ER bloqueando la glicosilación Ligada a N10. Los animales están expuestos a la tunicamicina después del desarrollo, ya que la droga causa defectos de desarrollo. Cuando se exponen a la tunicamicina, los gusanos adultos presentan una marcada disminución de la vida útil. Además, el derribo del gen, xbp-1, que codifica uno de los principales factores de transcripción implicados en la inducción de EUPER, da lugar a un aumento significativo de la sensibilidad a la tunicamicina(Figura 5A)12. Por lo tanto, esto sirve como un ensayo robusto para medir la sensibilidad al estrés de ER en gusanos adultos.

Para medir el estrés oxidativo y el estrés mitocondrial, exponemos a los animales al agente químico, el paraquat. Paraquat causa estrés mitocondrial por síntesis de ROS dentro de la matriz mitocondrial, que luego se puede convertir en peróxido de hidrógeno y difuse fuera de las mitocondrias para causar daño oxidativo de células enteras13. Al igual que los ensayos de estrés de Er, exponemos a los animales a paraquat en la edad adulta. Sin embargo, realizamos ensayos de paraquat en líquido para reducir el costo y la mano de obra manual y los ensayos a base de placas de agar serían difíciles para la mayoría de los laboratorios. Aquí, mostramos que los animales expuestos al paraquat en líquido muestran una mediana de supervivencia de aproximadamente 5 horas(Figura 5B). Por otra parte, el derribo del receptor de insulina, daf-2, da lugar a una mayor resistencia al paraquat, ya que la activación de DAF-16/FOXO da lugar a una mayor expresión de implicado en el aclaramiento de ROS, como sod-342,43. Los ensayos de supervivencia de Paraquat son cortos, duran hasta 14 horas, y por lo tanto sirven como un método eficiente para interrogar las respuestas de estrés mitocondrial y oxidativo.

Finalmente, la supervivencia a temperaturas elevadas se utiliza para interrogar la respuesta fisiológica al estrés térmico. Estos ensayos se pueden realizar tanto en agar líquido o sólido, y existen numerosos protocolos diferentes descritos21. Se recomienda estandarizar un solo ensayo en el laboratorio para disminuir la variabilidad, que es excepcionalmente alta en este ensayo. La termotolerancia se debe realizar en el día 1 de los animales adultos en placas de agar estándar, ya sea a 34 oC o a 37 oC. A 37 oC, la mayoría de la muerte se produce entre 7-11 horas, lo que lo convierte en un simple ensayo de un solo día, mientras que los experimentos de 12-16 horas a 34 oC se realizan más fácilmente durante la noche(Figura 5C-E). La mutación en el gen, ttx-3, resulta en el fracaso de la especificación de las interneuronas AIY responsables del circuito neural termosensorial, y causa un aumento significativo en la termosensibilidad44. Si bien los datos de termotolerancia se pueden trazar como una curva de supervivencia(Figura 5C),estos ensayos deben realizarse al menos 4-6 veces y todas las réplicas deben trazarse entre sí(Figura 5D-E),ya que la termotolerancia muestra una variabilidad increíblemente alta en comparación con otros ensayos de tensión. Esto se debe a las muchas advertencias que existen en la creación de estos experimentos, incluyendo la variabilidad en cepas de interés, ciclo desigual de aire en incubadoras, placas de agar desiguales, etc.21. A 34 oC, la mediana de supervivencia se produce aproximadamente a las 14 horas, y similar a los 37 oC, los mutantes ttx-3 presentan una disminución de la supervivencia a 34 oC(Figura 5E).

Figure 1
Figura 1: Uso de hsp-4p::GFP como reportero para la inducción de UPRER. (A) Micrografías fluorescentes representativas de hsp-4p::GFP que expresan animales cultivados con vector vacío de control (EV) o xbp-1 RNAi. Los animales fueron cultivados en RNAi desde la eclosión hasta la L4 a 20oC, luego tratados con 25 ng/L de tunicamicina o 1% de DMSO flotando en M9 a 20oC durante 4 horas, y recuperados en una placa OP50 durante 16 horas a 20oC antes de la toma de imágenes. Los animales fueron paralizados en ázida sódica de 100 m en una placa de agar NGM y se crearon imágenes con un estereomicroscopio. (B) Análisis cuantitativo de (A) utilizando un gran biosorter de partículas. Los datos se representan como intensidad de fluorescencia integrada en todo el animal, donde cada punto representa un solo animal; El control de DMSO es en gris y los animales tratados con tunicamicina están en rojo. La línea central representa la mediana y los bigotes representan el rango intercuartil. n 123-291 animales por cepa. p < 0.001 utilizando pruebas no paramétricas de Mann-Whitney. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2: Uso de hsp-6p::GFP MT como reportero para la inducción de MT UPR. (A) Micrografías fluorescentes representativas de hsp-6p::GFP que expresan animales cultivados con vector vacío de control (EV), cco-1, mrps-5o nuo-4 RNAi. Los animales fueron cultivados en el ARNI desde la eclosión y se les imageó el día 1 de la edad adulta a 20oC. Los animales fueron paralizados en ázida sódica de 100 m en una placa de agar NGM e imágenes utilizando un microscopio compuesto. (B) Análisis cuantitativo de (A) utilizando un gran biosorter de partículas. Los datos se representan como intensidad de fluorescencia integrada en todo el animal, donde cada punto representa un solo animal; El control ev está en animales grises tratados con ARI están en rojo. La línea central representa la mediana y los bigotes representan el rango intercuartil. n 303-384 animales por cepa. p < 0.001 en comparación con el control EV utilizando pruebas no paramétricas de Mann-Whitney. (C) Imágenes representativas de hsp-6p::GFP animales tratados con DMSO o antimicina A. Los animales fueron cultivados a partir de la eclosión en placas DMSO 0.2% y transferidos a placas que contienen 0.2% DMSO o 3 mM de antimicina A durante 16 horas antes de la toma de imágenes en un microscopio compuesto Revolve ECHO R4. Todo el crecimiento se realizó a 20oC. (D) Análisis cuantitativo de (C) utilizando un bioorter de partículas grande similar a (B). Los controles DMSO están en gran parte, y los animales tratados con antimicina A están en rojo. n a 495 para DMSO y 219 para Antimicina A. ***p < 0.001 en comparación con el control EV utilizando pruebas no paramétricas de Mann-Whitney. Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3: Uso de gst-4p::GFP como reportero para el OxSR. (A) Micrografías fluorescentes representativas de gst-4p::GFP que expresan animales cultivados con vector vacío de control (EV), skn-1o wdr-23 RNAi. Los animales fueron cultivados en RNAi desde la eclosión hasta la etapa L4 a 20 oC. Los animales fueron cultivados en RNAi desde la eclosión hasta la L4 a 20 oC, luego tratados con 2 mM de TBHP en M9 o sólo M9 para un control "sin tratar" a 20 oC durante 4 horas, y recuperados en una placa de EV durante 16 horas a 20 oC antes de la toma de imágenes. Los animales fueron paralizados en ázida sódica de 100 m en una placa de agar NGM e imágenes utilizando un microscopio compuesto. (B) Análisis cuantitativo de (A) utilizando un gran biosorter de partículas. Los datos se representan como intensidad de fluorescencia integrada en todo el animal, donde cada punto representa un solo animal; el control no tratado es en gris y los animales tratados con TBHP están en rojo. La línea central representa la mediana y los bigotes representan el rango intercuartil. n 101-204 animales por cepa. p < 0.001 en comparación con el control EV respectivo utilizando pruebas no paramétricas de Mann-Whitney. Haga clic aquí para ver una versión más grande de esta figura.

Figure 4
Figura 4: Uso de hsp16.2p::GFP y hsp-70p::GFP como reporteros para la respuesta de choque térmico. (A) Micrografías fluorescentes representativas de hsp16.2p::GFP que expresan animales cultivados con vector vacío de control (EV) o hsf-1 RNAi. Los animales fueron cultivados en EL ARNi desde la eclosión a 20oC hasta el día 1. Los animales del día 1 fueron dejados a 20oC (sin tratar) o expuestos a 2 horas de estrés térmico a 34oC, y luego recuperados durante 2 horas a 20oC. Los animales fueron paralizados en ázida sódica de 100 m en una placa de agar NGM y se crearon imágenes con un estereomicroscopio. (B) Análisis cuantitativo de (A) utilizando un gran biosorter de partículas. Los datos se representan como intensidad de fluorescencia integrada en todo el animal, donde cada punto representa un solo animal; control sin tratar es en gris y los animales con calor están en rojo. La línea central representa la mediana y los bigotes representan el rango intercuartil. n 320-364 animales por cepa. p < 0.001 utilizando pruebas no paramétricas de Mann-Whitney. (C) Micrografías fluorescentes representativas de hsp-70p::GFP que expresan los animales cultivados en EV de control y hsf-1 RNAi y tratados como se describe en (A). (D) Análisis cuantitativo de (C) como se describe en (B). n 773-941 animales por cepa. Haga clic aquí para ver una versión más grande de esta figura.

Figure 5
Figura 5: Ensayos fisiológicos de supervivencia bajo estrés en C. elegans. (A) Duración de los nematodos cultivados en 1% DMSO que contienen placas de 25 ng/L de tunicamicina (TM). Los animales fueron cultivados en placas DMSO al 1% desde la escotilla hasta el día 1, y transferidos a las placas TM respectivas en el día 1. Los animales se mantuvieron en el control del vector vacío (EV) o del ARN xbp-1 desde la escotilla hasta el final del ensayo a 20 oC. Los animales adultos se alejan manualmente de la progenie todos los días hasta el día 7-8, cuando la progenie ya no se detectó, y luego se anotan cada 2 días hasta que todos los animales fueron registrados como muertos o censurados. Los animales con embolsado, protuberancias/explosiones vulval, o aquellos que se arrastraban por los lados de las placas eran considerados censurados. (B) Curva de supervivencia de nematodos en paraquat de 100 mM (PQ) disueltos en solución M9. Los animales fueron cultivados en EV o daf-2 RNAi desde la eclosión hasta el día 1 de la edad adulta a 20oC. Los animales fueron colocados en 50 l de solución de M9 + PQ en una placa de 96 pozos a 20 oC y visualizados cada 2 horas hasta que todos los animales estaban inmóviles. (C) Curva de supervivencia de los nematodos a 37oC. Los animales de tipo salvaje (N2), ttx-3(KS5)y sur-5p::hsf-1 fueron cultivados en placas EV desde la escotilla hasta el día 1 a 20oC. En el día 1, los animales fueron trasladados a 37oC y anotados cada 2 horas hasta que todos los animales fueron marcados como muertos o censurados. (D) Datos agrupados de todos los ensayos de termotolerancia realizados a 37oC. Los datos se representan como porcentaje vivo a la hora 9 de un ensayo de termotolerancia, con cada línea representando un experimento coincidente realizado el mismo día. (E) Datos agrupados de todos los ensayos de termotolerancia realizados a 34oC. Los datos se representan como porcentaje vivo a la hora 14 de un ensayo de termotolerancia, con cada línea representando un experimento coincidente realizado el mismo día. Todas las estadísticas de A-C se realizaron mediante pruebas Log-Rank (Mantel-Cox) y se pueden encontrar en la Tabla 5. Haga clic aquí para ver una versión más grande de esta figura.

Reactivo Receta
Caldo de lysógenia (LB) En este protocolo, se utilizó LB comercial (ver Materiales), pero todas las recetas caseras estándar LB usando Bacto-triptolona, extracto de levadura y NaCl son suficientes.
Medios de crecimiento de nematodos (NGM) 1 mM CaCl2, 5 g/mL colesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (p/v) agar, 0,25% (p/v) Bacto-Peptone, 51,3 mM NaCl
Solución de lejía 1,8% (v/v) hipoclorito sódico, 0,375 M KOH
Solución M9 22 mM KH2PO4 monobásico, 42,3 mM Na2HPO4, 85,6 mM NaCl, 1 mM MgSO4
Placas NGM RNAi 1 mM De CaCl2, 5 g/mL de colesterol, 25 mM KPO4 pH 6,0, 1 mM MgSO4, 2% (p/v) agar, 0,25% (p/v) Bacto-Peptona, 51,3 mM de NaCl, 1 mM IPTG, 100 g/mLenicilina/ampicilina. Conservar a 4oC en la oscuridad durante un máximo de 3 meses
Tetraciclina 10 mg/ml de solución en stock (500x) en etanol 100%. Conservar a -20 oC
Carbenicilina 100 mg/ml de solución en stock (1000x) en agua. Conservar a 4 oC durante un máximo de 6 meses o -20 oC para un almacenamiento a largo plazo
Azida sódica 1 M de stock (6,5%) solución de azida sódica en agua. Conservar en la oscuridad a 4oC. Esta es una solución de 10x y se diluye a un stock de trabajo de 100 mM para la mayoría de los experimentos de imagen
Tunicamicina 2,5 mg/ml de solución en stock en 100% DMSO. Conservar a -80 oC para un almacenamiento a largo plazo. Se trata de una solución de 100x (solución de trabajo de 25 ng/L)
Antimicina A 15 mM antimicina Solución de stock en 100% DMSO. Conservar a -20oC. Se trata de una solución de 5000x (3 M de stock de trabajo)
Paraquat Solución de 50 M en agua – debe prepararse fresca
Hidroperóxido de tert-butilo (TBHP) 7.7 M solución en agua. Esta es una solución 3850x (2 mM de trabajo)
NGM RNAi + DMSO0.2 1 mM CaCl2, 5 g/mL colesterol, 25 mM KPO4 pH 6.0, 1 mM MgSO4, 2% (p/v) agar, 0,25% (p/v) Bacto-Peptona, 51,3 mM NaCl, 1 mM IPTG, 100 g/mLenicillin/ampicillin, 0,2% DMSO
(control para antimicina A)
NGM RNAi + antimicina A 1 mM CaCl2, Colesterol de 5 g/ml, 25 mM KPO4 pH 6,0, 1 mM MgSO4, agar 2% (p/v), 0,25% (p/v) Bacto-Peptone, 51,3 mM NaCl, 1 mM IPTG, 100 g/ml de carbenicilina/ampicilina, 0,2% DMSO, 3 mM
NGM RNAi DMSO 1 mM De CaCl2, 5 g/mL de colesterol, 25 mM KPO4 pH 6,0, 1 mM MgSO4, 2% (p/v) agar, 0,25% (p/v) Bacto-Peptona, 51,3 mM de NaCl, 1 mM IPTG, 100 g/mLenicilina/ampicilina; 1% DMSO
(control de tunicamicina)
NGM RNAi TM 1 mM De CaCl2, 5 g/mL de colesterol, 25 mM KPO4 pH 6,0, 1 mM MgSO4, 2% (p/v) agar, 0,25% (p/v) Bacto-Peptona, 51,3 mM de NaCl, 1 mM IPTG, 100 g/mLenicilina/ampicilina; 1% DMSO, 25 ng/L de tunicamicina
IPTG Solución de 1 M en agua.

Tabla 1: Recetas recomendadas para los reactivos utilizados. Todas las recetas exactas de los reactivos utilizados en este protocolo se describen aquí. Las empresas específicas en las que se compraron reactivos también están disponibles en la Tabla de Materiales. Se probaron muchas fuentes diferentes de productos químicos, y las enumeradas en la Tabla de Materiales son las que mostraron los resultados más robustos y reproducibles.

Tamaño de la placa Tipo de bacteria • de animales para llegar al día 1 de la edad adulta • de animales para llegar a la etapa L4
60 mm OP50 100-150 150-300
60 mm HT115 70-100 120-200
100 mm OP50 600-1000 1500-2000
100 mm HT115 350-600 700-1300

Tabla 2: Número recomendado de animales para la post-sincronización de placas para evitar el hambre. Para evitar el hambre, recomendamos enchapar un número específico de animales por condición. Dado que OP50 crece más denso que HT115, se pueden chapar más animales. Todos los números enumerados aquí son las pautas utilizadas en nuestro laboratorio, y los números pueden ser ligeramente diferentes debido a varias variables y diferencias entre las condiciones de laboratorio. Por lo tanto, o los números recomendados están en la parte inferior en negrita. Los números máximos son los que podrían ser chapados en condiciones óptimas en nuestro laboratorio sin llegar a la inanición, pero no se recomienda utilizar estos valores sin antes valorar sus condiciones. Todos los números se determinan con la suposición de que las bacterias se sembran en las placas y se les permite crecer durante 24 horas a temperatura ambiente (22 oC) en las placas antes de que los gusanos se coloquen en ellas. Aunque no hay ninguna diferencia importante en las tasas de inanición al enchapar huevos o L1s, recomendamos que se lijen un 10 % de números más altos al enchapar los huevos, ya que no todos los huevos eclosionan después del blanqueo.

Nombre de la cepa Transgén Propósito Aplicación(s) recomendada(s) de estrés Fuente
SJ4005 hsp-4p::GFP UPRER 25 g/ml de tunicamicina Cgc
SJ4100 hsp-6p::GFP UPRMT 3 -M antimicina A; Cgc
ARN contra ETC o ribosoma mitocondrial
SJ4058 hsp-60p::GFP UPRMT 3 -M antimicina A; Cgc
ARN contra ETC o ribosoma mitocondrial
CL2070 hsp-16.2p::GFP respuesta de choque de calor 34 oC 2 horas Cgc
AM446 hsp-70p::GFP respuesta de choque de calor 34 oC 2 horas Laboratorio Morimoto
CL2166 gst-4p::GFP OxsR 50 mM paraquat; Cgc
2 mM de hidroperóxido de tert-butilo
CF1553 sod-3p::GFP Señalización de OxSR e insulina ARN contra daf-2 (receptor de insulina) Cgc
AU78 T24B8.5p::GFP respuesta inmune innata exposición a patógenos (p. ej. P. aeruginosa) Cgc

Tabla 3: Reporteros transcripcionales para evaluar la activación de las respuestas de estrés celular. Todas las cepas enumeradas aquí están disponibles a través de CGC o a través de solicitudes especiales a laboratorios para su uso en métodos de imagen cualitativos y cuantitativos descritos en este manuscrito. Estas cepas se derivan del fondo Bristol N2. También se proporcionan métodos recomendados para aplicar el estrés para activar a los reporteros. Todos los periodistas, con la excepción de sod-3p::GFP45 y T24B8.5p::GFP46 se describen en el texto.

Transgén Aplicación(s) recomendada(s) de estrés Tiempo de exposición con un microscopio estéreo Leica M2250FA Tiempo de exposición con un microscopio Revolve ECHO Valores PMT mediante un biosorter Union Biometrica COPAS
hsp-4p::GFP 25 g/ml de tunicamicina (4 horas con recuperación durante la noche) 200 ms 275 ms 450
hsp-6p::GFP 3 antimicina S (16 horas) de antimicina A (16 horas); 100ms 50 ms 350
ARN contra ETC o ribosoma mitocondrial (de la escotilla)
hsp-60p::GFP 3 antimicina S (16 horas) de antimicina A (16 horas); 200 ms 100 ms 450
ARN contra ETC o ribosoma mitocondrial (de la escotilla)
hsp-16.2p::GFP 34 oC 2 horas 400 ms 200 ms 500
hsp-70p::GFP 34 oC 2 horas 400 ms 300 ms 500
gst-4p::GFP 50 mM de paraquat (2 horas); 100 ms 50 ms 350
2 mM de hidroperóxido de tert-butilo (4 horas con recuperación durante la noche)
sod-3p::GFP ARN contra daf-2 (receptor de insulina) 300 ms 300 ms 475
T24B8.5p::GFP exposición a patógenos (p. ej. P. aeruginosa) 100 ms 50 ms 350

Tabla 4: Ajustes recomendados para microscopía fluorescente y cuantificación utilizando un gran biosorter de partículas. Esta tabla sirve como guía para los tiempos de exposición recomendados para la microscopía fluorescente o los valores de PMT para el biosorter de partículas grandes. Estos servirán como buenos puntos de partida, pero el tiempo de exposición y el valor de PMT deben ajustarse para cada experimento para asegurarse de que no se produce saturación y que los valores fluorescentes están por encima del límite de detección de la señal de fondo. Si se conoce la muestra con la señal más brillante para un experimento (por ejemplo, controles positivos para la inducción de tensión), esas muestras se pueden utilizar para determinar el tiempo de exposición más alto o LA PMT que se puede utilizar sin saturación de la señal. Si no se conocen las muestras más brillantes, se puede utilizar el control y se puede utilizar un tiempo de exposición o PMT en el centro del rango dinámico de su sistema.

Figura correspondiente Tensión, Tratamiento Mediana de vida útil • Muertes / Total % de cambio en la mediana de la vida útil valor p (Log-Rank; Mantel-Cox)
5a N2, vector RNAi, 1% DMSO 22 días 95/120 -- --
N2, xbp-1 RNAi, 1% DMSO 14 días 92/120 -36.4 < 0.001
N2, vector RNAi, 25 ng/L TM 14 días 97/120 -36.4 < 0.001
N2, xbp-1 RNAi, 25 ng/L TM 12 días 98/120 -45.4 < 0.001
5B N2, vector RNAi, 100 mM PQ 5 horas 73/73 -- --
N2, daf-2 RNAi, PQ de 100 mM 6,5 horas 74/74 30 < 0.001
5C N2, vector RNAi, 37 oC 8 horas 59/60 -- --
ttx-3(KS5), vector RNAi, 37 oC 7 horas 60/60 -12.5 0.002
sur-5p::hsf-1, vector RNAi, 37 oC 9 horas 59/60 12.5 0.012

Tabla 5: Estadísticas de la vida útil y los ensayos de supervivencia por estrés. Todos los tamaños de muestra, estadísticas y tasas de censura para la Figura 5 están disponibles aquí.

Respuesta al estrés Gene objetivo Primer delantero Primer inverso
UPRER hsp-3 TCGCTGGATTGAACGTTGTTCG GTTGCGTTCTCCCCCCTTCTTG
UPRER hsp-4 GAACAACCTACTCGTGCGTTGG GAACAACCTACTCGTGCGTTGG
UPRER sel-11 TTGATCTCCGGAAAACGCAACG TTGATCTCCGGAAAACGCAACG
UPRER ire-1 TCCTCAACCGCTCCATCAACAT TCCTCAACCGCTCCATCAACAT
UPRER xbp-1 GGACTTCTTCGGCTCTGGGGAGT GGACTTCTTCGGCTCTGGGGAGT
UPRER xbp-1 (empalmado) GGTGGATGGAGGGAGAAGATT GGTGGATGGAGGGAGAAGATT
UPRER crt-1 GAAGTAATAGCCGAGGGAAGC GAAGTAATAGCCGAGGGAAGC
UPRER T14G8.3 CACCTCCATCAACAAAACataCAT CACCTCCATCAACAAAACataCAT
Hsr hsp-17 TCGTTTTCCACCATTCTCCCCA TGTTTGATCGGCCCAGTATGGT
Hsr hsp-70 TGTTTGATCGGCCCAGTATGGT TTCGCAATGAGAAGGGACGACT
Hsr F44E5.4 TTCGCAATGAGAAGGGACGACT CGTTGTGCTGCCTCTCTCtTTTT
Hsr hsp-16.2 TCCATCTGAGTCTTCTGAGATT
GTTA
TGGTTTAAACTGTGAGACGTTGA
Hsr hsf-1 TTTTGCATTTTCTCCTCTCTGTC TCTATTTCCAGCACACCTCGT
UPRMT hsp-6 GAGATCGTGGAACCGGAAAGGA CGGCATTCTTTTCGGCTTCCTTT
UPRMT hsp-60 CGGCATTCTTTTCGGCTTCCTTT CGTCGTTGCAGAGCTCAAGAAG
UPRMT ymel-1 CAAAAACCTGATCTCGCTGGG TTCTCAATGTCGGCCAGT
UPRMT clpp-1 TGATAAGTGCACCAGTCCA TGATTCTGGAGTTCGGGAGA
UPRMT lonp-1 CGATGATGGCCATTGTGCAG CGCTTTGAAACATCAATTTCAT
Cca
OxsR gst-4 GATGCTCGTGCCTTGCTGCTG CCGAATTGTTCTCCATCGAC
OxsR gst-6 CCGAATTGTTCTCCATCGAC TTTGGCAGTTGTTGAGGAG
OxsR gst-7 TTTGGCAGTTGTTGAGGAG TGGGTAATCTGGACGGTTTG
OxsR gcs-1 TGGGTAATCTGGACGGTTTG ATGTTTGCCTCGACAATGTT
OxsR skn-1 GGACAACAGAATCCCAAAGG TCAGGACGTCAACAGCAGAC
OxsR sod-3 GTAACGGGCGATAGCATGAG GCGAGAGCACATTGATGAC
OxsR ptps-1 AATCGATTCCTTTGGAGACC CAATCTCTCTTCGCCTGCGCTT
CAAAGC
Referencia pmp-3 TGGCCGGATGATGGTGTCGC ACGAACAATGCCAAAAGCCAGC
Referencia Y45F10.4 CGAGAACCCGCGAAATGTCGGA CGGTTGCCAGGGAAGATGAGGC
Referencia sap-49 TGGCGGATCGTCGTGCTTCC ACGAGTCTCCTCGTGTCCCA
Referencia tba-1 TCAACACTGCCATCGCCCCCC TCCAAGCGAGACCAGGCTTCAG

Tabla 6: Objetivos genéticos recomendados y pares de imprimación para medir la regulación ascendente transcripcional de genes de respuesta al estrés.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Aquí, se describen métodos para interrogar las respuestas de estrés celular en C. elegans,utilizando reporteros transcripcionales fluorescentes y ensayos fisiológicos de supervivencia por estrés. Todos los reporteros utilizan la expresión GFP impulsada bajo el promotor de un objetivo transcripcional descendente de los factores de transcripción involucrados en el montaje de las respuestas de estrés celular. El uso de hsp-4p::GFP modulado por XBP-1s-mediada UPRER, hsp-6p::GFP controlado por ATFS-1-mediado UPRMT, gst-4p::GFP bajo SKN-1 mediado OxSR, y hsp16.2p::GFP y hsp-70p::GFP bajo la respuesta de choque de calor mediada por HSF-1. Otros reporteros transcripcionales estandarizados se pueden encontrar en la Tabla 3. Todos los reporteros transcripcionales presentados aquí tienen un amplio rango dinámico y pueden activarse sólidamente aplicando el estrés ya sea a través de perturbaciones genéticas o la exposición a productos químicos que inducen el estrés. Además, todos estos reporteros pueden ser suprimidos por derribo de los factores de transcripción aguas arriba de los promotores empleados. Finalmente, cada reportero transcripcional está emparejado con un ensayo específico de supervivencia al estrés fisiológico para proporcionar una lectura fisiológica del impacto de activar o reprimir una respuesta de estrés específica.

Para emplear con éxito el uso de reporteros transcripcionales, es esencial determinar el rango dinámico de cada reportero. Debido a la gran variabilidad de laboratorio a laboratorio causada por diferencias en medios, agar, ambiente ambiente, etc., se recomienda valorar cada paradigma de inducción de drogas o estrés para las concentraciones y el momento utilizando nuestras recomendaciones como referencia. A continuación, es fundamental asegurarse de que los animales estén sanos y estén correctamente sincronizados. Los animales que han experimentado algún tipo de estrés (por ejemplo, hambre, exposición a largo plazo a la luz, exposición a temperaturas elevadas, etc.) deben recuperarse durante varias generaciones antes de la experimentación. La sincronización adecuada se puede lograr mediante el uso de los métodos descritos en la sección 2, que es esencial ya que varias respuestas de tensión tienen diferentes niveles de activación durante el proceso de envejecimiento. Por último, los protocolos de creación de imágenes son esenciales para estandarizar, ya que hay varias cosas que pueden afectar a la calidad de la imagen y los datos. Por ejemplo, la duración de los animales en azida sódica debe minimizarse, ya que esto causa estrés a los animales y puede afectar la señal del reportero. Además, las especificaciones del microscopio y del biosorter deben ajustarse correctamente para maximizar la relación señal-ruido y el rango dinámico, sin causar saturación. Los píxeles saturados pueden causar problemas importantes en el análisis cuantitativo de muestras, ya que la señal fluorescente máxima se puede subestimar gravemente.

Si bien los reporteros transcripcionales descritos aquí proporcionan un medio robusto y eficiente para medir la activación de las respuestas de estrés, es fundamental entender que es una única diana genética de un factor de transcripción conocido. Por lo tanto, si bien sirve como un método fiable para pantallas a gran escala o pruebas de primera pasada de cepas de interés, se deben realizar validaciones adecuadas. Recomendamos realizar qPCR para medir varios genes diana canónicos activados tras la inducción de cada respuesta de tensión que se está ensayando. En la Tabla 6se puede encontrar una lista de las dianas genéticas sugeridas. Además, el perfildeo de transcriptoma a través de ARN-seq es otra alternativa para una mirada más amplia a los efectos en múltiples objetivos transcripcionales a la vez. Cabe destacar que la toma de imágenes de los reporteros fluorescentes proporciona información espacial sobre los tejidos que se ven afectados por las perturbaciones. Dicha información no puede obtenerse de qRT-PCR o RNA-seq, ya que utiliza extractos de gusano entero, excepto por scRNA-seq, FISH y protocolos de ARN específicos de tejido47. Por último, estos reporteros de estrés se caracterizan generalmente por ser específicos de su maquinaria de respuesta al estrés. Sin embargo, es importante recordar que no todos los paradigmas de respuesta al estrés son únicos y distintos. Por ejemplo, la tensión ER puede activar OxSR y viceversa48,y las superposiciones entre la respuesta de choque térmico y las respuestas de tensión de ER se han encontrado comúnmente49. Estos son sólo algunos de los muchos ejemplos en la literatura de la comunicación cruzada y la superposición entre las respuestas de estrés, y por lo tanto es importante entender que todos los ensayos también deben ser probados para la especificidad para obtener conclusiones finales.

Otra limitación de los métodos descritos es que la creación de imágenes y la cuantificación a través de un biosorter tiene un rendimiento limitado. Si bien la cuantificación del biosorter se puede realizar en placas de 96 pocillos para un mayor rendimiento, sigue estando limitada por la necesidad de transferir gusanos a la solución, mientras que la capacidad del investigador para preparar gusanos y realizar microscopía. Por lo tanto, lo más probable es que las pantallas a gran escala impliquen sólo una proyección visual de la señal fluorescente del reportero, con sólo los golpes que se están imagenndo y cuantificando.

Una advertencia importante con el uso de estos reporteros fluorescentes es que la activación o supresión de las respuestas de estrés no siempre contribuyen a fenotipos fisiológicamente significativos, o pueden reflejar otros efectos globales (por ejemplo, disminución de la síntesis de proteínas). Por lo tanto, cada reportero transcripcional está emparejado con un método para probar la supervivencia por estrés. Se recomienda realizar ensayos de supervivencia de tunicamicina para elERE,ensayos de supervivencia de paraquat para la UPRMT y el OxSR, y supervivencia en temperaturas elevadas para la respuesta de choque térmico. Si bien estos son generalmente ensayos robustos, rápidos y simples, requieren un trabajo manual intensivo y, por lo tanto, están severamente limitados en escalabilidad. Además, casi todos los ensayos de termotolerancia publicados hasta la fecha tienen una gran variabilidad, haciendo que un gran número de réplicas sean casi esenciales21. Si bien los ensayos de supervivencia de tunicamicina y paraquat no sufren esta falta de reproducibilidad, tienen sus propios desafíos, incluyendo un amplio trabajo práctico y la duración del protocolo. A medida que las nuevas tecnologías nacen en la automatización de la vida útil y los ensayos de supervivencia, es probable que estos ensayos de supervivencia por estrés también puedan llegar a ser de alto rendimiento50. Sin embargo, hasta que estos ensayos automatizados se conviertan en estándar, los ensayos de supervivencia se limitan actualmente a la validación de las consecuencias fisiológicas al alterar la dinámica de la actividad de respuesta al estrés.

Más allá de los ensayos de supervivencia por estrés descritos aquí, hay una serie de otros métodos para medir la fisiología en animales. Por ejemplo, un analizador Seahorse XFp disponible comercialmente puede permitir la monitorización de la respiración celular, lo que proporciona una visión mecanicista adicional51. Otra alternativa a los reporteros transcripcionales es el uso de la localización nuclear de factores de transcripción etiquetados fluorescentemente. Hay numerosas variantes de esta técnica, pero de particular interés para los métodos descritos aquí incluyen: HSF-1::GFP para la respuesta de choque térmico52, DVE-1::GFP para el UPRMT53, y DAF-16::GFP y SKN-1::GFP para el OxSR54,55. Por último, se puede realizar un interrogatorio directo de morfología de orgánulos específicos de interés. Por ejemplo, la morfología mitocondrial se puede visualizar utilizando un fluoróforo dirigido a la matriz mitocondrial utilizando una secuencia de localización mitocondrial56. La morfología de ER se puede visualizar utilizando un fluoróforo dirigido al ER a través de una secuencia de señal fusionada al N-terminus y HDEL fusionado al C-terminus57 o GFP fusionado a una proteína de membrana ER58. Finalmente, la integridad citoesquelética de actina se puede utilizar como proxy para la sensibilidad a la tensión térmica aguas abajo de HSF-1. El citoesqueleto de actina está regulado por objetivos transcripcionales de HSF-1, específicamente durante el envejecimiento y el estrés térmico, y por lo tanto la organización actina se puede visualizar para determinar la lectura funcional de HSF-1 y el estrés relacionado con el calor59,60.

Todos los métodos descritos aquí se pueden utilizar de forma independiente o en combinación entre sí para un análisis exhaustivo de genes o fármacos de interés y su impacto en la respuesta al estrés. Las pantallas a gran escala se pueden realizar utilizando ensayos de reporteros transcripcionales de alto rendimiento, y las pantallas secundarias se pueden realizar utilizando análisis cuantitativos de estos reporteros. Una vez que se identifican más listas de genes/drogas candidatas manejables, se pueden realizar ensayos fisiológicos para identificar a aquellos candidatos que tienen un impacto directo en la fisiología animal entera. Los otros métodos sugeridos anteriormente también se pueden utilizar como validación o investigación adicional.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

R.BZ. cuenta con el apoyo de la beca a largo plazo embo y la Fundación Larry L. Hillblom. R.H.S cuenta con el apoyo de la concesión 5F32AG032023-02 a través del Instituto Nacional de Envejecimiento (NIA) y la Beca Postdoctoral Glenn Foundation for Medical Research. A.F. es apoyado por la concesión F32AG051355 a través de la NIA. H.K.G. cuenta con el apoyo de la beca DGE1752814 a través del Programa de Becas de Investigación de Posgrado de la Fundación Nacional de Ciencias. M.G.M. es compatible con 1F31AG060660-01 a través de NIA. A.D. cuenta con el apoyo de la Fundación Thomas y Stacey Siebel, el Instituto Médico Howard Hughes y 4R01AG042679-04 y 5R01AG055891-02 de NIA, y 5R01ES021667-09 de NIEHS. Agradecemos a Larry Joe, Melissa Sanchez, Naame Kelet y Anel Esquivel por su importante asistencia técnica. Agradecemos al laboratorio de Morimoto y al CGC (financiado por el Programa p40 OD010440 de la Oficina de Infraestructura de Investigación de los NIH) por las cepas.

Materials

Name Company Catalog Number Comments
Antimycin A Sigma-Aldrich A8674 for mitochondrial stress
Bacto Peptone Fisher Scientific DF0118072 for NGM plates
BD Difco granulated agar VWR 90000-782 for NGM plates
Calcium chloride dihydrate VWR 97061-904 for NGM plates
Carbenicillin BioPioneer C0051-25 for RNAi
Cholesterol Sigma-Aldrich 57-88-5 for NGM plates
COPAS Biosorter Union Biometrica 350-5000-000 equipped with a 488 nm light source.
COPAS Cleaning Solution Union Biometrica 300-5072-000 to use with COPAS
COPAS Sheath Solution Union Biometrica 300-5070-100 to use with COPAS
DMSO Sigma-Aldrich 472301 solvent for drugs
IPTG dioxane free Denville Scientific CI8280-4 for RNAi
LB Broth Miller Fisher Scientific BP1426500 for LB
M205FA stereoscope Leica 10450040 equipped with a Leica DFC3000G monochromatic CCD camera, standard Leica GFP filter (ex 395-455, EM 480 LP), and LAS X software
Magnesium sulfate heptahydrate VWR EM-MX0070-3 for NGM plates, M9
Paraquat Sigma-Aldrich 36541 for oxidative/mitochondrial stress
Potassium Chloride Fisher P217-500 for bleach soluton
Potassium phosphate dibasic VWR EM-PX1570-2 for NGM plates
Potassium phosphate monobasic VWR EM-PX1565-5 for M9
Revolve ECHO 75990-514 equipped with an Olympus 4x Plan Fluorite NA 0.13 objective lens, standard Olympus FITC filter (ex 470/40; em 525/50; DM 560), and an iPad Pro for camera and to drive ECHO software
Sodium Azide Sigma-Aldrich 71289-50G for imaging
Sodium Chloride EMD Millipore SX0420-5 for NGM plates, M9
Sodium phosphate dibasic VWR 71003-472 for M9
Tert-butyl hydroperoxide Sigma-Aldrich 458139 for oxidative stress
Tetracycline hydrochloride Sigma-Aldrich T7660-5G for RNAi
Tunicamycin Sigma-Aldrich T7765-50MG for ER stress

DOWNLOAD MATERIALS LIST

References

  1. Higuchi-Sanabria, R., Frankino, P. A., Paul, J. W., Tronnes, S. U., Dillin, A. A Futile Battle? Protein Quality Control and the Stress of Aging. Developmental Cell. 44, (2), 139-163 (2018).
  2. Brenner, S. The genetics of Caenorhabditis elegans. Genetics. 77, (1), 71-94 (1974).
  3. Rual, J. F., et al. Toward improving Caenorhabditis elegans phenome mapping with an ORFeome-based RNAi library. Genome Research. 14, (10B), 2162-2168 (2004).
  4. Timmons, L., Court, D. L., Fire, A. Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in Caenorhabditis elegans. Gene. 263, (1-2), 103-112 (2001).
  5. Reinke, S. N., Hu, X., Sykes, B. D., Lemire, B. D. Caenorhabditis elegans diet significantly affects metabolic profile, mitochondrial DNA levels, lifespan and brood size. Molecular Genetics and Metabolism. 100, (3), 274-282 (2010).
  6. Revtovich, A. V., Lee, R., Kirienko, N. V. Interplay between mitochondria and diet mediates pathogen and stress resistance in Caenorhabditis elegans. PLOS Genetics. 15, (3), e1008011 (2019).
  7. Calfon, M., et al. IRE1 couples endoplasmic reticulum load to secretory capacity by processing the XBP-1 mRNA. Nature. 415, (6867), 92-96 (2002).
  8. Yoneda, T., Benedetti, C., Urano, F., Clark, S. G., Harding, H. P., Ron, D. Compartment-specific perturbation of protein handling activates genes encoding mitochondrial chaperones. Journal of Cell Science. 117, (Pt 18), 4055-4066 (2004).
  9. Link, C. D., Cypser, J. R., Johnson, C. J., Johnson, T. E. Direct observation of stress response in Caenorhabditis elegans using a reporter transgene. Cell Stress & Chaperones. 4, (4), 235-242 (1999).
  10. Heifetz, A., Keenan, R. W., Elbein, A. D. Mechanism of action of tunicamycin on the UDP-GlcNAc:dolichyl-phosphate Glc-NAc-1-phosphate transferase. Biochemistry. 18, (11), 2186-2192 (1979).
  11. Struwe, W. B., Hughes, B. L., Osborn, D. W., Boudreau, E. D., Shaw, K. M. D., Warren, C. E. Modeling a congenital disorder of glycosylation type I in C. elegans: a genome-wide RNAi screen for N-glycosylation-dependent loci. Glycobiology. 19, (12), 1554-1562 (2009).
  12. Taylor, R. C., Dillin, A. XBP-1 is a cell-nonautonomous regulator of stress resistance and longevity. Cell. 153, (7), 1435-1447 (2013).
  13. Castello, P. R., Drechsel, D. A., Patel, M. Mitochondria are a major source of paraquat-induced reactive oxygen species production in the brain. The Journal of Biological Chemistry. 282, (19), 14186-14193 (2007).
  14. Oberley, L. W., Buettner, G. R. Role of Superoxide Dismutase in Cancer: A Review. Cancer Research. 39, (4), 1141-1149 (1979).
  15. Senchuk, M. M., Dues, D. J., Van Raamsdonk, J. M. Measuring Oxidative Stress in Caenorhabditis elegans: Paraquat and Juglone Sensitivity Assays. Bio-protocol. 7, (1), (2017).
  16. Lithgow, G. J., White, T. M., Hinerfeld, D. A., Johnson, T. E. Thermotolerance of a long-lived mutant of Caenorhabditis elegans. Journal of Gerontology. 49, (6), B270-B276 (1994).
  17. Labbadia, J., Morimoto, R. I. The Biology of Proteostasis in Aging and Disease. Annual Review of Biochemistry. 84, (1), 435-464 (2015).
  18. Park, H. E. H., Jung, Y., Lee, S. J. V. Survival assays using Caenorhabditis elegans. Molecules and Cells. 40, (2), 90-99 (2017).
  19. Waggoner, L. E., Hardaker, L. A., Golik, S., Schafer, W. R. Effect of a Neuropeptide Gene on Behavioral States in Caenorhabditis elegans Egg-Laying. Genetics. 154, (3), 1181-1192 (2000).
  20. Durieux, J., Wolff, S., Dillin, A. The cell-non-autonomous nature of electron transport chain-mediated longevity. Cell. 144, (1), 79-91 (2011).
  21. Zevian, S. C., Yanowitz, J. L. Methodological Considerations for Heat Shock of the Nematode Caenorhabditis elegans. Methods (San Diego, Calif). 68, (3), 450-457 (2014).
  22. Shen, X., Ellis, R. E., Sakaki, K., Kaufman, R. J. Genetic interactions due to constitutive and inducible gene regulation mediated by the unfolded protein response in C. elegans. PLoS genetics. 1, (3), e37 (2005).
  23. Frakes, A. E., Dillin, A. The UPR(ER): Sensor and Coordinator of Organismal Homeostasis. Molecular Cell. 66, (6), 761-771 (2017).
  24. Martinus, R. D., et al. Selective induction of mitochondrial chaperones in response to loss of the mitochondrial genome. European Journal of Biochemistry. 240, (1), 98-103 (1996).
  25. Nargund, A. M., Pellegrino, M. W., Fiorese, C. J., Baker, B. M., Haynes, C. M. Mitochondrial import efficiency of ATFS-1 regulates mitochondrial UPR activation. Science (New York, N.Y). 337, (6094), 587-590 (2012).
  26. Baker, B. M., Haynes, C. M. Mitochondrial protein quality control during biogenesis and aging. Trends in Biochemical Sciences. 36, (5), 254-261 (2011).
  27. Shore, D. E., Carr, C. E., Ruvkun, G. Induction of Cytoprotective Pathways Is Central to the Extension of Lifespan Conferred by Multiple Longevity Pathways. PLOS Genetics. 8, (7), e1002792 (2012).
  28. Houtkooper, R. H., et al. Mitonuclear protein imbalance as a conserved longevity mechanism. Nature. 497, (7450), 451-457 (2013).
  29. Chiang, S. M., Schellhorn, H. E. Regulators of oxidative stress response genes in Escherichia coli and their functional conservation in bacteria. Archives of Biochemistry and Biophysics. 525, (2), 161-169 (2012).
  30. Blackwell, T. K., Steinbaugh, M. J., Hourihan, J. M., Ewald, C. Y., Isik, M. SKN-1/Nrf, stress responses, and aging in Caenorhabditis elegans. Free Radical Biology & Medicine. 88, (Pt B), 290-301 (2015).
  31. Nguyen, T., Nioi, P., Pickett, C. B. The Nrf2-antioxidant response element signaling pathway and its activation by oxidative stress. The Journal of Biological Chemistry. 284, (20), 13291-13295 (2009).
  32. Lo, J. Y., Spatola, B. N., Curran, S. P. WDR23 regulates NRF2 independently of KEAP1. PLOS Genetics. 13, (4), e1006762 (2017).
  33. Link, C., Johnson, C. Reporter Transgenes for Study of Oxidant Stress in Caenorhabditis elegans. Methods in enzymology. 353, 497-505 (2002).
  34. Choe, K. P., Przybysz, A. J., Strange, K. The WD40 Repeat Protein WDR-23 Functions with the CUL4/DDB1 Ubiquitin Ligase To Regulate Nuclear Abundance and Activity of SKN-1 in Caenorhabditis elegans. Molecular and Cellular Biology. 29, (10), 2704-2715 (2009).
  35. Velazquez, J. M., Lindquist, S. hsp70: nuclear concentration during environmental stress and cytoplasmic storage during recovery. Cell. 36, (3), 655-662 (1984).
  36. Tissières, A., Mitchell, H. K., Tracy, U. M. Protein synthesis in salivary glands of Drosophila melanogaster: relation to chromosome puffs. Journal of Molecular Biology. 84, (3), 389-398 (1974).
  37. Gomez-Pastor, R., Burchfiel, E. T., Thiele, D. J. Regulation of heat shock transcription factors and their roles in physiology and disease. Nature Reviews Molecular Cell Biology. (2017).
  38. Guisbert, E., Czyz, D. M., Richter, K., McMullen, P. D., Morimoto, R. I. Identification of a tissue-selective heat shock response regulatory network. PLoS genetics. 9, (4), e1003466 (2013).
  39. Hentze, N., Le Breton, L., Wiesner, J., Kempf, G., Mayer, M. P. Molecular mechanism of thermosensory function of human heat shock transcription factor Hsf1. eLife. 5, (2016).
  40. Li, J., Labbadia, J., Morimoto, R. I. Rethinking HSF1 in Stress, Development, and Organismal Health. Trends in Cell Biology. (2017).
  41. Morley, J. F., Morimoto, R. I. Regulation of longevity in Caenorhabditis elegans by heat shock factor and molecular chaperones. Molecular Biology of the Cell. 15, (2), 657-664 (2004).
  42. Senchuk, M. M., et al. Activation of DAF-16/FOXO by reactive oxygen species contributes to longevity in long-lived mitochondrial mutants in Caenorhabditis elegans. PLoS Genetics. 14, (3), (2018).
  43. Henderson, S. T., Bonafè, M., Johnson, T. E. daf-16 protects the nematode Caenorhabditis elegans during food deprivation. The Journals of Gerontology. Series A, Biological Sciences and Medical Sciences. 61, (5), 444-460 (2006).
  44. Prahlad, V., Cornelius, T., Morimoto, R. I. Regulation of the Cellular Heat Shock Response in Caenorhabditis elegans by Thermosensory Neurons. Science. 320, (5877), 811-814 (2008).
  45. Libina, N., Berman, J. R., Kenyon, C. Tissue-specific activities of C. elegans DAF-16 in the regulation of lifespan. Cell. 115, (4), 489-502 (2003).
  46. Shivers, R. P., Kooistra, T., Chu, S. W., Pagano, D. J., Kim, D. H. Tissue-specific activities of an immune signaling module regulate physiological responses to pathogenic and nutritional bacteria in C. elegans. Cell Host & Microbe. 6, (4), 321-330 (2009).
  47. Kaletsky, R., et al. Transcriptome analysis of adult Caenorhabditis elegans cells reveals tissue-specific gene and isoform expression. PLoS Genetics. 14, (8), (2018).
  48. Glover-Cutter, K. M., Lin, S., Blackwell, T. K. Integration of the Unfolded Protein and Oxidative Stress Responses through SKN-1/Nrf. PLOS Genetics. 9, (9), e1003701 (2013).
  49. Liu, Y., Chang, A. Heat shock response relieves ER stress. The EMBO journal. 27, (7), 1049-1059 (2008).
  50. Stroustrup, N., Ulmschneider, B. E., Nash, Z. M., López-Moyado, I. F., Apfeld, J., Fontana, W. The Caenorhabditis elegans Lifespan Machine. Nature Methods. 10, (7), 665-670 (2013).
  51. Leung, D. T. H., Chu, S. Measurement of Oxidative Stress: Mitochondrial Function Using the Seahorse System. Methods in molecular biology (Clifton, N.J). 1710, 285-293 (2018).
  52. Morton, E. A., Lamitina, T. Caenorhabditis elegans HSF-1 is an essential nuclear protein that forms stress granule-like structures following heat shock. Aging Cell. 12, (1), 112-120 (2013).
  53. Haynes, C. M., Petrova, K., Benedetti, C., Yang, Y., Ron, D. ClpP mediates activation of a mitochondrial unfolded protein response in C. elegans. Developmental Cell. 13, (4), 467-480 (2007).
  54. Kwon, E. S., Narasimhan, S. D., Yen, K., Tissenbaum, H. A. A new DAF-16 isoform regulates longevity. Nature. 466, (7305), 498-502 (2010).
  55. An, J. H., et al. Regulation of the Caenorhabditis elegans oxidative stress defense protein SKN-1 by glycogen synthase kinase-3. Proceedings of the National Academy of Sciences of the United States of America. 102, (45), 16275-16280 (2005).
  56. Daniele, J. R., Esping, D. J., Garcia, G., Parsons, L. S., Arriaga, E. A., Dillin, A. High-Throughput Characterization of Region-Specific Mitochondrial Function and Morphology. Scientific Reports. 7, (1), 6749 (2017).
  57. Daniele, J. R., et al. A non-canonical arm of UPRER mediates longevity through ER remodeling and lipophagy. bioRxiv. 471177 (2018).
  58. Xu, N., et al. The FATP1-DGAT2 complex facilitates lipid droplet expansion at the ER-lipid droplet interface. The Journal of Cell Biology. 198, (5), 895-911 (2012).
  59. Baird, N. A., et al. HSF-1-mediated cytoskeletal integrity determines thermotolerance and life span. Science (New York, N.Y.). 346, (6207), 360-363 (2014).
  60. Higuchi-Sanabria, R., et al. Spatial regulation of the actin cytoskeleton by HSF-1 during aging. Molecular Biology of the Cell. 29, (21), 2522-2527 (2018).
Mediciones de las respuestas fisiológicas de estrés en <em>C. Elegans</em>
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Bar-Ziv, R., Frakes, A. E., Higuchi-Sanabria, R., Bolas, T., Frankino, P. A., Gildea, H. K., Metcalf, M. G., Dillin, A. Measurements of Physiological Stress Responses in C. Elegans. J. Vis. Exp. (159), e61001, doi:10.3791/61001 (2020).More

Bar-Ziv, R., Frakes, A. E., Higuchi-Sanabria, R., Bolas, T., Frankino, P. A., Gildea, H. K., Metcalf, M. G., Dillin, A. Measurements of Physiological Stress Responses in C. Elegans. J. Vis. Exp. (159), e61001, doi:10.3791/61001 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter