Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

תסכולת הזנה דרך הפה חיידקית עם יתושים שטופלו באנטיביוטיקה

Published: September 12, 2020 doi: 10.3791/61341

Summary

מאמר זה מציג פרוטוקול כדי לחקור את ההשפעה של חיידקים בודדים מעיים יתוש, כולל בידוד וזיהוי של חיידקים midgut יתושים, דלדול אנטיביוטיקה של חיידקים מעיים יתוש, ולהחזן מחדש מין אחד חיידקים ספציפיים.

Abstract

היתוש midgut נמלים microbiome דינמי מאוד המשפיע על חילוף החומרים המארח, רבייה, כושר, ויכולת וקטורית. מחקרים נערכו כדי לחקור את ההשפעה של חיידקים במעיים ככלל; עם זאת, חיידקים שונים יכולים להפעיל השפעות ברורות כלפי המארח. מאמר זה מספק את המתודולוגיה כדי ללמוד את ההשפעה של כל מיקרוב ספציפי מעיים יתוש ואת המנגנון הפוטנציאלי.

פרוטוקול זה מכיל שני חלקים. החלק הראשון מציג כיצד לנתח את מידגוט היתוש, לבודד מושבות חיידקים cultivable, ולזהות מינים חיידקים. החלק השני מספק את ההליך כדי ליצור יתושים שטופלו באנטיביוטיקה ולהריח מחדש מין אחד ספציפי חיידקים.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

יתושים נחשבים וקטורים החשובים ביותר של מחלות פתוגנית אנושית, העברת מעל מאה פתוגנים כולל וירוס זיקה, וירוס דנגה, טפילי Plasmodium 1. כאשר יתושים לקחת ארוחת דם כדי לרכוש חומרים מזינים עבור oviposition, הם יכולים בטעות בלע פתוגנים ממארח נגוע דרך מערכת העיכול2. חשוב לציין, midgut יתוש, אשר ממלא תפקיד מרכזי הן בעיכול ארוחת דם וכניסה פתוגן, נמלים microbiome דינמי מאוד3.

מספר מחקרים אפיינו מיקרוביוטה יתושים שנצברה במעבדה ואספו בשדה בשיטה התלויה בתרבות אובחיידק רצף 4,5,6. מינים כמו פנטואה, סראטיה, קלבסילה, אליזבתקינגיה, ו Enterococcus מבודדים בדרך כללמיתושים במחקרים שונים 5,7,8,9. מעניין, microbiota מעיים יתוש תנודות באופן דינמי הן המגוון הקהילתי ואת כמות מינים חיידקים, מושפע שלב הפיתוח, מינים, מוצא גיאוגרפי, והתנהגותהאכלה 4. מחקרים מראים כי האכלת דם מגבירה באופן דרמטי את העומס החיידקי הכולל עם התרחבות מהירה של מינים מ Enterobacteriaceae וירידה במגוון הכולל 10,11. בנוסף, microbiota מעיים יתוש של שלב הזחל הוא בדרך כלל נמחק כאשר החרק עובר מטמורפוזה במהלך גורים ואקלוסיון; לכן, יתושים בוגרים חדשים צריכים לאכלס מחדש את המיקרוביוטהשלהם 4.

מיקרוביוטה מעיים לווסת פיזיולוגיה חרקים בהיבטים שונים, כולל ספיגת חומרים מזינים, חסינות, פיתוח, רבייה, ויכולתוקטורית 12. זחלי יתושים Axenic להיכשל לפתח מעבר instar הראשון בעוד חיידקים אוראלי אספקה מצילה את הפיתוח, המציין כי החיידק מעיים יתוש חיוני לפיתוחזחלים 13,14. חוץ מזה, דלדול של חיידקי מעיים מעכב את העיכול של ארוחת הדם וספיגת חומרים מזינים, משפיע על התבגרות ביציט, ומפחית oviposition15. בנוסף, יתושים עם מיקרופלורה במעיים לעורר תגובות חיסוניות גבוהות יותר בהשוואה יתושים שטופלו באנטיביוטיקה, עם ביטוי פפטיד מיקרוביאלי גבוה כל הזמן נגד פתוגנים אחריםלהדביק 16. אנטיביוטיקה ניתנת בדרך כלל דרך הפה כדי להסיר חיידקים מעיים פאן במחקרים אלה, ולאחר מכן נערכים ניסויים כדי להשוות את ההבדל בין יתושים axenic ויתושים עם חיידקים commensal. עם זאת, היתוש midgut נמלים קהילה מגוונת של חיידקים, וכל מין חיידקים יכול להפעיל השפעה ברורה כלפי הפיזיולוגיה המארחת.

מיקרוביוטה יתוש מווסת יכולת וקטורית עם השפעות שונות. קולוניזציה על ידי Proteus מבודד יתושים נגזר שדה של אזורים דנגה אנדמי מקנה ביטוי פפטיד מיקרוביאלית מפוקחת והתנגדות נגד זיהום וירוס דנגה16. הפטריה entomopathogenic Beauveria bassiana מפעילה את מסלול החיסון אגרה ו JAK-STAT נגד זיהום arbovirus17. לעומת זאת, הפטרייה Talaromyces מבודד Aedes aegypti midgut מקל על זיהום וירוס דנגה על ידי לווסת פעילות ניסיוןהמעיים 18. בנוסף, Serratia marcescens מקדם שידור arbovirus באמצעות חלבון הפרשה בשם SmEnhancin, אשר מעכל את שכבת הריר על אפיתל מעיים שליתושים 19.

הליך זה מספק שיטה שיטתית ואינטואיטיבית לניתוק של מידגוט היתושים, בידוד מושבות חיידקים הניתנות לפולחן, זיהוי מיני החיידקים והפעלה מחדש באמצעות האכלה אוראלית. הוא מספק תוצאות מייצגות של הזנת דם עם חיידק commensal, מנלינוספטיום Chryseobacterium, על התפתחות השחלות יתושים וoviposition.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. פירוק מידגוט ובידוד חיידקים הניתנים לפולחן

  1. הכן את היתוש לפירוק.
    1. לאסוף את היתושים 7-9 ימים לאחר הופעתו עם שונא. להניא את היתושים שנאספו על ידי כך שהם נושאים אותם לטמפרטורה של 4 מעלות צלזיוס במשך 3-5 דקות ולשמור על היתושים מנומסים בצלחת פטרי קרה כקרח עד לפירוק.
  2. לחטא את מכשירי המעבדה ואת משטח היתוש.
    1. לחטא את ספסל הניסוי, לנתח מיקרוסקופ, מפסים, ושקופית זכוכית על ידי ריסוס 75% אתנול כדי למנוע זיהום על ידי חיידקים מהסביבה.
    2. הכינו צלחת פטרי סטרילית המכילה 75% אתנול ושתי מנות פטרי המכילות תמיסת מלח סטרילית עם פוספט אחד (PBS אחד).
    3. משטח לחטא את היתוש על ידי טבילה וטלטלה אותם 75% אתנול במשך 3 דקות, ולשטוף פעמיים עם 1x חיץ PBS במקרה אתנול משפיע על פלורת המעיים החתוצה.
  3. תנתקו את היתוש.
    1. העבר את היתוש המחוקר על מגלשת הזכוכית עם טיפה של מאגר PBS סטרילי פי 1. לנתח מתחת למיקרוסקופ ה לנתח.
    2. תחת ההגדלה התחתונה של מיקרוסקופ לנתח, בזהירות להסיר את הרגליים, כנפיים, ואת ראש היתוש כדי למנוע בריחה. הסר את somite האחרון של היתוש על ידי חיתוך ישירות, במקום למשוך אותו, כדי למנוע את שבירה מערכת העיכול.
    3. מהדק את בית היתוש ואת קצה הבטן עם מלחציים. שלף בעדינות את מערכת העיכול של היתוש. מערכת העיכול הנרכשת מכילה בדרך כלל את היבול, התפוררות, האמצע, ההינדגוט והצינורות המופיגים.
    4. כוונן את מיקרוסקופ הניתוח להגדלה גבוהה יותר. הסר את היבול, התעמלות, ההינדגוט, ואת הצינורות Malpighian ממערכת העיכול החתוצה כדי לקבל midgut של היתוש.
    5. יש לדאוג בעת הסרת היבול, כאשר היבול מתנפח ודומה למידגוט לאחר שהיתוש לוקח ארוחת סוכר. הצינורות המופיגים, קבוצה של צינורות צואה ארוכים ודקים, ממוקמים בגבול שבין האמצע לבין ההינדגוט.
  4. לבודד חיידקי מעיים.
    1. להעביר את midgut הניתח לצינור סטרילי 1.5 מ"ל עם 200 μL של חיץ PBS 1x סטרילי.
    2. טוחנים את האמצע על ספסל סטרילי ביסודיות עם עלי סטרילי כדי לאפשר שחרור מלא של חיידקי מעיים למאגר.
    3. תדלל את ההומוגן לשלושה דילולים פי 10. להוסיף 50 μL של כל דילול לצלחת LB (מרק לוריה) אגר, ולאחר מכן להפיץ אותו על הצלחת. אם האמצע מכיל ריכוז גבוה של פלורת מעיים, זה חיוני לעשות דילול סדרתי יותר כדי לבחור מושבות בודדות.
    4. דגירה את הצלחת ב 37 ° C במשך 1-2 ימים עד מושבות בודדות גלויות.
  5. זיהוי מינים
    1. בחר מושבות בודדות ולחסן אותם בהתאמה לתוך בקבוקון חסוני 150 מ"ל המכיל 50 מ"ל של מרק LB בינוני.
    2. לנער את החיידקים ב 37 מעלות צלזיוס לילה.
    3. לחלץ את ה-DNA הכולל על ידי ערכת מיצוי DNA גנומי חיידקי. להגביר 16S rDNA על ידי תגובת שרשרת פולימראז (PCR).
      הערה: קיימים מקטעים מרובים ב- 16S rDNA הנסחסים. בהתבסס על אזורים אלה שנסחבו, פריימרים אוניברסליים לחיידקים יכולים להיות מתוכננים כדי להגביר את שברי rDNA 16S של כל החיידקים. פריימרים אלה הם ספציפיים חיידקים, ואת ההבדל באזור המשתנה של 16S rDNA יכול לשמש כדי להבחין חיידקים שונים. לכן, 16S rDNA נמצא בשימוש נרחב לזיהוי חיידקים.
    4. לשחזר ולטהר שברי DNA ממוצרי PCR על ידי אלקטרופורזה ג'ל agarose וערכת שחזור ג'ל מסחרי.
    5. לבצע רצף DNA על שברי DNA מטוהרים כדי להשיג רצפי גנים חיידקיים.
    6. השווה את רצף הגנים 16S rRNA עם רצף חיידקים זמין GenBank. בחר את מסד הנתונים חיידקים וארכיאה.
      הערה: זיהוי לרמת המינים הוגדר כ-99% 16S רצף rDNA דמיון לערך GenBank הקרוב ביותר. המבודד הוקצה הסוג המתאים כאשר דמיון רצף rDNA 16S שלה היה <99% ו -95%.

2. טיפול אנטיביוטי וחיידק מחדש

  1. הכן את הפתרון האנטיביוטיקה.
    1. לשקול את הכמות הנדרשת של סוכרוז, פניצילין, סטרפטומיצין להכין 10% פתרון סוכרוז כולל 20 יחידות של פניצילין ו 20 μg של סטרפטומיצין לכל מ"ל.
  2. להאכיל יתושים עם תמיסת אנטיביוטיקה.
    1. להניע את היתושים ב-4°C למשך 3-5 דקות. מעבירים את היתושים לספל נייר. מכסים את החלק העליון בגזה ומדרים את הגזה בקלטת כדי למנוע מיתושים להימלט.
    2. טובלים כדורי צמר גפן סטריליים בתמיסה אנטיביוטית ומנינים אותם בזהירות על היתושים. לסחוט את כדורי הכותנה לפני השימוש כדי למנוע יתושים מטביעה בכדורי צמר גפן נוטף.
    3. מכסים את כדורי הכותנה בצלחת פטרי ב-10 ס"מ למניעת אידוי לחות. החליפו את כדורי הכותנה פעמיים ביום במשך שלושה ימים רצופים.
  3. אשר את היעילות של הטיפול באנטיביוטיקה.
    1. על פי השיטה הנ"ל, לנתח את midgut של יתושים שטופלו באנטיביוטיקה.
    2. להעביר את midguts החתוצו לצינור סטרילי 1.5 מ"ל עם 200 μL של חיץ PBS 1x סטרילי.
    3. טוחנים midguts בספסל סטרילי ביסודיות עם עלי סטרילי כדי לאפשר שחרור מלא של חיידקי מעיים למאגר.
    4. לחלץ את ה-DNA מיקרוביאלי בטן על ידי ערכת חילוץ DNA גנומי חיידקים.
    5. לבצע כמות חיידקים על ידי PCR כמותי בזמן אמת (qPCR) על ה-DNA הגנומי באמצעות פריימרים eubacteria אוניברסלי (16S rRNA F: TCCTACGGGGGAGACAGCAGT ו R: GGACTACCAGGACTCTAATCCTGTT).
  4. הכנת השעיה חיידקית
    1. למדוד את הפתרון החיידקי עם ספקטרופוטומטר. הוסף 1 OD (OD600) מתלים חיידקיים לתוך צינור 1 מ"ל. צנטריפוגה המתלים ב 5,000 x g עבור 5 דקות ב 4 ° C.
    2. בטל את supernatant ולהוסיף 1 מ"ל של חיץ PBS 1x סטרילי לצינור 1.5 מ"ל עבור משקעים השעיה.
    3. צנטריפוגה ב 5,000 x g עבור 5 דקות ב 4 ° C; זרוק את הסופרנטנט.
    4. חזור על שלבים 2.4.2 ו- 2.4.3.
    5. להוסיף 200 μL של חיץ PBS 1x סטרילי למשקעים חיידקיים.
    6. להוסיף 600 μL של 10% תמיסת סוכרוז, 200 μL של 10 מ"מ ATP (אשר פועל כמו phagostimulant), ו 200 μL של השעיה חיידקית לתוך צינור סטרילי 1.5 מ"ל. מערבבים על ידי מערבולות. לחלופין, להשעות חיידקים כדוריים בדם לא פעילות חום.
    7. הכנת דם לא מנוכה בחום
      1. לאסוף דם טרי עם צינור נוגד קרישה.
      2. קח 2-3 מ"ל של דם טרי. צנטריפוגה ב 1,000 x g עבור 10 דקות ב 4 מעלות צלזיוס להפריד פלזמה ותאי דם. שים לב כי הדם יאבד במהלך צנטריפוגציה ותהליך כביסה; יש צורך לחשב את השימוש מראש.
      3. לאסוף את הפלזמה לתוך צינור חדש 1.5 מ"ל וחום-inactivate ב 56 ° C עבור 1 שעה.
      4. להוסיף 500 μL של חיץ PBS 1x סטרילי לצינור 1.5 מ"ל להשעיית תאי דם. צנטריפוגה ב- 1,000 x g למשך 10 דקות ב- 4 °C ולאחר מכן להשליך את supernatant.
      5. חזור על שלב 2.4.7.4 פעמיים.
      6. תאי דם עם חום לא פעילות כדי להשיג דם לא פעילות חום.
      7. בצע את השלבים 2.4.1 כדי 2.4.4 כדי לקבל 1 גלולות חיידקי OD.
      8. תולה מחדש את החיידקים עם 1 מ"ל של דם לא מנוען בחום.
  5. להאכיל את היתוש עם מתלי חיידקים.
    1. הרעיב את היתושים במשך 24 שעות, מה שמאפשר לאנטיביוטיקה לעכל לפני האכלת חיידקים.
    2. להרכיב את מערכת הזנת קרום.
    3. לאטום את יחידת ההזנה המעוקרת עם פרפילם, לחילופין קרום קולגן.
    4. מניחים טבעת פלסטיק ומסדרים אותה עם פרפילם כדי להימנע מפריצה עקב חיכוך במהלך ההאכלה.
    5. מוסיפים לאט את הפתרון החיידקי המוכן ליחידת ההזנה. שים לב שניתן למלא רק באר אחת של יחידת המאכילים בעלת שתי הבארות בפתרון ולכסות את יחידת המאכיל רק מהצד השחרור של היאגנט.
    6. חבר את יחידת ההאכלה למערכת הזנה שחוממה מראש ל-37°C, המדמה את הטמפרטורה האנושית כדי למשוך יתושים. מניחים את מכשיר ההאכלה על נייר מלאה ביתושים וניזונים במשך 90 דקות.
    7. לאחר ההאכלה, להמרים את היתושים על ידי כך שהם נושאים אותם לטמפרטורה של 4 מעלות צלזיוס במשך 3-5 דקות ולשמור על היתושים מנושאים בצלחת פטרי קרה כקרח.
    8. בחר את היתושים הדחוסים במלואם למחקרים נוספים.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

האמצעים של יתושים שטופלו באנטיביוטיקה וללא אנטיביוטיקה הוצאו לחילוץ DNA, qPCR בוצע עם פריימרים חיידקים אוניברסליים. איור 1 מראה את הביטוי של חיידקים 16S rRNA בקבוצת הבקרה וקבוצה טיפול אנטיביוטי. התוצאות מראות כי כ 98% של חיידקי המעי הוסרו, ואת עיקור המעיים של פניצילין וסטרפטומיצין היה מוצלח.

עם השיטות המתוארות, זנים חיידקים היו מבודדים וזוהו. ג. מינגוספטיקום הוא bacillus אירובי לא מותסס, אוקסיד אזיד אז חיובי גרם שלילי, השייך Chryseobacterium. איור 2 מראה את הביצה הממוצעת שהונחה לכל יתוש לאחר הזנת דם של יתושים שטופלו באנטיביוטיקה עם C. meningosepticum. איור 3 מראה את הביטוי של התפתחות השחלות גנים הקשורים 24 שעות לאחר ארוחת דם המכילה C. meningosepticum. מבט כולל על התפתחות השחלות הקשורים לגנים ולרצף פריימר מפורטים בטבלה 1.

הזן מבודד מחיידקי מעיים שממנו הוסרו חיידקי מעיים ולאחר מכן היתושים הדחוסים חולקו לשלוש קבוצות. חמש נקבות בקבוצה הראשונה והקבוצה השנייה שימשו לספירת כמות ההשרצה, ו-10 נקבות בקבוצה השלישית שימשו לזיהוי ביטוי הגן הקשור להתפתחות השחלות לאחר 24 שעות של כל יתוש נקבה לאחר ההאכלה, בהתאמה. התוצאות מראות כי אין שינוי משמעותי בייצור הביצים של קבוצת הביקורת והקבוצה ההזנה.

Figure 1
איור 1: ביטוי של 16S rRNA לאחר טיפול אנטיביוטי. היתושים עם אנטיביוטיקה לא מטופלת שימשו כקבוצה הבקרה. לחץ כאן כדי להציג גירסה גדולה יותר של נתון זה.

Figure 2
איור 2:ההשפעה של חיידקי מעיים על היתוש. זני החיידקים המצוינים היו מעורבבים עם דם והוזן ליתושים שטופלו באנטיביוטיקה. היתושים עם חיידקים קומנליים מעיים לא מטופלים שימשו כקבוצה הבקרה. הנתונים מוצגים כ- mean ± SEM. אנא לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 3
איור 3: ביטוי של גנים הקשורים לרבייה לאחר הזנת דם. ביטוי של Cathepsin B (A), מעכב ATPase מיטוכונדריאלי (ב),ריבוזום biogenesis חלבון brix (ג), ו סרין / תרונין-חלבון kinase rio2 ( ד )לאחרהאכלה בדם של יתושים שטופלו באנטיביוטיקה במשך 24 שעות עם זנים חיידקים שצוינו. היתושים עם חיידק הבטן הלא מטופל שימשו כקבוצה הבקרה. כל נקודה מייצגת יתוש וכל קו מייצג את הערך החציוני של הקבוצה. לחץ כאן כדי להציג גירסה גדולה יותר של נתון זה.

שם (שם) מספר גן רצף פריימר
קתפסין B מיה פריימר-גאגאגאגאטגטגטגטגגה
פריימר הפוך-AATCCCACATCCACCACCCAGTA
מעכב ATPase מיטוכונדריאלי מיה פריימר-קאקאקאקאקאגאגגה
פריימר הפוך-ACGTGCGATAGCTCTTCTCGT
חלבון ריבוזום ביוגנזה brix מיה 01335 פריימר קדמי-GAACAGCAAGCGAATGAGAA
פריימר-TTGGCCTTGAGAGTCGTCTT
סרין/ת'רין-חלבון קינאז ריו2 מי נוע פריימר-גאגאגאגאגאגאקאקאק
פריימר-TCGAATGGCTTCCATTTC

טבלה 1: פיתוח השחלות הקשורות גנים רצפי פריימר.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

מחקרים על אינטראקציות בין חיידקי מארחים מצאו כי מיקרובים שונים במעיים משפיעים על הפיזיולוגיה המארחת שלהם באמצעות מנגנונים שונים. מאמר זה מציג את השיטה לחקור את התפקיד המתאים של חיידקים מעיים יתוש, כולל ניתוח midgut יתוש, culturing חיידקים מעיים cultivable, טיפול אנטיביוטי, ו reintroducing חיידקים של עניין.

לטיפול אנטיביוטי מוצלח, יש לשקול את הפרטים הבאים בביצוע הניסוי. בפרוטוקול זה, יתושים טופלו באמצעות כדורי כותנה לחים עם תמיסת 10% סוכרוז כולל 20 יחידות של פניצילין ו 20 μg של סטרפטומיצין לכל mL במשך 3 ימים11,16. פניצילין שימש כאנטיביוטיקה ספקטרום רחב נגד חיידקים גראם חיובי, סטרפטומיצין שימש כאנטיביוטיקה ספקטרום רחב נגד חיידקים גרם שלילי20. שימור נכון של אנטיביוטיקה חיוני לטיפול אנטיביוטי יעיל21. כאשר מאוחסנים ב -18 °C, היציבות של פניצילין G הוא לפחות 3 מ '. סטרפטומיצין יציב לפחות 12 מ ' כאשר מאוחסן ב 4 °C22. בעוד הבדלים במותג אנטיביוטיקה או זמן אחסון עלול לגרום להבדלים קלים בסיווג מיקרוביאלי, יש צורך לאמת את היעילות לאחר כל טיפול אנטיביוטי. בנוסף qPCR, התפשטות הצלחת או באמצעות PCR משמשים בדרך כלל כדי להעריך את היעילות של טיפולאנטיביוטי 23,24. יתר על כן, כדי למנוע יתושים להיות מזוהמים עם חיידקים אחרים לאחר טיפול אנטיביוטי, assay האכלה צריך להתבצע עם ציוד מעוטר להרכיב תחת ספסל סופר נקי.

לפני האכלה אוראלית חיידקית, היתושים צריך להיות מורעב במשך 24 שעות כדי לאפשר את האנטיביוטיקה להיות מטבוליזם25. זה לא רק עוזר ליתושים לבעוס נוזל חיידקים, אלא גם מונע מהאנטיביוטיקה להרוג את החיידקים.

יש להודות, פרוטוקול זה הוא בעיקר לחקירת ההשפעה של חיידקים cultivable. כדי לחקור את microbiota מעיים של מארח בעלי חוליות וחולי חוליות, reintroduction של חיידקים cultivable למארח טיפול באנטיביוטיקה משמש בדרך כלל במחקריםהאחרונים 8,26,27. בנוסף, הזיהוי הראשוני של חיידקי מעיים תרבותיים מבוסס בדרך כלל על המאפיינים של גודל המושבה, צורה, צבע, קצה, אטימות, גובה, ועקביות28. עבור חיידקים שאינם culturable, גישות מטגנומיות מבוססות רצף תפוקה גבוהה צפויות לספק מידע מקיף על ההרכב הכולל של microbiota midgut29,30,31. עם זאת, יחסי הגומלין בין חיידקים שאינם כת לבין המארח נותר במידה רבה בלתי נחקר.

מאמר זה מציע שתי אפשרויות חלופיות כדי ללמוד את ההשפעה של חיידקים במעיים על oviposition יתוש, לערבב את החיידקים עם דם לא פעילות חום או השתלה של החיידקים באמצעות האכלה סוכר ואחריו האכלה בדם. התוצאות המייצגות בכתב יד זה אימצו את האפשרות הראשונה, בעוד שהשיטה האחרונה הניבה תוצאות דומות. מחקרים שונים יכולים לערך לאחר האכלה אוראלית עם זן אחד ספציפי חיידקים. לאחר מכן ניתן להשתמש בה כדי לחקור כיצד גורם מיקרוביאלי לווסת התנהגות קטר יתושים. חלבון כימות assay יכול להיות אחריו כדי ללמוד את ההשפעות של חיידקים שונים על העיכול. עם שינויים קלים, שיטה זו יכולה לשמש כדי ללמוד את ההשפעות המתאימות של חיידקים שונים כלפי פיזיולוגיה יתושים, כולל ספיגת חומרים מזינים, חסינות, פיתוח, רבייה, ויכולת וקטורית.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

למחברים אין ניגודי אינטרסים לחשוף.

Acknowledgments

עבודה זו נתמכה על ידי הקרן הלאומית למדעי הטבע של סין (גרנט מס' 81902094, 81600497) ופרויקט תוכנית המדע והטכנולוגיה של מחוז הונאן (2019RS1036).

Materials

Name Company Catalog Number Comments
Adenosine 5′-triphosphate disodium salt hydrate Sigma A2383 Adenosine 5′-triphosphate disodium salt hydrate has been used to prepare adenosine triphosphate (ATP) standard solutions
Aedes aegypti Female mosquitoes
Anticoagulant tube BD Vacutainer 363095 Collect fresh blood
Centrifuge tube Sangon Biotech F601620-0010 1.5 ml, Natural, Graduated, Sterile
Cotton balls
Disposable Tissue Grinding Pestle Sangon Biotech F619072-0001 70 mm Long, Conical, Blue, Sterile
Ethanol absolute Paini Dilute it to 75% ethanol
Forceps RWD F11029 Dissection
Hemotek Membrane Feeding System Hemotek Components of the feeding system, including  Hemotek temperature controller, feeder-housing assembly, metal feeder assembled.
Incubator shaker ZQZY-78AN
Inoculation Loops Sangon Biotech F619312-0001 10 μl, Yellow
LB Agar Powder Sangon Biotech A507003 Tryptone 10.0 g, Yeast Extract 5.0 g, NaCl 10.0 g, Agar 15.0 g.
LB Broth Powder Sangon Biotech A507002 Tryptone 10.0 g, Yeast Extract 5.0 g, NaCl 10.0 g.
Microscope Zeiss Stemi508
Paper cup Place mosquito
Parafilm Sangon Biotech F104002 4 inx 125 ft
Petri dish Sangon Biotech F611203
Penicillin G procaine salt hydrate Sangon Biotech A606248 White powder. Soluble in water, soluble in methanol, slightly soluble in water, ethanol
Single Channal Pipettor Gilson
Streptomycin sulfate Sangon Biotech A610494 Streptomycin sulfate is a glucosamine antibiotic that interferes with the synthesis of prokaryotic proteins.
Sucrose Sangon Biotech A502792 Soluble in water, ethanol and methanol, slightly soluble in glycerol and pyridine.
TIANamp Bacteria DNA Kit TIANGEN DP302 Extract DNA 
Utility Fabric-Mosquito Netting White
Vortex mixer Scintic Industries S1-0246
1.5ml EP tube Sangon Biotech F600620
10X PBS buffer Sangon Biotech E607016 This product is a 10X solution. Please dilute it 10 times before use. The pH value is 7.4.

DOWNLOAD MATERIALS LIST

References

  1. Tolle, M. A. Mosquito-borne diseases. Current Problems in Pediatric and Adolescent Health Care. 39, (4), 97-140 (2009).
  2. Wu, P., Yu, X., Wang, P., Cheng, G. Arbovirus lifecycle in mosquito: acquisition, propagation and transmission. Expert Reviews in Molecular Medicine. 21, 1 (2019).
  3. Jayakrishnan, L., Sudhikumar, A. V., Aneesh, E. M. Role of gut inhabitants on vectorial capacity of mosquitoes. Journal of Vector Borne Diseases. 55, (2), 69 (2018).
  4. Jupatanakul, N., Sim, S., Dimopoulos, G. The insect microbiome modulates vector competence for arboviruses. Viruses. 6, (11), 4294-4313 (2014).
  5. Moro, C. V., Tran, F. H., Raharimalala, F. N., Ravelonandro, P., Mavingui, P. Diversity of culturable bacteria including Pantoea in wild mosquito Aedes albopictus. BMC Microbiology. 13, (1), 70 (2013).
  6. Chouaia, B., et al. Molecular evidence for multiple infections as revealed by typing of Asaia bacterial symbionts of four mosquito species. Applied and Environmental Microbiology. 76, (22), 7444-7450 (2010).
  7. Terenius, O., et al. Midgut bacterial dynamics in Aedes aegypti. FEMS Microbiology Ecology. 80, (3), 556-565 (2012).
  8. Bando, H., et al. Intra-specific diversity of Serratia marcescens in Anopheles mosquito midgut defines Plasmodium transmission capacity. Scientific Reports. 3, 1641 (2013).
  9. Telang, A., Skinner, J., Nemitz, R. Z., McClure, A. M. Metagenome and culture-based methods reveal candidate bacterial mutualists in the Southern house mosquito (Diptera: Culicidae). Journal of Medical Entomology. 55, (5), 1170-1181 (2018).
  10. Wang, Y., Gilbreath, T. M., Kukutla, P., Yan, G., Xu, J. Dynamic gut microbiome across life history of the malaria mosquito Anopheles gambiae in Kenya. PloS One. 6, (9), (2011).
  11. Xiao, X., et al. A Mesh-Duox pathway regulates homeostasis in the insect gut. Nature Microbiology. 2, (5), 17020 (2017).
  12. Guégan, M., et al. Short-term impacts of anthropogenic stressors on Aedes albopictus mosquito vector microbiota. FEMS Microbiology Ecology. 94, (12), 188 (2018).
  13. Valzania, L., Coon, K. L., Vogel, K. J., Brown, M. R., Strand, M. R. Hypoxia-induced transcription factor signaling is essential for larval growth of the mosquito Aedes aegypti. Proceedings of the National Academy of Sciences of the United States of America. 115, (3), 457-465 (2018).
  14. Coon, K. L., Vogel, K. J., Brown, M. R., Strand, M. R. Mosquitoes rely on their gut microbiota for development. Molecular Ecology. 23, (11), 2727-2739 (2014).
  15. de O Gaio, A., et al. Contribution of midgut bacteria to blood digestion and egg production in Aedes aegypti (diptera: culicidae)(L). Parasites & Vectors. 4, (1), 105 (2011).
  16. Ramirez, J. L., et al. Reciprocal tripartite interactions between the Aedes aegypti midgut microbiota, innate immune system and dengue virus influences vector competence. PLoS Neglected Tropical Diseases. 6, (3), 1561 (2012).
  17. Dong, Y., Morton, J. C., Ramirez, J. L., Souza-Neto, J. A., Dimopoulos, G. The entomopathogenic fungus Beauveria bassiana activate toll and JAK-STAT pathway-controlled effector genes and anti-dengue activity in Aedes aegypti. Insect Biochemistry and Molecular Biology. 42, (2), 126-132 (2012).
  18. Anglero-Rodriguez, Y. I., et al. An Aedes aegypti-associated fungus increases susceptibility to dengue virus by modulating gut trypsin activity. Elife. 6, 28844 (2017).
  19. Wu, P., et al. A gut commensal bacterium promotes mosquito permissiveness to arboviruses. Cell Host & Microbe. 25, (1), 101-112 (2019).
  20. Möhlmann, T. W., et al. Impact of gut bacteria on the infection and transmission of pathogenic arboviruses by biting midges and mosquitoes. Microbial Ecology. (2020).
  21. Llorca, M., Gros, M., Rodríguez-Mozaz, S., Barceló, D. Sample preservation for the analysis of antibiotics in water. Journal of Chromatography. A. 1369, 43-51 (2014).
  22. Berendsen, B., Elbers, I., Stolker, A. Determination of the stability of antibiotics in matrix and reference solutions using a straightforward procedure applying mass spectrometric detection. Food Additives & Contaminants: Part A, Chemistry, Analysis, Control, Exposure & Risk Assessment. 28, (12), 1657-1666 (2011).
  23. Hill, C. L., Sharma, A., Shouche, Y., Severson, D. W. Dynamics of midgut microflora and dengue virus impact on life history traits in Aedes aegypti. Acta Tropica. 140, 151-157 (2014).
  24. Eng, M. W., et al. Multifaceted functional implications of an endogenously expressed tRNA fragment in the vector mosquito Aedes aegypti. PLoS Neglected Tropical Diseases. 12, (1), 0006186 (2018).
  25. Kajla, M. K., Barrett-Wilt, G. A., Paskewitz, S. M. Bacteria: A novel source for potent mosquito feeding-deterrents. Science Advances. 5, (1), 6141 (2019).
  26. Gonçalves, G. G. A., et al. Use of MALDI-TOF MS to identify the culturable midgut microbiota of laboratory and wild mosquitoes. Acta Tropica. 200, 105174 (2019).
  27. Kuss, S. K., et al. Intestinal microbiota promote enteric virus replication and systemic pathogenesis. Science. 334, (6053), New York, N.Y. 249-252 (2011).
  28. Rani, A., Sharma, A., Rajagopal, R., Adak, T., Bhatnagar, R. K. Bacterial diversity analysis of larvae and adult midgut microflora using culture-dependent and culture-independent methods in lab-reared and field-collected Anopheles stephensi-an Asian malarial vector. BMC Microbiology. 9, (1), (2009).
  29. Apte-Deshpande, A., Paingankar, M., Gokhale, M. D., Deobagkar, D. N. Serratia odorifera a midgut inhabitant of Aedes aegypti mosquito enhances its susceptibility to dengue-2 virus. PLoS One. 7, (7), 40401 (2012).
  30. Behura, S. K. Mosquito microbiota and metagenomics, and its relevance to disease transmission. Nature. 436, 257-260 (2013).
  31. Dickson, L. B., et al. Diverse laboratory colonies of Aedes aegypti harbor the same adult midgut bacterial microbiome. Parasites & Vectors. 11, (1), 1-8 (2018).
תסכולת הזנה דרך הפה חיידקית עם יתושים שטופלו באנטיביוטיקה
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Liu, X., Wu, S., Li, W., Zhang, M., Wu, Y., Zhou, N., Wu, P. A Bacterial Oral Feeding Assay with Antibiotic-Treated Mosquitoes. J. Vis. Exp. (163), e61341, doi:10.3791/61341 (2020).More

Liu, X., Wu, S., Li, W., Zhang, M., Wu, Y., Zhou, N., Wu, P. A Bacterial Oral Feeding Assay with Antibiotic-Treated Mosquitoes. J. Vis. Exp. (163), e61341, doi:10.3791/61341 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter