Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Indringende mRNA Kinetics in ruimte en tijd in Escherichia coli met behulp van Two-Color Single-Molecule Fluorescentie in Situ Hybridisatie

doi: 10.3791/61520 Published: July 30, 2020

Summary

Dit protocol beschrijft een toepassing van fluorescentie met één molecuul in situ hybridisatie (smFISH) om de in vivo kinetiek van mRNA-synthese en -afbraak te meten.

Abstract

Single-molecule fluorescentie in situ hybridisatie (smFISH) maakt het mogelijk om het absolute aantal mRNAs in individuele cellen te tellen. Hier beschrijven we een toepassing van smFISH om de percentages transcriptie en mRNA-afbraak in Escherichia coli te meten. Omdat smFISH is gebaseerd op vaste cellen, voeren we smFISH uit op meerdere tijdstippen tijdens een tijdscursusexperiment, d.w.z. wanneer cellen gesynchroniseerde veranderingen ondergaan bij inductie of onderdrukking van genexpressie. Op elk moment punt, sub-regio's van een mRNA worden spectrally onderscheiden om transcriptie verlenging en voortijdige beëindiging sonde. Het resultaat van dit protocol maakt het ook mogelijk voor het analyseren van intracellulaire lokalisatie van mRNAs en heterogeniteit in mRNA-kopienummers tussen cellen. Met behulp van dit protocol veel monsters (~ 50) kan worden verwerkt binnen 8 uur, net als de hoeveelheid tijd die nodig is voor slechts een paar monsters. We bespreken hoe dit protocol toe te passen om de transcriptie en afbraak kinetiek van verschillende mRNAs in bacteriële cellen te bestuderen.

Introduction

De stroom van genetische informatie van DNA naar mRNA en eiwit is een van de meest fundamentele cellulaire processen, waarvan de regulering belangrijk is voor cellulaire fitness1. Het aantal mRNAs in een cel wordt bepaald door twee dynamische processen, transcriptie en mRNA-afbraak. Echter, hoe transcriptie en mRNA afbraak worden geregeld in de tijd en ruimte van een enkele cel blijft niet volledig begrepen, grotendeels te wijten aan het tekort aan experimentele methoden om kwantitatief te meten hun kinetiek in vivo.

Methoden op basis van de totale mRNAs gewonnen uit een populatie van cellen, zoals Noordelijke vlek, RT-PCR, RNA sequencing, en genexpressie microarrays, kan meten van het relatieve verschil in mRNA niveaus en zijn op grote schaal gebruikt om de snelheid van transcriptie rek2,3,4,5 of de snelheid van mRNA afbraak6,7te analyseren ., Zij bieden echter niet het absolute aantal mRNAs per cel, en daarom zijn ze niet geschikt voor het indringen van de mate van transcriptie-initiatie8. Ook omdat mRNAs worden geëxtraheerd uit een populatie van cellen, kan de ruimtelijke verdeling van mRNAs binnen een enkele cel en de variabiliteit van mRNA-kopienummers tussen cellen niet worden gemeten.

RNA-sequencing van de volgende generatie op individuele cellen (scRNAseq) kan het aantal mRNAs per cel kwantificeren in een genomische schaal9. Het blijft echter moeilijk om deze techniek te gebruiken om transcriptiekinetiek te meten, als gevolg van uitdagingen met monstervoorbereiding en hoge kosten. In het bijzonder is de toepassing van scRNAseq op bacteriën technisch moeilijk geweest als gevolg van een lage mRNA-overvloed10,11.

Single-molecule fluorescentie in situ hybridisatie (smFISH) is gebaseerd op de hybridisatie van fluorescerende enkelstrengse sondes waarvan de sequenties complementair zijn aan het doel mRNA van belang12,13. Het concept van sequentie-specifieke hybridisatie is vergelijkbaar met die gebruikt in Noordelijke vlek of RT-PCR, maar de hybridisatie wordt gedaan in situ binnen vaste cellen, om de native lokalisatie van mRNAs te behouden. Het signaal van een enkele mRNA wordt versterkt met behulp van vele sondes, ~ 20 nucleotiden (nt) in lengte, hybridiseren naar verschillende delen van een mRNA (Figuur 1A)13. In deze "tegel" sonde aanpak, het aantal sondes die nodig zijn om een enkele mRNA detecteren stelt een ondergrens op de lengte van mRNA die kan worden onderzocht. Als alternatief kan het mRNA van belang transcriptie worden gesmolten tot een niet-codering array van tandem Lac operator sequenties, zodanig dat meerdere kopieën van een fluorescerend gelabelde lacO sonde hybridiseren tot een enkele mRNA (Figuur 1B)14.

smFISH is gebruikt om het aantal mRNAs per cel in stabiele toestand te kwantificeren (d.w.z. wanneer synthese en verval in evenwicht zijn) en om de gemiddelde en variabiliteit van mRNAs onder bacteriële cellen15,16,,17te analyseren . Onlangs is smFISH toegepast op het kwantificeren van mRNA-getallen in niet-steady state, direct na inductie of onderdrukking van genexpressie in E. coli18,19,20. De temporele veranderingen in de absolute mRNA-kopienummers werden vervolgens gebruikt om het percentage transcriptieinwijding, verlenging en beëindiging te berekenen, evenals de snelheid van mRNA-degradatie. Voor deze toepassing kunnen conventionele zelfzuchtige procedures omslachtig zijn omdat er veel monsters zijn, die elk een eenmalig punt vertegenwoordigen, die meerdere bufferuitwisselingsstappen moeten doorlopen (d.w.z. centrifugatie en wassen). Hier beschrijven we een smFISH-protocol, waarin de stappen voor de behandeling van het monster drastisch worden vereenvoudigd door cellen aan het oppervlak van een coverslip te laten hechten en door vloeistoffen te aspireren met een vacuümfiltratiesysteem14,19. Met behulp van de expressie van lacZ in E. coli als voorbeeld, wordt de volledige workflow(figuur 2) aangetoond, inclusief beeldanalyse (figuur 3) die de in vivo kinetiek van transcriptie (initiatie, verlenging en beëindiging) en mRNA-afbraak, cel-tot-cel variabiliteit in mRNA-expressie en mRNA-lokalisatie oplevert. We verwachten dat het protocol op grote schaal van toepassing is op sonde in vivo kinetiek en lokalisatie van andere mRNAs in verschillende bacteriesoorten.

Protocol

1. Voorbereiding van smFISH sondes

OPMERKING: Om smFISH-sondes te labelen met een enkele fluorofof, volgt u een standaardprotocol voor het labelen van nucleïnezuur oligonucleotiden op basis van NHS ester chemie21.

  1. Ontwerp smFISH sondes. Bepaal of u "tegels" sondes of "array" sondes(figuur 1) wilt gebruiken voor het gen van belang. Zie de sectie Discussie over hoe u de beslissing nemen.
    1. Voor "tegel"-sondes(figuur 1A)gebruikt u een online sondeontwerptool (zie bijvoorbeeld Tabel met materialen).
    2. Voor "array" probes(Figuur 1B),voer een BLAST sequentie zoeken om ervoor te zorgen dat de sonde sequentie is niet complementair aan andere mRNA sequenties.
    3. Voor het bestuderen van lacZ mRNA transcriptie en afbraak kinetiek, gebruik maken van twee sets van 24 sondes, elke set die de eerste en laatste 1 kb regio's van lacZ (3,072 bp)19.
      OPMERKING: Deze sondesets worden hierna respectievelijk "5' mRNA probe" en "3' mRNA probe" genoemd. Sequenties van deze sondes zijn opgenomen in de tabel van materialen.
  2. Bestel sondesequenties als DNA oligonucleotiden met een C6 linker amino aan het einde van 5.000 uur. Los individuele sondes op in water tot 1 mM.
  3. Combineer equimolar hoeveelheden sondes voor "5' mRNA probe" en "3' mRNA probe" sets. Bijvoorbeeld, voor de 5 'mRNA sonde ingesteld voor lacZ, combineren 20 μL van elke sonde (totaal 24 soorten sondes in de set).
  4. Voer ethanolneerslaguit 22 van de gecombineerde sondes om eventuele verontreinigingen van primaire en secundaire amines (zoals Tris, glycine en ammoniumzouten) te verwijderen die de vervoegingsreactie kunnen remmen. Los uiteindelijk de DNA-pellet op in 100 μL water (met ~4,5 mM DNA in een sondeset).
    LET OP: Deze stap wordt aanbevolen, zelfs als de sondes een standaard desalt zuivering door de fabrikant ondergingen. Een standaard filtergebaseerde zuivering kan werken in plaats van en in aanvulling op de ethanolneerslag.
  5. Kies twee spectrally verschillende fluoroforen met een monofunctionele NHS ester moiety, zodanig dat 5' en 3 ' mRNA sonde sets kunnen differentieel worden gelabeld. Bereid bijvoorbeeld Cy5 NHS ester voor op 5' mRNA-sondes en Cy3B NHS-ester voor 3' mRNA-sondes. Los elk type fluoroforen op in watervrije DMSO tot de laatste 20 mg/mL (~ 25 mM).
  6. Bereid 0,1 M natriumbicarbonaat (pH 8.5) vlak voor elke etiketteringsreactie. Blootstelling aan lucht voor een lange tijd zal de pH verlagen en de etikettering efficiëntie verminderen.
  7. Combineer voor de vervoegingsreactie het volgende: 15 μL van de Cy5 fluorofolaat (vanaf stap 1.5), 4 μL van 5' mRNA sondeset (vanaf stap 1.4), 75 μL natriumbicarbonaat (vanaf stap 1.6) en 7 μL water. Wikkel de buis met aluminiumfolie en schud op kamertemperatuur voor 3-6 uur.
    OPMERKING: Langere incubatie leidt niet noodzakelijkerwijs tot een grotere etiketteringsefficiëntie. Ook kan de reactie omhoog of omlaag worden geschaald als de concentraties van de componenten worden gehandhaafd.
  8. Herhaal de bovenstaande stap voor de 3 ' mRNA sonde set en de bijbehorende fluorofoforie (dat wil zeggen, Cy3B NHS-ester).
  9. Voer ethanol neerslag22 om niet-gereageerd kleurstof moleculen te verwijderen. Los de pellet op in ~50 μL TE buffer (10mM Tris-HCl pH 8.0 met 1mM EDTA).
  10. Schat de concentraties DNA en fluorofoforeren met behulp van een UV-Vis spectrometer.
    1. Meet de absorptie op 260 nm en 559 nm (Cy3B) of 649 nm (Cy5). Als het monster te geconcentreerd is om een nauwkeurige meting op te leveren, verdun dan 1 μL van het monster tot 10 μL.
    2. Zet de absorptie om in de concentratie:
      Equation 1
      Equation 2
      Equation 3
      εDNA = 0,2 μM-1 (voor 20-nt enkelstrengs DNA), εCy5 = 0,25 μM-1, en εCy3B = 0,13 μM-1
      OPMERKING: [DNA] is de concentratie van totale sondes in de oplossing. De concentratie van individuele sondes is ongeveer 24x lager. De concentratie van de totale sondes zal worden gebruikt als "sonde concentraties" vanaf dit punt. Als de verhouding tussen [DNA] en [kleurstof] 1 is, kan de volgende HPLC-stap23worden overgeslagen en moet het monster worden verdund tot de uiteindelijke 4-5 μM in de TE-buffer.
  11. (Aanbevolen) Zuiver de gelabelde sondes van niet-gelabelde sondes en vrije kleurstoffen met behulp van HPLC.
    OPMERKING: Hoewel deze extra zuiveringsstap zal leiden tot het verlies van monsters, is het gunstig voor de downstream-toepassingen. Verwijdering van niet-gelabelde DNA-sondes zal het fluorescentiesignaal van mRNA-doelen verhogen en het verwijderen van niet-gereageerde kleurstoffen zal de achtergrondfluorescentie verminderen.
    1. Bereid HPLC voor met een standaard analytische C18-kolom, 0,1 M triethylammoniumacetaat (TEAA) als buffer A en acetonitril als buffer B.
    2. Voeg 1 M TEAA toe aan het monster (van stap 1.9) om 0,1 M TEAA te maken.
    3. Stel het verloopprogramma als volgt in: 0-5 min met 0% B, 5-35 min met een 0-30% lineair verloop van B, 35-37 min met een 30-100% lineair verloop van B, en 37-40 min met 0% B. Houd de stroomsnelheid op 0,1 mL/min en neem chromatogrammen op 260 en 649 nm (voor de Cy5-gelabelde monsters) of op 260 en 559 nm (voor de Cy3B-gelabelde monsters).
    4. Verzamel het geëuterde monster wanneer de absorptie van zowel DNA als fluorofoforische kanalen toeneemt.
    5. Concentreer het geëuteerde monster met behulp van een vacuümconcentrator en schort de pellet opnieuw op in een TE-buffer van 50-100 μL.
  12. Controleer de concentratie DNA en fluorofofoër met behulp van een UV-Vis spectrometer (zie Stap 1.10). Verdun, indien nodig, om de uiteindelijke concentratie rond 4-5 μM te maken. Bewaar de sondes op -20 °C

2. Voorbereiding van oplossingen

  1. Bereid een groot volume met DEPC-behandeld water en buffers voor(tabel 1). Deze oplossingen kunnen meer dan een jaar meegaan bij kamertemperatuur.
  2. Bereid 4x bevestigingsoplossing en wasoplossing(tabel 1).
  3. Bereid de pre-hybridisatieoplossing voor en sondehybrideoplossing(tabel 1). Bereid de hybridisatieoplossing van de sonde voor tijdens incubatie in stap 5.1 of stap 6.1 en bewaar de oplossing vervolgens 20-40 minuten in een aanrechthaker van 37 °C met een afdekking om de blootstelling aan licht te minimaliseren.
    OPMERKING: De concentraties van formamide, SSC en lacZ sonde werden geoptimaliseerd voor de lacZ-sondesets om de achtergrondfluorescentie te minimaliseren terwijl het echte signaal wordt gemaximaliseerd. Zie de sectie Discussie voor meer informatie over het wijzigen van deze concentraties voor verschillende toepassingen.

3. Bereiding van afdekplaten en glazen platen

  1. Schone coverslips en glazen glijbanen.
    1. Plaats individuele covers en glijbanen in een Coplin pot met behulp van tangen. Zorg ervoor dat de covers en dia's worden gescheiden en elkaar niet raken.
    2. Vul de pot met 100% ethanol en sluit het deksel. Plaats de pot in een waterbad ultrasone reiniger en sonicaat voor 15-20 min.
      LET OP: Voor de waterbadsonde wordt aanbevolen om de verwarmingsfunctie uit te schakelen.
    3. Giet ethanol uit en was 3-4x met ultrazuiver water. Gebruik water dat rechtstreeks uit de waterzuiveringsmachine stroomt.
    4. Giet het water uit de pot en vul het met 70% ethanol. Sluit het deksel en voer sonicatie uit gedurende 15-20 minuten en was met ultrazuiver water.
    5. Vul de pot met ultrazuiver water en sonicaat gedurende 15-20 minuten.
      LET OP: Coverslips en glazen platen kunnen 's nachts worden bewaard in de Coplin pot gevuld met ultrazuiver water.
    6. Neem een glijbaan of een coverslip uit de Coplin pot met behulp van schone tangen en föhnen met behulp van N2 gas. Herhaal dit voor de resterende dia's en coverslips.
  2. Plaats de gedroogde glijbanen in een schone opbergdoos tot gebruik in stap 7.5. Plaats de gedroogde coverslips in een lege 1.000-μL pipet tip box, die zal dienen als een "kamer" in de resterende procedure.
  3. Teken met behulp van een hydrofobe marker cirkels op de covers na cirkelvormige gaten in de pipettetipbox. Deze cirkels (~ 0,5 cm in diameter) zullen dienen als "putten". Wacht minstens 5-10 minuten voordat de marker volledig gedroogd is.
    LET OP: Houd altijd het deksel van de tipbox gesloten.
  4. Breng een 20-μL druppel van 0,1% poly-L-lysine aan op elke put. Incubeer gedurende 10-50 min bij kamertemperatuur.
    LET OP: Pas dit volume aan op basis van de putgrootte. Zorg ervoor dat de oplossing het putgebied volledig bedekt. Voor langere incubatie, wees voorzichtig om verdamping te voorkomen.
  5. Na incubatie aanzuigen poly-L-lysine zonder het oppervlak aan te raken, omdat dit de poly-L-lysine eraf schraapt. Breng vervolgens een druppel (~ 20 μL) dePC-water aan op de poly-L-lysine behandelde putten. Sluit het deksel van de "kamer" om verdamping te voorkomen tot stap 5.1.

4. Experiment voor tijd en monsterfixatie

  1. Kweek E. coli cellen in ~20 mL vloeibare cultuur in een kolf van 250 mL. Bewaar de kolf in een waterbadshaker (30 °C) en blijf schudden. Stop de shaker alleen bij het nemen van monsters.
    OPMERKING: De resultaten in dit document worden verkregen uit MG1655 cellen geteeld in M9 minimaal medium aangevuld met 0,2% glycerol, 0,1% casamino zuren, en 1 mg / L thiamine tot een exponentiële groeifase (OD600~ 0,2).
  2. Voeg 250 μL van de 4x bevestigingsoplossing toe in een lege buis van 1,5 mL. Herhaal en bereid meerdere buizen, zo veel als de tijd punten worden genomen. Label de buizen met tijdpuntnummers en houd ze op kamertemperatuur.
  3. Neem 750 μL celcultuur (OD600~0.2) voordat u een time-course experiment start. Voeg de cultuur toe aan een buis met de vermelding 'tijd nul' (vanaf stap 4.2). Draai de buis voorzichtig om om cellen te mengen met de bevestigingsoplossing.
    OPMERKING: Niet pipette op en neer te mengen, vortex, of "ruw" op de cellen. Dit monster vertegenwoordigt de onderdrukte toestand en zal worden gebruikt als een controle om de fluorescentieintensiteit van een enkel mRNA te berekenen (zie stap 9.4).
  4. Voeg 0,02-1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) toe aan de vloeibare cultuur om lacZ-expressie te induceren. Start een timer op dit punt (t = 0 min) en proef vanaf dat moment op een bepaald tijdsinterval (bijvoorbeeld elke 1 min). Herhaal stap 4.3 voor steekproeven.
  5. Voeg 5 mM orthonitropheynl-β-D-fucopyranoside (ONPF) of 500 mM glucose24 toe op een bepaald moment tijdens het tijdscursusexperiment (bijvoorbeeld op t = 1,5 min) om lacZ-expressie te onderdrukken. Na re-onderdrukking, blijven proeven van de culturen (Stap 4.3) om mRNA degradatie te volgen.
    OPMERKING: Repressie kan ook worden gedaan met ~ 400 μg/mL rifampicin, een transcriptie initiatieremmer25.
  6. Voor fixatie, incubeer de buizen met bemonsterde cellen bij kamertemperatuur gedurende 15 minuten, gevolgd door incubatie in ijs gedurende 30 min.
  7. Om fixatiemiddelen te verwijderen, centrifugeren de buizen op 4.500 x g gedurende 4 min bij kamertemperatuur. Verwijder de supernatant met een pipet.
    LET OP: Zorg ervoor dat u formaldehyde in een aparte afvalcontainer verwijdert volgens het veiligheidsprotocol.
  8. Voeg 1 mL DEPC-PBS toe en schort de cellen opnieuw op. Herhaal centrifugatie en re-schorsing 2x meer keer.
    LET OP: Vaste cellen zijn kwetsbaar en moeten worden behandeld. Voorzichtig opnieuw op te schorten de pellet en te voorkomen dat bubbels.
  9. Na de laatste wasstap worden cellen opnieuw opgehangen in ~30 μL DEPC-PBS.

5. Permeabilisatie van celmembranen

  1. Breng elk keer puntmonster aan op verschillende putten op de coverslip (~30 μL per put). Wacht 10-30 min bij kamertemperatuur voor cellen te hechten aan het oppervlak. Vermijd het samenvoegen van de vloeibare druppels tussen putten.
  2. Om niet-gebonden cellen af te spoelen, de vloeistof aan te spoelen en ~20 μL DEPC PBS op elke put aan te brengen. Aspirate DEPC PBS binnen een paar minuten.
  3. Permeabiliseren van de celmembranen door het toepassen van 15 μL van 70% ethanol op elke put gedurende 4 min. Aspirate de ethanol na de 4 min, en zorg ervoor dat de putten zijn volledig droog.
    OPMERKING: Het is van cruciaal belang om de ethanolbehandeling gedurende 4 minuten te beperken. Langere behandeling zal resulteren in over-permeabilisatie.
  4. Breng 30 μL van de wasoplossing aan op elke put.

6.

  1. Aspirate de wasoplossing van elke put. Breng 30 μL van de pre-hybridisatieoplossing aan op elke put. Broed de kamer in de 37 °C oven gedurende 30 min.
    OPMERKING: Voeg ~ 50 mL water toe aan de bodem van de kamer om vochtigheid te bieden.
  2. Aspirate de pre-hybridisatie oplossing van elke put. Breng ~30 μL van de sondehybrideoplossing aan op elke put. Bedek de kamer met aluminiumfolie en broed gedurende 2 uur in de oven van 37 °C.
    OPMERKING: Zorg ervoor dat de sondehybrideoplossing zich voor deze stap in de 37 °C-aanrechtshaker bevindt. Vermijd het samenvoegen van vloeistoffen tussen putten. Breng een kleiner volume van de oplossing aan op elke put, indien nodig.

7. Wasbeurt na hybridisatie en voorbereiding op beeldvorming

  1. Breng met behulp van een meerkanaals pipet ~ 30 μL van de wasoplossing aan op elke put in één keer. Aanzuigen en herhalen 3-5x keer wassen. Broed de kamer in de 37 °C oven gedurende 15-30 min.
  2. Herhaal stap 7.1 nog twee keer.
  3. Was elk goed met DEPC-PBS 5x keer. Volg de methode die wordt gebruikt in stap 7.1, maar sla het incubatieproces over.
  4. De vloeistof uit de coverslip aanzuigen. Breng 4 μL DEPC-PBS aan op elke put.
  5. Met behulp van tangen, til en flip de coverslip, en plaats het voorzichtig over een glazen glijbaan (van stap 3.2). Vermijd bubbels.
  6. Verzegel de randen van de coverslip met siliconen tandvlees.
  7. Wacht tot het tandvlees is gestold. Men kan hier pauzeren en de glijbaan 's nachts op 4 °C bewaren.
    OPMERKING: Andere smFISH protocollen suggereren het toevoegen van zuurstof opruiming reagentia (bijvoorbeeld glucose oxidase / catalase) of het gebruik van een commerciële anti-fade montage medium14,26 om de lichtheid van de fluoroforen te verhogen.

8. Beeldvorming

  1. Gebruik de live-modus van fasecontrastbeeldvorming om een interessegebied te vinden. Verander het gezichtsveld binnen een put door het manoeuvreren van het podium joystick. Kies een gebied waar de celdichtheid optimaal is (dat wil zeggen, er zijn veel cellen die meestal gescheiden zijn). Pas z-focus zodanig aan dat celafbeeldingen met fasecontrast scherp zijn.
  2. Maak snapshots in de volgorde van Cy5 (4-s belichting), Cy3 (2-s belichting) en fasecontrast (0,2-s belichting).
    OPMERKING: Cy3B kleurstof moleculen zijn afgebeeld in de Cy3 kanaal, en de beelden worden aangeduid als Cy3 beelden.
  3. Herhaal stappen 8.1-8.2 om beelden van ~ 10 verschillende gebieden binnen een put te verwerven.
  4. Verplaats het doel naar een andere put en herhaal stappen 8.1-8.3.
  5. Afbeeldingen exporteren als TIFF-bestanden.
  6. (Optioneel) Afbeeldingskralen met meerdere kleuren die op het coverslipoppervlak in Cy5- en Cy3-kanalen worden geadsorbeerd om de ruimtelijke verschuiving tussen Cy5- en Cy3-kanalen te bepalen voor beeldregistratiedoeleinden.
    1. Breng ~10 μL fluorescerende kralen (0,2 μm diameter) aan op een schoon coverslipoppervlak en wacht 10-30 min. Breng na het wassen met ~50 μL PBS ~5 μL PBS en sandwich de coverslip met een glazen schuif aan. Verzegel en monteer op de microscoop.
    2. Afbeeldingskralen in zowel Cy5- als Cy3-kanalen.

9. Beeldanalyse

OPMERKING: Matlab-code die in deze stap wordt gebruikt, is beschikbaar op de volgende GitHub-website: https://github.com/sjkimlab/Code_Publication/tree/master/JoVE_2020. De GitHub-map bevat alles wat nodig is voor de beeldanalyse, inclusief parameterwaarden voor celsegmentatie en spotidentificatie. De procedure in deze stap wordt verder uitgelegd in het master script, genaamd "FISHworkflow.m".

  1. Open een celsegmentatiegereedschap, zoals microbeTracker27 of Oufti28, en laad fasecontrastbeelden. Kies "Onafhankelijke frames" en druk op een knop genaamd "Alle frames" om het segmentatieproces te starten, waaruit cellen worden geïdentificeerd en hun contouren worden berekend (figuur 3B,C).
    LET OP: Gedetailleerde protocollen voor het gebruik van deze softwarepakketten zijn online beschikbaar (bijvoorbeeld oufti.org).
  2. Laad Cy5 fluorescentiebeelden in de spotFinder-functie van microbeTracker of Oufti en druk op de "Run"-knop om te beginnen met het identificeren en kwantificeren van 2D Gaussian(Figuur 3B,C). Herhaal deze stap voor Cy3 fluorescentie beelden om vlekken te analyseren in het Cy3-kanaal. Deze stap produceert een lijst van vlekken in elke cel, inclusief hun intensiteiten en coördinaten.
  3. (Optioneel) Filter dim spots (false positives) met behulp van een drempelwaarde, zoals uitgelegd in het FISHworkflow.m-bestand.
    OPMERKING: Onderzoek fluorescerende vlekken in de negatieve controle (bijvoorbeeld MG1655 ΔlacZ)en bepaal de drempel om foute positieven eruit te filteren.
  4. Om de spotintensiteit van één mRNA te verkrijgen, gebruikt u een lijst met spotintensiteiten gemeten op tijd nul (voordat IPTG wordt toegevoegd) en past u de verdeling van de spotintensiteiten met een Gaussian mengselmodel met twee mengselcomponenten. Neem de piekpositie van de eerste Gaussische bevolking (zwarte lijn in figuur 3D,E)als de spotintensiteit van een enkele mRNA. Voer dit afzonderlijk uit voor Cy5 spots en Cy3 spots om de spotintensiteit van een enkele 5' en 3' lacZ mRNA te verkrijgen.
    OPMERKING: Herhaal dit in elk time-course experiment omdat de spotintensiteit van een enkel mRNA enigszins kan variëren in verschillende experimenten.
  5. Verdeel de fluorescentieintensiteit van een vlek met de intensiteit van een enkel mRNA (vanaf stap 9.4) om het aantal mRNAs binnen een vlek te verkrijgen. Som genormaliseerde spotintensiteiten in een cel om het totale aantal mRNA in een cel te berekenen (figuur 3F). Voer deze berekeningen voor 5' en 3' mRNA afzonderlijk uit.
  6. Bereken en plot de gemiddelde mRNA-getallen per cel op elk tijdstip (bijvoorbeeld figuur 4B)en analyseer de in vivo kinetiek van transcriptie en mRNA-afbraak van de temporele verandering in de gemiddelde mRNA-niveaus(figuur 4B).
    1. Om de snelheid van transcriptieverlenging te verkrijgen, voert u een minste vierkanten uit die past bij de initiële stijging van de 5' en 3' mRNA-signalen en identificeert u onderscheppingen tot de basisniveaus (figuur 4B). Het verschil tussen deze onderscheppingen geeft de gemiddelde tijd aan voor RNAPs om van het 5'-sondegebied naar het 3'-sondegebied te reizen. Verdeel de afstand tussen twee sondesets (2 kb) met deze tijd om de gemiddelde snelheid van transcriptieverlenging te verkrijgen.
    2. Om de snelheid van mRNA-degradatie te verkrijgen, past u een exponentiële vervalfunctie, y = A·exp(-t/τ) in het uiteindelijke vervalgebied van de mRNA-signalen van 5 en 3 (bijvoorbeeld figuur 4B). De montageparameter, τ, is de gemiddelde mRNA levensduur.
  7. (Optioneel) Analyseer de cel-naar-celvariatie in genexpressie (bijvoorbeeld de respons op celniveau op de inductie in figuur 4C),op basis van de verdeling van mRNA-getallen in elke cel (berekend in stap 9.5).
  8. (Optioneel) Met behulp van informatie over de locatie van de spot langs de grote en kleine assen van een cel (verkregen uit stap 9.2), analyseren van de lokalisatie van mRNAs (Figuur 4D,E).
  9. (Optioneel) Analyseer colokalisatie van 5' en 3' mRNAs (figuur 5) door lokalisatie van gedetecteerde vlekken in de Cy5- en Cy3-kanalen te vergelijken.
    1. Laad afbeeldingen van multi-color kralen (stap 8.6) in de spotFinderF-functie in microbeTracker en verkrijg coördinaten van kralencentroïden in Cy5- en Cy3-kanalen. Gebruik de lijst met centroidcoördinaten om de affinetransformatiematrix te berekenen, die informeert hoe Cy5- en Cy3-kanalen worden verschoven en ten opzichte van elkaar worden gedraaid29.
    2. Pas de affine transformatiematrix toe op Cy5- en Cy3 FISH-afbeeldingen om Cy3-afbeeldingen om te zetten in de Cy5-coördinaat. Classificeer of een spot co-gelokaliseerd is met een andere plek in een ander kanaal. Bijvoorbeeld, een plek in de Cy5 kanaal wordt beschouwd als co-gelokaliseerd met een andere plek in de Cy3 kanaal als de afstand tussen hun centroids is minder dan 150 nm (Figuur 5).
    3. Analyseer hoeveel Cy5 spots worden geclassificeerd als "co-gelokaliseerd" met Cy3 vlekken op elk moment punt. Analyseer ook de intensiteit van de co-gelokaliseerde vlekken(figuur 5).

Representative Results

Figuur 3 toont representatieve afbeeldingen van dit smFISH protocol. Een volledig gezichtsveld (86,7 μm x 66,0 μm met behulp van onze microscopie-opstelling, beschreven in tabel van materialen),toont ~500 E. coli-cellen verspreid over het hele veld(figuur 3A). Als de dichtheid van cellen veel hoger is dan wat in deze afbeelding wordt weergegeven, wordt automatische celsegmentatie moeilijk omdat segmentatiealgoritmen afzonderlijke cellen niet betrouwbaar identificeren wanneer cellen elkaar raken. Men moet de concentratie van cellen en incubatietijd die wordt gebruikt voor oppervlakteafhankelijkheid (Stap 5.1) aanpassen om de optimale dichtheid van cellen in het gezichtsveld te bereiken.

De morfologie van cellen in de fasecontrastbeelden moet voor segmentatiedoeleinden vergelijkbaar blijven met die van levende cellen (figuur 3A-C). Als cellen over-permeabiliseerd zijn, verandert de celmorfologie (als "spoken"; Aanvullend figuur 1). In dat geval kan men de duur van de behandeling met 70% ethanol in stap 5.3 verminderen.

Vóór inductie bedroeg het gemiddelde lacZ-expressieniveau ~0,03 mRNAs per cel, in overeenstemming met eerdere rapporten15,30. Ook paste de verdeling van lacZ mRNA-spotintensiteiten vóór inductie niet goed bij een normale verdeling of een Poisson-verdeling vanwege de aanwezigheid van vlekken met hoge intensiteiten (figuur 3D,E). Dit suggereert dat de meeste van de vlekken gedetecteerd onder de onderdrukte staat vertegenwoordigen een enkele lacZ mRNA, maar een kleine populatie van vlekken bevat meer dan een lacZ mRNA. Om de populatie te isoleren met een enkele lacZ mRNA, gebruikten we een Gaussian mengselmodel met twee mengselcomponenten (insets in figuur 3D,E). Vervolgens werd het gemiddelde van de eerste Gaussian genomen als de gemiddelde intensiteit van een enkele mRNA-spot (bijvoorbeeld de piek van de zwarte curve in figuur 3D)en gebruikt om de spotintensiteit om te zetten in het aantal mRNAs, voor alle plekken die worden gedetecteerd in het tijdsloopexperiment. Om het totale aantal mRNAs binnen een cel te berekenen, werden de genormaliseerde steunintensiteiten samengevat in elke cel (figuur 3F)19.

Wanneer het expressieniveau van lacZ mRNA laag is, zijn er een of twee diffractie-beperkte lacZ mRNA vlekken ruimte gescheiden in een cel. Vandaar dat de beelden van deze vlekken kunnen worden geanalyseerd door 2D Gaussian montage voor hun intensiteit en lokalisatie.

Wanneer het expressieniveau hoog is, zodanig dat vlekken elkaar overlappen in een cel, doet 2D Gaussische fitting geen betrouwbare kwantificering. In dat geval moet het mRNA-niveau worden berekend door het totale, met achtergrond afgetrokken fluorescentiesignaal in een cel te delen met de gemiddelde intensiteit van één mRNA19.

Wanneer de expressie van lacZ wordt geïnduceerd, neemt eerst het signaal van 5' lacZ mRNA toe en dat van 3' lacZ mRNA later (figuur 4B). Als de expressie van lacZ wordt onderdrukt, nemen zowel 5' als 3' lacZ mRNA-signalen af met enige vertraging tussendoor (figuur 4B). Om de snelheid van transcriptieverlenging te verkrijgen, zijn de stijging van 5' en 3' signalen eerst geschikt met lijnen(figuur 4B), en het verschil in x-intercepties worden genomen als de tijd voor RNAPs om de afstand tussen twee sondegebieden (2.000 nt) te reizen. De snelheid van de transcriptieverlenging kan worden gemeten vanaf elk time-course experiment en standaarddeviaties kunnen worden berekend op basis van experimentele duplicaten. Het gemiddelde percentage transcriptie verlenging was 15-30 nt/s onder onze experimentele omstandigheden19.

Bovendien werd de snelheid van mRNA-afbraak (omgekeerd van de gemiddelde mRNA-levensduur) verkregen door het vervalgebied te voorzien van een exponentiële functie(figuur 4B). Onze tijdsloopgegevens bevatten mRNA-degradatie tijdens en na transcriptie31. We passen de tijd punten na 3 'mRNA begon te rotten (t > 6 min) om de afbraak van vrijgegeven mRNAs sonde. We verkregen ~90 s als een gemiddelde levensduur van 5' of 3' lacZ mRNA19.

De mate van transcriptie-initiatie kan worden berekend vanaf de helling van 5' signaalstijging na inductie(figuur 4B, blauw), of van het gemiddelde mRNA-getal in stabiele toestand (het initiatiepercentage gedeeld door het afbraakpercentage). Bovendien kan de waarschijnlijkheid van voortijdige transcriptiebeëindiging worden geschat, hetzij door de verhouding tussen de helling van 3' signaalverhoging ten opzichte van die van 5' signaalverhoging32 of tussen de steady-state niveaus van 3' en 5' mRNA-regio's19.

Omdat smFISH een eencellige techniek is, kunnen we cel-naar-cel variabiliteit in transcriptie analyseren. Men kan bijvoorbeeld het percentage cellen analyseren dat lacZ mRNA uitdrukt nadat IPTG is toegevoegd(figuur 4C). Men kan ook ingaan op de vraag of mRNA lokalisatie verandert na inductie. We merkten op dat 5' en 3' lacZ mRNA spots iets naar buiten bewegen, weg van het midden van de cel(figuur 4D,E), in overeenstemming met een eerder rapport33.

Ten slotte kan de analyse van colokalisatie tussen 5' en 3' mRNA spots informatief zijn (figuur 5A). Bijvoorbeeld, in de onderdrukte toestand (tijd nul), ongeveer 25% van de 5 'mRNA vlekken zijn co-gelokaliseerd met een 3 'mRNA plek. Op t = 1 min, zoals veel gen loci hebben 5 'mRNA synthese, maar nog niet 3 'mRNA synthese, de meeste van de 5 'mRNA vlekken zijn op zichzelf zonder 3 'mRNA signaal (dat wil zeggen, lage kans op co-lokalisatie). Wanneer het mRNA van 3 wordt weergegeven (d.w.z. t = 2 min), neemt de kans op colokalisatie echter toe (paarse pijl in figuur 5A,B). Dit tijdpunt, wanneer de co-lokalisatie frequent wordt, hangt af van de snelheid van de transcriptieverlenging. De 2-D dichtheid plot van 5' en 3 ' lacZ mRNA nummers binnen elke co-lokalisatie plek gedetecteerd op dit moment punt kan worden gebruikt om de dichtheid van RNAPs afleiden op de lacZ gen (Figuur 5C). Zoals eerder gemeld19, de 5 'mRNA nummers in dit perceel geven aan dat de meeste van de lacZ loci hebben minder dan 10 RNAPs op het DNA wanneer lacZ expressie wordt veroorzaakt door 1 mM IPTG. Bovendien zijn de 3'mRNA-getallen in dit perceel gerelateerd aan de clustering van RNAPs34. Het feit dat het aantal van 3' mRNA dicht bij één is betekent dat ruwweg slechts één RNAP het 3' sondegebied binnengaat. Dit suggereert dat RNAPs op het lacZ-gen ruimtelijk gescheiden zijn, in plaats van een cluster (of "konvooi" te vormen).

Figure 1
Figuur 1: Ontwerp van smFISH sondes voor een mRNA van belang. (A) Een tegelmethode. Sequenties van korte DNA oligonucleotiden (~ 20 bp in lengte) worden gekozen, zodat ze het mRNA van belang kunnen dekken. De oligonucleotidesondes zijn gelabeld met een fluorescerend kleurstofmolecuul. (B) Een arraymethode. Een niet-coderingsarray van tandemsequentieslacO (bijvoorbeeld " lacO-array") wordt transcriptie gefuseerd met het mRNA van belang. Fluorescerend gelabelde sonde complementair aan de herhalingseenheid (bijvoorbeeld lacO-sonde van 17 bp in lengte) wordt gebruikt om het signaal van een mRNA te versterken. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 2
Figuur 2: Schematisch van smFISH experimentele procedure en tijdsduur van elke stap. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 3
Figuur 3: smFISH beeldanalyse. (A-C) smFISH microscopie beeld van 5' lacZ mRNA (rood) en 3' lacZ mRNA (groen) in wilde-type E. coli (MG1655) geteeld in M9 minimaal medium aangevuld met 0,2% glycerol, 0,1% casaminozuren en 1 mg/L thiamine bij 30 °C. (A) Een representatieve afbeelding van een monster van t = 3 min na inductie met 0,05 mM IPTG bij t = 0 min en repressie met 500 mM glucose op t = 1,5 min. Fasecontrast en twee fluorescentiebeelden van Cy5 (voor 5' lacZ mRNA, red) en Cy3 (voor 3' lacZ mRNA, groen) werden bedekt met pseudo-kleuren. De afbeelding toont een volledig veld van 86,7 μm x 66,0 μm. Schaalbalk, 5 μm. (B) Inzoomversie van een klein gebied (geel vak) in (A). Celcontouren worden weergegeven in wit en fluorescentievlekken die zijn geïdentificeerd op uit beeldanalyse worden weergegeven met rode stippen. Schaalbalk, 1 μm. (C) Detectie van celcontouren en tl-vlekken onder een hoge expressieconditie (t = 4 min na inductie met 1 mM IPTG). Schaalbalk, 1 μm. (D-E) Distributies van 5' en 3' mRNA spot intensiteiten gemeten voor het toevoegen van IPTG (de onderdrukte toestand). De histogrammen worden getoond met twee Gaussische functies (zwart en grijs) waarvan de gemiddelde waarden zijn van de Gaussische mengsel model. De inzet toont quantile-quantile plot van willekeurige getallen gegenereerd uit de Gaussische mengselmodellen en experimenteel gemeten mRNA-spotintensiteiten (n = 1040 voor 5' mRNA en 680 voor 3' mRNA). (F) Informatie verkregen voor een in paneel (B) puntige individuele cel. Voor een bepaalde cel (i), vlekken werden geïdentificeerd in Cy5 en Cy3 kanalen, en hun intensiteit (I) en coördineren langs de korte en lange as van een cel (d, l) werden gekwantificeerd uit 2D Gaussian montage. Na normalisatie werden de spotintensiteiten samengevat om het totale aantal 5' of 3' mRNAs in deze cel op te leveren. Co-lokalisatie tussen spots uit verschillende kanalen kan ook worden geanalyseerd zoals in het voorbeeld in figuur 5. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 4
Figuur 4: Analyse van in vivo kinetiek van transcriptie en mRNA-afbraak. (A) Schematische en representatieve afbeeldingen van tweekleurige smFISH-experimenten die veranderingen in lacZ mRNA-niveaus in de loop van de tijd meten. Rode en groene stippellijnen geven Cy5- of Cy3B-gelabelde oligonucleotidesondes aan die hybridiseren naar de 1-kb-lange 5' en 3' mRNA-gebieden van respectievelijk lacZ mRNA in E. coli. Ook getoond zijn overlays van twee fluorescentie beelden met een fase contrast beeld op aangegeven tijdstippen na inductie met 0,2 mM IPTG op t = 0 min. Transcriptie werd onderdrukt met 500 mM glucose op t = 1,5 min. Schaalbalk, 1 μm. Het cijfer is gewijzigd van Kim etal. 19. (B) 5' en 3' lacZ mRNA-getallen per cel in de loop van de tijd, tijdens het in het paneel beschreven experiment (A). Foutbalken zijn bootstrapped SEMs. Minstens 1.200 cellen werden geanalyseerd per tijdspunt. De initiële stijging van de 5' en 3' mRNA signalen was fit met een lijn (blauw). Het verschil in x-intercepts was 1,93 min, wat de gemiddelde snelheid van transcriptie van 17,3 nt/s opleverde. Het laatste verval van de 5' en 3' mRNA signalen was fit met een exponentiële vervalfunctie (grijs). De fit parameters geven aan dat de gemiddelde mRNA levensduur is 1,52 min voor 5 ' mRNA en 1,66 min voor 3 'mRNA. (C) Percentage cellen met een of meer lacZ mRNA vlekken tijdens het experiment beschreven in (A). Foutbalken zijn bootstrapped SEMs. (D) Lokalisatie van een vlek langs de korte as van een cel. Men kan de nabijheid van een vlek tot het membraan kwantificeren door de locatie langs de korte as(d)te delen met de halve breedte van de cel(w). (E) Verandering in de lokalisatie van 5' en 3' lacZ mRNA vlekken langs de korte as van cellen tijdens het experiment beschreven in (A). Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 5
Figuur 5: Analyse van colokalisatie van 5' en 3' mRNA spots. (A) Schematisch met de verwachte colokalisatie tussen 5' en 3' mRNA-vlekken na inductie. Wanneer 3' mRNA wordt gemaakt, neemt de kans op een 5' mRNA-spot co-gelokaliseerd met een 3'mRNA-spot toe (paarse pijl). (B) De kans op colokalisatie na inductie met 1 mM IPTG. De paarse pijl geeft het tijdspunt aan waar de kans op colokalisatie voor het eerst frequent wordt volgens het schema in paneel (A). (C) Het aantal lacZ-mRNAS van 5' en 3' binnen een colokalisatieplek die bij t = 2 min na inductie met 1 mM IPTG (totaal 841 plekken) wordt gedetecteerd. Grijze stippen vertegenwoordigen afzonderlijke colokaliseerde vlekken, terwijl rode stippen het gemiddelde van opgemaakte gegevens vertegenwoordigen. Foutbalken zijn SEM. De grijstint geeft de dichtheid van de punten in een bepaald gebied van de grafiek aan. De stippellijn geeft een helling van 1 aan. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 6
Figuur 6: Optimalisatie van de sondehybridetoestand. Er werden twee soorten monsters gebruikt: MG1655-cellen die worden gekweekt zoals beschreven in figuur 3 en niet geïnduceerd (blauw) blijven of gedurende 20 minuten (rood) met 0,5 mM IPTG worden behandeld. Sonde hybridisatie oplossing werd gemaakt met verschillende concentraties van sondes (totaal 72 Cy5-geconjugeerde sondes tegels de gehele lacZ regio) en van formamide. De formamideconcentraties werden ook aangepast in de pre-hybridisatieoplossing en de wasoplossing, dienovereenkomstig. "Geen sonde" (grijze lijn) geeft het fluorescentieniveau aan van de IPTG-toegevoegde cellen die zonder sondes tijdens de hybridisatiestap worden behandeld. Gemiddelde fluorescentieintensiteit genormaliseerd door celgebied (AU) werd berekend op basis van 300-800 cellen. Foutbalken zijn bootstrapped SEMs. Klik hier om een grotere versie van dit cijfer te bekijken.

Aanvullend figuur 1: Vervormde celmorfologieën toe te schrijven aan over permeabilisatie. Overlay van fasecontrast (grijze schaal), 5' lacZ mRNA (Cy5, red) en 3' lacZ mRNA (Cy3, groen) beelden van MG1655 cellen 5 min na de inductie met 1 mM IPTG. (A) Een voorbeeld met een mengsel van normale cellen en overdreven permeabiliseerde cellen zonder normale morfologie (aangegeven met roze pijlen). (B) Een voorbeeld met "spookachtige" cellen samengeklonterd. Schaalbalk = 1 μm. Klik hier om dit bestand te downloaden.

DEPC Water
Voeg 0,1% DEPC toe aan ultrazuiver water en broed de fles (bedekt) 's nachts in de 37°C oven en de volgende dag autoclave.
DEPC PBS (10x)
Meng het volgende:
80 g NaCl (finale 1.37 M)
2 g KCl (laatste 27 mM)
14,2 g Na2HPO4 (laatste 100 mM)
2,7 g KH2PO4 (finale 20 mM)
Ultrazuiver water naar 1L
Filter (0,22 μm) in een glazen fles.
Voeg 0,1% DEPC toe en volg de instructie voor DEPC-water.
Om 1X oplossing te maken, verdun je 10 keer met DEPC water.
1M DEPC natriumfosfaatbuffer, pH 7.4
Meng het volgende:
115 g Na2HPO4
22,8 g NaH2PO4
Ultrazuiver water tot 1 L
Filter (0,22 μm) in een glazen fles.
Voeg 0,1% DEPC toe en volg de instructie voor DEPC-water.
4X bevestigingsoplossing (16% formaldehyde)
5 mL 20% formaldehyde
500 μL DEPC water
750 μL 1M DEPC natriumfosfaatbuffer, pH 7.4
Bewaar tot 2-4 weken bij 4 °C.
LET OP: Formaldehyde is giftig. Draag handschoenen en gebruik een rookkap bij het maken van deze oplossing.
Wasoplossing
Meng het volgende:
10 mL Formamide (laatste 25%)
4 mL 20X SSC (laatste 2X)
Vul DEPC water tot 40 mL
Filter (0,22 μm) en op te slaan bij 4 °C
LET OP: Formamide is giftig. Draag handschoenen en gebruik een rookkap bij het maken van deze oplossing.
Pre-hybridisatieoplossing
200 μL Formamide (laatste 20%)
100 μL 20X SSC (laatste 2X)
10 μL 100X VRC (laatste 1X)
25 μL 4% (w/v) BSA (finale 0,1%)
685 μL DEPC water
LET OP: Vortex de VRC voorraad voordat u 10 μL uit.
LET OP: Formamide is giftig en een bekende teratogene. Draag handschoenen en behandel het onder een rookkap.
Probe hybridisatie oplossing
200 μL Formamide (laatste 20%)
100 μL 20X SSC (laatste 2X)
10 μL 100X VRC (laatste 1X)
25 μL 4% (w/v) BSA (finale 0,1%)
10 μL 40 mg/mL E. coli tRNA (laatste 0,4 mg/mL)
200 μL 50% dextran sulfaat (laatste 10%)
x μL 5' mRNA sondeset (van stap 1.12) tot de laatste 4 nM.
y μL 3' mRNA sondeset (van stap 1.12) tot de laatste 4 nM.
- DEPC water om het totale volume 1 mL te maken
OPMERKING: Voeg dextran sulfaat als laatste toe. Omdat het erg stroperig is, snijd het uiteinde van een pipetpunt voordat u 200 μL uit de 50% voorraad haalt. Na het toevoegen van dextran sulfaat, pipet op en neer om de oplossing te homogeniseren.

Tabel 1: Recepten van de gebruikte oplossingen.

Discussion

Hier presenteerden we een smFISH protocol voor het meten van mRNA kinetiek in E. coli. In de eerder gepubliceerde smFISH protocollen voor bacteriën23, cellen werden bewaard in de buizen tot het einde van het protocol, dat wil zeggen totdat ze klaar zijn voor beeldvorming. Hoewel het vele voordelen heeft, zoals minimale niet-specifieke binding van fluorescerende sondes op het coverslip oppervlak23,is het moeilijk om deze protocollen te volgen wanneer er veel monsters zijn van een tijdscursusexperiment. Ten eerste moet een relatief groot volume cellen (>1 mL) worden bemonsterd en zelfs geoogst vóór fixatie. Ten tweede moeten de celmonsters meerdere keren worden gecentrifugeerd om oplossingen uit te wisselen en te wassen na de hybridisatiestap. In ons protocol wordt een klein volume (<1 mL) van cultuur direct gemengd met een bevestigingsoplossing in een 1,5 mL-buis, waardoor de celtoestand op het moment van bemonstering snel wordt "bevroren". Ook blijven cellen tijdens de procedure aan het oppervlak bevestigd en kunnen verschillende oplossingen snel worden uitgewisseld door vloeistoffen te aspireren met een vacuümfiltratiesysteem en het toepassen van oplossingsdruppels in een keer met een multi-channel pipet. Dit verschil maakt ons protocol zeer voordelig wanneer een groot aantal monsters in één keer moet worden verwerkt. Met behulp van ons protocol kunnen 12-48 monsters gelijktijdig worden behandeld en kan de volledige FISH-procedure binnen ~ 8 uur worden voltooid, ongeveer een vergelijkbare hoeveelheid tijd die nodig is voor een paar monsters(figuur 2). Hoewel we de expressie van lacZ in E. coli als voorbeeld gebruikten, is het protocol breed toepasbaar op verschillende genen en bacteriële soorten met overwegingen die hieronder worden besproken.

Voor verschillende genen, het eerste ding om te overwegen is smFISH sondes. Men kan oligonucleotidesondes ontwerpen die het mRNA van belang tegelen (Figuur 1A)13. In deze "tegel" sonde aanpak, elke sonde is ~ 20 basis lang en gelabeld met een fluorofofre op de 5 'of 3 'eindpunt. Deze strategie is handig omdat er geen genetische manipulatie nodig is. Als alternatief kan een tandemrecitie van ~20 bp-sequentie, vreemd lacO aan de genomische sequentie (bijvoorbeeld een array van lacO-sequentie in Caulobacter crescentus14),worden ingevoegd in het onvertaalde gebied van een gen van belang en wordt een enkele sonde die complementair is aan de herhalingseenheid gebruikt om de mRNA -benadering te labelen; Figuur 1B). In beide gevallen versieren meerdere fluoroforen een mRNA, waardoor een versterkt fluorescentiesignaal wordt gegeven dat gemakkelijk kan worden onderscheiden van een enkele sonde die niet specifiek in een cel is gebonden.

Of het nu gaat om "tegel" of "array"-benaderingen, hangt af van de negatieve controle, een monster waarbij niet-specifieke binding van sondes wordt getest omdat het doelmRNA ontbreekt. Voor tegelsondes (figuur 1A), kan een gemuteerde stam zonder het gen van belang of een aandoening, waarbij het gen niet wordt getranscribeerd (bijvoorbeeld onderdrukking van lacZ)dienen als een negatieve controle voor het testen van niet-specifieke binding van sondes. Voor de array-gebaseerde smFISH (Figuur 1B), een wild-type stam ontbreekt de array kan dienen als een negatieve controle, omdat het geen bindende sites voor de sondes bevatten.

Optimale hybridisatie voorwaarden kunnen afhangen van de sonde sequenties en zelfs de keuze van fluorofofre kleurstoffen. We hebben de hybridisatievoorwaarde voor lacZ-sondesets geoptimaliseerd door de hybridisatietemperatuur op 37 °C te houden en verschillende concentraties sondesets en formamide in de hybridisatieoplossing te testen. lacZ Hogere concentraties van formamide hebben de neiging om zowel niet-specifieke als specifieke binding26,35te verminderen . We raden aan om de hybridisatie en de wasomstandigheden systematisch te veranderen terwijl de hybridisatietijd en temperatuur gelijk blijven. Naarmate de voorwaarde strenger wordt, nemen zowel niet-specifieke als specifieke bindingsdaling(figuur 6). Het is belangrijk om een punt te vinden waarop de niet-specifieke binding onder een aanvaardbare drempel begint te komen zonder de specifieke binding verder in gevaar te brengen. We gebruikten bijvoorbeeld het signaalniveau dat zonder sondes ("geen sondes") is verkregen als drempel(figuur 6).

De tweekleurige smFISH-methode die twee afzonderlijke gebieden van een mRNA labelt, is beperkt tot lange genen. Om de snelheid van transcriptieverlenging te meten, hebben we gebruik gemaakt van het feit dat lacZ lang is (3075 bp) en de expressie ervan kan worden veroorzaakt door IPTG. Wanneer een gen kort is, is het moeilijk om twee tegelsondesets te ontwerpen (bijna 5' en 3' uiteinden) en de vertraging tussen verschijningen van 5' versus 3' mRNA-regio's op te lossen. In dit geval kan men ontluikende mRNAs bij steady state tellen door smFISH en hun distributie analyseren met een analytisch model dat de snelheid van transcriptieverlenging heeft als een passende parameter20. Ook wanneer een gen van belang niet onduceerbaar is, kan men cellen met rifampicine op tijd nul behandelen en de temporele verandering in 5' en 3' mRNA sub-gebieden meten. De vertraging van de daling van het 5'mRNA-signaal tot dat van het mRNA-signaal van 3 kan vervolgens worden gebruikt om de snelheid van transcriptieverlenging te berekenen zoals eerder gedaan31.

Ten slotte is het smFISH-protocol veelzijdig en kan het worden gecombineerd met andere etiketteringsschema's. Voorheen werd DNA locus samen met mRNAs gevisualiseerd door mRNA FISH te combineren met DNA FISH14 of fluorescerend reporter-operator systeem20. Eiwitproducten kunnen worden gevisualiseerd door het uitvoeren van immunofluorescentie samen met mRNA FISH14,36. Ook kan het worden gecombineerd met driedimensionale microscopie met superresolutie37 om mRNAs in alle drie de dimensies38,39te visualiseren .

Disclosures

De auteurs verklaren dat zij geen concurrerende financiële belangen hebben.

Acknowledgments

Dit protocol werd ontwikkeld door S.K. tijdens haar postdoctoraal onderzoek in dr. Christine Jacobs-Wagner's laboratorium aan het Howard Hughes Medical Institute en het Microbial Sciences Institute aan de Yale University. Wij danken Dr Jacobs-Wagner en haar lableden voor verschillende input tijdens de methodeontwikkeling en Laura Troyer voor het kritisch lezen van het manuscript. S.K. erkent steun van het Searle Scholars Program; K.V. erkent de steun van James Scholar Preble Research Award van de Universiteit van Illinois.

Materials

Name Company Catalog Number Comments
Bacterial strain
Escherichia coli MG1655
Chemicals, peptides, and others
Acetonitrile Sigma-Aldrich 34851 UPLC buffer B
Ammonium chloride Fisher Chemical A661-500 To make M9 medium
Bovine serum albumin (BSA) Sigma-Aldrich B2518 Probe hybridization
Calcium chloride Acros Organics 349610250 To make M9 medium
Casamino acid BD Difco 223050 To make M9 medium
Cy3B NHS ester GE Healthcare Life Sciences PA63101 Fluorophore for FISH probes
Cy5 NHS ester GE Healthcare Life Sciences PA15101 Fluorophore for FISH probes
DEPC Sigma-Aldrich D5758
Dextran sulfate Millipore S4030 Probe hybridization
Dextrose Fisher Chemical D16 To repress the expression of lacZ
Dimethyl sulfoxide (DMSO) Sigma-Aldrich D8418 To dissolve fluorophores
E. coli tRNA Sigma-Aldrich R1753 Probe hybridization
Ethanol Decon Laboratories 2701 Used in DNA purification, lysis, and cleaning coverslips
FISH probes Biosearch Technologies Sequences are published in ref#16
Formaldehyde Ladd Research Industries 20295 Fixation
Formamide American Bio AB00600 Probe hybridization, pre-hybridization, and wash
Glycerol Americanbio AB00751-01000 To make M9 medium
Isopropylthio-β-galactoside (IPTG) Invitrogen 15529019 lacZ induction
Magnesium sulfate Fisher Chemical M65-500 To make M9 medium
2-Nitrophenyl β-D-fucopyranoside (ONPF) Santa Cruz Biotechnology sc-216258 lacZ repression
Picodent twinsil 22 Picodent 1300 1000 Sealant
Poly-L-lysine Sigma-Aldrich P8920 To treat the coverslip surface
Potassium chloride Fisher BioReagents BP366-500 To make PBS
Potassium phosphate monobasic Fisher BioReagents BP362-500 To make PBS and M9 medium
Rifampicin Sigma-Aldrich R3501 To stop transcription initiation
Saline-sodium citrate buffer (SSC) Invitrogen AM9763 Probe hybridization, pre-hybridization, and wash
sodium bicarbonate Fisher BioReagents BP328-500 Fluorophore-probe conjugation
Sodium chloride Fisher BioReagents BP358-1 For DNA purification, PBS and M9 medium
Sodium phosphate dibasic Fisher BioReagents BP332-500 To make PBS and M9 medium
Sodium phosphate monobasic Fisher BioReagents BP329-500 To make a sodium phosphate buffer
Super PAP Pen Invitrogen 8899 Hydrophobic marker for coverslips
TetraSpek microspheres Invitrogen T7280 Controls for multi-channel registration
Thiamine Sigma-Aldrich T1270 To make M9 medium
Triethylammonium acetate Sigma-Aldrich 90358 UPLC buffer A
Vanadyl ribonucleoside complex (VRC) Sigma-Aldrich 94742 Probe hybridization and pre-hybridization
Equipment
C18 column Waters Acquity BEH C18 column
Countertop centrifuge Eppendorf 5425
Countertop incubator Eppendorf Thermomixer F1.5
Incubator (Oven) Thermo Scientific 51030514 Gravity convection
Water purification system Millipore Milli-Q Reference
Nanodrop Thermo Scientific 2000C
Nitrogen gas Building For blow-drying coverslips and glass slides
UPLC Waters Acquity UPLC system
Vacuum and aspirator Building Aspirator is made of a filtration flask with a side arm.
Vacuum concentrator Labconco 7810010 Centrivap; to dry samples collected from UPLC.
Vortexer Scientific Industries Genie-2 SI-0236
Water bath shaker New Brunswick Innova 3100 Critical for time-course experiments
Water bath sonicator VWR 97043-960 To clean coverslips and glass slides
Tools
1.5-mL tubes Eppendorf 22431021 DNA lobind tubes
1000-uL pipette tip box Denville Scientific P1126 An empty box after using all the tips
Coplin jar SPI 01240-AB To clean coverslips and glass slides
Coverslip Fisher Scientific 22-050-230 24x60 No1
Filtered pipette tips Denville Scientific P1121,P1122,P1126 SHARP® Precision Barrier Tips
Forceps SPI K35a To handle clean coverslips and glass slides
Glass slide Fisher Scientific 12-544-1
Gloves Microflex MK-296-M
Multichannel pipetter Eppendorf 2231300045 To use in the washing step (#7)
Pipette Gilson P1000, P200, P20
Reagent reservoir MTC Bio P8025-1S To use in the washing step (#7)
Syringe filter (0.22 um) Millipore SLGS033SS
Timer VWR 62344-641
Software and algorithms
MATLAB Mathworks R2013 and up https://www.mathworks.com
MicrobeTracker or Oufti https://www.github.com/JacobsWagnerLab/MicrobeTracker
https://oufti.org/
Stellaris Probe Designer Biosearch Technologies https://www.biosearchtech.com/support/tools/design-software/stellaris-probe-designer
Microscope
CCD camera Hamamatsu Photonics Orca-II-ER
Cy3 filter set Chroma 49004
Cy5 filter set Chroma 49006
Epi-fluorescence microscope Nikon Eclipse Ti For phase-contrast and epi fluorescence
Fluorescence excitation source Lumencor SOLA-E
Nikon Elements software Nikon software that controls the microscope setup
Phase-contrast 100x objective Nikon Plan Apochromat (NA 1.45)
Probe sequence
DNA oligos with C6 amino modification at the 5' end Biosearch Technologies Inc
lacZ1 GTGAATCCGTAATCATGGTC 5' mRNA
lacZ2 TCACGACGTTGTAAAACGAC 5' mRNA
lacZ3 ATTAAGTTGGGTAACGCCAG 5' mRNA
lacZ4 TATTACGCCAGCTGGCGAAA 5' mRNA
lacZ5 ATTCAGGCTGCGCAACTGTT 5' mRNA
lacZ6 AAACCAGGCAAAGCGCCATT 5' mRNA
lacZ7 AGTATCGGCCTCAGGAAGAT 5' mRNA
lacZ8 AACCGTGCATCTGCCAGTTT 5' mRNA
lacZ9 TAGGTCACGTTGGTGTAGAT 5' mRNA
lacZ10 AATGTGAGCGAGTAACAACC 5' mRNA
lacZ11 GTAGCCAGCTTTCATCAACA 5' mRNA
lacZ12 AATAATTCGCGTCTGGCCTT 5' mRNA
lacZ13 AGATGAAACGCCGAGTTAAC 5' mRNA
lacZ14 AATTCAGACGGCAAACGACT 5' mRNA
lacZ15 TTTCTCCGGCGCGTAAAAAT 5' mRNA
lacZ16 ATCTTCCAGATAACTGCCGT 5' mRNA
lacZ17 AACGAGACGTCACGGAAAAT 5' mRNA
lacZ18 GCTGATTTGTGTAGTCGGTT 5' mRNA
lacZ19 TTAAAGCGAGTGGCAACATG 5' mRNA
lacZ20 AACTGTTACCCGTAGGTAGT 5' mRNA
lacZ21 ATAATTTCACCGCCGAAAGG 5' mRNA
lacZ22 TTTCGACGTTCAGACGTAGT 5' mRNA
lacZ23 ATAGAGATTCGGGATTTCGG 5' mRNA
lacZ24 TTCTGCTTCAATCAGCGTGC 5' mRNA
lacZ25 ACCATTTTCAATCCGCACCT
lacZ26 TTAACGCCTCGAATCAGCAA
lacZ27 ATGCAGAGGATGATGCTCGT
lacZ28 TCTGCTCATCCATGACCTGA
lacZ29 TTCATCAGCAGGATATCCTG
lacZ30 CACGGCGTTAAAGTTGTTCT
lacZ31 TGGTTCGGATAATGCGAACA
lacZ32 TTCATCCACCACATACAGGC
lacZ33 TGCCGTGGGTTTCAATATTG
lacZ34 ATCGGTCAGACGATTCATTG
lacZ35 TGATCACACTCGGGTGATTA
lacZ36 ATACAGCGCGTCGTGATTAG
lacZ37 GATCGACAGATTTGATCCAG
lacZ38 AAATAATATCGGTGGCCGTG
lacZ39 TTTGATGGACCATTTCGGCA
lacZ40 TATTCGCAAAGGATCAGCGG
lacZ41 AAGACTGTTACCCATCGCGT
lacZ42 TGCCAGTATTTAGCGAAACC
lacZ43 AAACGGGGATACTGACGAAA
lacZ44 TAATCAGCGACTGATCCACC
lacZ45 GGGTTGCCGTTTTCATCATA
lacZ46 TCGGCGTATCGCCAAAATCA
lacZ47 TTCATACAGAACTGGCGATC
lacZ48 TGGTGTTTTGCTTCCGTCAG
lacZ49 ACGGAACTGGAAAAACTGCT 3' mRNA
lacZ50 TATTCGCTGGTCACTTCGAT 3' mRNA
lacZ51 GTTATCGCTATGACGGAACA 3' mRNA
lacZ52 TTTACCTTGTGGAGCGACAT 3' mRNA
lacZ53 GTTCAGGCAGTTCAATCAAC 3' mRNA
lacZ54 TTGCACTACGCGTACTGTGA 3' mRNA
lacZ55 AGCGTCACACTGAGGTTTTC 3' mRNA
lacZ56 ATTTCGCTGGTGGTCAGATG 3' mRNA
lacZ57 ACCCAGCTCGATGCAAAAAT 3' mRNA
lacZ58 CGGTTAAATTGCCAACGCTT 3' mRNA
lacZ59 CTGTGAAAGAAAGCCTGACT 3' mRNA
lacZ60 GGCGTCAGCAGTTGTTTTTT 3' mRNA
lacZ61 TACGCCAATGTCGTTATCCA 3' mRNA
lacZ62 TAAGGTTTTCCCCTGATGCT 3' mRNA
lacZ63 ATCAATCCGGTAGGTTTTCC 3' mRNA
lacZ64 GTAATCGCCATTTGACCACT 3' mRNA
lacZ65 AGTTTTCTTGCGGCCCTAAT 3' mRNA
lacZ66 ATGTCTGACAATGGCAGATC 3' mRNA
lacZ67 ATAATTCAATTCGCGCGTCC 3' mRNA
lacZ68 TGATGTTGAACTGGAAGTCG 3' mRNA
lacZ69 TCAGTTGCTGTTGACTGTAG 3' mRNA
lacZ70 ATTCAGCCATGTGCCTTCTT 3' mRNA
lacZ71 AATCCCCATATGGAAACCGT 3' mRNA
lacZ72 AGACCAACTGGTAATGGTAG 3' mRNA

DOWNLOAD MATERIALS LIST

References

  1. Bervoets, I., Charlier, D. Diversity, versatility and complexity of bacterial gene regulation mechanisms: opportunities and drawbacks for applications in synthetic biology. FEMS Microbiology Reviews. 43, (3), 304-339 (2019).
  2. Epshtein, V., Nudler, E. Cooperation between RNA polymerase molecules in transcription elongation. Science. 300, (5620), 801-805 (2003).
  3. Vogel, U., Jensen, K. F. The RNA chain elongation rate in Escherichia coli depends on the growth rate. Journal of Bacteriology. 176, (10), 2807-2813 (1994).
  4. Tennyson, C. N., Klamut, H. J., Worton, R. G. The human dystrophin gene requires 16 hours to be transcribed and is cotranscriptionally spliced. Nature Genetics. 9, 184 (1995).
  5. Singh, J., Padgett, R. A. Rates of in situ transcription and splicing in large human genes. Nature Structural & Molecular Biology. 16, 1128 (2009).
  6. Selinger, D. W., Saxena, R. M., Cheung, K. J., Church, G. M., Rosenow, C. Global RNA Half-Life Analysis in Escherichia coli Reveals Positional Patterns of Transcript Degradation. Genome Research. 13, (2), 216-223 (2003).
  7. Bernstein, J. A., Khodursky, A. B., Lin, P. -H., Lin-Chao, S., Cohen, S. N. Global analysis of mRNA decay and abundance in Escherichia coli at single-gene resolution using two-color fluorescent DNA microarrays. Proceedings of the National Academy of Sciences. 99, (15), 9697-9702 (2002).
  8. Pérez-Ortín, J. E., Medina, D. A., Chávez, S., Moreno, J. What do you mean by transcription rate. BioEssays. 35, (12), 1056-1062 (2013).
  9. Tang, F., et al. mRNA-Seq whole-transcriptome analysis of a single cell. Nature Methods. 6, (5), 377-382 (2009).
  10. Kuchina, A., et al. Microbial single-cell RNA sequencing by split-pool barcoding. BioRxiv. 869248 (2019).
  11. Blattman, S. B., Jiang, W., Oikonomou, P., Tavazoie, S. Prokaryotic single-cell RNA sequencing by in situ combinatorial indexing. Nature Microbiology. (2020).
  12. Femino, A., Fay, F., Fogarty, K., Singer, R. Visualization of single RNA transcripts in situ. Science. 280, (5363), 585-590 (1998).
  13. Raj, A., vanden Bogaard, P., Rifkin, S. A., van Oudenaarden, A., Tyagi, S. Imaging individual mRNA molecules using multiple singly labeled probes. Nature Methods. 5, (10), 877-879 (2008).
  14. Montero Llopis, P., et al. Spatial organization of the flow of genetic information in bacteria. Nature. 466, (7302), 77-81 (2010).
  15. So, L. -h, et al. General properties of transcriptional time series in Escherichia coli. Nature Genetics. 43, (6), 554-560 (2011).
  16. Taniguchi, Y., et al. Quantifying E. coli proteome and transcriptome with single-molecule sensitivity in single cells. Science. 329, (5991), 533-538 (2010).
  17. Jones, D. L., Brewster, R. C., Phillips, R. Promoter architecture dictates cell-to-cell variability in gene expression. Science. 346, (6216), 1533-1536 (2014).
  18. Iyer, S., Park, B. R., Kim, M. Absolute quantitative measurement of transcriptional kinetic parameters in vivo. Nucleic Acids Research. 44, (18), 142 (2016).
  19. Kim, S., Beltran, B., Irnov, I., Jacobs-Wagner, C. Long-Distance Cooperative and Antagonistic RNA Polymerase Dynamics via DNA Supercoiling. Cell. 179, (1), 106-119 (2019).
  20. Wang, M., Zhang, J., Xu, H., Golding, I. Measuring transcription at a single gene copy reveals hidden drivers of bacterial individuality. Nature Microbiology. 4, (12), 2118-2127 (2019).
  21. Joo, C., Ha, T. Labeling DNA (or RNA) for single-molecule FRET. 2012, (9), Cold Spring Harbor. 1005-1008 (2012).
  22. Sambrook, J., Russell, D. W. Standard Ethanol Precipitation of DNA in Microcentrifuge Tubes. 2006, (1), Cold Spring Harbor Protocols. 4456 (2006).
  23. Skinner, S. O., Sepúlveda, L. A., Xu, H., Golding, I. Measuring mRNA copy number in individual Escherichia coli cells using single-molecule fluorescent in situ hybridization. Nature Protocols. 8, (6), 1100-1113 (2013).
  24. Adesnik, M., Levinthal, C. The synthesis and degradation of lactose operon messenger RNA in E. coli. Cold Spring Harbor Symposia on Quantitative Biology. 35, 451-459 (1970).
  25. Campbell, E. A., et al. Structural mechanism for rifampicin inhibition of bacterial RNA polymerase. Cell. 104, (6), 901-912 (2001).
  26. Raj, A., Tyagi, S. Methods in Enzymology. Walter, N. G. 472, Academic Press. 365-386 (2010).
  27. Sliusarenko, O., Heinritz, J., Emonet, T., Jacobs-Wagner, C. High-throughput, subpixel precision analysis of bacterial morphogenesis and intracellular spatio-temporal dynamics. Molecular Microbiology. 80, (3), 612-627 (2011).
  28. Paintdakhi, A., et al. Oufti: an integrated software package for high-accuracy, high-throughput quantitative microscopy analysis. Molecular Microbiology. 99, (4), 767-777 (2016).
  29. Moffitt, J. R., Zhuang, X. Methods in Enzymology. Filonov, G. S., Jaffrey, S. R. 572, Academic Press. 1-49 (2016).
  30. Yu, J., Xiao, J., Ren, X., Lao, K., Xie, X. S. Probing gene expression in live cells, one protein molecule at a time. Science. 311, (5767), 1600-1603 (2006).
  31. Chen, H., Shiroguchi, K., Ge, H., Xie, X. S. Genome-wide study of mRNA degradation and transcript elongation in Escherichia coli. Molecular Systems Biology. 11, (1), 781 (2015).
  32. Vogel, U., Sørensen, M., Pedersen, S., Jensen, K. F., Kilstrup, M. Decreasing transcription elongation rate in Escherichia Coli exposed to amino acid starvation. Molecular Microbiology. 6, (15), 2191-2200 (1992).
  33. Yang, S., et al. Transcription and translation contribute to gene locus relocation to the nucleoid periphery in E. coli. Nature Communications. 10, (1), 5131 (2019).
  34. Zenklusen, D., Larson, D. R., Singer, R. H. Single-RNA counting reveals alternative modes of gene expression in yeast. Nature Structural & Molecular Biology. 15, (12), 1263-1271 (2008).
  35. Fontenete, S., Guimarães, N., Wengel, J., Azevedo, N. F. Prediction of melting temperatures in fluorescence in situ hybridization (FISH) procedures using thermodynamic models. Critical Reviews in Biotechnology. 36, (3), 566-577 (2016).
  36. Sepúlveda, L. A., Xu, H., Zhang, J., Wang, M., Golding, I. Measurement of gene regulation in individual cells reveals rapid switching between promoter states. Science. 351, (6278), 1218-1222 (2016).
  37. Huang, B., Wang, W., Bates, M., Zhuang, X. Three-Dimensional Super-Resolution Imaging by Stochastic Optical Reconstruction Microscopy. Science. 319, (5864), 810-813 (2008).
  38. Moffitt, J. R., Pandey, S., Boettiger, A. N., Wang, S., Zhuang, X. Spatial organization shapes the turnover of a bacterial transcriptome. eLife. 5, 13065 (2016).
  39. Fei, J., et al. Determination of in vivo target search kinetics of regulatory noncoding RNA. Science. 347, (6228), 1371-1374 (2015).
Indringende mRNA Kinetics in ruimte en tijd in <em>Escherichia coli</em> met behulp van Two-Color Single-Molecule Fluorescentie in Situ Hybridisatie
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kim, S., Vaidya, K. Probing mRNA Kinetics in Space and Time in Escherichia coli using Two-Color Single-Molecule Fluorescence In Situ Hybridization. J. Vis. Exp. (161), e61520, doi:10.3791/61520 (2020).More

Kim, S., Vaidya, K. Probing mRNA Kinetics in Space and Time in Escherichia coli using Two-Color Single-Molecule Fluorescence In Situ Hybridization. J. Vis. Exp. (161), e61520, doi:10.3791/61520 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter